WorldWideScience

Sample records for reversible chemical reactions

  1. Chemical reactions in reverse micelle systems

    Science.gov (United States)

    Matson, Dean W.; Fulton, John L.; Smith, Richard D.; Consani, Keith A.

    1993-08-24

    This invention is directed to conducting chemical reactions in reverse micelle or microemulsion systems comprising a substantially discontinuous phase including a polar fluid, typically an aqueous fluid, and a microemulsion promoter, typically a surfactant, for facilitating the formation of reverse micelles in the system. The system further includes a substantially continuous phase including a non-polar or low-polarity fluid material which is a gas under standard temperature and pressure and has a critical density, and which is generally a water-insoluble fluid in a near critical or supercritical state. Thus, the microemulsion system is maintained at a pressure and temperature such that the density of the non-polar or low-polarity fluid exceeds the critical density thereof. The method of carrying out chemical reactions generally comprises forming a first reverse micelle system including an aqueous fluid including reverse micelles in a water-insoluble fluid in the supercritical state. Then, a first reactant is introduced into the first reverse micelle system, and a chemical reaction is carried out with the first reactant to form a reaction product. In general, the first reactant can be incorporated into, and the product formed in, the reverse micelles. A second reactant can also be incorporated in the first reverse micelle system which is capable of reacting with the first reactant to form a product.

  2. Mass transfer with complex reversible chemical reactions. II: Parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, Geert; van Beckum, F.P.H.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  3. Mass transfer with complex reversible chemical reactions. II: parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, van F.P.H.; van Swaaij, W.P.M.

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  4. Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  5. Mass transfer with complex reversible chemical reactions—I. Single reversible chemical reaction

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1989-01-01

    An improved numerical technique was used in order to develop an absorption model with which it is possible to calculate rapidly absorption rates for the phenomenon of mass transfer accompanied by a complex reversible chemical reaction. This model can be applied for the calculation of the mass

  6. Chemical boundary layers in CVD II. Reversible reactions

    NARCIS (Netherlands)

    Croon, de M.H.J.M.; Giling, L.J.

    1990-01-01

    In addition to irreversible reactions, which were treated in part I, reversible reactions in the gas phase have beenstudied using the concept of the chemical boundary layer. The analysis is given for the situations in which either the forwardor the back reaction is dominant. Two conceptual models

  7. Simulation of square wave voltammetry of three electrode reactions coupled by two reversible chemical reactions

    OpenAIRE

    Lovrić, Milivoj

    2017-01-01

    Three fast and reversible electrode reactions that are connected by two reversible chemical reactions that are permanently in the equilibrium are analysed theoretically for square wave voltammetry. The dependence of peak potentials on the dimensionless equilibrium constants of chemical reactions is calculated. The influence of the basic thermodynamic parameters on the square wave voltammetric responses is analysed.

  8. Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions

    OpenAIRE

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and concentration profiles for a wide range of processes and conditions, for both film and penetration model. With the aid of this mass transfer model it is demonstrated that the absorption rates in syst...

  9. Do high school chemistry examinations inhibit deeper level understanding of dynamic reversible chemical reactions?

    Science.gov (United States)

    Wheeldon, R.; Atkinson, R.; Dawes, A.; Levinson, R.

    2012-07-01

    Background and purpose : Chemistry examinations can favour the deployment of algorithmic procedures like Le Chatelier's Principle (LCP) rather than reasoning using chemical principles. This study investigated the explanatory resources which high school students use to answer equilibrium problems and whether the marks given for examination answers require students to use approaches beyond direct application of LCP. Sample : The questionnaire was administered to 162 students studying their first year of advanced chemistry (age 16/17) in three high achieving London high schools. Design and methods : The students' explanations of reversible chemical systems were inductively coded to identify the explanatory approaches used and interviews with 13 students were used to check for consistency. AS level examination questions on reversible reactions were analysed to identify the types of explanations sought and the students' performance in these examinations was compared to questionnaire answers. Results : 19% of students used a holistic explanatory approach: when the rates of forward and reverse reactions are correctly described, recognising their simultaneous and mutually dependent nature. 36% used a mirrored reactions approach when the connected nature of the forward and reverse reactions is identified, but not their mutual dependency. 42% failed to recognize the interdependence of forward and reverse reactions (reactions not connected approach). Only 4% of marks for AS examination questions on reversible chemical systems asked for responses which went beyond either direct application of LCP or recall of equilibrium knowledge. 37% of students attained an A grade in their AS national examinations. Conclusions : Examinations favour the application of LCP making it possible to obtain the highest grade with little understanding of reversible chemical systems beyond a direct application of this algorithm. Therefore students' understanding may be attenuated so that they are

  10. Nanoscale control of reversible chemical reaction between fullerene C60 molecules using scanning tunneling microscope.

    Science.gov (United States)

    Nakaya, Masato; Kuwahara, Yuji; Aono, Masakazu; Nakayama, Tomonobu

    2011-04-01

    The nanoscale control of reversible chemical reactions, the polymerization and depolymerization between C60 molecules, has been investigated. Using a scanning tunneling microscope (STM), the polymerization and depolymerization can be controlled at designated positions in ultrathin films of C60 molecules. One of the two chemical reactions can be selectively induced by controlling the sample bias voltage (V(s)); the application of negative and positive values of V(s) results in polymerization and depolymerization, respectively. The selectivity between the two chemical reactions becomes extremely high when the thickness of the C60 film increases to more than three molecular layers. We conclude that STM-induced negative and positive electrostatic ionization are responsible for the control of the polymerization and depolymerization, respectively.

  11. On the graph and systems analysis of reversible chemical reaction networks with mass action kinetics

    NARCIS (Netherlands)

    Rao, Shodhan; Jayawardhana, Bayu; Schaft, Arjan van der

    2012-01-01

    Motivated by the recent progresses on the interplay between the graph theory and systems theory, we revisit the analysis of reversible chemical reaction networks described by mass action kinetics by reformulating it using the graph knowledge of the underlying networks. Based on this formulation, we

  12. Chemical kinetics and reaction mechanism

    International Nuclear Information System (INIS)

    Jung, Ou Sik; Park, Youn Yeol

    1996-12-01

    This book is about chemical kinetics and reaction mechanism. It consists of eleven chapters, which deal with reaction and reaction speed on reaction mechanism, simple reaction by rate expression, reversible reaction and simultaneous reaction, successive reaction, complicated reaction mechanism, assumption for reaction mechanism, transition state theory, successive reaction and oscillating reaction, reaction by solution, research method high except kinetics on reaction mechanism, high reaction of kinetics like pulsed radiolysis.

  13. Versatile Dual Photoresponsive System for Precise Control of Chemical Reactions.

    Science.gov (United States)

    Xu, Can; Bing, Wei; Wang, Faming; Ren, Jinsong; Qu, Xiaogang

    2017-08-22

    A versatile method for photoregulation of chemical reactions was developed through a combination of near-infrared (NIR) and ultraviolet (UV) light sensitive materials. This regulatory effect was achieved through photoresponsive modulation of reaction temperature and pH values, two prominent factors influencing reaction kinetics. Photothermal nanomaterial graphene oxide (GO) and photobase reagent malachite green carbinol base (MGCB) were selected for temperature and pH regulation, respectively. Using nanocatalyst- and enzyme-mediated chemical reactions as model systems, we demonstrated the feasibility and high efficiency of this method. In addition, a photoresponsive, multifunctional "Band-aid"-like hydrogel platform was presented for programmable wound healing. Overall, this simple, efficient, and reversible system was found to be effective for controlling a wide variety of chemical reactions. Our work may provide a method for remote and sustainable control over chemical reactions for industrial and biomedical applications.

  14. Insights into the mechanisms on chemical reactions: reaction paths for chemical reactions

    International Nuclear Information System (INIS)

    Dunning, T.H. Jr.; Rosen, E.; Eades, R.A.

    1987-01-01

    We report reaction paths for two prototypical chemical reactions: Li + HF, an electron transfer reaction, and OH + H 2 , an abstraction reaction. In the first reaction we consider the connection between the energetic terms in the reaction path Hamiltonian and the electronic changes which occur upon reaction. In the second reaction we consider the treatment of vibrational effects in chemical reactions in the reaction path formalism. 30 refs., 9 figs

  15. Symmetry Relations in Chemical Kinetics Arising from Microscopic Reversibility

    Science.gov (United States)

    Adib, Artur B.

    2006-01-01

    It is shown that the kinetics of time-reversible chemical reactions having the same equilibrium constant but different initial conditions are closely related to one another by a directly measurable symmetry relation analogous to chemical detailed balance. In contrast to detailed balance, however, this relation does not require knowledge of the elementary steps that underlie the reaction, and remains valid in regimes where the concept of rate constants is ill defined, such as at very short times and in the presence of low activation barriers. Numerical simulations of a model of isomerization in solution are provided to illustrate the symmetry under such conditions, and potential applications in protein folding or unfolding are pointed out.

  16. Nonequilibrium thermodynamics and a fluctuation theorem for individual reaction steps in a chemical reaction network

    International Nuclear Information System (INIS)

    Pal, Krishnendu; Das, Biswajit; Banerjee, Kinshuk; Gangopadhyay, Gautam

    2015-01-01

    We have introduced an approach to nonequilibrium thermodynamics of an open chemical reaction network in terms of the propensities of the individual elementary reactions and the corresponding reverse reactions. The method is a microscopic formulation of the dissipation function in terms of the relative entropy or Kullback-Leibler distance which is based on the analogy of phase space trajectory with the path of elementary reactions in a network of chemical process. We have introduced here a fluctuation theorem valid for each opposite pair of elementary reactions which is useful in determining the contribution of each sub-reaction on the nonequilibrium thermodynamics of overall reaction. The methodology is applied to an oligomeric enzyme kinetics at a chemiostatic condition that leads the reaction to a nonequilibrium steady state for which we have estimated how each step of the reaction is energy driven or entropy driven to contribute to the overall reaction. (paper)

  17. Performance and cost of energy transport and storage systems for dish applications using reversible chemical reactions

    Science.gov (United States)

    Schredder, J. M.; Fujita, T.

    1984-01-01

    The use of reversible chemical reactions for energy transport and storage for parabolic dish networks is considered. Performance and cost characteristics are estimated for systems using three reactions (sulfur-trioxide decomposition, steam reforming of methane, and carbon-dioxide reforming of methane). Systems are considered with and without storage, and in several energy-delivery configurations that give different profiles of energy delivered versus temperature. Cost estimates are derived assuming the use of metal components and of advanced ceramics. (The latter reduces the costs by three- to five-fold). The process that led to the selection of the three reactions is described, and the effects of varying temperatures, pressures, and heat exchanger sizes are addressed. A state-of-the-art survey was performed as part of this study. As a result of this survey, it appears that formidable technical risks exist for any attempt to implement the systems analyzed in this study, especially in the area of reactor design and performance. The behavior of all components and complete systems under thermal energy transients is very poorly understood. This study indicates that thermochemical storage systems that store reactants as liquids have efficiencies below 60%, which is in agreement with the findings of earlier investigators.

  18. Enzymatic reactions in reversed micelles

    NARCIS (Netherlands)

    Hilhorst, M.H.

    1984-01-01

    It has been recognised that enzymes in reversed micelles have potential for application in chemical synthesis. Before these expectations will be realised many problems must be overcome. This thesis deals with some of them.
    In Chapter 1 the present knowledge about reversed micelles and

  19. SIMULTANEOUS ABSORPTION AND DESORPTION WITH REVERSIBLE 1ST-ORDER CHEMICAL-REACTION - ANALYTICAL SOLUTION AND NEGATIVE ENHANCEMENT FACTORS

    NARCIS (Netherlands)

    WINKELMAN, JGM; BEENACKERS, AACM

    The problem of ps absorption accompanied by a first-order reversible reaction, producing a volatile reaction product, is considered. A general analytical solution is developed for the film model, resulting in explicit relations for the concentration profiles in the film and for the mass transfer

  20. Reversible logic gates based on enzyme-biocatalyzed reactions and realized in flow cells: a modular approach.

    Science.gov (United States)

    Fratto, Brian E; Katz, Evgeny

    2015-05-18

    Reversible logic gates, such as the double Feynman gate, Toffoli gate and Peres gate, with 3-input/3-output channels are realized using reactions biocatalyzed with enzymes and performed in flow systems. The flow devices are constructed using a modular approach, where each flow cell is modified with one enzyme that biocatalyzes one chemical reaction. The multi-step processes mimicking the reversible logic gates are organized by combining the biocatalytic cells in different networks. This work emphasizes logical but not physical reversibility of the constructed systems. Their advantages and disadvantages are discussed and potential use in biosensing systems, rather than in computing devices, is suggested. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Mass transfer with complex chemical reactions in gas–liquid systems : two-step reversible reactions with unit stoichiometric and kinetic orders

    NARCIS (Netherlands)

    Vas Bhat, R.D.; Kuipers, J.A.M.; Versteeg, G.F.

    2000-01-01

    An absorption model to study gas–liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although

  2. Direct single-molecule dynamic detection of chemical reactions.

    Science.gov (United States)

    Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng

    2018-02-01

    Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.

  3. Chemical kinetics of gas reactions

    CERN Document Server

    Kondrat'Ev, V N

    2013-01-01

    Chemical Kinetics of Gas Reactions explores the advances in gas kinetics and thermal, photochemical, electrical discharge, and radiation chemical reactions. This book is composed of 10 chapters, and begins with the presentation of general kinetic rules for simple and complex chemical reactions. The next chapters deal with the experimental methods for evaluating chemical reaction mechanisms and some theories of elementary chemical processes. These topics are followed by discussions on certain class of chemical reactions, including unimolecular, bimolecular, and termolecular reactions. The rema

  4. Global Controllability of Chemical Reactions

    OpenAIRE

    Drexler, Dániel András; Tóth, János

    2015-01-01

    Controllability of chemical reactions is an important problem in chemical engineering science. In control theory, analysis of the controllability of linear systems is well-founded, however the dynamics of chemical reactions is usually nonlinear. Global controllability properties of chemical reactions are analyzed here based on the Lie-algebra of the vector fields associated to elementary reactions. A chemical reaction is controllable almost everywhere if all the reaction rate coefficients can...

  5. Mass transfer with complex chemical reactions in gas-liquid systems: two-step reversible reactions with unit stoichiometric and kinetic orders

    NARCIS (Netherlands)

    Vas bhat, R.D.; Kuipers, J.A.M.; Versteeg, Geert

    2000-01-01

    An absorption model to study gas¿liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although

  6. Microfluidic chemical reaction circuits

    Science.gov (United States)

    Lee, Chung-cheng [Irvine, CA; Sui, Guodong [Los Angeles, CA; Elizarov, Arkadij [Valley Village, CA; Kolb, Hartmuth C [Playa del Rey, CA; Huang, Jiang [San Jose, CA; Heath, James R [South Pasadena, CA; Phelps, Michael E [Los Angeles, CA; Quake, Stephen R [Stanford, CA; Tseng, Hsian-rong [Los Angeles, CA; Wyatt, Paul [Tipperary, IE; Daridon, Antoine [Mont-Sur-Rolle, CH

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  7. The influence of the "cage effect" on the mechanism of reversible bimolecular multistage chemical reactions in solutions.

    Science.gov (United States)

    Doktorov, Alexander B

    2015-08-21

    Manifestations of the "cage effect" at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a "cage complex." Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the "cage effect" leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.

  8. Infrared laser-induced chemical reactions

    International Nuclear Information System (INIS)

    Katayama, Mikio

    1978-01-01

    The experimental means which clearly distinguishes between infrared ray-induced reactions and thermal reactions has been furnished for the first time when an intense monochromatic light source has been obtained by the development of infrared laser. Consequently, infrared laser-induced chemical reactions have started to develop as one field of chemical reaction researches. Researches of laser-induced chemical reactions have become new means for the researches of chemical reactions since they were highlighted as a new promising technique for isotope separation. Specifically, since the success has been reported in 235 U separation using laser in 1974, comparison of this method with conventional separation techniques from the economic point of view has been conducted, and it was estimated by some people that the laser isotope separation is cheaper. This report briefly describes on the excitation of oscillation and reaction rate, and introduces the chemical reactions induced by CW laser and TEA CO 2 laser. Dependence of reaction yield on laser power, measurement of the absorbed quantity of infrared ray and excitation mechanism are explained. Next, isomerizing reactions are reported, and finally, isotope separation is explained. It was found that infrared laser-induced chemical reactions have the selectivity for isotopes. Since it is evident that there are many examples different from thermal and photo-chemical reactions, future collection of the data is expected. (Wakatsuki, Y.)

  9. Introduction to chemical reaction engineering

    International Nuclear Information System (INIS)

    Kim, Yeong Geol

    1990-10-01

    This deals with chemical reaction engineering with thirteen chapters. The contents of this book are introduction on reaction engineering, chemical kinetics, thermodynamics and chemical reaction, abnormal reactor, non-isothermal reactor, nonideal reactor, catalysis in nonuniform system, diffusion and reaction in porosity catalyst, design catalyst heterogeneous reactor in solid bed, a high molecule polymerization, bio reaction engineering, reaction engineering in material process, control multi-variable reactor process using digital computer.

  10. Reversible aqueous zinc/manganese oxide energy storage from conversion reactions

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Huilin; Shao, Yuyan; Yan, Pengfei; Cheng, Yingwen; Han, Kee Sung; Nie, Zimin; Wang, Chongmin; Yang, Jihui; Li, Xiaolin; Bhattacharya, Priyanka; Mueller, Karl T.; Liu, Jun

    2016-04-18

    Rechargeable aqueous batteries are attracting growing interest for energy storage due to their low cost and high safety. Fundamental understanding of highly reversible aqueous reactions is critical for building high-performance batteries. Herein, we studied the reversibility of Zn/MnO2 battery chemistry in mild aqueous MnSO4 electrolytes. α-MnO2 nanofibers were used as a high performance cathode. Our study provides good evidence for a conversion reaction mechanism through reversible formation of short nanorods and nanoparticle aggregates. This reversible conversion reaction provides an operating voltage of 1.44 V, high capacity of 285 mAh g-1, excellent rate and capacity retention of 92% after 5000 cycles. Zn metal anode also shows high reversibility in the mild aqueous MnSO4 electrolytes. The highly reversible and stable chemistries in aqueous Zn/MnO2 batteries open new opportunity for energy storage technologies with potentially high energy density, high safety, and low cost.

  11. Chemical reaction networks as a model to describe UVC- and radiolytically-induced reactions of simple compounds.

    Science.gov (United States)

    Dondi, Daniele; Merli, Daniele; Albini, Angelo; Zeffiro, Alberto; Serpone, Nick

    2012-05-01

    When a chemical system is submitted to high energy sources (UV, ionizing radiation, plasma sparks, etc.), as is expected to be the case of prebiotic chemistry studies, a plethora of reactive intermediates could form. If oxygen is present in excess, carbon dioxide and water are the major products. More interesting is the case of reducing conditions where synthetic pathways are also possible. This article examines the theoretical modeling of such systems with random-generated chemical networks. Four types of random-generated chemical networks were considered that originated from a combination of two connection topologies (viz., Poisson and scale-free) with reversible and irreversible chemical reactions. The results were analyzed taking into account the number of the most abundant products required for reaching 50% of the total number of moles of compounds at equilibrium, as this may be related to an actual problem of complex mixture analysis. The model accounts for multi-component reaction systems with no a priori knowledge of reacting species and the intermediates involved if system components are sufficiently interconnected. The approach taken is relevant to an earlier study on reactions that may have occurred in prebiotic systems where only a few compounds were detected. A validation of the model was attained on the basis of results of UVC and radiolytic reactions of prebiotic mixtures of low molecular weight compounds likely present on the primeval Earth.

  12. Properties of the reverse transcription reaction in mRNA quantification

    DEFF Research Database (Denmark)

    Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie

    2004-01-01

    BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...

  13. The influence of the “cage effect” on the mechanism of reversible bimolecular multistage chemical reactions in solutions

    International Nuclear Information System (INIS)

    Doktorov, Alexander B.

    2015-01-01

    Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants

  14. The influence of the “cage effect” on the mechanism of reversible bimolecular multistage chemical reactions in solutions

    Energy Technology Data Exchange (ETDEWEB)

    Doktorov, Alexander B., E-mail: doktorov@kinetics.nsc.ru [Voevodsky Institute of Chemical Kinetics & Combustion, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)

    2015-08-21

    Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.

  15. Reaction Decoder Tool (RDT): extracting features from chemical reactions.

    Science.gov (United States)

    Rahman, Syed Asad; Torrance, Gilliean; Baldacci, Lorenzo; Martínez Cuesta, Sergio; Fenninger, Franz; Gopal, Nimish; Choudhary, Saket; May, John W; Holliday, Gemma L; Steinbeck, Christoph; Thornton, Janet M

    2016-07-01

    Extracting chemical features like Atom-Atom Mapping (AAM), Bond Changes (BCs) and Reaction Centres from biochemical reactions helps us understand the chemical composition of enzymatic reactions. Reaction Decoder is a robust command line tool, which performs this task with high accuracy. It supports standard chemical input/output exchange formats i.e. RXN/SMILES, computes AAM, highlights BCs and creates images of the mapped reaction. This aids in the analysis of metabolic pathways and the ability to perform comparative studies of chemical reactions based on these features. This software is implemented in Java, supported on Windows, Linux and Mac OSX, and freely available at https://github.com/asad/ReactionDecoder : asad@ebi.ac.uk or s9asad@gmail.com. © The Author 2016. Published by Oxford University Press.

  16. Chemical-looping combustion in a reverse-flow fixed bed reactor

    International Nuclear Information System (INIS)

    Han, Lu; Bollas, George M.

    2016-01-01

    A reverse-flow fixed bed reactor concept for CLC (chemical-looping combustion) is explored. The limitations of conventional fixed bed reactors, as applied to CLC, are overcome by reversing the gas flow direction periodically to enhance the mixing characteristics of the bed, thus improving oxygen carrier utilization and energy efficiency with respect to power generation. The reverse-flow reactor is simulated by a dusty-gas model and compared with an equivalent fixed bed reactor without flow reversal. Dynamic optimization is used to calculate conditions at which each reactor operates at maximum energy efficiency. Several cases studies illustrate the benefits of reverse-flow operation for the CLC with CuO and NiO oxygen carriers and methane and syngas fuels. The results show that periodic reversal of the flow during reduction improves the contact between the fuel and unconverted oxygen carrier, enabling the system to suppress unwanted catalytic reactions and axial temperature and conversion gradients. The operational scheme presented reduces the fluctuations of temperature during oxidation and increases the high-temperature heat produced by the process. CLC in a reverse-flow reactor has the potential to achieve higher energy efficiency than conventional fixed bed CLC reactors, when integrated with a downstream gas turbine of a combined cycle power plant. - Highlights: • Reverse-flow fixed bed CLC reactors for combined cycle power systems. • Dynamic optimization tunes operation of batch and transient CLC systems. • The reverse-flow CLC system provides stable turbine-ready gas stream. • Reverse-flow CLC fixed bed reactor has superior CO 2 capture and thermal efficiency.

  17. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  18. Chemical burn or reaction

    Science.gov (United States)

    Chemicals that touch skin can lead to a reaction on the skin, throughout the body, or both. ... leave the person alone and watch carefully for reactions affecting the entire body. Note: If a chemical gets into the eyes, the eyes should be ...

  19. Reduced Reactivity of Amines against Nucleophilic Substitution via Reversible Reaction with Carbon Dioxide

    Directory of Open Access Journals (Sweden)

    Fiaz S. Mohammed

    2015-12-01

    Full Text Available The reversible reaction of carbon dioxide (CO2 with primary amines to form alkyl-ammonium carbamates is demonstrated in this work to reduce amine reactivity against nucleophilic substitution reactions with benzophenone and phenyl isocyanate. The reversible formation of carbamates has been recently exploited for a number of unique applications including the formation of reversible ionic liquids and surfactants. For these applications, reduced reactivity of the carbamate is imperative, particularly for applications in reactions and separations. In this work, carbamate formation resulted in a 67% reduction in yield for urea synthesis and 55% reduction for imine synthesis. Furthermore, the amine reactivity can be recovered upon reversal of the carbamate reaction, demonstrating reversibility. The strong nucleophilic properties of amines often require protection/de-protection schemes during bi-functional coupling reactions. This typically requires three separate reaction steps to achieve a single transformation, which is the motivation behind Green Chemistry Principle #8: Reduce Derivatives. Based upon the reduced reactivity, there is potential to employ the reversible carbamate reaction as an alternative method for amine protection in the presence of competing reactions. For the context of this work, CO2 is envisioned as a green protecting agent to suppress formation of n-phenyl benzophenoneimine and various n-phenyl–n-alky ureas.

  20. A copper-mediated reverse aromatic Finkelstein reaction in ionic liquid

    Directory of Open Access Journals (Sweden)

    Anh T.H. Nguyen

    2018-03-01

    Full Text Available We have developed a general method for reverse aromatic Finkelstein reactions. Good reaction yields were obtained when aryl iodides or aryl bromides were treated with copper halide salts as promoters in a 1-butyl-3-methylimidazolium bromide ([BMIM]Br ionic liquid (IL solvent at 140 °C for 8 h. Preliminary investigation supported that the copper salts were also the halide sources in halogen exchange reactions. The optimized conditions are applicable to a variety of substrates and have excellent functional group tolerance. Additionally, the [BMIM]Br solvent showed good stability for at least 10 consecutive runs. Results indicated that the [BMIM]Br solvent was recyclable for reverse aromatic Finkelstein reactions.

  1. Chemical transport reactions

    CERN Document Server

    Schäfer, Harald

    2013-01-01

    Chemical Transport Reactions focuses on the processes and reactions involved in the transport of solid or liquid substances to form vapor phase reaction products. The publication first offers information on experimental and theoretical principles and the transport of solid substances and its special applications. Discussions focus on calculation of the transport effect of heterogeneous equilibria for a gas motion between equilibrium spaces; transport effect and the thermodynamic quantities of the transport reaction; separation and purification of substances by means of material transport; and

  2. One- and two-dimensional chemical exchange nuclear magnetic resonance studies of the creatine kinase catalyzed reaction

    International Nuclear Information System (INIS)

    Gober, J.R.

    1988-01-01

    The equilibrium chemical exchange dynamics of the creatine kinase enzyme system were studied by one- and two-dimensional 31 P NMR techniques. Pseudo-first-order reaction rate constants were measured by the saturation transfer method under an array of experimental conditions of pH and temperature. Quantitative one-dimensional spectra were collected under the same conditions in order to calculate the forward and reverse reaction rates, the K eq , the hydrogen ion stoichiometry, and the standard thermodynamic functions. The pure absorption mode in four quadrant two-dimensional chemical exchange experiment was employed so that the complete kinetic matrix showing all of the chemical exchange process could be realized

  3. The efficiency of driving chemical reactions by a physical non-equilibrium is kinetically controlled.

    Science.gov (United States)

    Göppel, Tobias; Palyulin, Vladimir V; Gerland, Ulrich

    2016-07-27

    An out-of-equilibrium physical environment can drive chemical reactions into thermodynamically unfavorable regimes. Under prebiotic conditions such a coupling between physical and chemical non-equilibria may have enabled the spontaneous emergence of primitive evolutionary processes. Here, we study the coupling efficiency within a theoretical model that is inspired by recent laboratory experiments, but focuses on generic effects arising whenever reactant and product molecules have different transport coefficients in a flow-through system. In our model, the physical non-equilibrium is represented by a drift-diffusion process, which is a valid coarse-grained description for the interplay between thermophoresis and convection, as well as for many other molecular transport processes. As a simple chemical reaction, we consider a reversible dimerization process, which is coupled to the transport process by different drift velocities for monomers and dimers. Within this minimal model, the coupling efficiency between the non-equilibrium transport process and the chemical reaction can be analyzed in all parameter regimes. The analysis shows that the efficiency depends strongly on the Damköhler number, a parameter that measures the relative timescales associated with the transport and reaction kinetics. Our model and results will be useful for a better understanding of the conditions for which non-equilibrium environments can provide a significant driving force for chemical reactions in a prebiotic setting.

  4. On the Green's function of the partially diffusion-controlled reversible ABCD reaction for radiation chemistry codes

    Energy Technology Data Exchange (ETDEWEB)

    Plante, Ianik, E-mail: ianik.plante-1@nasa.gov [Wyle Science, Technology & Engineering, 1290 Hercules, Houston, TX 77058 (United States); Devroye, Luc, E-mail: lucdevroye@gmail.com [School of Computer Science, McGill University, 3480 University Street, Montreal H3A 0E9 (Canada)

    2015-09-15

    Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well.

  5. On the Green's function of the partially diffusion-controlled reversible ABCD reaction for radiation chemistry codes

    International Nuclear Information System (INIS)

    Plante, Ianik; Devroye, Luc

    2015-01-01

    Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well

  6. Chemical potential and reaction electronic flux in symmetry controlled reactions.

    Science.gov (United States)

    Vogt-Geisse, Stefan; Toro-Labbé, Alejandro

    2016-07-15

    In symmetry controlled reactions, orbital degeneracies among orbitals of different symmetries can occur along a reaction coordinate. In such case Koopmans' theorem and the finite difference approximation provide a chemical potential profile with nondifferentiable points. This results in an ill-defined reaction electronic flux (REF) profile, since it is defined as the derivative of the chemical potential with respect to the reaction coordinate. To overcome this deficiency, we propose a new way for the calculation of the chemical potential based on a many orbital approach, suitable for reactions in which symmetry is preserved. This new approach gives rise to a new descriptor: symmetry adapted chemical potential (SA-CP), which is the chemical potential corresponding to a given irreducible representation of a symmetry group. A corresponding symmetry adapted reaction electronic flux (SA-REF) is also obtained. Using this approach smooth chemical potential profiles and well defined REFs are achieved. An application of SA-CP and SA-REF is presented by studying the Cs enol-keto tautomerization of thioformic acid. Two SA-REFs are obtained, JA'(ξ) and JA'' (ξ). It is found that the tautomerization proceeds via an in-plane delocalized 3-center 4-electron O-H-S hypervalent bond which is predicted to exist only in the transition state (TS) region. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  7. The general theory of multistage geminate reactions of isolated pairs of reactants. III. Two-stage reversible dissociation in geminate reaction A + A↔C↔B + B

    Energy Technology Data Exchange (ETDEWEB)

    Kipriyanov, Alexey A.; Kipriyanov, Alexander A.; Doktorov, Alexander B. [Voevodsky Institute of Chemical Kinetics and Combustion, Siberian Branch of the Russian Academy of Sciences, Novosibirsk 630090, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)

    2016-04-14

    Specific two-stage reversible reaction A + A↔C↔B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.

  8. Modeling chemical reactions for drug design.

    Science.gov (United States)

    Gasteiger, Johann

    2007-01-01

    Chemical reactions are involved at many stages of the drug design process. This starts with the analysis of biochemical pathways that are controlled by enzymes that might be downregulated in certain diseases. In the lead discovery and lead optimization process compounds have to be synthesized in order to test them for their biological activity. And finally, the metabolism of a drug has to be established. A better understanding of chemical reactions could strongly help in making the drug design process more efficient. We have developed methods for quantifying the concepts an organic chemist is using in rationalizing reaction mechanisms. These methods allow a comprehensive modeling of chemical reactivity and thus are applicable to a wide variety of chemical reactions, from gas phase reactions to biochemical pathways. They are empirical in nature and therefore allow the rapid processing of large sets of structures and reactions. We will show here how methods have been developed for the prediction of acidity values and of the regioselectivity in organic reactions, for designing the synthesis of organic molecules and of combinatorial libraries, and for furthering our understanding of enzyme-catalyzed reactions and of the metabolism of drugs.

  9. Chemical reactions confined within carbon nanotubes.

    Science.gov (United States)

    Miners, Scott A; Rance, Graham A; Khlobystov, Andrei N

    2016-08-22

    In this critical review, we survey the wide range of chemical reactions that have been confined within carbon nanotubes, particularly emphasising how the pairwise interactions between the catalysts, reactants, transition states and products of a particular molecular transformation with the host nanotube can be used to control the yields and distributions of products of chemical reactions. We demonstrate that nanoscale confinement within carbon nanotubes enables the control of catalyst activity, morphology and stability, influences the local concentration of reactants and products thus affecting equilibria, rates and selectivity, pre-arranges the reactants for desired reactions and alters the relative stability of isomeric products. We critically evaluate the relative advantages and disadvantages of the confinement of chemical reactions inside carbon nanotubes from a chemical perspective and describe how further developments in the controlled synthesis of carbon nanotubes and the incorporation of multifunctionality are essential for the development of this ever-expanding field, ultimately leading to the effective control of the pathways of chemical reactions through the rational design of multi-functional carbon nanoreactors.

  10. Amazing variational approach to chemical reactions

    OpenAIRE

    Fernández, Francisco M.

    2009-01-01

    In this letter we analyse an amazing variational approach to chemical reactions. Our results clearly show that the variational expressions are unsuitable for the analysis of empirical data obtained from chemical reactions.

  11. Recurrence Relations for the Equilibrium Means of Distributions Arising in Chemical Reactions

    Directory of Open Access Journals (Sweden)

    E.K. Elsheikh

    1997-12-01

    Full Text Available In this paper we derive recurrence relations that describe how the equilibrium mean of the number molecules of a reactant varies with each of the parameters defining the initial state for four basic reversible chemical reactions. In essence, the relations provide a rationale for updating the equilibrium mean following the addition (or removal of a molecule of one of the types involved in the reaction, there being a relation for each type. With a new parameterization introduced for each reaction, the relations provide a convenient means of evaluating the means, variances and other important moments without any need to work out the underlying distributions. As an application, the relations are used to numerically assess-approximate expressions for the means and variances.

  12. The Forward-Reverse Algorithm for Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

    2015-01-01

    In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem

  13. ReactionMap: an efficient atom-mapping algorithm for chemical reactions.

    Science.gov (United States)

    Fooshee, David; Andronico, Alessio; Baldi, Pierre

    2013-11-25

    Large databases of chemical reactions provide new data-mining opportunities and challenges. Key challenges result from the imperfect quality of the data and the fact that many of these reactions are not properly balanced or atom-mapped. Here, we describe ReactionMap, an efficient atom-mapping algorithm. Our approach uses a combination of maximum common chemical subgraph search and minimization of an assignment cost function derived empirically from training data. We use a set of over 259,000 balanced atom-mapped reactions from the SPRESI commercial database to train the system, and we validate it on random sets of 1000 and 17,996 reactions sampled from this pool. These large test sets represent a broad range of chemical reaction types, and ReactionMap correctly maps about 99% of the atoms and about 96% of the reactions, with a mean time per mapping of 2 s. Most correctly mapped reactions are mapped with high confidence. Mapping accuracy compares favorably with ChemAxon's AutoMapper, versions 5 and 6.1, and the DREAM Web tool. These approaches correctly map 60.7%, 86.5%, and 90.3% of the reactions, respectively, on the same data set. A ReactionMap server is available on the ChemDB Web portal at http://cdb.ics.uci.edu .

  14. Analysis of Brownian Dynamics Simulations of Reversible Bimolecular Reactions

    KAUST Repository

    Lipková, Jana

    2011-01-01

    A class of Brownian dynamics algorithms for stochastic reaction-diffusion models which include reversible bimolecular reactions is presented and analyzed. The method is a generalization of the λ-bcȳ model for irreversible bimolecular reactions which was introduced in [R. Erban and S. J. Chapman, Phys. Biol., 6(2009), 046001]. The formulae relating the experimentally measurable quantities (reaction rate constants and diffusion constants) with the algorithm parameters are derived. The probability of geminate recombination is also investigated. © 2011 Society for Industrial and Applied Mathematics.

  15. Thermodynamic chemical energy transfer mechanisms of non-equilibrium, quasi-equilibrium, and equilibrium chemical reactions

    International Nuclear Information System (INIS)

    Roh, Heui-Seol

    2015-01-01

    Chemical energy transfer mechanisms at finite temperature are explored by a chemical energy transfer theory which is capable of investigating various chemical mechanisms of non-equilibrium, quasi-equilibrium, and equilibrium. Gibbs energy fluxes are obtained as a function of chemical potential, time, and displacement. Diffusion, convection, internal convection, and internal equilibrium chemical energy fluxes are demonstrated. The theory reveals that there are chemical energy flux gaps and broken discrete symmetries at the activation chemical potential, time, and displacement. The statistical, thermodynamic theory is the unification of diffusion and internal convection chemical reactions which reduces to the non-equilibrium generalization beyond the quasi-equilibrium theories of migration and diffusion processes. The relationship between kinetic theories of chemical and electrochemical reactions is also explored. The theory is applied to explore non-equilibrium chemical reactions as an illustration. Three variable separation constants indicate particle number constants and play key roles in describing the distinct chemical reaction mechanisms. The kinetics of chemical energy transfer accounts for the four control mechanisms of chemical reactions such as activation, concentration, transition, and film chemical reactions. - Highlights: • Chemical energy transfer theory is proposed for non-, quasi-, and equilibrium. • Gibbs energy fluxes are expressed by chemical potential, time, and displacement. • Relationship between chemical and electrochemical reactions is discussed. • Theory is applied to explore nonequilibrium energy transfer in chemical reactions. • Kinetics of non-equilibrium chemical reactions shows the four control mechanisms

  16. Mining chemical reactions using neighborhood behavior and condensed graphs of reactions approaches.

    Science.gov (United States)

    de Luca, Aurélie; Horvath, Dragos; Marcou, Gilles; Solov'ev, Vitaly; Varnek, Alexandre

    2012-09-24

    This work addresses the problem of similarity search and classification of chemical reactions using Neighborhood Behavior (NB) and Condensed Graphs of Reaction (CGR) approaches. The CGR formalism represents chemical reactions as a classical molecular graph with dynamic bonds, enabling descriptor calculations on this graph. Different types of the ISIDA fragment descriptors generated for CGRs in combination with two metrics--Tanimoto and Euclidean--were considered as chemical spaces, to serve for reaction dissimilarity scoring. The NB method has been used to select an optimal combination of descriptors which distinguish different types of chemical reactions in a database containing 8544 reactions of 9 classes. Relevance of NB analysis has been validated in generic (multiclass) similarity search and in clustering with Self-Organizing Maps (SOM). NB-compliant sets of descriptors were shown to display enhanced mapping propensities, allowing the construction of better Self-Organizing Maps and similarity searches (NB and classical similarity search criteria--AUC ROC--correlate at a level of 0.7). The analysis of the SOM clusters proved chemically meaningful CGR substructures representing specific reaction signatures.

  17. Study of flow past an exponentially accelerated isothermal vertical plate in the presence of chemical reaction

    Directory of Open Access Journals (Sweden)

    Muthucumaraswamy R.

    2010-01-01

    Full Text Available Theoretical study of unsteady flow past an exponentially accelerated infinite isothermal vertical plate with variable mass diffusion has been presented in the presence of homogeneous chemical reaction of first order. The plate temperature is raised to Tw and species concentration level near the plate is made to rise linearly with time. The dimensionless governing equations are solved using Laplace-transform technique. The velocity profiles are studied for different physical parameters like chemical reaction parameter, thermal Grashof number, mass Grashof number, a and time. It is observed that the velocity increases with increasing values of a or t. But the trend is just reversed with respect to K.

  18. Femtosecond laser control of chemical reactions

    CSIR Research Space (South Africa)

    Du Plessis, A

    2010-08-31

    Full Text Available Femtosecond laser control of chemical reactions is made possible through the use of pulse-shaping techniques coupled to a learning algorithm feedback loop – teaching the laser pulse to control the chemical reaction. This can result in controllable...

  19. The general theory of multistage geminate reactions of isolated pairs of reactants. III. Two-stage reversible dissociation in geminate reaction A + A ↔ C ↔ B + B.

    Science.gov (United States)

    Kipriyanov, Alexey A; Kipriyanov, Alexander A; Doktorov, Alexander B

    2016-04-14

    Specific two-stage reversible reaction A + A ↔ C ↔ B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.

  20. Characterization of reversible reactions of isocyanides with molybdenum dithiolate complexes

    International Nuclear Information System (INIS)

    Miller, D.J.; DuBois, M.R.

    1980-01-01

    Dimeric molybdenum complexes with bridging dithiocarbonimidate ligands of the formula [C 5 H 5 MoS 2 CNR] 2 (where R = CH 3 , CH 2 C 6 H 5 , C 6 H 11 , and n-C 4 H 9 ) have been synthesized and characterized. The syntheses involve the room-temperature reactions of excess isocyanides with solutions of the dimeric complex [C 5 H 5 MoSC 3 H 6 S] 2 . During the course of these reactions, propene is displaced from the sulfur atoms of the bridging dithiolate ligands. Addition of excess alkene reverses the above reactions. Equilibrium constants have been calculated for the following reactions by integration of NMR resonances: [CH 3 C 5 H 4 MoSC 2 H 4 S] 2 + RNC reversible (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + C == C, K 1 = 2.9 +- 0.2; (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + RNC reversible [CH 3 C 5 H 4 MoS 2 CNR] 2 + C == C, K 2 = 0.7 +- 0.1 (R = CH 2 C 6 H 5 ). The dithiocarbonimidate complexes react cleanly with the electrophiles CH 3 OSO 2 F and HOSO 2 CF 3 to form [C 5 H 5 MoS 2 CNRR'] 2 2+ where R' = H or CH 3 . These products have been characterized by spectral and conductivity methods. The reactions of the dithiocarbonimidate complexes with reducing agents and with carbon monoxide are discussed. 1 figure, 2 tables

  1. Microfabricated sleeve devices for chemical reactions

    Science.gov (United States)

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  2. Plasmon-driven sequential chemical reactions in an aqueous environment.

    Science.gov (United States)

    Zhang, Xin; Wang, Peijie; Zhang, Zhenglong; Fang, Yurui; Sun, Mengtao

    2014-06-24

    Plasmon-driven sequential chemical reactions were successfully realized in an aqueous environment. In an electrochemical environment, sequential chemical reactions were driven by an applied potential and laser irradiation. Furthermore, the rate of the chemical reaction was controlled via pH, which provides indirect evidence that the hot electrons generated from plasmon decay play an important role in plasmon-driven chemical reactions. In acidic conditions, the hot electrons were captured by the abundant H(+) in the aqueous environment, which prevented the chemical reaction. The developed plasmon-driven chemical reactions in an aqueous environment will significantly expand the applications of plasmon chemistry and may provide a promising avenue for green chemistry using plasmon catalysis in aqueous environments under irradiation by sunlight.

  3. The influence of the "cage" effect on the mechanism of reversible bimolecular multistage chemical reactions proceeding from different sites in solutions.

    Science.gov (United States)

    Doktorov, Alexander B

    2016-08-28

    Manifestations of the "cage" effect at the encounters of reactants have been theoretically treated on the example of multistage reactions (including bimolecular exchange reactions as elementary stages) proceeding from different active sites in liquid solutions. It is shown that for reactions occurring near the contact of reactants, consistent consideration of quasi-stationary kinetics of such multistage reactions (possible in the framework of the encounter theory only) can be made on the basis of chemical concepts of the "cage complex," just as in the case of one-site model described in the literature. Exactly as in the one-site model, the presence of the "cage" effect gives rise to new channels of reactant transformation that cannot result from elementary event of chemical conversion for the given reaction mechanism. Besides, the multisite model demonstrates new (as compared to one-site model) features of multistage reaction course.

  4. Complex Chemical Reaction Networks from Heuristics-Aided Quantum Chemistry.

    Science.gov (United States)

    Rappoport, Dmitrij; Galvin, Cooper J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán

    2014-03-11

    While structures and reactivities of many small molecules can be computed efficiently and accurately using quantum chemical methods, heuristic approaches remain essential for modeling complex structures and large-scale chemical systems. Here, we present a heuristics-aided quantum chemical methodology applicable to complex chemical reaction networks such as those arising in cell metabolism and prebiotic chemistry. Chemical heuristics offer an expedient way of traversing high-dimensional reactive potential energy surfaces and are combined here with quantum chemical structure optimizations, which yield the structures and energies of the reaction intermediates and products. Application of heuristics-aided quantum chemical methodology to the formose reaction reproduces the experimentally observed reaction products, major reaction pathways, and autocatalytic cycles.

  5. Surface chemical reactions probed with scanning force microscopy

    NARCIS (Netherlands)

    Werts, M.P L; van der Vegte, E.W.; Hadziioannou, G

    1997-01-01

    In this letter we report the study of surface chemical reactions with scanning force microscopy (SFM) with chemical specificity. Using chemically modified SFM probes, we can determine the local surface reaction conversion during a chemical surface modification. The adhesion forces between a

  6. Runaway chemical reaction exposes community to highly toxic chemicals

    International Nuclear Information System (INIS)

    Kaszniak, Mark; Vorderbrueggen, John

    2008-01-01

    The U.S. Chemical Safety and Hazard Investigation Board (CSB) conducted a comprehensive investigation of a runaway chemical reaction at MFG Chemical (MFG) in Dalton, Georgia on April 12, 2004 that resulted in the uncontrolled release of a large quantity of highly toxic and flammable allyl alcohol and allyl chloride into the community. Five people were hospitalized and 154 people required decontamination and treatment for exposure to the chemicals. This included police officers attempting to evacuate the community and ambulance personnel who responded to 911 calls from residents exposed to the chemicals. This paper presents the findings of the CSB report (U.S. Chemical Safety and Hazard Investigation Board (CSB), Investigation Report: Toxic Chemical Vapor Cloud Release, Report No. 2004-09-I-GA, Washington DC, April 2006) including a discussion on tolling practices; scale-up of batch reaction processes; Process Safety Management (PSM) and Risk Management Plan (RMP) implementation; emergency planning by the company, county and the city; and emergency response and mitigation actions taken during the incident. The reactive chemical testing and atmospheric dispersion modeling conducted by CSB after the incident and recommendations adopted by the Board are also discussed

  7. Chemical reaction due to stronger Ramachandran interaction

    Indian Academy of Sciences (India)

    actions between two polarized atoms are responsible for initiating a chemical reaction, either before or after ... Chemical reaction; Ramachandran interaction; anisotropic and asymmetric polarization; ionization ..... man sequence exactly, including the generalized mech- ..... We now move on and rearrange Eq. (8) to arrive at.

  8. Reduction of chemical reaction models

    Science.gov (United States)

    Frenklach, Michael

    1991-01-01

    An attempt is made to reconcile the different terminologies pertaining to reduction of chemical reaction models. The approaches considered include global modeling, response modeling, detailed reduction, chemical lumping, and statistical lumping. The advantages and drawbacks of each of these methods are pointed out.

  9. Enhancing chemical reactions

    Science.gov (United States)

    Morrey, John R.

    1978-01-01

    Methods of enhancing selected chemical reactions. The population of a selected high vibrational energy state of a reactant molecule is increased substantially above its population at thermal equilibrium by directing onto the molecule a beam of radiant energy from a laser having a combination of frequency and intensity selected to pump the selected energy state, and the reaction is carried out with the temperature, pressure, and concentrations of reactants maintained at a combination of values selected to optimize the reaction in preference to thermal degradation by transforming the absorbed energy into translational motion. The reaction temperature is selected to optimize the reaction. Typically a laser and a frequency doubler emit radiant energy at frequencies of .nu. and 2.nu. into an optical dye within an optical cavity capable of being tuned to a wanted frequency .delta. or a parametric oscillator comprising a non-centrosymmetric crystal having two indices of refraction, to emit radiant energy at the frequencies of .nu., 2.nu., and .delta. (and, with a parametric oscillator, also at 2.nu.-.delta.). Each unwanted frequency is filtered out, and each desired frequency is focused to the desired radiation flux within a reaction chamber and is reflected repeatedly through the chamber while reactants are fed into the chamber and reaction products are removed therefrom.

  10. Time-reversal asymmetry: polarization and analyzing power in nuclear reactions

    International Nuclear Information System (INIS)

    Rioux, C.; Roy, R.; Slobodrian, R.J.; Conzett, H.E.

    1984-01-01

    Measurements of the proton polarization in the reactions 7 Li( 3 He, p vector) 9 Be and 9 Be( 3 He, p vector) 11 B and of the analyzing powers in the inverse reactions, initiated by polarized protons at the same center-of-mass energies, show significant differences. This implies the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction 2 H( 3 He, p vector) 4 He and its inverse have also been investigated and show smaller differences. A discussion of instrumental asymmetries is presented

  11. Optimizing Chemical Reactions with Deep Reinforcement Learning.

    Science.gov (United States)

    Zhou, Zhenpeng; Li, Xiaocheng; Zare, Richard N

    2017-12-27

    Deep reinforcement learning was employed to optimize chemical reactions. Our model iteratively records the results of a chemical reaction and chooses new experimental conditions to improve the reaction outcome. This model outperformed a state-of-the-art blackbox optimization algorithm by using 71% fewer steps on both simulations and real reactions. Furthermore, we introduced an efficient exploration strategy by drawing the reaction conditions from certain probability distributions, which resulted in an improvement on regret from 0.062 to 0.039 compared with a deterministic policy. Combining the efficient exploration policy with accelerated microdroplet reactions, optimal reaction conditions were determined in 30 min for the four reactions considered, and a better understanding of the factors that control microdroplet reactions was reached. Moreover, our model showed a better performance after training on reactions with similar or even dissimilar underlying mechanisms, which demonstrates its learning ability.

  12. Flows and chemical reactions in heterogeneous mixtures

    CERN Document Server

    Prud'homme, Roger

    2014-01-01

    This book - a sequel of previous publications 'Flows and Chemical Reactions' and 'Chemical Reactions in Flows and Homogeneous Mixtures' - is devoted to flows with chemical reactions in heterogeneous environments.  Heterogeneous media in this volume include interfaces and lines. They may be the site of radiation. Each type of flow is the subject of a chapter in this volume. We consider first, in Chapter 1, the question of the generation of environments biphasic individuals: dusty gas, mist, bubble flow.  Chapter 2 is devoted to the study at the mesoscopic scale: particle-fluid exchange of mom

  13. Silicon-based sleeve devices for chemical reactions

    Science.gov (United States)

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  14. Investigation of Evaluation method of chemical runaway reaction

    International Nuclear Information System (INIS)

    Sato, Yoshihiko; Sasaya, Shinji; Kurakata, Koichiro; Nojiri, Ichiro

    2002-02-01

    Safety study 'Study of evaluation of abnormal occurrence for chemical substances in the nuclear fuel facilities' will be carried out from 2001 to 2005. In this study, the prediction of thermal hazards of chemical substances will be investigated and prepared. The hazard prediction method of chemical substances will be constructed from these results. Therefore, the hazard prediction methods applied in the chemical engineering in which the chemical substances with the hazard of fire and explosion were often treated were investigated. CHETAH (The ASTM Computer Program for Chemical Thermodynamic and Energy Release Evaluation) developed by ASTM (American Society for Testing and Materials) and TSS (Thermal Safety Software) developed by CISP (ChemInform St. Petersburg) were introduced and the fire and explosion hazards of chemical substances and reactions in the reprocessing process were evaluated. From these evaluated results, CHETAH could almost estimate the heat of reaction at 10% accuracy. It was supposed that CHETAH was useful as a screening for the hazards of fire and explosion of the new chemical substances and so on. TSS could calculate the reaction rate and the reaction behavior from the data measured by the various calorimeters rapidly. It was supposed that TSS was useful as an evaluation method for the hazards of fire and explosion of the new chemical reactions and so on. (author)

  15. Neural Network Control of CSTR for Reversible Reaction Using Reverence Model Approach

    Directory of Open Access Journals (Sweden)

    Duncan ALOKO

    2007-01-01

    Full Text Available In this work, non-linear control of CSTR for reversible reaction is carried out using Neural Network as design tool. The Model Reverence approach in used to design ANN controller. The idea is to have a control system that will be able to achieve improvement in the level of conversion and to be able to track set point change and reject load disturbance. We use PID control scheme as benchmark to study the performance of the controller. The comparison shows that ANN controller out perform PID in the extreme range of non-linearity.This paper represents a preliminary effort to design a simplified neutral network control scheme for a class of non-linear process. Future works will involve further investigation of the effectiveness of thin approach for the real industrial chemical process

  16. HEAT AND MASS TRANSFER EFFECTS ON FLOW PAST PARABOLIC STARTING MOTION OF ISOTHERMAL VERTICAL PLATE IN THE PRESENCE OF FIRST ORDER CHEMICAL REACTION

    Directory of Open Access Journals (Sweden)

    R. Muthucumaraswamy

    2013-06-01

    Full Text Available An exact solution of unsteady flow past a parabolic starting motion of the infinite isothermal vertical plate with uniform mass diffusion, in the presence of a homogeneous chemical reaction of the first order, has been studied. The plate temperature and the concentration level near the plate are raised uniformly. The dimensionless governing equations are solved using the Laplace transform technique. The effect of velocity profiles are studied for different physical parameters, such as chemical reaction parameter, thermal Grashof number, mass Grashof number, Schmidt number, and time. It is observed that velocity increases with increasing values of thermal Grashof number or mass Grashof number. The trend is reversed with respect to the chemical reaction parameter.

  17. Chemical tailoring of teicoplanin with site-selective reactions.

    Science.gov (United States)

    Pathak, Tejas P; Miller, Scott J

    2013-06-05

    Semisynthesis of natural product derivatives combines the power of fermentation with orthogonal chemical reactions. Yet, chemical modification of complex structures represents an unmet challenge, as poor selectivity often undermines efficiency. The complex antibiotic teicoplanin eradicates bacterial infections. However, as resistance emerges, the demand for improved analogues grows. We have discovered chemical reactions that achieve site-selective alteration of teicoplanin. Utilizing peptide-based additives that alter reaction selectivities, certain bromo-teicoplanins are accessible. These new compounds are also scaffolds for selective cross-coupling reactions, enabling further molecular diversification. These studies enable two-step access to glycopeptide analogues not available through either biosynthesis or rapid total chemical synthesis alone. The new compounds exhibit a spectrum of activities, revealing that selective chemical alteration of teicoplanin may lead to analogues with attenuated or enhanced antibacterial properties, in particular against vancomycin- and teicoplanin-resistant strains.

  18. Aerosol simulation including chemical and nuclear reactions

    International Nuclear Information System (INIS)

    Marwil, E.S.; Lemmon, E.C.

    1985-01-01

    The numerical simulation of aerosol transport, including the effects of chemical and nuclear reactions presents a challenging dynamic accounting problem. Particles of different sizes agglomerate and settle out due to various mechanisms, such as diffusion, diffusiophoresis, thermophoresis, gravitational settling, turbulent acceleration, and centrifugal acceleration. Particles also change size, due to the condensation and evaporation of materials on the particle. Heterogeneous chemical reactions occur at the interface between a particle and the suspending medium, or a surface and the gas in the aerosol. Homogeneous chemical reactions occur within the aersol suspending medium, within a particle, and on a surface. These reactions may include a phase change. Nuclear reactions occur in all locations. These spontaneous transmutations from one element form to another occur at greatly varying rates and may result in phase or chemical changes which complicate the accounting process. This paper presents an approach for inclusion of these effects on the transport of aerosols. The accounting system is very complex and results in a large set of stiff ordinary differential equations (ODEs). The techniques for numerical solution of these ODEs require special attention to achieve their solution in an efficient and affordable manner. 4 refs

  19. A transformation theory of stochastic evolution in Red Moon methodology to time evolution of chemical reaction process in the full atomistic system.

    Science.gov (United States)

    Suzuki, Yuichi; Nagaoka, Masataka

    2017-05-28

    Atomistic information of a whole chemical reaction system, e.g., instantaneous microscopic molecular structures and orientations, offers important and deeper insight into clearly understanding unknown chemical phenomena. In accordance with the progress of a number of simultaneous chemical reactions, the Red Moon method (a hybrid Monte Carlo/molecular dynamics reaction method) is capable of simulating atomistically the chemical reaction process from an initial state to the final one of complex chemical reaction systems. In the present study, we have proposed a transformation theory to interpret the chemical reaction process of the Red Moon methodology as the time evolution process in harmony with the chemical kinetics. For the demonstration of the theory, we have chosen the gas reaction system in which the reversible second-order reaction H 2 + I 2  ⇌ 2HI occurs. First, the chemical reaction process was simulated from the initial configurational arrangement containing a number of H 2 and I 2 molecules, each at 300 K, 500 K, and 700 K. To reproduce the chemical equilibrium for the system, the collision frequencies for the reactions were taken into consideration in the theoretical treatment. As a result, the calculated equilibrium concentrations [H 2 ] eq and equilibrium constants K eq at all the temperatures were in good agreement with their corresponding experimental values. Further, we applied the theoretical treatment for the time transformation to the system and have shown that the calculated half-life τ's of [H 2 ] reproduce very well the analytical ones at all the temperatures. It is, therefore, concluded that the application of the present theoretical treatment with the Red Moon method makes it possible to analyze reasonably the time evolution of complex chemical reaction systems to chemical equilibrium at the atomistic level.

  20. Explorations into Chemical Reactions and Biochemical Pathways.

    Science.gov (United States)

    Gasteiger, Johann

    2016-12-01

    A brief overview of the work in the research group of the present author on extracting knowledge from chemical reaction data is presented. Methods have been developed to calculate physicochemical effects at the reaction site. It is shown that these physicochemical effects can quite favourably be used to derive equations for the calculation of data on gas phase reactions and on reactions in solution such as aqueous acidity of alcohols or carboxylic acids or the hydrolysis of amides. Furthermore, it is shown that these physicochemical effects are quite effective for assigning reactions into reaction classes that correspond to chemical knowledge. Biochemical reactions constitute a particularly interesting and challenging task for increasing our understanding of living species. The BioPath.Database is a rich source of information on biochemical reactions and has been used for a variety of applications of chemical, biological, or medicinal interests. Thus, it was shown that biochemical reactions can be assigned by the physicochemical effects into classes that correspond to the classification of enzymes by the EC numbers. Furthermore, 3D models of reaction intermediates can be used for searching for novel enzyme inhibitors. It was shown in a combined application of chemoinformatics and bioinformatics that essential pathways of diseases can be uncovered. Furthermore, a study showed that bacterial flavor-forming pathways can be discovered. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Single-molecule stochastic times in a reversible bimolecular reaction

    Science.gov (United States)

    Keller, Peter; Valleriani, Angelo

    2012-08-01

    In this work, we consider the reversible reaction between reactants of species A and B to form the product C. We consider this reaction as a prototype of many pseudobiomolecular reactions in biology, such as for instance molecular motors. We derive the exact probability density for the stochastic waiting time that a molecule of species A needs until the reaction with a molecule of species B takes place. We perform this computation taking fully into account the stochastic fluctuations in the number of molecules of species B. We show that at low numbers of participating molecules, the exact probability density differs from the exponential density derived by assuming the law of mass action. Finally, we discuss the condition of detailed balance in the exact stochastic and in the approximate treatment.

  2. Modelling of simultaneous mass and heat transfer with chemical reaction using the Maxwell-Stefan theory II. Non-isothermal study

    NARCIS (Netherlands)

    Frank, M.J.W.; Kuipers, J.A.M.; Krishna, R.; van Swaaij, W.P.M.

    1995-01-01

    In Part I a general applicable model has been developed which calculates mass and heat transfer fluxes through a vapour/gas-liquid interface in case a reversible chemical reaction with associated heat effect takes place in the liquid phase. In this model the Maxwell-Stefan theory has been used to

  3. Modelling Students' Visualisation of Chemical Reaction

    Science.gov (United States)

    Cheng, Maurice M. W.; Gilbert, John K.

    2017-01-01

    This paper proposes a model-based notion of "submicro representations of chemical reactions". Based on three structural models of matter (the simple particle model, the atomic model and the free electron model of metals), we suggest there are two major models of reaction in school chemistry curricula: (a) reactions that are simple…

  4. Non-equilibrium reaction rates in chemical kinetic equations

    Science.gov (United States)

    Gorbachev, Yuriy

    2018-05-01

    Within the recently proposed asymptotic method for solving the Boltzmann equation for chemically reacting gas mixture, the chemical kinetic equations has been derived. Corresponding one-temperature non-equilibrium reaction rates are expressed in terms of specific heat capacities of the species participate in the chemical reactions, bracket integrals connected with the internal energy transfer in inelastic non-reactive collisions and energy transfer coefficients. Reactions of dissociation/recombination of homonuclear and heteronuclear diatomic molecules are considered. It is shown that all reaction rates are the complex functions of the species densities, similarly to the unimolecular reaction rates. For determining the rate coefficients it is recommended to tabulate corresponding bracket integrals, additionally to the equilibrium rate constants. Correlation of the obtained results with the irreversible thermodynamics is established.

  5. Kinetics of chemical reactions initiated by hot atoms

    International Nuclear Information System (INIS)

    Firsova, L.P.

    1977-01-01

    Modern ideas about kinetics of chemical reactions of hot atoms are generalized. The main points of the phenomenological theories (''kinetic theory'' of Wolfgang-Estrup hot reactions and the theory of ''reactions integral probability'' of Porter) are given. Physico-chemical models of elastic and non-elastic collisions are considered which are used in solving Boltzmann integro-differential equations and stochastic equations in the Porter theory. The principal formulas are given describing probabilities or yields of chemical reactions, initiated with hot atoms, depending on the distribution functions of hot particles with respect to energy. Briefly described are the techniques and the results of applying the phenomenological theories for interpretation of the experimental data obtained during nuclear reactions with hot atoms, photochemical investigations, etc. 96 references are given

  6. Relationship between thermodynamic driving force and one-way fluxes in reversible processes.

    Directory of Open Access Journals (Sweden)

    Daniel A Beard

    Full Text Available Chemical reaction systems operating in nonequilibrium open-system states arise in a great number of contexts, including the study of living organisms, in which chemical reactions, in general, are far from equilibrium. Here we introduce a theorem that relates forward and reverse fluxes and free energy for any chemical process operating in a steady state. This relationship, which is a generalization of equilibrium conditions to the case of a chemical process occurring in a nonequilibrium steady state in dilute solution, provides a novel equivalent definition for chemical reaction free energy. In addition, it is shown that previously unrelated theories introduced by Ussing and Hodgkin and Huxley for transport of ions across membranes, Hill for catalytic cycle fluxes, and Crooks for entropy production in microscopically reversible systems, are united in a common framework based on this relationship.

  7. Mesoscale simulations of shockwave energy dissipation via chemical reactions.

    Science.gov (United States)

    Antillon, Edwin; Strachan, Alejandro

    2015-02-28

    We use a particle-based mesoscale model that incorporates chemical reactions at a coarse-grained level to study the response of materials that undergo volume-reducing chemical reactions under shockwave-loading conditions. We find that such chemical reactions can attenuate the shockwave and characterize how the parameters of the chemical model affect this behavior. The simulations show that the magnitude of the volume collapse and velocity at which the chemistry propagates are critical to weaken the shock, whereas the energetics in the reactions play only a minor role. Shock loading results in transient states where the material is away from local equilibrium and, interestingly, chemical reactions can nucleate under such non-equilibrium states. Thus, the timescales for equilibration between the various degrees of freedom in the material affect the shock-induced chemistry and its ability to attenuate the propagating shock.

  8. Acoustic wave propagation in fluids with coupled chemical reactions

    International Nuclear Information System (INIS)

    Margulies, T.S.; Schwarz, W.H.

    1984-08-01

    This investigation presents a hydroacoustic theory which accounts for sound absorption and dispersion in a multicomponent mixture of reacting fluids (assuming a set of first-order acoustic equations without diffusion) such that several coupled reactions can occur simultaneously. General results are obtained in the form of a biquadratic characteristic equation (called the Kirchhoff-Langevin equation) for the complex propagation variable chi = - (α + iω/c) in which α is the attenuation coefficient, c is the phase speed of the progressive wave and ω is the angular frequency. Computer simulations of sound absorption spectra have been made for three different chemical systems, each comprised of two-step chemical reactions using physico-chemical data available in the literature. The chemical systems studied include: (1) water-dioxane, (2) aqueous solutions of glycine and (3) cobalt polyphosphate mixtures. Explicit comparisons are made between the exact biquadratic characteristic solution and the approximate equation (sometimes referred to as a Debye equation) previously applied to interpret the experimental data for the chemical reaction contribution to the absorption versus frequency. The relative chemical reaction and classical viscothermal contributions to the sound absorption are also presented. Several discrepancies that can arise when estimating thermodynamic data (chemical reaction heats or volume changes) for multistep chemical reaction systems when making dilute solution or constant density assumptions are discussed

  9. Chemical reactions in solvents and melts

    CERN Document Server

    Charlot, G

    1969-01-01

    Chemical Reactions in Solvents and Melts discusses the use of organic and inorganic compounds as well as of melts as solvents. This book examines the applications in organic and inorganic chemistry as well as in electrochemistry. Organized into two parts encompassing 15 chapters, this book begins with an overview of the general properties and the different types of reactions, including acid-base reactions, complex formation reactions, and oxidation-reduction reactions. This text then describes the properties of inert and active solvents. Other chapters consider the proton transfer reactions in

  10. Kinetic studies of elementary chemical reactions

    Energy Technology Data Exchange (ETDEWEB)

    Durant, J.L. Jr. [Sandia National Laboratories, Livermore, CA (United States)

    1993-12-01

    This program concerning kinetic studies of elementary chemical reactions is presently focussed on understanding reactions of NH{sub x} species. To reach this goal, the author is pursuing experimental studies of reaction rate coefficients and product branching fractions as well as using electronic structure calculations to calculate transition state properties and reaction rate calculations to relate these properties to predicted kinetic behavior. The synergy existing between the experimental and theoretical studies allow one to gain a deeper insight into more complex elementary reactions.

  11. Neutral theory of chemical reaction networks

    International Nuclear Information System (INIS)

    Lee, Sang Hoon; Holme, Petter; Minnhagen, Petter; Bernhardsson, Sebastian; Kim, Beom Jun

    2012-01-01

    To what extent do the characteristic features of a chemical reaction network reflect its purpose and function? In general, one argues that correlations between specific features and specific functions are key to understanding a complex structure. However, specific features may sometimes be neutral and uncorrelated with any system-specific purpose, function or causal chain. Such neutral features are caused by chance and randomness. Here we compare two classes of chemical networks: one that has been subjected to biological evolution (the chemical reaction network of metabolism in living cells) and one that has not (the atmospheric planetary chemical reaction networks). Their degree distributions are shown to share the very same neutral system-independent features. The shape of the broad distributions is to a large extent controlled by a single parameter, the network size. From this perspective, there is little difference between atmospheric and metabolic networks; they are just different sizes of the same random assembling network. In other words, the shape of the degree distribution is a neutral characteristic feature and has no functional or evolutionary implications in itself; it is not a matter of life and death. (paper)

  12. Automatic NMR-based identification of chemical reaction types in mixtures of co-occurring reactions.

    Science.gov (United States)

    Latino, Diogo A R S; Aires-de-Sousa, João

    2014-01-01

    The combination of chemoinformatics approaches with NMR techniques and the increasing availability of data allow the resolution of problems far beyond the original application of NMR in structure elucidation/verification. The diversity of applications can range from process monitoring, metabolic profiling, authentication of products, to quality control. An application related to the automatic analysis of complex mixtures concerns mixtures of chemical reactions. We encoded mixtures of chemical reactions with the difference between the (1)H NMR spectra of the products and the reactants. All the signals arising from all the reactants of the co-occurring reactions were taken together (a simulated spectrum of the mixture of reactants) and the same was done for products. The difference spectrum is taken as the representation of the mixture of chemical reactions. A data set of 181 chemical reactions was used, each reaction manually assigned to one of 6 types. From this dataset, we simulated mixtures where two reactions of different types would occur simultaneously. Automatic learning methods were trained to classify the reactions occurring in a mixture from the (1)H NMR-based descriptor of the mixture. Unsupervised learning methods (self-organizing maps) produced a reasonable clustering of the mixtures by reaction type, and allowed the correct classification of 80% and 63% of the mixtures in two independent test sets of different similarity to the training set. With random forests (RF), the percentage of correct classifications was increased to 99% and 80% for the same test sets. The RF probability associated to the predictions yielded a robust indication of their reliability. This study demonstrates the possibility of applying machine learning methods to automatically identify types of co-occurring chemical reactions from NMR data. Using no explicit structural information about the reactions participants, reaction elucidation is performed without structure elucidation of

  13. Automatic NMR-based identification of chemical reaction types in mixtures of co-occurring reactions.

    Directory of Open Access Journals (Sweden)

    Diogo A R S Latino

    Full Text Available The combination of chemoinformatics approaches with NMR techniques and the increasing availability of data allow the resolution of problems far beyond the original application of NMR in structure elucidation/verification. The diversity of applications can range from process monitoring, metabolic profiling, authentication of products, to quality control. An application related to the automatic analysis of complex mixtures concerns mixtures of chemical reactions. We encoded mixtures of chemical reactions with the difference between the (1H NMR spectra of the products and the reactants. All the signals arising from all the reactants of the co-occurring reactions were taken together (a simulated spectrum of the mixture of reactants and the same was done for products. The difference spectrum is taken as the representation of the mixture of chemical reactions. A data set of 181 chemical reactions was used, each reaction manually assigned to one of 6 types. From this dataset, we simulated mixtures where two reactions of different types would occur simultaneously. Automatic learning methods were trained to classify the reactions occurring in a mixture from the (1H NMR-based descriptor of the mixture. Unsupervised learning methods (self-organizing maps produced a reasonable clustering of the mixtures by reaction type, and allowed the correct classification of 80% and 63% of the mixtures in two independent test sets of different similarity to the training set. With random forests (RF, the percentage of correct classifications was increased to 99% and 80% for the same test sets. The RF probability associated to the predictions yielded a robust indication of their reliability. This study demonstrates the possibility of applying machine learning methods to automatically identify types of co-occurring chemical reactions from NMR data. Using no explicit structural information about the reactions participants, reaction elucidation is performed without structure

  14. TR-ESR Investigation on Reaction of Vitamin C with Excited Triplet of 9,10-phenanthrenequinone in Reversed Micelle Solutions

    Science.gov (United States)

    Xu, Xin-sheng; Shi, Lei; Liu, Yi; Ji, Xue-han; Cui, Zhi-feng

    2011-04-01

    Time-resolved electron spin resonance has been used to study quenching reactions between the antioxidant Vitamin C (VC) and the triplet excited states of 9,10-phenanthrenequinone (PAQ) in ethylene glycol-water (EG-H2O) homogeneous and inhomogeneous reversed micelle solutions. Reversed micelle solutions were used to be the models of physiological environment of biological cell and tissue. In PAQ/EG-H2O homogeneous solution, the excited triplet of PAQ (3PAQ*) abstracts hydrogen atom from solvent EG. In PAQ/VC/EG-H2O solution, 3PAQ* abstracts hydrogen atom not only from solvent EG but also from VC. The quenching rate constant of 3PAQ* by VC is close to the diffusion-controlled value of 1.41 × 108 L/(mol ·s). In hexadecyltrimethylammonium bromide (CTAB)/EG-H2O and aerosol OT (AOT)/EG-H2O reversed micelle solutions, 3PAQ* and VC react around the water-oil interface of the reversed micelle. Exit of 3PAQ* from the lipid phase slows down the quenching reaction. For Triton X-100 (TX-100)/EG-H2O reversed micelle solution, PAQ and VC coexist inside the hydrophilic polyethylene glycol core, and the quenching rate constant of 3PAQ* by VC is larger than those in AOT/EG-H2O and CTAB/EG-H2O reversed micelle solutions, even a little larger than that in EG-H2O homogeneous solution. The strong emissive chemically induced dynamic electron polarization of As.- resulted from the effective TM spin polarization transfer in hydrogen abstraction of 3PAQ* from VC.

  15. Experimental and numerical reaction analysis on sodium-water chemical reaction field

    International Nuclear Information System (INIS)

    Deguchi, Yoshihiro; Takata, Takashi; Yamaguchi, Akira; Kikuchi, Shin; Ohshima, Hiroyuki

    2015-01-01

    In a sodium-cooled fast reactor (SFR), liquid sodium is used as a heat transfer fluid because of its excellent heat transport capability. On the other hand, it has strong chemical reactivity with water vapor. One of the design basis accidents of the SFR is the water leakage into the liquid sodium flow by a breach of heat transfer tubes. This process ends up damages on the heat transport equipment in the SFR. Therefore, the study on sodium-water chemical reactions is of paramount importance for security reasons. This study aims to clarify the sodium-water reaction mechanisms using an elementary reaction analysis. A quasi one-dimensional flame model is applied to a sodium-water counter-flow reaction field. The analysis contains 25 elementary reactions, which consist of 17 H_2-O_2 and 8 Na-H_2O reactions. Temperature and species concentrations in the counter-flow reaction field were measured using laser diagnostics such as LIF and CARS. The main reaction in the experimental conditions is Na+H_2O → NaOH+H and OH is produced by H_2O+H → H_2+OH. It is demonstrated that the reaction model in this study well explains the structure of the sodium-water counter-flow diffusion flame. (author)

  16. Reaction Hamiltonian and state-to-state description of chemical reactions

    International Nuclear Information System (INIS)

    Ruf, B.A.; Kresin, V.Z.; Lester, W.A. Jr.

    1985-08-01

    A chemical reaction is treated as a quantum transition from reactants to products. A specific reaction Hamiltonian (in second quantization formalism) is introduced. The approach leads to Franck-Condon-like factor, and adiabatic method in the framework of the nuclear motion problems. The influence of reagent vibrational state on the product energy distribution has been studied following the reaction Hamiltonian method. Two different cases (fixed available energy and fixed translational energy) are distinguished. Results for several biomolecular reactions are presented. 40 refs., 5 figs

  17. Heterogeneously Catalysed Chemical Reactions in Carbon Dioxide Medium

    DEFF Research Database (Denmark)

    Musko, Nikolai E.

    In this PhD-study the different areas of chemical engineering, heterogeneous catalysis, supercritical fluids, and phase equilibrium thermodynamics have been brought together for selected reactions. To exploit the beneficial properties of supercritical fluids in heterogeneous catalysis, experimental...... studies of catalytic chemical reactions in dense and supercritical carbon dioxide have been complemented by the theoretical calculations of phase equilibria using advanced thermodynamic models. In the recent years, the use of compressed carbon dioxide as innovative, non-toxic and non-flammable, cheap......, and widely available reaction medium for many practical and industrial applications has drastically increased. Particularly attractive are heterogeneously catalysed chemical reactions. The beneficial use of CO2 is attributed to its unique properties at dense and supercritical states (at temperatures...

  18. Chemical changes in groundwater and their reaction rates

    International Nuclear Information System (INIS)

    Talma, A.S.

    1981-01-01

    The evolution of the major ion concentrations of groundwater (Na, K, Ca, Mg, HCO 3 , SO 4 , Cl and NO 3 ) can be described as the consequence of a number of competing chemical reactions. With the aid of the naturally occuring radioactive and stable isotopes some of these reactions can be separated, identified and followed in space and time. In some field studies, especialy of artesian water, the rates of reactions can be estimated. A number of processes observed in South African sandstones aquifers are discussed and the variable reaction rates demonstrated. Reactions that can be identified include carbonate solution, chemical weathering, salt leaching, cation exchange and redox processes

  19. Temperature dependence on sodium-water chemical reaction

    International Nuclear Information System (INIS)

    Tamura, Kenta; Deguchi, Yoshihiro; Suzuki, Koichi; Takata, Takashi; Yamaguchi, Akira; Kikuchi, Shin; Ohshima, Hiroyuki

    2012-01-01

    In a sodium-cooled fast reactor (SFR), liquid sodium is used as a heat transfer fluid because of its excellent heat transport capability. On the other hand, it has strong chemical reactivity with water vapor. One of the design basis accidents of the SFR is the water leakage into the liquid sodium flow by a breach of heat transfer tubes. This process ends up damages on the heat transport equipment in the SFR. Therefore, the study on sodium-water chemical reactions is of paramount importance for security reasons. This study aims to clarify the sodium-water reaction mechanisms using laser diagnostics. A quasi one-dimensional flame model is also applied to a sodium-water counter-flow reaction field. Temperature, H 2 , H 2 O, OH, Na and Particulate matter were measured using laser induced fluorescence and CARS in the counter-flow reaction field. The temperature of the reaction field was also modified to reduce the condensation of Na in the reaction zone. (author)

  20. A new type of power energy for accelerating chemical reactions: the nature of a microwave-driving force for accelerating chemical reactions.

    Science.gov (United States)

    Zhou, Jicheng; Xu, Wentao; You, Zhimin; Wang, Zhe; Luo, Yushang; Gao, Lingfei; Yin, Cheng; Peng, Renjie; Lan, Lixin

    2016-04-27

    The use of microwave (MW) irradiation to increase the rate of chemical reactions has attracted much attention recently in nearly all fields of chemistry due to substantial enhancements in reaction rates. However, the intrinsic nature of the effects of MW irradiation on chemical reactions remains unclear. Herein, the highly effective conversion of NO and decomposition of H2S via MW catalysis were investigated. The temperature was decreased by several hundred degrees centigrade. Moreover, the apparent activation energy (Ea') decreased substantially under MW irradiation. Importantly, for the first time, a model of the interactions between microwave electromagnetic waves and molecules is proposed to elucidate the intrinsic reason for the reduction in the Ea' under MW irradiation, and a formula for the quantitative estimation of the decrease in the Ea' was determined. MW irradiation energy was partially transformed to reduce the Ea', and MW irradiation is a new type of power energy for speeding up chemical reactions. The effect of MW irradiation on chemical reactions was determined. Our findings challenge both the classical view of MW irradiation as only a heating method and the controversial MW non-thermal effect and open a promising avenue for the development of novel MW catalytic reaction technology.

  1. Stereodynamics: From elementary processes to macroscopic chemical reactions

    Energy Technology Data Exchange (ETDEWEB)

    Kasai, Toshio [Department of Chemistry, National Taiwan University, Taipei 106, Taiwan (China); Graduate School of Science, Department of Chemistry, Osaka University, Toyonaka, 560-0043 Osaka (Japan); Che, Dock-Chil [Graduate School of Science, Department of Chemistry, Osaka University, Toyonaka, 560-0043 Osaka (Japan); Tsai, Po-Yu [Department of Chemistry, National Taiwan University, Taipei 106, Taiwan (China); Department of Chemistry, National Chung Hsing University, Taichung 402, Taiwan (China); Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei 106, Taiwan (China); Lin, King-Chuen [Department of Chemistry, National Taiwan University, Taipei 106, Taiwan (China); Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei 106, Taiwan (China); Palazzetti, Federico [Scuola Normale Superiore, Pisa (Italy); Dipartimento di Chimica Biologia e Biotecnologie, Università di Perugia, 06123 Perugia (Italy); Aquilanti, Vincenzo [Dipartimento di Chimica Biologia e Biotecnologie, Università di Perugia, 06123 Perugia (Italy); Istituto di Struttura della Materia, Consiglio Nazionale delle Ricerche, Roma (Italy); Instituto de Fisica, Universidade Federal da Bahia, Salvador (Brazil)

    2015-12-31

    This paper aims at discussing new facets on stereodynamical behaviors in chemical reactions, i.e. the effects of molecular orientation and alignment on reactive processes. Further topics on macroscopic processes involving deviations from Arrhenius behavior in the temperature dependence of chemical reactions and chirality effects in collisions are also discussed.

  2. CHEMICAL REACTIONS ON ADSORBING SURFACE: KINETIC LEVEL OF DESCRIPTION

    Directory of Open Access Journals (Sweden)

    P.P.Kostrobii

    2003-01-01

    Full Text Available Based on the effective Hubbard model we suggest a statistical description of reaction-diffusion processes for bimolecular chemical reactions of gas particles adsorbed on the metallic surface. The system of transport equations for description of particles diffusion as well as reactions is obtained. We carry out the analysis of the contributions of all physical processes to the formation of diffusion coefficients and chemical reactions constants.

  3. Chemical memory reactions induced bursting dynamics in gene expression.

    Science.gov (United States)

    Tian, Tianhai

    2013-01-01

    Memory is a ubiquitous phenomenon in biological systems in which the present system state is not entirely determined by the current conditions but also depends on the time evolutionary path of the system. Specifically, many memorial phenomena are characterized by chemical memory reactions that may fire under particular system conditions. These conditional chemical reactions contradict to the extant stochastic approaches for modeling chemical kinetics and have increasingly posed significant challenges to mathematical modeling and computer simulation. To tackle the challenge, I proposed a novel theory consisting of the memory chemical master equations and memory stochastic simulation algorithm. A stochastic model for single-gene expression was proposed to illustrate the key function of memory reactions in inducing bursting dynamics of gene expression that has been observed in experiments recently. The importance of memory reactions has been further validated by the stochastic model of the p53-MDM2 core module. Simulations showed that memory reactions is a major mechanism for realizing both sustained oscillations of p53 protein numbers in single cells and damped oscillations over a population of cells. These successful applications of the memory modeling framework suggested that this innovative theory is an effective and powerful tool to study memory process and conditional chemical reactions in a wide range of complex biological systems.

  4. Entropy Generation in a Chemical Reaction

    Science.gov (United States)

    Miranda, E. N.

    2010-01-01

    Entropy generation in a chemical reaction is analysed without using the general formalism of non-equilibrium thermodynamics at a level adequate for advanced undergraduates. In a first approach to the problem, the phenomenological kinetic equation of an elementary first-order reaction is used to show that entropy production is always positive. A…

  5. An autonomous organic reaction search engine for chemical reactivity

    Science.gov (United States)

    Dragone, Vincenza; Sans, Victor; Henson, Alon B.; Granda, Jaroslaw M.; Cronin, Leroy

    2017-06-01

    The exploration of chemical space for new reactivity, reactions and molecules is limited by the need for separate work-up-separation steps searching for molecules rather than reactivity. Herein we present a system that can autonomously evaluate chemical reactivity within a network of 64 possible reaction combinations and aims for new reactivity, rather than a predefined set of targets. The robotic system combines chemical handling, in-line spectroscopy and real-time feedback and analysis with an algorithm that is able to distinguish and select the most reactive pathways, generating a reaction selection index (RSI) without need for separate work-up or purification steps. This allows the automatic navigation of a chemical network, leading to previously unreported molecules while needing only to do a fraction of the total possible reactions without any prior knowledge of the chemistry. We show the RSI correlates with reactivity and is able to search chemical space using the most reactive pathways.

  6. A cellular automata approach to chemical reactions : 1 reaction controlled systems

    NARCIS (Netherlands)

    Korte, de A.C.J.; Brouwers, H.J.H.

    2013-01-01

    A direct link between the chemical reaction controlled (shrinking core) model and cellular automata, to study the dissolution of particles, is derived in this paper. Previous research on first and second order reactions is based on the concentration of the reactant. The present paper describes the

  7. Modelling Chemical Reasoning to Predict and Invent Reactions.

    Science.gov (United States)

    Segler, Marwin H S; Waller, Mark P

    2017-05-02

    The ability to reason beyond established knowledge allows organic chemists to solve synthetic problems and invent novel transformations. Herein, we propose a model that mimics chemical reasoning, and formalises reaction prediction as finding missing links in a knowledge graph. We have constructed a knowledge graph containing 14.4 million molecules and 8.2 million binary reactions, which represents the bulk of all chemical reactions ever published in the scientific literature. Our model outperforms a rule-based expert system in the reaction prediction task for 180 000 randomly selected binary reactions. The data-driven model generalises even beyond known reaction types, and is thus capable of effectively (re-)discovering novel transformations (even including transition metal-catalysed reactions). Our model enables computers to infer hypotheses about reactivity and reactions by only considering the intrinsic local structure of the graph and because each single reaction prediction is typically achieved in a sub-second time frame, the model can be used as a high-throughput generator of reaction hypotheses for reaction discovery. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Chemical dynamics in the gas phase: Time-dependent quantum mechanics of chemical reactions

    Energy Technology Data Exchange (ETDEWEB)

    Gray, S.K. [Argonne National Laboratory, IL (United States)

    1993-12-01

    A major goal of this research is to obtain an understanding of the molecular reaction dynamics of three and four atom chemical reactions using numerically accurate quantum dynamics. This work involves: (i) the development and/or improvement of accurate quantum mechanical methods for the calculation and analysis of the properties of chemical reactions (e.g., rate constants and product distributions), and (ii) the determination of accurate dynamical results for selected chemical systems, which allow one to compare directly with experiment, determine the reliability of the underlying potential energy surfaces, and test the validity of approximate theories. This research emphasizes the use of recently developed time-dependent quantum mechanical methods, i.e. wave packet methods.

  9. A network dynamics approach to chemical reaction networks

    Science.gov (United States)

    van der Schaft, A. J.; Rao, S.; Jayawardhana, B.

    2016-04-01

    A treatment of a chemical reaction network theory is given from the perspective of nonlinear network dynamics, in particular of consensus dynamics. By starting from the complex-balanced assumption, the reaction dynamics governed by mass action kinetics can be rewritten into a form which allows for a very simple derivation of a number of key results in the chemical reaction network theory, and which directly relates to the thermodynamics and port-Hamiltonian formulation of the system. Central in this formulation is the definition of a balanced Laplacian matrix on the graph of chemical complexes together with a resulting fundamental inequality. This immediately leads to the characterisation of the set of equilibria and their stability. Furthermore, the assumption of complex balancedness is revisited from the point of view of Kirchhoff's matrix tree theorem. Both the form of the dynamics and the deduced behaviour are very similar to consensus dynamics, and provide additional perspectives to the latter. Finally, using the classical idea of extending the graph of chemical complexes by a 'zero' complex, a complete steady-state stability analysis of mass action kinetics reaction networks with constant inflows and mass action kinetics outflows is given, and a unified framework is provided for structure-preserving model reduction of this important class of open reaction networks.

  10. A Non-Isothermal Chemical Lattice Boltzmann Model Incorporating Thermal Reaction Kinetics and Enthalpy Changes

    Directory of Open Access Journals (Sweden)

    Stuart Bartlett

    2017-08-01

    Full Text Available The lattice Boltzmann method is an efficient computational fluid dynamics technique that can accurately model a broad range of complex systems. As well as single-phase fluids, it can simulate thermohydrodynamic systems and passive scalar advection. In recent years, it also gained attention as a means of simulating chemical phenomena, as interest in self-organization processes increased. This paper will present a widely-used and versatile lattice Boltzmann model that can simultaneously incorporate fluid dynamics, heat transfer, buoyancy-driven convection, passive scalar advection, chemical reactions and enthalpy changes. All of these effects interact in a physically accurate framework that is simple to code and readily parallelizable. As well as a complete description of the model equations, several example systems will be presented in order to demonstrate the accuracy and versatility of the method. New simulations, which analyzed the effect of a reversible reaction on the transport properties of a convecting fluid, will also be described in detail. This extra chemical degree of freedom was utilized by the system to augment its net heat flux. The numerical method outlined in this paper can be readily deployed for a vast range of complex flow problems, spanning a variety of scientific disciplines.

  11. Non-equilibrium effects in high temperature chemical reactions

    Science.gov (United States)

    Johnson, Richard E.

    1987-01-01

    Reaction rate data were collected for chemical reactions occurring at high temperatures during reentry of space vehicles. The principle of detailed balancing is used in modeling kinetics of chemical reactions at high temperatures. Although this principle does not hold for certain transient or incubation times in the initial phase of the reaction, it does seem to be valid for the rates of internal energy transitions that occur within molecules and atoms. That is, for every rate of transition within the internal energy states of atoms or molecules, there is an inverse rate that is related through an equilibrium expression involving the energy difference of the transition.

  12. The Electronic Flux in Chemical Reactions. Insights on the Mechanism of the Maillard Reaction

    Science.gov (United States)

    Flores, Patricio; Gutiérrez-Oliva, Soledad; Herrera, Bárbara; Silva, Eduardo; Toro-Labbé, Alejandro

    2007-11-01

    The electronic transfer that occurs during a chemical process is analysed in term of a new concept, the electronic flux, that allows characterizing the regions along the reaction coordinate where electron transfer is actually taking place. The electron flux is quantified through the variation of the electronic chemical potential with respect to the reaction coordinate and is used, together with the reaction force, to shed light on reaction mechanism of the Schiff base formation in the Maillard reaction. By partitioning the reaction coordinate in regions in which different process might be taking place, electronic reordering associated to polarization and transfer has been identified and found to be localized at specific transition state regions where most bond forming and breaking occur.

  13. Modular verification of chemical reaction network encodings via serializability analysis

    Science.gov (United States)

    Lakin, Matthew R.; Stefanovic, Darko; Phillips, Andrew

    2015-01-01

    Chemical reaction networks are a powerful means of specifying the intended behaviour of synthetic biochemical systems. A high-level formal specification, expressed as a chemical reaction network, may be compiled into a lower-level encoding, which can be directly implemented in wet chemistry and may itself be expressed as a chemical reaction network. Here we present conditions under which a lower-level encoding correctly emulates the sequential dynamics of a high-level chemical reaction network. We require that encodings are transactional, such that their execution is divided by a “commit reaction” that irreversibly separates the reactant-consuming phase of the encoding from the product-generating phase. We also impose restrictions on the sharing of species between reaction encodings, based on a notion of “extra tolerance”, which defines species that may be shared between encodings without enabling unwanted reactions. Our notion of correctness is serializability of interleaved reaction encodings, and if all reaction encodings satisfy our correctness properties then we can infer that the global dynamics of the system are correct. This allows us to infer correctness of any system constructed using verified encodings. As an example, we show how this approach may be used to verify two- and four-domain DNA strand displacement encodings of chemical reaction networks, and we generalize our result to the limit where the populations of helper species are unlimited. PMID:27325906

  14. Supramolecular Assembly of Comb-like Macromolecules Induced by Chemical Reactions that Modulate the Macromolecular Interactions In Situ.

    Science.gov (United States)

    Xia, Hongwei; Fu, Hailin; Zhang, Yanfeng; Shih, Kuo-Chih; Ren, Yuan; Anuganti, Murali; Nieh, Mu-Ping; Cheng, Jianjun; Lin, Yao

    2017-08-16

    Supramolecular polymerization or assembly of proteins or large macromolecular units by a homogeneous nucleation mechanism can be quite slow and require specific solution conditions. In nature, protein assembly is often regulated by molecules that modulate the electrostatic interactions of the protein subunits for various association strengths. The key to this regulation is the coupling of the assembly process with a reversible or irreversible chemical reaction that occurs within the constituent subunits. However, realizing this complex process by the rational design of synthetic molecules or macromolecules remains a challenge. Herein, we use a synthetic polypeptide-grafted comb macromolecule to demonstrate how the in situ modulation of interactions between the charged macromolecules affects their resulting supramolecular structures. The kinetics of structural formation was studied and can be described by a generalized model of nucleated polymerization containing secondary pathways. Basic thermodynamic analysis indicated the delicate role of the electrostatic interactions between the charged subunits in the reaction-induced assembly process. This approach may be applicable for assembling a variety of ionic soft matters that are amenable to chemical reactions in situ.

  15. Stochastic thermodynamics and entropy production of chemical reaction systems

    Science.gov (United States)

    Tomé, Tânia; de Oliveira, Mário J.

    2018-06-01

    We investigate the nonequilibrium stationary states of systems consisting of chemical reactions among molecules of several chemical species. To this end, we introduce and develop a stochastic formulation of nonequilibrium thermodynamics of chemical reaction systems based on a master equation defined on the space of microscopic chemical states and on appropriate definitions of entropy and entropy production. The system is in contact with a heat reservoir and is placed out of equilibrium by the contact with particle reservoirs. In our approach, the fluxes of various types, such as the heat and particle fluxes, play a fundamental role in characterizing the nonequilibrium chemical state. We show that the rate of entropy production in the stationary nonequilibrium state is a bilinear form in the affinities and the fluxes of reaction, which are expressed in terms of rate constants and transition rates, respectively. We also show how the description in terms of microscopic states can be reduced to a description in terms of the numbers of particles of each species, from which follows the chemical master equation. As an example, we calculate the rate of entropy production of the first and second Schlögl reaction models.

  16. Scattering theory and chemical reactions

    International Nuclear Information System (INIS)

    Kuppermann, A.

    1988-01-01

    In this course, scattering theory and chemical reactions are presented including scattering of one particle by a potential, n-particle systems, colinear triatomic molecules and the study of reactive scattering for 3-dimensional triatomic systems. (A.C.A.S.) [pt

  17. The Forward-Reverse Algorithm for Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian

    2015-01-07

    In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which we solve a set of deterministic optimization problems where the SRNs are replaced by the classical ODE rates; then, during the second phase, the Monte Carlo version of the EM algorithm is applied starting from the output of the previous phase. Starting from a set of over-dispersed seeds, the output of our two-phase method is a cluster of maximum likelihood estimates obtained by using convergence assessment techniques from the theory of Markov chain Monte Carlo.

  18. On the Complexity of Reconstructing Chemical Reaction Networks

    DEFF Research Database (Denmark)

    Fagerberg, Rolf; Flamm, Christoph; Merkle, Daniel

    2013-01-01

    The analysis of the structure of chemical reaction networks is crucial for a better understanding of chemical processes. Such networks are well described as hypergraphs. However, due to the available methods, analyses regarding network properties are typically made on standard graphs derived from...... the full hypergraph description, e.g. on the so-called species and reaction graphs. However, a reconstruction of the underlying hypergraph from these graphs is not necessarily unique. In this paper, we address the problem of reconstructing a hypergraph from its species and reaction graph and show NP...

  19. Reaction Mechanism Generator: Automatic construction of chemical kinetic mechanisms

    Science.gov (United States)

    Gao, Connie W.; Allen, Joshua W.; Green, William H.; West, Richard H.

    2016-06-01

    Reaction Mechanism Generator (RMG) constructs kinetic models composed of elementary chemical reaction steps using a general understanding of how molecules react. Species thermochemistry is estimated through Benson group additivity and reaction rate coefficients are estimated using a database of known rate rules and reaction templates. At its core, RMG relies on two fundamental data structures: graphs and trees. Graphs are used to represent chemical structures, and trees are used to represent thermodynamic and kinetic data. Models are generated using a rate-based algorithm which excludes species from the model based on reaction fluxes. RMG can generate reaction mechanisms for species involving carbon, hydrogen, oxygen, sulfur, and nitrogen. It also has capabilities for estimating transport and solvation properties, and it automatically computes pressure-dependent rate coefficients and identifies chemically-activated reaction paths. RMG is an object-oriented program written in Python, which provides a stable, robust programming architecture for developing an extensible and modular code base with a large suite of unit tests. Computationally intensive functions are cythonized for speed improvements.

  20. The Theory of Thermodynamics for Chemical Reactions in Dispersed Heterogeneous Systems

    Science.gov (United States)

    Yongqiang; Baojiao; Jianfeng

    1997-07-01

    In this paper, the expressions of Gibbs energy change, enthalpy change, entropy change, and equilibrium constant for chemical reactions in dispersed heterogeneous systems are derived using classical thermodynamics theory. The thermodynamical relations for the same reaction system between the dispersed and the block state are also derived. The effects of degree of dispersion on thermodynamical properties, reaction directions, and chemical equilibria are discussed. The results show that the present equation of thermodynamics for chemical reactions is only a special case of the above-mentioned formulas and that the effect of the dispersity of a heterogeneous system on the chemical reaction obeys the Le Chatelier principle of movement of equilibria.

  1. Laser-induced chemical vapor deposition reactions

    International Nuclear Information System (INIS)

    Teslenko, V.V.

    1990-01-01

    The results of investigation of chemical reactions of deposition of different substances from the gas phase when using the energy of pulse quasicontinuous and continuous radiation of lasers in the wave length interval from 0.193 to 10.6 μm are generalized. Main attetion is paid to deposition of inorganic substances including nonmetals (C, Si, Ge and others), metals (Cu, Au, Zn, Cd, Al, Cr, Mo, W, Ni) and some simple compounds. Experimental data on the effect of laser radiation parameters and reagent nature (hydrides, halogenides, carbonyls, alkyl organometallic compounds and others) on the deposition rate and deposit composition are described in detail. Specific features of laser-chemical reactions of deposition and prospects of their application are considered

  2. Chemical reactions directed Peptide self-assembly.

    Science.gov (United States)

    Rasale, Dnyaneshwar B; Das, Apurba K

    2015-05-13

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

  3. Supersonic molecular beam experiments on surface chemical reactions.

    Science.gov (United States)

    Okada, Michio

    2014-10-01

    The interaction of a molecule and a surface is important in various fields, and in particular in complex systems like biomaterials and their related chemistry. However, the detailed understanding of the elementary steps in the surface chemistry, for example, stereodynamics, is still insufficient even for simple model systems. In this Personal Account, I review our recent studies of chemical reactions on single-crystalline Cu and Si surfaces induced by hyperthermal oxygen molecular beams and by oriented molecular beams, respectively. Studies of oxide formation on Cu induced by hyperthermal molecular beams demonstrate a significant role of the translational energy of the incident molecules. The use of hyperthermal molecular beams enables us to open up new chemical reaction paths specific for the hyperthermal energy region, and to develop new methods for the fabrication of thin films. On the other hand, oriented molecular beams also demonstrate the possibility of understanding surface chemical reactions in detail by varying the orientation of the incident molecules. The steric effects found on Si surfaces hint at new ways of material fabrication on Si surfaces. Controlling the initial conditions of incoming molecules is a powerful tool for finely monitoring the elementary step of the surface chemical reactions and creating new materials on surfaces. Copyright © 2014 The Chemical Society of Japan and Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Surface chemical reactions induced by molecules electronically-excited in the gas

    DEFF Research Database (Denmark)

    Petrunin, Victor V.

    2011-01-01

    and alignment are taking place, guiding all the molecules towards the intersections with the ground state PES, where transitions to the ground state PES will occur with minimum energy dissipation. The accumulated kinetic energy may be used to overcome the chemical reaction barrier. While recombination chemical...... be readily produced. Products of chemical adsorption and/or chemical reactions induced within adsorbates are aggregated on the surface and observed by light scattering. We will demonstrate how pressure and spectral dependencies of the chemical outcomes, polarization of the light and interference of two laser...... beams inducing the reaction can be used to distinguish the new process we try to investigate from chemical reactions induced by photoexcitation within adsorbed molecules and/or gas phase photolysis....

  5. Calculation of the energetics of chemical reactions

    Energy Technology Data Exchange (ETDEWEB)

    Dunning, T.H. Jr.; Harding, L.B.; Shepard, R.L.; Harrison, R.J.

    1988-01-01

    To calculate the energetics of chemical reactions we must solve the electronic Schroedinger equation for the molecular conformations of importance for the reactive encounter. Substantial changes occur in the electronic structure of a molecular system as the reaction progresses from reactants through the transition state to products. To describe these changes, our approach includes the following three elements: the use of multiconfiguration self-consistent field wave functions to provide a consistent zero-order description of the electronic structure of the reactants, transition state, and products; the use of configuration interaction techniques to describe electron correlation effects needed to provide quantitative predictions of the reaction energetics; and the use of large, optimized basis sets to provide the flexibility needed to describe the variations in the electronic distributions. With this approach we are able to study reactions involving as many as 5--6 atoms with errors of just a few kcal/mol in the predicted reaction energetics. Predictions to chemical accuracy, i.e., to 1 kcal/mol or less, are not yet feasible, although continuing improvements in both the theoretical methodology and computer technology suggest that this will soon be possible, at least for reactions involving small polyatomic species. 4 figs.

  6. Lagrangian descriptors of driven chemical reaction manifolds.

    Science.gov (United States)

    Craven, Galen T; Junginger, Andrej; Hernandez, Rigoberto

    2017-08-01

    The persistence of a transition state structure in systems driven by time-dependent environments allows the application of modern reaction rate theories to solution-phase and nonequilibrium chemical reactions. However, identifying this structure is problematic in driven systems and has been limited by theories built on series expansion about a saddle point. Recently, it has been shown that to obtain formally exact rates for reactions in thermal environments, a transition state trajectory must be constructed. Here, using optimized Lagrangian descriptors [G. T. Craven and R. Hernandez, Phys. Rev. Lett. 115, 148301 (2015)PRLTAO0031-900710.1103/PhysRevLett.115.148301], we obtain this so-called distinguished trajectory and the associated moving reaction manifolds on model energy surfaces subject to various driving and dissipative conditions. In particular, we demonstrate that this is exact for harmonic barriers in one dimension and this verification gives impetus to the application of Lagrangian descriptor-based methods in diverse classes of chemical reactions. The development of these objects is paramount in the theory of reaction dynamics as the transition state structure and its underlying network of manifolds directly dictate reactivity and selectivity.

  7. Transport Properties of a Kinetic Model for Chemical Reactions without Barriers

    International Nuclear Information System (INIS)

    Alves, Giselle M.; Kremer, Gilberto M.; Soares, Ana Jacinta

    2011-01-01

    A kinetic model of the Boltzmann equation for chemical reactions without energy barrier is considered here with the aim of evaluating the reaction rate and characterizing the transport coefficient of shear viscosity for the reactive system. The Chapman-Enskog solution of the Boltzmann equation is used to compute the chemical reaction effects, in a flow regime for which the reaction process is close to the final equilibrium state. Some numerical results are provided illustrating that the considered chemical reaction without energy barrier can induce an appreciable influence on the reaction rate and on the transport coefficient of shear viscosity.

  8. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  9. Molecular dynamics simulation of a chemical reaction

    International Nuclear Information System (INIS)

    Gorecki, J.; Gryko, J.

    1988-06-01

    Molecular dynamics is used to study the chemical reaction A+A→B+B. It is shown that the reaction rate constant follows the Arrhenius law both for Lennard-Jones and hard sphere interaction potentials between substrate particles. A. For the denser systems the reaction rate is proportional to the value of the radial distribution function at the contact point of two hard spheres. 10 refs, 4 figs

  10. Molecular codes in biological and chemical reaction networks.

    Directory of Open Access Journals (Sweden)

    Dennis Görlich

    Full Text Available Shannon's theory of communication has been very successfully applied for the analysis of biological information. However, the theory neglects semantic and pragmatic aspects and thus cannot directly be applied to distinguish between (bio- chemical systems able to process "meaningful" information from those that do not. Here, we present a formal method to assess a system's semantic capacity by analyzing a reaction network's capability to implement molecular codes. We analyzed models of chemical systems (martian atmosphere chemistry and various combustion chemistries, biochemical systems (gene expression, gene translation, and phosphorylation signaling cascades, an artificial chemistry, and random reaction networks. Our study suggests that different chemical systems possess different semantic capacities. No semantic capacity was found in the model of the martian atmosphere chemistry, the studied combustion chemistries, and highly connected random networks, i.e. with these chemistries molecular codes cannot be implemented. High semantic capacity was found in the studied biochemical systems and in random reaction networks where the number of second order reactions is twice the number of species. We conclude that our approach can be applied to evaluate the information processing capabilities of a chemical system and may thus be a useful tool to understand the origin and evolution of meaningful information, e.g. in the context of the origin of life.

  11. Chemical Demonstrations with Consumer Chemicals: The Black and White Reaction

    Science.gov (United States)

    Wright, Stephen W.

    2002-01-01

    A color-change reaction is described in which two colorless solutions are combined to afford a black mixture. Two more colorless solutions are combined to afford a white mixture. The black and white mixtures are then combined to afford a clear, colorless solution. The reaction uses chemicals that are readily available on the retail market: vitamin C, tincture of iodine, vinegar, ammonia, bleach, Epsom salt, and laundry starch.

  12. MRI of chemical reactions and processes.

    Science.gov (United States)

    Britton, Melanie M

    2017-08-01

    As magnetic resonance imaging (MRI) can spatially resolve a wealth of molecular information available from nuclear magnetic resonance (NMR), it is able to non-invasively visualise the composition, properties and reactions of a broad range of spatially-heterogeneous molecular systems. Hence, MRI is increasingly finding applications in the study of chemical reactions and processes in a diverse range of environments and technologies. This article will explain the basic principles of MRI and how it can be used to visualise chemical composition and molecular properties, providing an overview of the variety of information available. Examples are drawn from the disciplines of chemistry, chemical engineering, environmental science, physics, electrochemistry and materials science. The review introduces a range of techniques used to produce image contrast, along with the chemical and molecular insight accessible through them. Methods for mapping the distribution of chemical species, using chemical shift imaging or spatially-resolved spectroscopy, are reviewed, as well as methods for visualising physical state, temperature, current density, flow velocities and molecular diffusion. Strategies for imaging materials with low signal intensity, such as those containing gases or low sensitivity nuclei, using compressed sensing, para-hydrogen or polarisation transfer, are discussed. Systems are presented which encapsulate the diversity of chemical and physical parameters observable by MRI, including one- and two-phase flow in porous media, chemical pattern formation, phase transformations and hydrodynamic (fingering) instabilities. Lastly, the emerging area of electrochemical MRI is discussed, with studies presented on the visualisation of electrochemical deposition and dissolution processes during corrosion and the operation of batteries, supercapacitors and fuel cells. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  13. Analysis of activation energy in Couette-Poiseuille flow of nanofluid in the presence of chemical reaction and convective boundary conditions

    Science.gov (United States)

    Zeeshan, A.; Shehzad, N.; Ellahi, R.

    2018-03-01

    The motivation of the current article is to explore the energy activation in MHD radiative Couette-Poiseuille flow nanofluid in horizontal channel with convective boundary conditions. The mathematical model of Buongiorno [1] effectively describes the current flow analysis. Additionally, the impact of chemical reaction is also taken in account. The governing flow equations are simplified with the help of boundary layer approximations. Non-linear coupled equations for momentum, energy and mass transfer are tackled with analytical (HAM) technique. The influence of dimensionless convergence parameter like Brownian motion parameter, radiation parameter, buoyancy ratio parameter, dimensionless activation energy, thermophoresis parameter, temperature difference parameter, dimensionless reaction rate, Schmidt number, Brinkman number, Biot number and convection diffusion parameter on velocity, temperature and concentration profiles are discussed graphically and in tabular form. From the results, it is elaborate that the nanoparticle concentration is directly proportional to the chemical reaction with activation energy and the performance of Brownian motion on nanoparticle concentration gives reverse pattern to that of thermophoresis parameter.

  14. Modeling Electric Double-Layers Including Chemical Reaction Effects

    DEFF Research Database (Denmark)

    Paz-Garcia, Juan Manuel; Johannesson, Björn; Ottosen, Lisbeth M.

    2014-01-01

    A physicochemical and numerical model for the transient formation of an electric double-layer between an electrolyte and a chemically-active flat surface is presented, based on a finite elements integration of the nonlinear Nernst-Planck-Poisson model including chemical reactions. The model works...... for symmetric and asymmetric multi-species electrolytes and is not limited to a range of surface potentials. Numerical simulations are presented, for the case of a CaCO3 electrolyte solution in contact with a surface with rate-controlled protonation/deprotonation reactions. The surface charge and potential...... are determined by the surface reactions, and therefore they depends on the bulk solution composition and concentration...

  15. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  16. Non-allergic cutaneous reactions in airborne chemical sensitivity--a population based study

    DEFF Research Database (Denmark)

    Berg, Nikolaj Drimer; Linneberg, Allan; Thyssen, Jacob Pontoppidan

    2011-01-01

    the relationship between cutaneous reactions from patch testing and self-reported severity of chemical sensitivity to common airborne chemicals. A total of 3460 individuals participating in a general health examination, Health 2006, were patch tested with allergens from the European standard series and screened...... for chemical sensitivity with a standardised questionnaire dividing the participants into four severity groups of chemical sensitivity. Both allergic and non-allergic cutaneous reactions--defined as irritative, follicular, or doubtful allergic reactions--were analysed in relationship with severity of chemical...... most severe groups of self-reported sensitivity to airborne chemicals. When adjusting for confounding, associations were weakened, and only non-allergic cutaneous reactions were significantly associated with individuals most severely affected by inhalation of airborne chemicals (odds ratio = 2.5, p = 0...

  17. Communication: Control of chemical reactions using electric field gradients

    Energy Technology Data Exchange (ETDEWEB)

    Deshmukh, Shivaraj D.; Tsori, Yoav, E-mail: tsori@bgu.ac.il [Department of Chemical Engineering, Ben-Gurion University of the Negev, Beer-Sheva 84105 (Israel)

    2016-05-21

    We examine theoretically a new idea for spatial and temporal control of chemical reactions. When chemical reactions take place in a mixture of solvents, an external electric field can alter the local mixture composition, thereby accelerating or decelerating the rate of reaction. The spatial distribution of electric field strength can be non-trivial and depends on the arrangement of the electrodes producing it. In the absence of electric field, the mixture is homogeneous and the reaction takes place uniformly in the reactor volume. When an electric field is applied, the solvents separate and the reactants are concentrated in the same phase or separate to different phases, depending on their relative miscibility in the solvents, and this can have a large effect on the kinetics of the reaction. This method could provide an alternative way to control runaway reactions and to increase the reaction rate without using catalysts.

  18. Communication: Control of chemical reactions using electric field gradients.

    Science.gov (United States)

    Deshmukh, Shivaraj D; Tsori, Yoav

    2016-05-21

    We examine theoretically a new idea for spatial and temporal control of chemical reactions. When chemical reactions take place in a mixture of solvents, an external electric field can alter the local mixture composition, thereby accelerating or decelerating the rate of reaction. The spatial distribution of electric field strength can be non-trivial and depends on the arrangement of the electrodes producing it. In the absence of electric field, the mixture is homogeneous and the reaction takes place uniformly in the reactor volume. When an electric field is applied, the solvents separate and the reactants are concentrated in the same phase or separate to different phases, depending on their relative miscibility in the solvents, and this can have a large effect on the kinetics of the reaction. This method could provide an alternative way to control runaway reactions and to increase the reaction rate without using catalysts.

  19. Development of Green and Sustainable Chemical Reactions

    DEFF Research Database (Denmark)

    Taarning, Esben

    Abstract This thesis entitled Development of Green and Sustainable Chemical Reactions is divided into six chapters involving topics and projects related to green and sustainable chemistry. The chapters can be read independently, however a few concepts and some background information is introduced...... as well as the possibility for establishing a renewable chemical industry is discussed. The development of a procedure for using unsaturated aldehydes as olefin synthons in the Diels- Alder reaction is described in chapter three. This procedure affords good yields of the desired Diels- Alder adducts...... in chapter one and two which can be helpful to know when reading the subsequent chapters. The first chapter is an introduction into the fundamentals of green and sustainable chemistry. The second chapter gives an overview of some of the most promising methods to produce value added chemicals from biomass...

  20. On the ambiguity of the reaction rate constants in multivariate curve resolution for reversible first-order reaction systems.

    Science.gov (United States)

    Schröder, Henning; Sawall, Mathias; Kubis, Christoph; Selent, Detlef; Hess, Dieter; Franke, Robert; Börner, Armin; Neymeyr, Klaus

    2016-07-13

    If for a chemical reaction with a known reaction mechanism the concentration profiles are accessible only for certain species, e.g. only for the main product, then often the reaction rate constants cannot uniquely be determined from the concentration data. This is a well-known fact which includes the so-called slow-fast ambiguity. This work combines the question of unique or non-unique reaction rate constants with factor analytic methods of chemometrics. The idea is to reduce the rotational ambiguity of pure component factorizations by considering only those concentration factors which are possible solutions of the kinetic equations for a properly adapted set of reaction rate constants. The resulting set of reaction rate constants corresponds to those solutions of the rate equations which appear as feasible factors in a pure component factorization. The new analysis of the ambiguity of reaction rate constants extends recent research activities on the Area of Feasible Solutions (AFS). The consistency with a given chemical reaction scheme is shown to be a valuable tool in order to reduce the AFS. The new methods are applied to model and experimental data. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Enrichment: CRISLA [chemical reaction by isotope selective activation] aims to reduce costs

    International Nuclear Information System (INIS)

    Eerkens, J.W.

    1989-01-01

    Every year, more than $3 billion is spent on enriching uranium. CRISLA (Chemical Reaction by Isotope Selective Activation) uses a laser-catalyzed chemical reaction which, its proponents claim, could substantially reduce these costs. In CRISLA, an infrared CO laser illuminates the intracavity reaction cell (IC) at a frequency tuned to excite primarily UF 6 . When UF 6 and co-reactant RX are passed through the IC, the tuned laser photons preferentially enhance the reaction of UF 6 with RX ten-thousand-fold over the thermal reaction rate. Thus the laser serves as an activator and the chemical energy for separation is largely chemical. (author)

  2. Chemical modeling of irreversible reactions in nuclear waste-water-rock systems

    International Nuclear Information System (INIS)

    Wolery, T.J.

    1981-02-01

    Chemical models of aqueous geochemical systems are usually built on the concept of thermodynamic equilibrium. Though many elementary reactions in a geochemical system may be close to equilibrium, others may not be. Chemical models of aqueous fluids should take into account that many aqueous redox reactions are among the latter. The behavior of redox reactions may critically affect migration of certain radionuclides, especially the actinides. In addition, the progress of reaction in geochemical systems requires thermodynamic driving forces associated with elementary reactions not at equilibrium, which are termed irreversible reactions. Both static chemical models of fluids and dynamic models of reacting systems have been applied to a wide spectrum of problems in water-rock interactions. Potential applications in nuclear waste disposal range from problems in geochemical aspects of site evaluation to those of waste-water-rock interactions. However, much further work in the laboratory and the field will be required to develop and verify such applications of chemical modeling

  3. Effect of chemical reaction on unsteady MHD free convective two ...

    African Journals Online (AJOL)

    The effect of flow parameters on the coefficient of skin friction, Nusselt number and Sherwood number are also tabulated and discussed appropriately. It was observed that the increase in chemical reaction coefficient/parameter suppresses both velocity and concentration profiles. Keywords: Chemical Reaction, MHD, ...

  4. Non-allergic cutaneous reactions in airborne chemical sensitivity--a population based study.

    Science.gov (United States)

    Berg, Nikolaj Drimer; Linneberg, Allan; Thyssen, Jacob Pontoppidan; Dirksen, Asger; Elberling, Jesper

    2011-06-01

    Multiple chemical sensitivity (MCS) is characterised by adverse effects due to exposure to low levels of chemical substances. The aetiology is unknown, but chemical related respiratory symptoms have been found associated with positive patch test. The purpose of this study was to investigate the relationship between cutaneous reactions from patch testing and self-reported severity of chemical sensitivity to common airborne chemicals. A total of 3460 individuals participating in a general health examination, Health 2006, were patch tested with allergens from the European standard series and screened for chemical sensitivity with a standardised questionnaire dividing the participants into four severity groups of chemical sensitivity. Both allergic and non-allergic cutaneous reactions--defined as irritative, follicular, or doubtful allergic reactions--were analysed in relationship with severity of chemical sensitivity. Associations were controlled for the possible confounding effects of sex, age, asthma, eczema, atopic dermatitis, psychological and social factors, and smoking habits. In unadjusted analyses we found associations between allergic and non-allergic cutaneous reactions on patch testing and the two most severe groups of self-reported sensitivity to airborne chemicals. When adjusting for confounding, associations were weakened, and only non-allergic cutaneous reactions were significantly associated with individuals most severely affected by inhalation of airborne chemicals (odds ratio = 2.5, p = 0.006). Our results suggest that individuals with self-reported chemical sensitivity show increased non-allergic cutaneous reactions based on day 2 readings of patch tests. Copyright © 2011 Elsevier GmbH. All rights reserved.

  5. Depressurization accident analysis of MPBR by PBRSIM with chemical reaction model

    International Nuclear Information System (INIS)

    No, Hee Cheon; Kadak, A. C.

    2002-01-01

    The simple model for natural circulation is implemented into PBR S IM to provide air inlet velocity from the containment air space. For the friction and form loss only the pebble region is considered conservatively modeling laminar flow through a packed bed. For the chemical reaction model of PBR S IM the oxidation rate is determined as the minimum value of three mechanisms estimated at each time step: oxygen mass flow rate entering the bottom of the reflector, oxidation rate by kinetics, and oxygen mass flow rate arriving at the graphite surface by diffusion. Oxygen mass flux arriving at the graphite surface by diffusion is estimated based on energy-mass analogy. Two types of exothermic chemical reaction are considered: (C + zO 2 → xCO + yCO 2 ) and (2CO + O 2 2CO 2 ). The heterogeneous and homogeneous chemical reaction rates by kinetics are determined by INEEL and Bruno correlations, respectively. The instantaneous depressurization accident of MPBR is simulated using PBR S IM with chemical model. The air inlet velocity is initially rapidly dropped within 10 hr and reaches a saturation value of about 1.5cm/s. The oxidation rate by the diffusion process becomes lower than that by the chemical kinetics above 600K. The maximum pebble bed temperatures without and with chemical reaction reach the peak values of 1560 and 1617 .deg. C at 80 hr and 92 hr, respectively. As the averaged temperatures in the bottom reflector and the pebble bed regions increase with time, (C+1/2O2 ->CO) reaction becomes dominant over (C+O 2 →CO 2 ) reaction. Also, the CO generated by (C+1/2O 2 →CO) reaction will be consumed by (2CO+O 2 →2CO 2 ) reaction and the energy homogeneously generated by this CO depletion reaction becomes dominant over the heterogeneous reaction

  6. Raman Spectral Determination of Chemical Reaction Rate Characteristics

    Science.gov (United States)

    Balakhnina, I. A.; Brandt, N. N.; Mankova, A. A.; Chikishev, A. Yu.; Shpachenko, I. G.

    2017-09-01

    The feasibility of using Raman spectroscopy to determine chemical reaction rates and activation energies has been demonstrated for the saponification of ethyl acetate. The temperature dependence of the reaction rate was found in the range from 15 to 45°C.

  7. Microbial reverse-electrodialysis chemical-production cell for acid and alkali production

    KAUST Repository

    Zhu, Xiuping; Hatzell, Marta C.; Cusick, Roland D.; Logan, Bruce E.

    2013-01-01

    A new type of bioelectrochemical system, called a microbial reverse-electrodialysis chemical-production cell (MRCC), was developed to produce acid and alkali using energy derived from organic matter (acetate) and salinity gradients (NaCl solutions

  8. Quantum chemical approach to estimating the thermodynamics of metabolic reactions.

    Science.gov (United States)

    Jinich, Adrian; Rappoport, Dmitrij; Dunn, Ian; Sanchez-Lengeling, Benjamin; Olivares-Amaya, Roberto; Noor, Elad; Even, Arren Bar; Aspuru-Guzik, Alán

    2014-11-12

    Thermodynamics plays an increasingly important role in modeling and engineering metabolism. We present the first nonempirical computational method for estimating standard Gibbs reaction energies of metabolic reactions based on quantum chemistry, which can help fill in the gaps in the existing thermodynamic data. When applied to a test set of reactions from core metabolism, the quantum chemical approach is comparable in accuracy to group contribution methods for isomerization and group transfer reactions and for reactions not including multiply charged anions. The errors in standard Gibbs reaction energy estimates are correlated with the charges of the participating molecules. The quantum chemical approach is amenable to systematic improvements and holds potential for providing thermodynamic data for all of metabolism.

  9. Conservation-dissipation structure of chemical reaction systems.

    Science.gov (United States)

    Yong, Wen-An

    2012-12-01

    In this Brief Report, we show that balanced chemical reaction systems governed by the law of mass action have an elegant conservation-dissipation structure. From this structure a number of important conclusions can be easily deduced. In particular, with the help of this structure we can rigorously justify the classical partial equilibrium approximation in chemical kinetics.

  10. Systematic trends in photonic reagent induced reactions in a homologous chemical family.

    Science.gov (United States)

    Tibbetts, Katharine Moore; Xing, Xi; Rabitz, Herschel

    2013-08-29

    The growing use of ultrafast laser pulses to induce chemical reactions prompts consideration of these pulses as "photonic reagents" in analogy to chemical reagents. This work explores the prospect that photonic reagents may affect systematic trends in dissociative ionization reactions of a homologous family of halomethanes, much as systematic outcomes are often observed for reactions between homologous families of chemical reagents and chemical substrates. The experiments in this work with photonic reagents of varying pulse energy and linear spectral chirp reveal systematic correlations between observable ion yields and the following set of natural variables describing the substrate molecules: the ionization energy of the parent molecule, the appearance energy of each fragment ion, and the relative strength of carbon-halogen bonds in molecules containing two different halogens. The results suggest that reactions induced by photonic reagents exhibit systematic behavior analogous to that observed in reactions driven by chemical reagents, which provides a basis to consider empirical "rules" for predicting the outcomes of photonic reagent induced reactions.

  11. An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

    2016-01-01

    In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem

  12. Thermo effect of chemical reaction in irreversible electrochemical systems

    International Nuclear Information System (INIS)

    Tran Vinh Quy; Nguyen Tang

    1989-01-01

    From first law of thermodynamics the expressions of statistical calculation of 'Fundamental' and 'Thermo-chemical' thermal effects are obtained. Besides, method of calculation of thermal effect of chemical reactions in non-equilibrium electro-chemical systems is accurately discussed. (author). 7 refs

  13. Waste dissolution with chemical reaction, diffusion and advection

    International Nuclear Information System (INIS)

    Chambre, P.L.; Kang, C.H.; Lee, W.W.L.; Pigford, T.H.

    1987-06-01

    This paper extends the mass-transfer analysis to include the effect of advective transport in predicting the steady-state dissolution rate, with a chemical-reaction-rate boundary condition at the surface of a waste form of arbitrary shape. This new theory provides an analytic means of predicting the ground-water velocities at which dissolution rate in a geologic environment will be governed entirely to the chemical reaction rate. As an illustration, we consider the steady-state potential flow of ground water in porous rock surrounding a spherical waste solid. 3 refs., 2 figs

  14. Formal modeling of a system of chemical reactions under uncertainty.

    Science.gov (United States)

    Ghosh, Krishnendu; Schlipf, John

    2014-10-01

    We describe a novel formalism representing a system of chemical reactions, with imprecise rates of reactions and concentrations of chemicals, and describe a model reduction method, pruning, based on the chemical properties. We present two algorithms, midpoint approximation and interval approximation, for construction of efficient model abstractions with uncertainty in data. We evaluate computational feasibility by posing queries in computation tree logic (CTL) on a prototype of extracellular-signal-regulated kinase (ERK) pathway.

  15. Computational prediction of chemical reactions: current status and outlook.

    Science.gov (United States)

    Engkvist, Ola; Norrby, Per-Ola; Selmi, Nidhal; Lam, Yu-Hong; Peng, Zhengwei; Sherer, Edward C; Amberg, Willi; Erhard, Thomas; Smyth, Lynette A

    2018-06-01

    Over the past few decades, various computational methods have become increasingly important for discovering and developing novel drugs. Computational prediction of chemical reactions is a key part of an efficient drug discovery process. In this review, we discuss important parts of this field, with a focus on utilizing reaction data to build predictive models, the existing programs for synthesis prediction, and usage of quantum mechanics and molecular mechanics (QM/MM) to explore chemical reactions. We also outline potential future developments with an emphasis on pre-competitive collaboration opportunities. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Electronic dissipation processes during chemical reactions on surfaces

    CERN Document Server

    Stella, Kevin

    2012-01-01

    Hauptbeschreibung Every day in our life is larded with a huge number of chemical reactions on surfaces. Some reactions occur immediately, for others an activation energy has to be supplied. Thus it happens that though a reaction should thermodynamically run off, it is kinetically hindered. Meaning the partners react only to the thermodynamically more stable product state within a mentionable time if the activation energy of the reaction is supplied. With the help of catalysts the activation energy of a reaction can be lowered. Such catalytic processes on surfaces are widely used in industry. A

  17. Sintering with a chemical reaction as applied to uranium monocarbide

    International Nuclear Information System (INIS)

    Accary, A.; Caillat, R.

    1960-01-01

    The present paper provides a survey of different investigations whose aim was the preparation and fabrication of uranium monocarbide for nuclear use. If a chemical reaction takes place in the sample during the sintering operation, it may be expected that the atom rearrangements involved in this reaction should favour the sintering process and thereby lower the temperature needed to yield a body of a given density. With this hypothesis in mind, the following methods have been studied: - Sintering of U-C mixtures; - Sintering of UO 2 -C mixtures; - Hot pressing of U-C mixtures; - Extrusion of U-C mixtures. To generalize our result, it could be said that a chemical reaction does not lead to high densification, if one depends on a simple contact between discrete particles. On the contrary, a chemical reaction can help sintering if, as our hot pressing experiments shows, the densification can be achieved prior to the reaction. (author) [fr

  18. Reaction path analysis of sodium-water reaction phenomena in support of chemical reaction model development

    International Nuclear Information System (INIS)

    Kikuchi, Shin; Ohshima, Hiroyuki; Hashimoto, Kenro

    2011-01-01

    Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule to the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. The results are used as the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by JAEA toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR). (author)

  19. Minimum Energy Pathways for Chemical Reactions

    Science.gov (United States)

    Walch, S. P.; Langhoff, S. R. (Technical Monitor)

    1995-01-01

    Computed potential energy surfaces are often required for computation of such parameters as rate constants as a function of temperature, product branching ratios, and other detailed properties. We have found that computation of the stationary points/reaction pathways using CASSCF/derivative methods, followed by use of the internally contracted CI method to obtain accurate energetics, gives useful results for a number of chemically important systems. The talk will focus on a number of applications to reactions leading to NOx and soot formation in hydrocarbon combustion.

  20. Theoretical studies of chemical reaction dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Schatz, G.C. [Argonne National Laboratory, IL (United States)

    1993-12-01

    This collaborative program with the Theoretical Chemistry Group at Argonne involves theoretical studies of gas phase chemical reactions and related energy transfer and photodissociation processes. Many of the reactions studied are of direct relevance to combustion; others are selected they provide important examples of special dynamical processes, or are of relevance to experimental measurements. Both classical trajectory and quantum reactive scattering methods are used for these studies, and the types of information determined range from thermal rate constants to state to state differential cross sections.

  1. A Data-Driven Sparse-Learning Approach to Model Reduction in Chemical Reaction Networks

    OpenAIRE

    Harirchi, Farshad; Khalil, Omar A.; Liu, Sijia; Elvati, Paolo; Violi, Angela; Hero, Alfred O.

    2017-01-01

    In this paper, we propose an optimization-based sparse learning approach to identify the set of most influential reactions in a chemical reaction network. This reduced set of reactions is then employed to construct a reduced chemical reaction mechanism, which is relevant to chemical interaction network modeling. The problem of identifying influential reactions is first formulated as a mixed-integer quadratic program, and then a relaxation method is leveraged to reduce the computational comple...

  2. A network dynamics approach to chemical reaction networks

    NARCIS (Netherlands)

    van der Schaft, Abraham; Rao, S.; Jayawardhana, B.

    2016-01-01

    A treatment of chemical reaction network theory is given from the perspective of nonlinear network dynamics, in particular of consensus dynamics. By starting from the complex-balanced assumption the reaction dynamics governed by mass action kinetics can be rewritten into a form which allows for a

  3. Non-stationary filtration mode during chemical reactions with the gas phase

    Science.gov (United States)

    Zavialov, Ivan; Konyukhov, Andrey; Negodyaev, Sergey

    2015-04-01

    An experimental and numerical study of filtration accompanied by chemical reactions between displacing fluid and solid skeleton is considered. Glass balls (400-500 μm in diameter) were placed in 1 cm gap between two glass sheets and were used as model porous medium. The baking soda was added to the glass balls. The 70% solution of acetic acid was used as the displacer. The modeling porous medium was saturated with a mineral oil, and then 70% solution of colored acetic acid was pumped through the medium. The glass balls and a mineral oil have a similar refractive index, so the model porous medium was optically transparent. During the filtration, the gas phase was generated by the chemical reactions between the baking soda and acetic acid, and time-dependent displacement of the chemical reaction front was observed. The front of the chemical reaction was associated with the most intensive gas separation. The front moved, stopped, and then moved again to the area where it had been already. We called this process a secondary oxidation wave. To describe this effect, we added to the balance equations a term associated with the formation and disappearance of phases due to chemical reactions. The equations were supplemented by Darcy's law for multiphase filtration. Nonstationarity front propagation of the chemical reaction in the numerical experiment was observed at Damköhler numbers greater than 100. The mathematical modelling was agreed well with the experimental results.

  4. Strain-induced structural changes and chemical reactions. 1: Thermomechanical and kinetic models

    International Nuclear Information System (INIS)

    Levitas, V.I.; Nesterenko, V.F.; Meyers, M.A.

    1998-01-01

    Strain-induced chemical reactions were observed recently (Nesterenko et al) in experiments in the shear band in both Ti-Si and Nb-Si mixtures. Reactions can start in the solid state or after melting of at least one component. One of the aims is to find theoretically whether there are possible macroscopic mechanisms of mechanical intensification of the above and other chemical reactions due to plastic shear in the solid state. Continuum thermodynamical theory of structural changes with an athermal kinetics, which includes martensitic phase transformations, plastic strain-induced chemical reactions and polymorphic transformations, is developed at finite strains. The theory includes kinematics, criterion of structural change and extremum principle for determination of all unknown variable parameters for the case with neglected elastic strains. Thermodynamically consistent kinetic theory of thermally activated structural changes is suggested. The concept of the effective temperature is introduced which takes into account that temperature can vary significantly (on 1,000 K) during the chemical reactions under consideration. The theory will be applied in Part 2 of the paper for the description of chemical reactions in the shear band

  5. A reaction-based paradigm to model reactive chemical transport in groundwater with general kinetic and equilibrium reactions

    International Nuclear Information System (INIS)

    Zhang, Fan; Yeh, Gour-Tsyh; Parker, Jack C.; Brooks, Scott C; Pace, Molly; Kim, Young Jin; Jardine, Philip M.; Watson, David B.

    2007-01-01

    This paper presents a reaction-based water quality transport model in subsurface flow systems. Transport of chemical species with a variety of chemical and physical processes is mathematically described by M. partial differential equations (PDEs). Decomposition via Gauss-Jordan column reduction of the reaction network transforms M. species reactive transport equations into two sets of equations: a set of thermodynamic equilibrium equations representing NE equilibrium reactions and a set of reactive transport equations of M-NE kinetic-variables involving no equilibrium reactions (a kinetic-variable is a linear combination of species). The elimination of equilibrium reactions from reactive transport equations allows robust and efficient numerical integration. The model solves the PDEs of kinetic-variables rather than individual chemical species, which reduces the number of reactive transport equations and simplifies the reaction terms in the equations. A variety of numerical methods are investigated for solving the coupled transport and reaction equations. Simulation comparisons with exact solutions were performed to verify numerical accuracy and assess the effectiveness of various numerical strategies to deal with different application circumstances. Two validation examples involving simulations of uranium transport in soil columns are presented to evaluate the ability of the model to simulate reactive transport with complex reaction networks involving both kinetic and equilibrium reactions

  6. A reaction-based paradigm to model reactive chemical transport in groundwater with general kinetic and equilibrium reactions.

    Science.gov (United States)

    Zhang, Fan; Yeh, Gour-Tsyh; Parker, Jack C; Brooks, Scott C; Pace, Molly N; Kim, Young-Jin; Jardine, Philip M; Watson, David B

    2007-06-16

    This paper presents a reaction-based water quality transport model in subsurface flow systems. Transport of chemical species with a variety of chemical and physical processes is mathematically described by M partial differential equations (PDEs). Decomposition via Gauss-Jordan column reduction of the reaction network transforms M species reactive transport equations into two sets of equations: a set of thermodynamic equilibrium equations representing N(E) equilibrium reactions and a set of reactive transport equations of M-N(E) kinetic-variables involving no equilibrium reactions (a kinetic-variable is a linear combination of species). The elimination of equilibrium reactions from reactive transport equations allows robust and efficient numerical integration. The model solves the PDEs of kinetic-variables rather than individual chemical species, which reduces the number of reactive transport equations and simplifies the reaction terms in the equations. A variety of numerical methods are investigated for solving the coupled transport and reaction equations. Simulation comparisons with exact solutions were performed to verify numerical accuracy and assess the effectiveness of various numerical strategies to deal with different application circumstances. Two validation examples involving simulations of uranium transport in soil columns are presented to evaluate the ability of the model to simulate reactive transport with complex reaction networks involving both kinetic and equilibrium reactions.

  7. BGK-type models in strong reaction and kinetic chemical equilibrium regimes

    International Nuclear Information System (INIS)

    Monaco, R; Bianchi, M Pandolfi; Soares, A J

    2005-01-01

    A BGK-type procedure is applied to multi-component gases undergoing chemical reactions of bimolecular type. The relaxation process towards local Maxwellians, depending on mass and numerical densities of each species as well as common velocity and temperature, is investigated in two different cases with respect to chemical regimes. These cases are related to the strong reaction regime characterized by slow reactions, and to the kinetic chemical equilibrium regime where fast reactions take place. The consistency properties of both models are stated in detail. The trend to equilibrium is numerically tested and comparisons for the two regimes are performed within the hydrogen-air and carbon-oxygen reaction mechanism. In the spatial homogeneous case, it is also shown that the thermodynamical equilibrium of the models recovers satisfactorily the asymptotic equilibrium solutions to the reactive Euler equations

  8. Femtosecond laser control of chemical reaction of carbon monoxide and hydrogen

    CSIR Research Space (South Africa)

    Du Plessis, A

    2010-09-01

    Full Text Available Femtosecond laser control of chemical reactions is made possible through the use of pulse-shaping techniques coupled to a learning algorithm feedback loop – teaching the laser pulse to control the chemical reaction. This can result in controllable...

  9. Flavylium network of chemical reactions in confined media: modulation of 3',4',7-trihydroxyflavilium reactions by host-guest interactions with cucurbit[7]uril.

    Science.gov (United States)

    Basílio, Nuno; Pina, Fernando

    2014-08-04

    In moderately acidic aqueous solutions, flavylium compounds undergo a pH-, and in some cases, light-dependent array of reversible chemical reactions. This network can be described as a single acid-base reaction involving a flavylium cation (acidic form) and a mixture of basic forms (quinoidal base, hemiketal and cis and trans chalcones). The apparent pK'a of the system and the relative mole fractions of the basic forms can be modulated by the interaction with cucurbit[7]uril. The system is studied by using (1) H NMR spectroscopy, UV/Vis spectroscopy, flash photolysis, and steady-state irradiation. Of all the network species, the flavylium cation possesses the highest affinity for cucurbit[7]uril. The rate of interconversion between flavylium cation and the basic species (where trans-chalcone is dominant) is approximately nine times lower inside the cucurbit[7]uril. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Nanoparticle-triggered in situ catalytic chemical reactions for tumour-specific therapy.

    Science.gov (United States)

    Lin, Han; Chen, Yu; Shi, Jianlin

    2018-03-21

    Tumour chemotherapy employs highly cytotoxic chemodrugs, which kill both cancer and normal cells by cellular apoptosis or necrosis non-selectively. Catalysing/triggering the specific chemical reactions only inside tumour tissues can generate abundant and special chemicals and products locally to initiate a series of unique biological and pathologic effects, which may enable tumour-specific theranostic effects to combat cancer without bringing about significant side effects on normal tissues. Nevertheless, chemical reaction-initiated selective tumour therapy strongly depends on the advances in chemistry, materials science, nanotechnology and biomedicine. This emerging cross-disciplinary research area is substantially different from conventional cancer-theranostic modalities in clinics. In response to the fast developments in cancer theranostics based on intratumoural catalytic chemical reactions, this tutorial review summarizes the very-recent research progress in the design and synthesis of representative nanoplatforms with intriguing nanostructures, compositions, physiochemical properties and biological behaviours for versatile catalytic chemical reaction-enabled cancer treatments, mainly by either endogenous tumour microenvironment (TME) triggering or exogenous physical irradiation. These unique intratumoural chemical reactions can be used in tumour-starving therapy, chemodynamic therapy, gas therapy, alleviation of tumour hypoxia, TME-responsive diagnostic imaging and stimuli-responsive drug release, and even externally triggered versatile therapeutics. In particular, the challenges and future developments of such a novel type of cancer-theranostic modality are discussed in detail to understand the future developments and prospects in this research area as far as possible. It is highly expected that this kind of unique tumour-specific therapeutics by triggering specific in situ catalytic chemical reactions inside tumours would provide a novel but efficient

  11. Open complex-balanced mass action chemical reaction networks

    NARCIS (Netherlands)

    Rao, Shodhan; van der Schaft, Arjan; Jayawardhana, Bayu

    We consider open chemical reaction networks, i.e. ones with inflows and outflows. We assume that all the inflows to the network are constant and all outflows obey the mass action kinetics rate law. We define a complex-balanced open reaction network as one that admits a complex-balanced steady state.

  12. Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

    National Research Council Canada - National Science Library

    McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

    2005-01-01

    ...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

  13. A chemical reaction in the movie The Ten Commandments

    Directory of Open Access Journals (Sweden)

    López Pérez, José Pedro;

    2012-04-01

    Full Text Available The study of natural sciences in the second year of Secondary Education must be complemented with a visit to the laboratory, where experiments should be permormed. The curriculum emphasizes the initial basis of Chemistry and the study of reactions. In this paper we describe a laboratory experience, useful for understanding the concept of chemical change. Also, we present the hypothesis that a chemical reaction was used in the classic movie The Ten Commandments.

  14. Adsorption and catalysis: The effect of confinement on chemical reactions

    International Nuclear Information System (INIS)

    Santiso, Erik E.; George, Aaron M.; Turner, C. Heath; Kostov, Milen K.; Gubbins, Keith E.; Buongiorno-Nardelli, Marco; Sliwinska-Bartkowiak, MaIgorzata

    2005-01-01

    Confinement within porous materials can affect chemical reactions through a host of different effects, including changes in the thermodynamic state of the system due to interactions with the pore walls, selective adsorption, geometrical constraints that affect the reaction mechanism, electronic perturbation due to the substrate, etc. In this work, we present an overview of some of our recent research on some of these effects, on chemical equilibrium, kinetic rates and reaction mechanisms. We also discuss our current and future directions for research in this area

  15. The role of reversed kinematics and double kinematic solutions in nuclear reactions studies

    International Nuclear Information System (INIS)

    Kaplan, M.; Parker, W.E.; Moses, D.J.; Lacey, R.; Alexander, J.M.

    1993-01-01

    The advantages of reversed kinematics in nuclear reactions studies are discussed, with particular emphasis on the origin of double solutions in the reaction kinematics. This possibility for double solutions does not exist in normal kinematics, and provides the basis for a new method of imposing important experimental constraints on the uniqueness of fitting complex observations. By gating on one or the other of the two solutions, light particle kinematics can be greatly influenced in coincidence measurements. The power of the method is illustrated with data for the reaction 1030 MeV 121 Sb+ 27 Al, where charged particle emissions arise from several different sources. (orig.)

  16. The Dynamics of Chemical Reactions: Atomistic Visualizations of Organic Reactions, and Homage to van 't Hoff.

    Science.gov (United States)

    Yang, Zhongyue; Houk, K N

    2018-03-15

    Jacobus Henricus van 't Hoff was the first Nobel Laureate in Chemistry. He pioneered in the study of chemical dynamics, which referred at that time to chemical kinetics and thermodynamics. The term has evolved in modern times to refer to the exploration of chemical transformations in a time-resolved fashion. Chemical dynamics has been driven by the development of molecular dynamics trajectory simulations, which provide atomic visualization of chemical processes and illuminate how dynamic effects influence chemical reactivity and selectivity. In homage to the legend of van 't Hoff, we review the development of the chemical dynamics of organic reactions, our area of research. We then discuss our trajectory simulations of pericyclic reactions, and our development of dynamic criteria for concerted and stepwise reaction mechanisms. We also describe a method that we call environment-perturbed transition state sampling, which enables trajectory simulations in condensed-media using quantum mechanics and molecular mechanics (QM/MM). We apply the method to reactions in solvent and in enzyme. Jacobus Henricus van 't Hoff (1852, Rotterdam-1911, Berlin) received the Nobel Prize for Chemistry in 1901 "in recognition of the extraordinary services he has rendered by the discovery of the laws of chemical dynamics and osmotic pressure in solutions". van 't Hoff was born the Netherlands, and earned his doctorate in Utrecht in 1874. In 1896 he moved to Berlin, where he was offered a position with more research and less teaching. van 't Hoff is considered one of the founders of physical chemistry. A key step in establishing this new field was the start of Zeitschrift für Physikalische Chemie in 1887. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Chemical treatment of commercial reverse osmosis membranes for use in FO

    Science.gov (United States)

    Commercially available reverse osmosis (RO) membranes – SW30HR, BW30, and AG – were chemically treated for use in forward osmosis (FO). Nitric acid, phosphoric acid, sulfuric acid, ethanol, and ethanol–acid–water ternary solutions were employed for the treatment. All three membra...

  18. Mass transfer with chemical reaction in multiphase systems

    International Nuclear Information System (INIS)

    Alper, E.

    1983-01-01

    These volumes deal with the phenomenon of 'mass transfer with chemical reaction' which is of industrial, biological and physiological importance. In process engineering, it is encountered both in separation processes and in reaction engineering and both aspects are covered here in four sections: introduction; gas-liquid system; liquid-liquid system; and gas-liquid-solid system

  19. Matrix isolation as a tool for studying interstellar chemical reactions

    Science.gov (United States)

    Ball, David W.; Ortman, Bryan J.; Hauge, Robert H.; Margrave, John L.

    1989-01-01

    Since the identification of the OH radical as an interstellar species, over 50 molecular species were identified as interstellar denizens. While identification of new species appears straightforward, an explanation for their mechanisms of formation is not. Most astronomers concede that large bodies like interstellar dust grains are necessary for adsorption of molecules and their energies of reactions, but many of the mechanistic steps are unknown and speculative. It is proposed that data from matrix isolation experiments involving the reactions of refractory materials (especially C, Si, and Fe atoms and clusters) with small molecules (mainly H2, H2O, CO, CO2) are particularly applicable to explaining mechanistic details of likely interstellar chemical reactions. In many cases, matrix isolation techniques are the sole method of studying such reactions; also in many cases, complexations and bond rearrangements yield molecules never before observed. The study of these reactions thus provides a logical basis for the mechanisms of interstellar reactions. A list of reactions is presented that would simulate interstellar chemical reactions. These reactions were studied using FTIR-matrix isolation techniques.

  20. Silver Nanowire Embedded Colorless Polyimide Heater for Wearable Chemical Sensors: Improved Reversible Reaction Kinetics of Optically Reduced Graphene Oxide.

    Science.gov (United States)

    Choi, Seon-Jin; Kim, Sang-Joon; Jang, Ji-Soo; Lee, Ji-Hyun; Kim, Il-Doo

    2016-09-14

    Optically reduced graphene oxide (ORGO) sheets are successfully integrated on silver nanowire (Ag NW)-embedded transparent and flexible substrate. As a heating element, Ag NWs are embedded in a colorless polyimide (CPI) film by covering Ag NW networks using polyamic acid and subsequent imidization. Graphene oxide dispersed aqueous solution is drop-coated on the Ag NW-embedded CPI (Ag NW-CPI) film and directly irradiated by intense pulsed light to obtain ORGO sheets. The heat generation property of Ag NW-CPI film is investigated by applying DC voltage, which demonstrates unprecedentedly reliable and stable characteristics even in dynamic bending condition. To demonstrate the potential application in wearable chemical sensors, NO 2 sensing characteristic of ORGO is investigated with respect to the different heating temperature (22.7-71.7 °C) of Ag NW-CPI film. The result reveals that the ORGO sheets exhibit high sensitivity of 2.69% with reversible response/recovery sensing properties and minimal deviation of baseline resistance of around 1% toward NO 2 molecules when the temperature of Ag NW-CPI film is 71.7 °C. This work first demonstrates the improved reversible NO 2 sensing properties of ORGO sheets on flexible and transparent Ag NW-CPI film assisted by Ag NW heating networks. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Quantum dynamics of fast chemical reactions

    Energy Technology Data Exchange (ETDEWEB)

    Light, J.C. [Univ. of Chicago, IL (United States)

    1993-12-01

    The aims of this research are to explore, develop, and apply theoretical methods for the evaluation of the dynamics of gas phase collision processes, primarily chemical reactions. The primary theoretical tools developed for this work have been quantum scattering theory, both in time dependent and time independent forms. Over the past several years, the authors have developed and applied methods for the direct quantum evaluation of thermal rate constants, applying these to the evaluation of the hydrogen isotopic exchange reactions, applied wave packet propagation techniques to the dissociation of Rydberg H{sub 3}, incorporated optical potentials into the evaluation of thermal rate constants, evaluated the use of optical potentials for state-to-state reaction probability evaluations, and, most recently, have developed quantum approaches for electronically non-adiabatic reactions which may be applied to simplify calculations of reactive, but electronically adiabatic systems. Evaluation of the thermal rate constants and the dissociation of H{sub 3} were reported last year, and have now been published.

  2. An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian

    2016-01-06

    In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce an efficient two-phase algorithm in which the first phase is deterministic and it is intended to provide a starting point for the second phase which is the Monte Carlo EM Algorithm.

  3. On Medium Chemical Reaction in Diffusion-Based Molecular Communication: a Two-Way Relaying Example

    OpenAIRE

    Farahnak-Ghazani, Maryam; Aminian, Gholamali; Mirmohseni, Mahtab; Gohari, Amin; Nasiri-Kenari, Masoumeh

    2016-01-01

    Chemical reactions are a prominent feature of molecular communication (MC) systems, with no direct parallels in wireless communications. While chemical reactions may be used inside the transmitter nodes, receiver nodes or the communication medium, we focus on its utility in the medium in this paper. Such chemical reactions can be used to perform computation over the medium as molecules diffuse and react with each other (physical-layer computation). We propose the use of chemical reactions for...

  4. Chemical reaction between single hydrogen atom and graphene

    International Nuclear Information System (INIS)

    Ito, Atsushi; Nakamura, Hiroaki; Takayama, Arimichi

    2007-04-01

    We study chemical reaction between a single hydrogen atom and a graphene, which is the elemental reaction between hydrogen and graphitic carbon materials. In the present work, classical molecular dynamics simulation is used with modified Brenner's empirical bond order potential. The three reactions, that is, absorption reaction, reflection reaction and penetration reaction, are observed in our simulation. Reaction rates depend on the incident energy of the hydrogen atom and the graphene temperature. The dependence can be explained by the following mechanisms: (1) The hydrogen atom receives repulsive force by π-electrons in addition to nuclear repulsion. (2) Absorbing the hydrogen atom, the graphene transforms its structure to the 'overhand' configuration such as sp 3 state. (3) The hexagonal hole of the graphene is expanded during the penetration of the hydrogen atom. (author)

  5. Application of laser diagnostics to sodium-water chemical reaction field

    International Nuclear Information System (INIS)

    Deguchi, Yoshihiro; Tamura, Kenta; Muranaka, Ryota; Kusano, Koji; Kikuchi, Shin; Kurihara, Akikazu

    2013-01-01

    In a sodium-cooled fast reactor (SFR), liquid sodium is used as a heat transfer fluid because of its excellent heat transport capability. On the other hand, it has strong chemical reactivity with water vapor. One of the design basis accidents of the SFR is the water leakage into the liquid sodium flow by a breach of heat transfer tubes in a steam generator. Therefore the study on sodium-water chemical reactions is of paramount importance for safety reasons. This study aims to clarify the sodium-water reaction mechanisms using laser diagnostics. The sodium-water counter-flow reactions were measured using laser diagnostics such as laser induced fluorescence, CARS, Raman scattering and photo-fragmentation. The measurement results show that the sodium-water reaction proceeds mainly by the reaction Na + H 2 O → NaOH + H and the main product is NaOH in this reaction. Its forward and backward reaction rates tend to balance with each other and the whole reaction rate reduces as temperature increases. (author)

  6. Quantum indistinguishability in chemical reactions.

    Science.gov (United States)

    Fisher, Matthew P A; Radzihovsky, Leo

    2018-05-15

    Quantum indistinguishability plays a crucial role in many low-energy physical phenomena, from quantum fluids to molecular spectroscopy. It is, however, typically ignored in most high-temperature processes, particularly for ionic coordinates, implicitly assumed to be distinguishable, incoherent, and thus well approximated classically. We explore enzymatic chemical reactions involving small symmetric molecules and argue that in many situations a full quantum treatment of collective nuclear degrees of freedom is essential. Supported by several physical arguments, we conjecture a "quantum dynamical selection" (QDS) rule for small symmetric molecules that precludes chemical processes that involve direct transitions from orbitally nonsymmetric molecular states. As we propose and discuss, the implications of the QDS rule include ( i ) a differential chemical reactivity of para- and orthohydrogen, ( ii ) a mechanism for inducing intermolecular quantum entanglement of nuclear spins, ( iii ) a mass-independent isotope fractionation mechanism, ( iv ) an explanation of the enhanced chemical activity of "reactive oxygen species", ( v ) illuminating the importance of ortho-water molecules in modulating the quantum dynamics of liquid water, and ( vi ) providing the critical quantum-to-biochemical linkage in the nuclear spin model of the (putative) quantum brain, among others.

  7. Chemical reactions inside the plasma chamber of the SEAFP reactor plant models

    International Nuclear Information System (INIS)

    Gay, J.M.; Ebert, E.; Mazille, F.

    1995-01-01

    Loss of coolant or loss of vacuum accidents may lead to chemical reactions between the protecting materials of the plasma facing components and air or water. A production of energy, reaction products and hydrogen may be induced. The paper defines the operating conditions and chemical reactions and presents the main results from the underlying studies. (orig.)

  8. Chemical Reactions at Surfaces. Final Progress Report

    Energy Technology Data Exchange (ETDEWEB)

    Freud, Hans-Joachim [Max-Planck-Gesellschaft, Berlin (Germany). Fritz-Haber-Inst.

    2003-02-21

    The Gordon Research Conference (GRC) on Chemical Reactions at Surfaces was held at Holiday Inn, Ventura, California, 2/16-21/03. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  9. Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.

    Science.gov (United States)

    Abe, Hiroshi; Kimura, Yasuaki

    2018-01-01

    Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.

  10. NATO Advanced Research Workshop on The Theory of Chemical Reaction Dynamics

    CERN Document Server

    1986-01-01

    The calculation of cross sections and rate constants for chemical reactions in the gas phase has long been a major problem in theoretical chemistry. The need for reliable and applicable theories in this field is evident when one considers the significant recent advances that have been made in developing experimental techniques, such as lasers and molecular beams, to probe the microscopic details of chemical reactions. For example, it is now becoming possible to measure cross sections for chemical reactions state selected in the vibrational­ rotational states of both reactants and products. Furthermore, in areas such as atmospheric, combustion and interstellar chemistry, there is an urgent need for reliable reaction rate constant data over a range of temperatures, and this information is often difficult to obtain in experiments. The classical trajectory method can be applied routinely to simple reactions, but this approach neglects important quantum mechanical effects such as tunnelling and resonances. For al...

  11. Asymmetric effect of mechanical stress on the forward and reverse reaction catalyzed by an enzyme.

    Directory of Open Access Journals (Sweden)

    Collin Joseph

    Full Text Available The concept of modulating enzymatic activity by exerting a mechanical stress on the enzyme has been established in previous work. Mechanical perturbation is also a tool for probing conformational motion accompanying the enzymatic cycle. Here we report measurements of the forward and reverse kinetics of the enzyme Guanylate Kinase from yeast (Saccharomyces cerevisiae. The enzyme is held in a state of stress using the DNA spring method. The observation that mechanical stress has different effects on the forward and reverse reaction kinetics suggests that forward and reverse reactions follow different paths, on average, in the enzyme's conformational space. Comparing the kinetics of the stressed and unstressed enzyme we also show that the maximum speed of the enzyme is comparable to the predictions of the relaxation model of enzyme action, where we use the independently determined dissipation coefficient [Formula: see text] for the enzyme's conformational motion. The present experiments provide a mean to explore enzyme kinetics beyond the static energy landscape picture of transition state theory.

  12. On null tests of time-reversal invariance in scattering and reactions

    International Nuclear Information System (INIS)

    Conzett, H.E.

    1993-01-01

    There have been suggestions in the literature, both recently and in the more distant past, that, in the lowest-order Born approximation, time-reversal (T)-odd experimental observables in certain reactions are required by T-symmetry to vanish. These observables are the final-state spin-correlation coefficient C xy in the reaction e + e - → τ + τ - and the target analysing power A oy in the inclusive process ep → eX with a polarized proton target. These assertions are in direct conflict with a theorem that states that there can be no null-test of T-symmetry in such processes; that is, T-symmetry does not require any single observable to vanish. This talk addresses the resolution of that conflict

  13. Diabatic models with transferrable parameters for generalized chemical reactions

    International Nuclear Information System (INIS)

    Reimers, Jeffrey R; McKemmish, Laura K; McKenzie, Ross H; Hush, Noel S

    2017-01-01

    Diabatic models applied to adiabatic electron-transfer theory yield many equations involving just a few parameters that connect ground-state geometries and vibration frequencies to excited-state transition energies and vibration frequencies to the rate constants for electron-transfer reactions, utilizing properties of the conical-intersection seam linking the ground and excited states through the Pseudo Jahn-Teller effect. We review how such simplicity in basic understanding can also be obtained for general chemical reactions. The key feature that must be recognized is that electron-transfer (or hole transfer) processes typically involve one electron (hole) moving between two orbitals, whereas general reactions typically involve two electrons or even four electrons for processes in aromatic molecules. Each additional moving electron leads to new high-energy but interrelated conical-intersection seams that distort the shape of the critical lowest-energy seam. Recognizing this feature shows how conical-intersection descriptors can be transferred between systems, and how general chemical reactions can be compared using the same set of simple parameters. Mathematical relationships are presented depicting how different conical-intersection seams relate to each other, showing that complex problems can be reduced into an effective interaction between the ground-state and a critical excited state to provide the first semi-quantitative implementation of Shaik’s “twin state” concept. Applications are made (i) demonstrating why the chemistry of the first-row elements is qualitatively so different to that of the second and later rows, (ii) deducing the bond-length alternation in hypothetical cyclohexatriene from the observed UV spectroscopy of benzene, (iii) demonstrating that commonly used procedures for modelling surface hopping based on inclusion of only the first-derivative correction to the Born-Oppenheimer approximation are valid in no region of the chemical

  14. The role of van der Waals interactions in chemical reactions

    International Nuclear Information System (INIS)

    Takayanagi, Toshiyuki

    1998-01-01

    We are studying the role of van der Waals interactions in the chemical reactions from the theoretical view point, especially, a case related to the tunnel effect. The fist case that the cumulative reaction probability depends on the tunnel effect was increased by the van der waals force. This case was proved by theoretical calculation of the reaction rate constant of the reaction: Mu + F2 → MuF + F. The second case was that a van der Waals well was so deep that pseudo bound state was observed in the reaction: F + H 2 → HF + H. A van der Waals complex such as AB(v=j=0)...C was excited to the resonance state of AB(vij)...C and A...BC(v,j) by laser, than the resonance state proceeded to AB + C (predissociation) or A + BC(pre-reaction). We succeeded for the first time to calculate theoretically the pre-reaction by the real three dimentional potential curve. The pre-reaction can be observed only the case that the tunnel probability is larger than the non-adiabatic transition probability. The chemical reactions in solid were explained, too. (S.Y.)

  15. Mapping students' ideas about chemical reactions at different educational levels

    Science.gov (United States)

    Yan, Fan

    Understanding chemical reactions is crucial in learning chemistry at all educational levels. Nevertheless, research in science education has revealed that many students struggle to understand chemical processes. Improving teaching and learning about chemical reactions demands that we develop a clearer understanding of student reasoning in this area and of how this reasoning evolves with training in the discipline. Thus, we have carried out a qualitative study using semi-structured interviews as the main data collection tool to explore students reasoning about reaction mechanism and causality. The participants of this study included students at different levels of training in chemistry: general chemistry students (n=22), organic chemistry students (n=16), first year graduate students (n=13) and Ph.D. candidates (n=14). We identified major conceptual modes along critical dimensions of analysis, and illustrated common ways of reasoning using typical cases. Main findings indicate that although significant progress is observed in student reasoning in some areas, major conceptual difficulties seem to persist even at the more advanced educational levels. In addition, our findings suggest that students struggle to integrate important concepts when thinking about mechanism and causality in chemical reactions. The results of our study are relevant to chemistry educators interested in learning progressions, assessment, and conceptual development.

  16. Reformulation and solution of the master equation for multiple-well chemical reactions.

    Science.gov (United States)

    Georgievskii, Yuri; Miller, James A; Burke, Michael P; Klippenstein, Stephen J

    2013-11-21

    We consider an alternative formulation of the master equation for complex-forming chemical reactions with multiple wells and bimolecular products. Within this formulation the dynamical phase space consists of only the microscopic populations of the various isomers making up the reactive complex, while the bimolecular reactants and products are treated equally as sources and sinks. This reformulation yields compact expressions for the phenomenological rate coefficients describing all chemical processes, i.e., internal isomerization reactions, bimolecular-to-bimolecular reactions, isomer-to-bimolecular reactions, and bimolecular-to-isomer reactions. The applicability of the detailed balance condition is discussed and confirmed. We also consider the situation where some of the chemical eigenvalues approach the energy relaxation time scale and show how to modify the phenomenological rate coefficients so that they retain their validity.

  17. Click and chemically triggered declick reactions through reversible amine and thiol coupling via a conjugate acceptor

    Science.gov (United States)

    Diehl, Katharine L.; Kolesnichenko, Igor V.; Robotham, Scott A.; Bachman, J. Logan; Zhong, Ye; Brodbelt, Jennifer S.; Anslyn, Eric V.

    2016-10-01

    The coupling and decoupling of molecular units is a fundamental undertaking of organic chemistry. Herein we report the use of a very simple conjugate acceptor, derived from Meldrum's acid, for the sequential ‘clicking’ together of an amine and a thiol in aqueous conditions at neutral pH. Subsequently, this linkage can be ‘declicked’ by a chemical trigger to release the original amine and thiol undisturbed. The reactivity differs from that of other crosslinking agents because the selectivity for sequential functionalization derives from an altering of the electrophilicity of the conjugate acceptor on the addition of the amine. We describe the use of the procedure to modify proteins, create multicomponent libraries and synthesize oligomers, all of which can be declicked to their starting components in a controlled fashion when desired. Owing to the mild reaction conditions and ease of use in a variety of applications, the method is predicted to have wide utility.

  18. Physio-chemical reactions in recycle aggregate concrete.

    Science.gov (United States)

    Tam, Vivian W Y; Gao, X F; Tam, C M; Ng, K M

    2009-04-30

    Concrete waste constitutes the major proportion of construction waste at about 50% of the total waste generated. An effective way to reduce concrete waste is to reuse it as recycled aggregate (RA) for the production of recycled aggregate concrete (RAC). This paper studies the physio-chemical reactions of cement paste around aggregate for normal aggregate concrete (NAC) and RAC mixed with normal mixing approach (NMA) and two-stage mixing approach (TSMA) by differential scanning calorimetry (DSC) and scanning electron microscopy (SEM). Four kinds of physio-chemical reactions have been recorded from the concrete samples, including the dehydration of C(3)S(2)H(3), iron-substituted ettringite, dehydroxylation of CH and development of C(6)S(3)H at about 90 degrees C, 135 degrees C, 441 degrees C and 570 degrees C, respectively. From the DSC results, it is confirmed that the concrete samples with RA substitution have generated less amount of strength enhancement chemical products when compared to those without RA substitution. However, the results from the TSMA are found improving the RAC quality. The pre-mix procedure of the TSMA can effectively develop some strength enhancing chemical products including, C(3)S(2)H(3), ettringite, CH and C(6)S(3)H, which shows that RAC made from the TSMA can improve the hydration processes.

  19. Physio-chemical reactions in recycle aggregate concrete

    International Nuclear Information System (INIS)

    Tam, Vivian W.Y.; Gao, X.F.; Tam, C.M.; Ng, K.M.

    2009-01-01

    Concrete waste constitutes the major proportion of construction waste at about 50% of the total waste generated. An effective way to reduce concrete waste is to reuse it as recycled aggregate (RA) for the production of recycled aggregate concrete (RAC). This paper studies the physio-chemical reactions of cement paste around aggregate for normal aggregate concrete (NAC) and RAC mixed with normal mixing approach (NMA) and two-stage mixing approach (TSMA) by differential scanning calorimetry (DSC) and scanning electron microscopy (SEM). Four kinds of physio-chemical reactions have been recorded from the concrete samples, including the dehydration of C 3 S 2 H 3 , iron-substituted ettringite, dehydroxylation of CH and development of C 6 S 3 H at about 90 deg. C, 135 deg. C, 441 deg. C and 570 deg. C, respectively. From the DSC results, it is confirmed that the concrete samples with RA substitution have generated less amount of strength enhancement chemical products when compared to those without RA substitution. However, the results from the TSMA are found improving the RAC quality. The pre-mix procedure of the TSMA can effectively develop some strength enhancing chemical products including, C 3 S 2 H 3 , ettringite, CH and C 6 S 3 H, which shows that RAC made from the TSMA can improve the hydration processes

  20. Efficient Solar Energy Harvesting and Storage through a Robust Photocatalyst Driving Reversible Redox Reactions.

    Science.gov (United States)

    Zhou, Yangen; Zhang, Shun; Ding, Yu; Zhang, Leyuan; Zhang, Changkun; Zhang, Xiaohong; Zhao, Yu; Yu, Guihua

    2018-06-14

    Simultaneous solar energy conversion and storage is receiving increasing interest for better utilization of the abundant yet intermittently available sunlight. Photoelectrodes driving nonspontaneous reversible redox reactions in solar-powered redox cells (SPRCs), which can deliver energy via the corresponding reverse reactions, present a cost-effective and promising approach for direct solar energy harvesting and storage. However, the lack of photoelectrodes having both high conversion efficiency and high durability becomes a bottleneck that hampers practical applications of SPRCs. Here, it is shown that a WO 3 -decorated BiVO 4 photoanode, without the need of extra electrocatalysts, can enable a single-photocatalyst-driven SPRC with a solar-to-output energy conversion efficiency as high as 1.25%. This SPRC presents stable performance over 20 solar energy storage/delivery cycles. The high efficiency and stability are attributed to the rapid redox reactions, the well-matched energy level, and the efficient light harvesting and charge separation of the prepared BiVO 4 . This demonstrated device system represents a potential alternative toward the development of low-cost, durable, and easy-to-implement solar energy technologies. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. An efficient forward-reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Vilanova, Pedro

    2016-01-07

    In this work, we present an extension of the forward-reverse representation introduced in Simulation of forward-reverse stochastic representations for conditional diffusions , a 2014 paper by Bayer and Schoenmakers to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the Expectation-Maximization algorithm to the phase I output. By selecting a set of over-dispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.

  2. The Heck reaction in the production of fine chemicals

    NARCIS (Netherlands)

    Vries, Johannes G. de

    2001-01-01

    An overview is given of the use of the Heck reaction for the production of fine chemicals. Five commercial products have been identified that are produced on a scale in excess of 1 ton/year. The herbicide Prosulfuron™ is produced via a Matsuda reaction of 2-sulfonatobenzenediazonium on

  3. Fast stochastic simulation of biochemical reaction systems by alternative formulations of the chemical Langevin equation

    KAUST Repository

    Mélykúti, Bence

    2010-01-01

    The Chemical Langevin Equation (CLE), which is a stochastic differential equation driven by a multidimensional Wiener process, acts as a bridge between the discrete stochastic simulation algorithm and the deterministic reaction rate equation when simulating (bio)chemical kinetics. The CLE model is valid in the regime where molecular populations are abundant enough to assume their concentrations change continuously, but stochastic fluctuations still play a major role. The contribution of this work is that we observe and explore that the CLE is not a single equation, but a parametric family of equations, all of which give the same finite-dimensional distribution of the variables. On the theoretical side, we prove that as many Wiener processes are sufficient to formulate the CLE as there are independent variables in the equation, which is just the rank of the stoichiometric matrix. On the practical side, we show that in the case where there are m1 pairs of reversible reactions and m2 irreversible reactions there is another, simple formulation of the CLE with only m1 + m2 Wiener processes, whereas the standard approach uses 2 m1 + m2. We demonstrate that there are considerable computational savings when using this latter formulation. Such transformations of the CLE do not cause a loss of accuracy and are therefore distinct from model reduction techniques. We illustrate our findings by considering alternative formulations of the CLE for a human ether a-go-go related gene ion channel model and the Goldbeter-Koshland switch. © 2010 American Institute of Physics.

  4. Flow-Injection Responses of Diffusion Processes and Chemical Reactions

    DEFF Research Database (Denmark)

    Andersen, Jens Enevold Thaulov

    2000-01-01

    tool of automated analytical chemistry. The need for an even lower consumption of chemicals and for computer analysis has motivated a study of the FIA peak itself, that is, a theoretical model was developed, that provides detailed knowledge of the FIA profile. It was shown that the flow in a FIA...... manifold may be characterised by a diffusion coefficient that depends on flow rate, denoted as the kinematic diffusion coefficient. The description was applied to systems involving species of chromium, both in the case of simple diffusion and in the case of chemical reactions. It is suggested that it may...... be used in the resolution of FIA profiles to obtain information about the content of interference’s, in the study of chemical reaction kinetics and to measure absolute concentrations within the FIA-detector cell....

  5. Development of tight-binding, chemical-reaction-dynamics simulator for combinatorial computational chemistry

    International Nuclear Information System (INIS)

    Kubo, Momoji; Ando, Minako; Sakahara, Satoshi; Jung, Changho; Seki, Kotaro; Kusagaya, Tomonori; Endou, Akira; Takami, Seiichi; Imamura, Akira; Miyamoto, Akira

    2004-01-01

    Recently, we have proposed a new concept called 'combinatorial computational chemistry' to realize a theoretical, high-throughput screening of catalysts and materials. We have already applied our combinatorial, computational-chemistry approach, mainly based on static first-principles calculations, to various catalysts and materials systems and its applicability to the catalysts and materials design was strongly confirmed. In order to realize more effective and efficient combinatorial, computational-chemistry screening, a high-speed, chemical-reaction-dynamics simulator based on quantum-chemical, molecular-dynamics method is essential. However, to the best of our knowledge, there is no chemical-reaction-dynamics simulator, which has an enough high-speed ability to perform a high-throughput screening. In the present study, we have succeeded in the development of a chemical-reaction-dynamics simulator based on our original, tight-binding, quantum-chemical, molecular-dynamics method, which is more than 5000 times faster than the regular first-principles, molecular-dynamics method. Moreover, its applicability and effectiveness to the atomistic clarification of the methanol-synthesis dynamics at reaction temperature were demonstrated

  6. Comparing chemical reaction networks

    DEFF Research Database (Denmark)

    Cardelli, Luca; Tribastone, Mirco; Tschaikowski, Max

    2017-01-01

    We study chemical reaction networks (CRNs) as a kernel model of concurrency provided with semantics based on ordinary differential equations. We investigate the problem of comparing two CRNs, i.e., to decide whether the solutions of a source and of a target CRN can be matched for an appropriate...... choice of initial conditions. Using a categorical framework, we extend and unify model-comparison approaches based on dynamical (semantic) and structural (syntactic) properties of CRNs. Then, we provide an algorithm to compare CRNs, running linearly in time with respect to the cardinality of all possible...... comparisons. Finally, using a prototype implementation, CAGE, we apply our results to biological models from the literature....

  7. Learning to predict chemical reactions.

    Science.gov (United States)

    Kayala, Matthew A; Azencott, Chloé-Agathe; Chen, Jonathan H; Baldi, Pierre

    2011-09-26

    Being able to predict the course of arbitrary chemical reactions is essential to the theory and applications of organic chemistry. Approaches to the reaction prediction problems can be organized around three poles corresponding to: (1) physical laws; (2) rule-based expert systems; and (3) inductive machine learning. Previous approaches at these poles, respectively, are not high throughput, are not generalizable or scalable, and lack sufficient data and structure to be implemented. We propose a new approach to reaction prediction utilizing elements from each pole. Using a physically inspired conceptualization, we describe single mechanistic reactions as interactions between coarse approximations of molecular orbitals (MOs) and use topological and physicochemical attributes as descriptors. Using an existing rule-based system (Reaction Explorer), we derive a restricted chemistry data set consisting of 1630 full multistep reactions with 2358 distinct starting materials and intermediates, associated with 2989 productive mechanistic steps and 6.14 million unproductive mechanistic steps. And from machine learning, we pose identifying productive mechanistic steps as a statistical ranking, information retrieval problem: given a set of reactants and a description of conditions, learn a ranking model over potential filled-to-unfilled MO interactions such that the top-ranked mechanistic steps yield the major products. The machine learning implementation follows a two-stage approach, in which we first train atom level reactivity filters to prune 94.00% of nonproductive reactions with a 0.01% error rate. Then, we train an ensemble of ranking models on pairs of interacting MOs to learn a relative productivity function over mechanistic steps in a given system. Without the use of explicit transformation patterns, the ensemble perfectly ranks the productive mechanism at the top 89.05% of the time, rising to 99.86% of the time when the top four are considered. Furthermore, the system

  8. Learning to Predict Chemical Reactions

    Science.gov (United States)

    Kayala, Matthew A.; Azencott, Chloé-Agathe; Chen, Jonathan H.

    2011-01-01

    Being able to predict the course of arbitrary chemical reactions is essential to the theory and applications of organic chemistry. Approaches to the reaction prediction problems can be organized around three poles corresponding to: (1) physical laws; (2) rule-based expert systems; and (3) inductive machine learning. Previous approaches at these poles respectively are not high-throughput, are not generalizable or scalable, or lack sufficient data and structure to be implemented. We propose a new approach to reaction prediction utilizing elements from each pole. Using a physically inspired conceptualization, we describe single mechanistic reactions as interactions between coarse approximations of molecular orbitals (MOs) and use topological and physicochemical attributes as descriptors. Using an existing rule-based system (Reaction Explorer), we derive a restricted chemistry dataset consisting of 1630 full multi-step reactions with 2358 distinct starting materials and intermediates, associated with 2989 productive mechanistic steps and 6.14 million unproductive mechanistic steps. And from machine learning, we pose identifying productive mechanistic steps as a statistical ranking, information retrieval, problem: given a set of reactants and a description of conditions, learn a ranking model over potential filled-to-unfilled MO interactions such that the top ranked mechanistic steps yield the major products. The machine learning implementation follows a two-stage approach, in which we first train atom level reactivity filters to prune 94.00% of non-productive reactions with a 0.01% error rate. Then, we train an ensemble of ranking models on pairs of interacting MOs to learn a relative productivity function over mechanistic steps in a given system. Without the use of explicit transformation patterns, the ensemble perfectly ranks the productive mechanism at the top 89.05% of the time, rising to 99.86% of the time when the top four are considered. Furthermore, the system

  9. Method of operating a thermal engine powered by a chemical reaction

    Science.gov (United States)

    Ross, J.; Escher, C.

    1988-06-07

    The invention involves a novel method of increasing the efficiency of a thermal engine. Heat is generated by a non-linear chemical reaction of reactants, said heat being transferred to a thermal engine such as Rankine cycle power plant. The novel method includes externally perturbing one or more of the thermodynamic variables of said non-linear chemical reaction. 7 figs.

  10. Reversible chemical patterning on stimuli-responsive polymer film: Environment-responsive lithography

    International Nuclear Information System (INIS)

    Ionov, Leonid; Minko, Sergiy; Stamm, Manfred; Gohy, Jean-Francois; Jerome, Robert; Scholl, Andreas

    2003-01-01

    We report on a novel type of chemical patterning based on thin stimuli-responsive polymer films. The basic concept is the permanent storage (writing) of a pattern, which is reversibly developed and erased upon exposure to appropriate environment, e.g., solvent, pH, and temperature. The smart surface is fabricated from the mixed brush of poly(2-vinylpyridine) and polyisoprene. The mixed brush demonstrates switching behavior upon exposure to different solvents. Cross-linking of polyisoprene via illumination through a photomask results in formation of patterns with suppressed switching. Due to the contrast in switching between illuminated and dark areas, exposure of the smart surface to different solvents causes either reversible formation or erasing of chemical contrast between the illuminated and dark areas. Thus, the pattern surface can very locally attract colloidal particles or can be wetted by water only upon exposure to the special solvent which introduces the contrast between the illuminated and dark areas. Appearance of the patterns indicates particular environment and can be used for local switching of adsorption

  11. Flows and chemical reactions in homogeneous mixtures

    CERN Document Server

    Prud'homme, Roger

    2013-01-01

    Flows with chemical reactions can occur in various fields such as combustion, process engineering, aeronautics, the atmospheric environment and aquatics. The examples of application chosen in this book mainly concern homogeneous reactive mixtures that can occur in propellers within the fields of process engineering and combustion: - propagation of sound and monodimensional flows in nozzles, which may include disequilibria of the internal modes of the energy of molecules; - ideal chemical reactors, stabilization of their steady operation points in the homogeneous case of a perfect mixture and c

  12. Rapid Hydrogen Shift Reactions in Acyl Peroxy Radicals

    DEFF Research Database (Denmark)

    Knap, Hasse Christian; Jørgensen, Solvejg

    2017-01-01

    -shift with X = 6, 7, 8, or 9) in the hydroperoxy acyl peroxy radicals, this H-shift is a reversible reaction and it scrambles between two peroxides, hydroperoxy acyl peroxy and peroxy peroxoic acid radicals. The forward reaction rate constants of the 1,X-OOH H-shift reactions are estimated to be above 103 s–1...... with transition state theory corrected with Eckart quantum tunnelling correction. The ratio between the forward and reverse reaction rate constant of the 1,X-OOH H-shift reactions is around ∼105. Therefore, the equilibrium is pushed toward the production of peroxy peroxoic acid radicals. These very fast 1,X-OOH H......We have used quantum mechanical chemical calculations (CCSD(T)-F12a/cc-pVDZ-F12//M06-2X/aug-cc-pVTZ) to investigate the hydrogen shift (H-shift) reactions in acyl peroxy and hydroperoxy acyl peroxy radicals. We have focused on the H-shift reactions from a hydroperoxy group (OOH) (1,X-OOH H...

  13. Non-allergic cutaneous reactions in airborne chemical sensitivity--a population based study

    DEFF Research Database (Denmark)

    Berg, Nikolaj Drimer; Linneberg, Allan; Thyssen, Jacob Pontoppidan

    2011-01-01

    the relationship between cutaneous reactions from patch testing and self-reported severity of chemical sensitivity to common airborne chemicals. A total of 3460 individuals participating in a general health examination, Health 2006, were patch tested with allergens from the European standard series and screened...... most severe groups of self-reported sensitivity to airborne chemicals. When adjusting for confounding, associations were weakened, and only non-allergic cutaneous reactions were significantly associated with individuals most severely affected by inhalation of airborne chemicals (odds ratio = 2.5, p = 0...

  14. Conditions for extinction events in chemical reaction networks with discrete state spaces.

    Science.gov (United States)

    Johnston, Matthew D; Anderson, David F; Craciun, Gheorghe; Brijder, Robert

    2018-05-01

    We study chemical reaction networks with discrete state spaces and present sufficient conditions on the structure of the network that guarantee the system exhibits an extinction event. The conditions we derive involve creating a modified chemical reaction network called a domination-expanded reaction network and then checking properties of this network. Unlike previous results, our analysis allows algorithmic implementation via systems of equalities and inequalities and suggests sequences of reactions which may lead to extinction events. We apply the results to several networks including an EnvZ-OmpR signaling pathway in Escherichia coli.

  15. Current status of uranium enrichment by way of chemical exchange reactions

    International Nuclear Information System (INIS)

    El Basyouny, A.; Bechthold, H.C.; Knoechel, A.; Vollmer, H.J.

    1985-04-01

    For this report, conference proceedings, patents and other types of literature have been collected to present an account of the current status of uranium enrichment by way of chemical exchange reactions. The report further presents a new concept along with the relevant process strategy developed by the authors. The principal process of the new concept is a chemical exchange process with crown ethers, complexed or free, playing an important part in the reactions. The authors also describe their experiments carried out for establishing suitable chemical systems. (orig./PW) [de

  16. Empirical Force Fields for Mechanistic Studies of Chemical Reactions in Proteins.

    Science.gov (United States)

    Das, A K; Meuwly, M

    2016-01-01

    Following chemical reactions in atomistic detail is one of the most challenging aspects of current computational approaches to chemistry. In this chapter the application of adiabatic reactive MD (ARMD) and its multistate version (MS-ARMD) are discussed. Both methods allow to study bond-breaking and bond-forming processes in chemical and biological processes. Particular emphasis is put on practical aspects for applying the methods to investigate the dynamics of chemical reactions. The chapter closes with an outlook of possible generalizations of the methods discussed. © 2016 Elsevier Inc. All rights reserved.

  17. Proton conduction based on intracrystalline chemical reaction

    International Nuclear Information System (INIS)

    Schuck, G.; Lechner, R.E.; Langer, K.

    2002-01-01

    Proton conductivity in M 3 H(SeO 4 ) 2 crystals (M=K, Rb, Cs) is shown to be due to a dynamic disorder in the form of an intracrystalline chemical equilibrium reaction: alternation between the association of the monomers [HSeO 4 ] 1- and [SeO 4 ] 2- resulting in the dimer [H(SeO 4 ) 2 ] 3- (H-bond formation) and the dissociation of the latter into the two monomers (H-bond breaking). By a combination of quasielastic neutron scattering and FTIR spectroscopy, reaction rates were obtained, as well as rates of proton exchange between selenate ions, leading to diffusion. The results demonstrate that this reaction plays a central role in the mechanism of proton transport in these solid-state protonic conductors. (orig.)

  18. Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.

    Science.gov (United States)

    Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing

    2017-04-01

    The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.

  19. Why Do Lithium-Oxygen Batteries Fail: Parasitic Chemical Reactions and Their Synergistic Effect.

    Science.gov (United States)

    Yao, Xiahui; Dong, Qi; Cheng, Qingmei; Wang, Dunwei

    2016-09-12

    As an electrochemical energy-storage technology with the highest theoretical capacity, lithium-oxygen batteries face critical challenges in terms of poor stabilities and low charge/discharge round-trip efficiencies. It is generally recognized that these issues are connected to the parasitic chemical reactions at the anode, electrolyte, and cathode. While the detailed mechanisms of these reactions have been studied separately, the possible synergistic effects between these reactions remain poorly understood. To fill in the knowledge gap, this Minireview examines literature reports on the parasitic chemical reactions and finds the reactive oxygen species a key chemical mediator that participates in or facilitates nearly all parasitic chemical reactions. Given the ubiquitous presence of oxygen in all test cells, this finding is important. It offers new insights into how to stabilize various components of lithium-oxygen batteries for high-performance operations and how to eventually materialize the full potentials of this promising technology. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  20. Communication: Rate coefficients from quasiclassical trajectory calculations from the reverse reaction: The Mu + H2 reaction re-visited

    Science.gov (United States)

    Homayoon, Zahra; Jambrina, Pablo G.; Aoiz, F. Javier; Bowman, Joel M.

    2012-07-01

    In a previous paper [P. G. Jambrina et al., J. Chem. Phys. 135, 034310 (2011), 10.1063/1.3611400] various calculations of the rate coefficient for the Mu + H2 → MuH + H reaction were presented and compared to experiment. The widely used standard quasiclassical trajectory (QCT) method was shown to overestimate the rate coefficients by several orders of magnitude over the temperature range 200-1000 K. This was attributed to a major failure of that method to describe the correct threshold for the reaction owing to the large difference in zero-point energies (ZPE) of the reactant H2 and product MuH (˜0.32 eV). In this Communication we show that by performing standard QCT calculations for the reverse reaction and then applying detailed balance, the resulting rate coefficient is in very good agreement with the other computational results that respect the ZPE, (as well as with the experiment) but which are more demanding computationally.

  1. Kinetics of isotope exchange reactions involving intra- and intermolecular reactions: 1. Rate law for a system with two chemical compounds and three exchangeable atoms

    International Nuclear Information System (INIS)

    Xuelei Chu; Ohmoto, Hiroshi

    1991-01-01

    For an isotopic exchange reaction between two compounds (X and AB) in a homogeneous system, such as a gaseous or aqueous system, where one (AB) of them possesses two exchangeable atoms in non-equivalent positions and where one intramolecular isotope exchange (A ↔ B) and two intermolecular isotope exchange reactions (X ↔ A and X ↔ B) may occur, its rate law no longer obeys a pseudo-first order rate equation described for simple two-component systems by many previous investigators. The change with time of the δ value of each of the three components (X, A, and B) in a closed and homogeneous system is a complicated function of the initial δ values of the three components, the chemical concentrations of the two compounds, and the overall rate constants of the forward and reverse reactions involving the two intermolecular and one intramolecular reactions of isotope exchanges. Also, for some one of the three components, the change of its δ value with time may not be monotonic, and the relationship of 1n (1 - F) with time may be non-linear in a plot of 1n (1 - F) vs. t. In addition, the rate law of the isotope exchange reaction in this system also provides a quantitative method to estimate the overall rate constants for the one-intra-and two intermolecular isotope exchanges and the equilibrium isotopic fractionation factors among the three components

  2. Phenomenological description of selected elementary chemical reaction mechanisms: An information-theoretic study

    International Nuclear Information System (INIS)

    Esquivel, R.O.; Flores-Gallegos, N.; Iuga, C.; Carrera, E.M.; Angulo, J.C.; Antolin, J.

    2010-01-01

    The information-theoretic description of the course of two elementary chemical reactions allows a phenomenological description of the chemical course of the hydrogenic abstraction and the S N 2 identity reactions by use of Shannon entropic measures in position and momentum spaces. The analyses reveal their synchronous/asynchronous mechanistic behavior.

  3. Chemical modifications and reactions in DNA nanostructures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager

    2017-01-01

    such as hydrocarbons or steroids have been introduced to change the surface properties of DNA origami structures, either to protect the DNA nanostructure or to dock it into membranes and other hydrophobic surfaces. DNA nanostructures have also been used to control covalent chemical reactions. This article provides......DNA nanotechnology has the power to form self-assembled and well-defined nanostructures, such as DNA origami, where the relative positions of each atom are known with subnanometer precision. Our ability to synthesize oligonucleotides with chemical modifications in almost any desired position...... provides rich opportunity to incorporate molecules, biomolecules, and a variety of nanomaterials in specific positions on DNA nanostructures. Several standard modifications for oligonucleotides are available commercially, such as dyes, biotin, and chemical handles, and such modified oligonucleotides can...

  4. Effects of chemical reaction on moving isothermal vertical plate with variable mass diffusion

    Directory of Open Access Journals (Sweden)

    Muthucumaraswamy R.

    2003-01-01

    Full Text Available An exact solution to the problem of flow past an impulsively started infinite vertical isothermal plate with variable mass diffusion is presented here, taking into account of the homogeneous chemical reaction of first-order. The dimensionless governing equations are solved by using the Laplace - transform technique. The velocity and skin-friction are studied for different parameters like chemical reaction parameter, Schmidt number and buoyancy ratio parameter. It is observed that the veloc­ity increases with decreasing chemical reaction parameter and increases with increasing buoyancy ratio parameter.

  5. Optimization of a Chemical Reaction Train

    Directory of Open Access Journals (Sweden)

    Bahar Sansar

    2010-01-01

    Full Text Available This project consists of the optimization of a chemical reactor train. The reactor considered here is the continuous stirred tank reactor (CSTR, one of the reactor models used in engineering. Given the design equation for the CSTR and the cost function for a reactor, the following values are determined; the optimum number of reactors in the reaction train, the volume of each reactor and the total cost.

  6. Synthetically chemical-electrical mechanism for controlling large scale reversible deformation of liquid metal objects

    Science.gov (United States)

    Zhang, Jie; Sheng, Lei; Liu, Jing

    2014-11-01

    Reversible deformation of a machine holds enormous promise across many scientific areas ranging from mechanical engineering to applied physics. So far, such capabilities are still hard to achieve through conventional rigid materials or depending mainly on elastomeric materials, which however own rather limited performances and require complicated manipulations. Here, we show a basic strategy which is fundamentally different from the existing ones to realize large scale reversible deformation through controlling the working materials via the synthetically chemical-electrical mechanism (SCHEME). Such activity incorporates an object of liquid metal gallium whose surface area could spread up to five times of its original size and vice versa under low energy consumption. Particularly, the alterable surface tension based on combination of chemical dissolution and electrochemical oxidation is ascribed to the reversible shape transformation, which works much more flexible than many former deformation principles through converting electrical energy into mechanical movement. A series of very unusual phenomena regarding the reversible configurational shifts are disclosed with dominant factors clarified. This study opens a generalized way to combine the liquid metal serving as shape-variable element with the SCHEME to compose functional soft machines, which implies huge potential for developing future smart robots to fulfill various complicated tasks.

  7. Imaging Molecular Motion: Femtosecond X-Ray Scattering of an Electrocyclic Chemical Reaction

    Science.gov (United States)

    Minitti, M. P.; Budarz, J. M.; Kirrander, A.; Robinson, J. S.; Ratner, D.; Lane, T. J.; Zhu, D.; Glownia, J. M.; Kozina, M.; Lemke, H. T.; Sikorski, M.; Feng, Y.; Nelson, S.; Saita, K.; Stankus, B.; Northey, T.; Hastings, J. B.; Weber, P. M.

    2015-06-01

    Structural rearrangements within single molecules occur on ultrafast time scales. Many aspects of molecular dynamics, such as the energy flow through excited states, have been studied using spectroscopic techniques, yet the goal to watch molecules evolve their geometrical structure in real time remains challenging. By mapping nuclear motions using femtosecond x-ray pulses, we have created real-space representations of the evolving dynamics during a well-known chemical reaction and show a series of time-sorted structural snapshots produced by ultrafast time-resolved hard x-ray scattering. A computational analysis optimally matches the series of scattering patterns produced by the x rays to a multitude of potential reaction paths. In so doing, we have made a critical step toward the goal of viewing chemical reactions on femtosecond time scales, opening a new direction in studies of ultrafast chemical reactions in the gas phase.

  8. Cellular automaton model of mass transport with chemical reactions

    International Nuclear Information System (INIS)

    Karapiperis, T.; Blankleider, B.

    1993-10-01

    The transport and chemical reactions of solutes are modelled as a cellular automaton in which molecules of different species perform a random walk on a regular lattice and react according to a local probabilistic rule. The model describes advection and diffusion in a simple way, and as no restriction is placed on the number of particles at a lattice site, it is also able to describe a wide variety of chemical reactions. Assuming molecular chaos and a smooth density function, we obtain the standard reaction-transport equations in the continuum limit. Simulations on one-and two-dimensional lattices show that the discrete model can be used to approximate the solutions of the continuum equations. We discuss discrepancies which arise from correlations between molecules and how these discrepancies disappear as the continuum limit is approached. Of particular interest are simulations displaying long-time behaviour which depends on long-wavelength statistical fluctuations not accounted for by the standard equations. The model is applied to the reactions a + b ↔ c and a + b → c with homogeneous and inhomogeneous initial conditions as well as to systems subject to autocatalytic reactions and displaying spontaneous formation of spatial concentration patterns. (author) 9 figs., 34 refs

  9. Challenge for real-time and real-space resolved spectroscopy of surface chemical reactions. Aiming at trace of irreversible and inhomogeneous reactions

    International Nuclear Information System (INIS)

    Amemiya, Kenta

    2015-01-01

    A novel experimental technique, time-resolved wavelength-dispersive soft X-ray imaging spectroscopy, is proposed in order to achieve real-time and real-space resolved spectroscopy for the observation of irreversible and inhomogeneous surface chemical reactions. By combining the wavelength-dispersed soft X rays, in which the X-ray wavelength (photon energy) changes as a function of position on the sample, with the photoelectron emission microscope, the soft X-ray absorption spectra are separately obtained at different positions on the sample without scanning the X-ray monochromator. Therefore, the real-time resolved measurement of site-selective soft X-ray absorption spectroscopy is realized in one event without repeating the chemical reaction. It is expected that the spatial distribution of different chemical species is traced during the surface chemical reaction, which is essential to understand the reaction mechanism. (author)

  10. Modified lignin: Preparation and use in reversible gel via Diels-Alder reaction.

    Science.gov (United States)

    Zhou, Wanpeng; Zhang, Hui; Chen, Fangeng

    2018-02-01

    In this study, popular soda lignin was modified with either furan or maleimide ring, and the modified lignins were subjected to reversible Diels-Alder reaction. A new process was proposed to prepare the functionalized lignin. A long chain was introduced to the hydroxyl groups of lignin, and then either the furan or maleimide ring was added to the other end of the chain. The test results confirmed that either the furan ring or the maleimide ring was bound to lignin. Furan- and maleimide-functionalized lignins were also combined to generate crosslinking via Diels-Alder [4+2] cycloaddition reaction. Under appropriate conditions, the formation of a gel was identified, which reverted to liquid state after retro Diels-Alder reaction upon heating at 120°C. This study reveals the significant versatility and potential of the developed strategy for the utilization of lignin-based recyclable networks. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Chemical reaction due to stronger Ramachandran interaction

    Indian Academy of Sciences (India)

    The origin of a chemical reaction between two reactant atoms is associated with the activation energy, on the assumption that, high-energy collisions between these atoms, are the ones that overcome the activation energy. Here, we show that a stronger attractive van der Waals (vdW) and electron-ion Coulomb interactions ...

  12. REACTION OF THE FEMALE BODY TO STRESS IN A CHEMICAL PROTECTIVE CLOTHING

    Directory of Open Access Journals (Sweden)

    Jiří SLABOTINSKÝ

    2016-12-01

    Full Text Available This article deals with the reaction of the female body to the use of an insulation chemical protective clothing combined with working – thermal and mental stress to which the female is exposed. The article provides a concise overview of protective chemical clothings and factors affecting their comfort; it describes the regularities corresponding to the physiological reaction, important for the body’s reaction to the use of a chemical protective clothing. Further, the article contains a description of the measurement and evaluation of physiological parameters of non-acclimated women during testing of these clothings and, finally, comparison with the results for males under the same stress which is unfavourable for women.

  13. On the network thermodynamics of mass action chemical reaction networks

    NARCIS (Netherlands)

    Schaft, A.J. van der; Rao, S.; Jayawardhana, B.

    In this paper we elaborate on the mathematical formulation of mass action chemical reaction networks as recently given in van der Schaft, Rao, Jayawardhana (2012). We show how the reference chemical potentials define a specific thermodynamical equilibrium, and we discuss the port-Hamiltonian

  14. Droplet heat transfer and chemical reactions during direct containment heating

    International Nuclear Information System (INIS)

    Baker, L. Jr.

    1986-01-01

    A simplified model of heat transfer and chemical reaction has been adapted to evaluate the expected behavior of droplets containing unreacted Zircaloy and stainless steel moving through the containment atmosphere during postulated accidents involving direct containment heating. The model includes internal and external diffusive resistances to reaction. The results indicate that reactions will be incomplete for many conditions characteristic of direct containment heating sequences

  15. Kinetics and thermochemistry of the reversible gas phase reaction HONO+NH3->3N-HONO studied by infrared diode laser spectroscopy

    DEFF Research Database (Denmark)

    Pagsberg, P.; Ratajczak, E.; Sillesen, A.

    1994-01-01

    The kinetics of the reversible reaction HONO+NH3 reversible H3N-HONO (1) was studied by monitoring trans-HONO relaxation kinetics. The rate of approach towards equilibrium was studied as a function of the ammonia concentration to obtain values of the rate constants for the forward and reverse rea...

  16. Out-of-equilibrium catalysis of chemical reactions by electronic tunnel currents.

    Science.gov (United States)

    Dzhioev, Alan A; Kosov, Daniel S; von Oppen, Felix

    2013-04-07

    We present an escape rate theory for current-induced chemical reactions. We use Keldysh nonequilibrium Green's functions to derive a Langevin equation for the reaction coordinate. Due to the out of equilibrium electronic degrees of freedom, the friction, noise, and effective temperature in the Langevin equation depend locally on the reaction coordinate. As an example, we consider the dissociation of diatomic molecules induced by the electronic current from a scanning tunnelling microscope tip. In the resonant tunnelling regime, the molecular dissociation involves two processes which are intricately interconnected: a modification of the potential energy barrier and heating of the molecule. The decrease of the molecular barrier (i.e., the current induced catalytic reduction of the barrier) accompanied by the appearance of the effective, reaction-coordinate-dependent temperature is an alternative mechanism for current-induced chemical reactions, which is distinctly different from the usual paradigm of pumping vibrational degrees of freedom.

  17. Finite element modeling of contaminant transport in soils including the effect of chemical reactions.

    Science.gov (United States)

    Javadi, A A; Al-Najjar, M M

    2007-05-17

    The movement of chemicals through soils to the groundwater is a major cause of degradation of water resources. In many cases, serious human and stock health implications are associated with this form of pollution. Recent studies have shown that the current models and methods are not able to adequately describe the leaching of nutrients through soils, often underestimating the risk of groundwater contamination by surface-applied chemicals, and overestimating the concentration of resident solutes. Furthermore, the effect of chemical reactions on the fate and transport of contaminants is not included in many of the existing numerical models for contaminant transport. In this paper a numerical model is presented for simulation of the flow of water and air and contaminant transport through unsaturated soils with the main focus being on the effects of chemical reactions. The governing equations of miscible contaminant transport including advection, dispersion-diffusion and adsorption effects together with the effect of chemical reactions are presented. The mathematical framework and the numerical implementation of the model are described in detail. The model is validated by application to a number of test cases from the literature and is then applied to the simulation of a physical model test involving transport of contaminants in a block of soil with particular reference to the effects of chemical reactions. Comparison of the results of the numerical model with the experimental results shows that the model is capable of predicting the effects of chemical reactions with very high accuracy. The importance of consideration of the effects of chemical reactions is highlighted.

  18. Chemical-Reaction-Controlled Phase Separated Drops: Formation, Size Selection, and Coarsening

    Science.gov (United States)

    Wurtz, Jean David; Lee, Chiu Fan

    2018-02-01

    Phase separation under nonequilibrium conditions is exploited by biological cells to organize their cytoplasm but remains poorly understood as a physical phenomenon. Here, we study a ternary fluid model in which phase-separating molecules can be converted into soluble molecules, and vice versa, via chemical reactions. We elucidate using analytical and simulation methods how drop size, formation, and coarsening can be controlled by the chemical reaction rates, and categorize the qualitative behavior of the system into distinct regimes. Ostwald ripening arrest occurs above critical reaction rates, demonstrating that this transition belongs entirely to the nonequilibrium regime. Our model is a minimal representation of the cell cytoplasm.

  19. Chemical respiratory allergy: Reverse engineering an adverse outcome pathway

    International Nuclear Information System (INIS)

    Kimber, Ian; Dearman, Rebecca J.; Basketter, David A.; Boverhof, Darrell R.

    2014-01-01

    Allergic sensitisation of the respiratory tract by chemicals is associated with rhinitis and asthma and remains an important occupational health issue. Although less than 80 chemicals have been confirmed as respiratory allergens the adverse health effects can be serious, and in rare instances can be fatal, and there are, in addition, related socioeconomic issues. The challenges that chemical respiratory allergy pose for toxicologists are substantial. No validated methods are available for hazard identification and characterisation, and this is due in large part to the fact that there remains considerable uncertainty and debate about the mechanisms through which sensitisation of the respiratory tract is acquired. Despite that uncertainty, there is a need to establish some common understanding of the key events and processes that are involved in respiratory sensitisation to chemicals and that might in turn provide the foundations for novel approaches to safety assessment. In recent years the concept of adverse outcome pathways (AOP) has gained some considerable interest among the toxicology community as a basis for outlining the key steps leading to an adverse health outcome, while also providing a framework for focusing future research, and for developing alternative paradigms for hazard characterisation. Here we explore application of the same general principles to an examination of the induction by chemicals of respiratory sensitisation. In this instance, however, we have chosen to adopt a reverse engineering approach and to model a possible AOP for chemical respiratory allergy working backwards from the elicitation of adverse health effects to the cellular and molecular mechanisms that are implicated in the acquisition of sensitisation

  20. Investigations of chemical reactions between U-Zr alloy and FBR cladding materials

    International Nuclear Information System (INIS)

    Ishii, Tetsuya; Ukai, Shigeharu

    2005-07-01

    U-Pu-Zr alloys are candidate materials for commercial FBR fuel. However, informations about chemical reactions with cladding materials developed by JNC for commercial FBR have not been well obtained. In this work, the reaction zones formed in four diffusion couples U-10wt.%Zr/PNC-FMS, U-10wt.%Zr/9Cr-ODS, U-10wt.%Zr/12Cr-ODS, and U-10wt.%Zr/Fe at about 1013K have been examined and following results were obtained. 1) At about 1013K, in the U-10wt.%Zr/Fe couple, the liquid phase zones were obtained. In the other couples U-10wt.%Zr/PNC-FMS, U-10wt.%Zr/9Cr-ODS and U-10wt.%Zr/12Cr-ODS, no liquid phase zones were obtained. The obtained chemical reaction zones in the later 3 couples were similar to the reported ones obtained in U-Zr/Fe couples without liquid phase formation. In comparison with the reaction zones obtained in the U-10wt.%Zr/Fe couple, the reaction zones inside cladding materials obtained in the PNC-FMS, 9Cr-ODS, and 12Cr-ODS couples were thin. 2) From the investigations of relationship between the obtained depths of the chemical reaction zones inside cladding materials and composition of the cladding materials, it was considered that the depth of chemical reaction zone would depend on the Cr content of the cladding materials and the depth would decrease with increasing Cr content, resulting in prevention of liquid phase formation. 3) From the investigations of the mechanisms of chemical reactions between U-Pu-Zr/cladding materials, it was considered that the same effect of Cr obtained in the U-Zr/cladding materials would be expected in U-Pu-Zr/cladding materials. Those seemed to indicate that the threshold temperatures of liquid phase formation for U-Pu-Zr/PNC-FMS, U-Pu-Zr/9Cr-ODS, and U-Pu-Zr/12Cr-ODS might be higher than that for U-Pu-Zr/Fe. (author)

  1. Quantum Chemical Approach to Estimating the Thermodynamics of Metabolic Reactions

    OpenAIRE

    Adrian Jinich; Dmitrij Rappoport; Ian Dunn; Benjamin Sanchez-Lengeling; Roberto Olivares-Amaya; Elad Noor; Arren Bar Even; Alán Aspuru-Guzik

    2014-01-01

    Thermodynamics plays an increasingly important role in modeling and engineering metabolism. We present the first nonempirical computational method for estimating standard Gibbs reaction energies of metabolic reactions based on quantum chemistry, which can help fill in the gaps in the existing thermodynamic data. When applied to a test set of reactions from core metabolism, the quantum chemical approach is comparable in accuracy to group contribution methods for isomerization and group transfe...

  2. Vicher: A Virtual Reality Based Educational Module for Chemical Reaction Engineering.

    Science.gov (United States)

    Bell, John T.; Fogler, H. Scott

    1996-01-01

    A virtual reality application for undergraduate chemical kinetics and reactor design education, Vicher (Virtual Chemical Reaction Model) was originally designed to simulate a portion of a modern chemical plant. Vicher now consists of two programs: Vicher I that models catalyst deactivation and Vicher II that models nonisothermal effects in…

  3. Lecithin-cholesterol acyltransferase (LCAT) catalyzes transacylation of intact cholesteryl esters. Evidence for the partial reversal of the forward LCAT reaction

    International Nuclear Information System (INIS)

    Sorci-Thomas, M.; Babiak, J.; Rudel, L.L.

    1990-01-01

    Lecithin-cholesterol acyltransferase (LCAT) catalyzes the intravascular synthesis of lipoprotein cholesteryl esters by converting cholesterol and lecithin to cholesteryl ester and lysolecithin. LCAT is unique in that it catalyzes sequential reactions within a single polypeptide sequence. In this report we find that LCAT mediates a partial reverse reaction, the transacylation of lipoprotein cholesteryl oleate, in whole plasma and in a purified, reconstituted system. As a result of the reverse transacylation reaction, a linear accumulation of [3H]cholesterol occurred during incubations of plasma containing high density lipoprotein labeled with [3H]cholesteryl oleate. When high density lipoprotein labeled with cholesteryl [14C]oleate was also included in the incubation the labeled fatty acyl moiety remained in the cholesteryl [14C]oleate pool showing that the formation of labeled cholesterol did not result from hydrolysis of the doubly labeled cholesteryl esters. The rate of release of [3H]cholesterol was only about 10% of the forward rate of esterification of cholesterol using partially purified human LCAT and was approximately 7% in whole monkey plasma. Therefore, net production of cholesterol via the reverse LCAT reaction would not occur. [3H]Cholesterol production from [3H]cholesteryl oleate was almost completely inhibited by a final concentration of 1.4 mM 5,5'-dithiobis(nitrobenzoic acid) during incubation with either purified LCAT or whole plasma. Addition of excess lysolecithin to the incubation system did not result in the formation of [14C]oleate-labeled lecithin, showing that the reverse reaction found here for LCAT was limited to the last step of the reaction. To explain these results we hypothesize that LCAT forms a [14C]oleate enzyme thioester intermediate after its attack on the cholesteryl oleate molecule

  4. Reaction diffusion and solid state chemical kinetics handbook

    CERN Document Server

    Dybkov, V I

    2010-01-01

    This monograph deals with a physico-chemical approach to the problem of the solid-state growth of chemical compound layers and reaction-diffusion in binary heterogeneous systems formed by two solids; as well as a solid with a liquid or a gas. It is explained why the number of compound layers growing at the interface between the original phases is usually much lower than the number of chemical compounds in the phase diagram of a given binary system. For example, of the eight intermetallic compounds which exist in the aluminium-zirconium binary system, only ZrAl3 was found to grow as a separate

  5. The 8Li(α,n)11B reaction and primordial nucleosynthesis

    International Nuclear Information System (INIS)

    Boyd, R.N.

    1992-01-01

    The cross section for the 8 Li(α,n) 11 B reaction, of importance to synthesis of 11 B and heavier nuclides following the big bang, has been measured using the radioactive beam facility of The Institute of Physical and Chemical Reasearch (RIKEN). The reaction cross section was found to be about five times larger than that estimated from the time reversed reaction cross section. (author)

  6. Apparent tunneling in chemical reactions

    DEFF Research Database (Denmark)

    Henriksen, Niels Engholm; Hansen, Flemming Yssing; Billing, G. D.

    2000-01-01

    A necessary condition for tunneling in a chemical reaction is that the probability of crossing a barrier is non-zero, when the energy of the reactants is below the potential energy of the barrier. Due to the non-classical nature (i.e, momentum uncertainty) of vibrational states this is, however......, not a sufficient condition in order to establish genuine tunneling as a result of quantum dynamics. This proposition is illustrated for a two-dimensional model potential describing dissociative sticking of N-2 on Ru(s). It is suggested that the remarkable heavy atom tunneling, found in this system, is related...

  7. Chemical reactions in organic monomolecular layers. Condensation of hydrazine on carbonyl functions

    International Nuclear Information System (INIS)

    Rosilio, Charles; Ruaudel-Teixier, Annie.

    1976-01-01

    Evidence is given for chemical reactions of hydrazine (NH 2 -NH 2 ) with different carbonyl functional groups of organic molecules in the solid state, in monomolecular layer structures. The condensation of hydrazine with these molecules leads to conjugated systems by bridging the N-N links, to cyclizations, and also to polycondensations. The reactions investigated were followed up by infrared spectrophotometry, by transmission and metallic reflection. These chemical reactions revealed in the solid phase constitute a polycondensation procedure which is valuable in obtaining organized polymers in monomolecular layers [fr

  8. Real time monitoring of accelerated chemical reactions by ultrasonication-assisted spray ionization mass spectrometry.

    Science.gov (United States)

    Lin, Shu-Hsuan; Lo, Ta-Ju; Kuo, Fang-Yin; Chen, Yu-Chie

    2014-01-01

    Ultrasonication has been used to accelerate chemical reactions. It would be ideal if ultrasonication-assisted chemical reactions could be monitored by suitable detection tools such as mass spectrometry in real time. It would be helpful to clarify reaction intermediates/products and to have a better understanding of reaction mechanism. In this work, we developed a system for ultrasonication-assisted spray ionization mass spectrometry (UASI-MS) with an ~1.7 MHz ultrasonic transducer to monitor chemical reactions in real time. We demonstrated that simply depositing a sample solution on the MHz-based ultrasonic transducer, which was placed in front of the orifice of a mass spectrometer, the analyte signals can be readily detected by the mass spectrometer. Singly and multiply charged ions from small and large molecules, respectively, can be observed in the UASI mass spectra. Furthermore, the ultrasonic transducer used in the UASI setup accelerates the chemical reactions while being monitored via UASI-MS. The feasibility of using this approach for real-time acceleration/monitoring of chemical reactions was demonstrated. The reactions of Girard T reagent and hydroxylamine with steroids were used as the model reactions. Upon the deposition of reactant solutions on the ultrasonic transducer, the intermediate/product ions are readily generated and instantaneously monitored using MS within 1 s. Additionally, we also showed the possibility of using this reactive UASI-MS approach to assist the confirmation of trace steroids from complex urine samples by monitoring the generation of the product ions. Copyright © 2014 John Wiley & Sons, Ltd.

  9. Understanding Chemical Reaction Kinetics and Equilibrium with Interlocking Building Blocks

    Science.gov (United States)

    Cloonan, Carrie A.; Nichol, Carolyn A.; Hutchinson, John S.

    2011-01-01

    Chemical reaction kinetics and equilibrium are essential core concepts of chemistry but are challenging topics for many students, both at the high school and undergraduate university level. Visualization at the molecular level is valuable to aid understanding of reaction kinetics and equilibrium. This activity provides a discovery-based method to…

  10. Application of a reversible chemical reaction system to solar thermal power plants

    Science.gov (United States)

    Hanseth, E. J.; Won, Y. S.; Seibowitz, L. P.

    1980-01-01

    Three distributed dish solar thermal power systems using various applications of SO2/SO3 chemical energy storage and transport technology were comparatively assessed. Each system features various roles for the chemical system: (1) energy storage only, (2) energy transport, or (3) energy transport and storage. These three systems were also compared with the dish-Stirling, using electrical transport and battery storage, and the central receiver Rankine system, with thermal storage, to determine the relative merit of plants employing a thermochemical system. As an assessment criterion, the busbar energy costs were compared. Separate but comparable solar energy cost computer codes were used for distributed receiver and central receiver systems. Calculations were performed for capacity factors ranging from 0.4 to 0.8. The results indicate that SO2/SO3 technology has the potential to be more cost effective in transporting the collected energy than in storing the energy for the storage capacity range studied (2-15 hours)

  11. Thermally activated reaction–diffusion-controlled chemical bulk reactions of gases and solids

    Directory of Open Access Journals (Sweden)

    S. Möller

    2015-01-01

    Full Text Available The chemical kinetics of the reaction of thin films with reactive gases is investigated. The removal of thin films using thermally activated solid–gas to gas reactions is a method to in-situ control deposition inventory in vacuum and plasma vessels. Significant scatter of experimental deposit removal rates at apparently similar conditions was observed in the past, highlighting the need for understanding the underlying processes. A model based on the presence of reactive gas in the films bulk and chemical kinetics is presented. The model describes the diffusion of reactive gas into the film and its chemical interaction with film constituents in the bulk using a stationary reaction–diffusion equation. This yields the reactive gas concentration and reaction rates. Diffusion and reaction rate limitations are depicted in parameter studies. Comparison with literature data on tokamak co-deposit removal results in good agreement of removal rates as a function of pressure, film thickness and temperature.

  12. Chemical Reaction Engineering: Current Status and Future Directions.

    Science.gov (United States)

    Dudukovic, M. P.

    1987-01-01

    Describes Chemical Reaction Engineering (CRE) as the discipline that quantifies the interplay of transport phenomena and kinetics in relating reactor performance to operating conditions and input variables. Addresses the current status of CRE in both academic and industrial settings and outlines future trends. (TW)

  13. Students' Visualisation of Chemical Reactions--Insights into the Particle Model and the Atomic Model

    Science.gov (United States)

    Cheng, Maurice M. W.

    2018-01-01

    This paper reports on an interview study of 18 Grade 10-12 students' model-based reasoning of a chemical reaction: the reaction of magnesium and oxygen at the submicro level. It has been proposed that chemical reactions can be conceptualised using two models: (i) the "particle model," in which a reaction is regarded as the simple…

  14. Perspective: Chemical reactions in ionic liquids monitored through the gas (vacuum)/liquid interface.

    Science.gov (United States)

    Maier, F; Niedermaier, I; Steinrück, H-P

    2017-05-07

    This perspective analyzes the potential of X-ray photoelectron spectroscopy under ultrahigh vacuum (UHV) conditions to follow chemical reactions in ionic liquids in situ. Traditionally, only reactions occurring on solid surfaces were investigated by X-ray photoelectron spectroscopy (XPS) in situ. This was due to the high vapor pressures of common liquids or solvents, which are not compatible with the required UHV conditions. It was only recently realized that the situation is very different when studying reactions in Ionic Liquids (ILs), which have an inherently low vapor pressure, and first studies have been performed within the last years. Compared to classical spectroscopy techniques used to monitor chemical reactions, the advantage of XPS is that through the analysis of their core levels all relevant elements can be quantified and their chemical state can be analyzed under well-defined (ultraclean) conditions. In this perspective, we cover six very different reactions which occur in the IL, with the IL, or at an IL/support interface, demonstrating the outstanding potential of in situ XPS to gain insights into liquid phase reactions in the near-surface region.

  15. A rapidly-reversible absorptive and emissive vapochromic Pt(II) pincer-based chemical sensor.

    Science.gov (United States)

    Bryant, M J; Skelton, J M; Hatcher, L E; Stubbs, C; Madrid, E; Pallipurath, A R; Thomas, L H; Woodall, C H; Christensen, J; Fuertes, S; Robinson, T P; Beavers, C M; Teat, S J; Warren, M R; Pradaux-Caggiano, F; Walsh, A; Marken, F; Carbery, D R; Parker, S C; McKeown, N B; Malpass-Evans, R; Carta, M; Raithby, P R

    2017-11-27

    Selective, robust and cost-effective chemical sensors for detecting small volatile-organic compounds (VOCs) have widespread applications in industry, healthcare and environmental monitoring. Here we design a Pt(II) pincer-type material with selective absorptive and emissive responses to methanol and water. The yellow anhydrous form converts reversibly on a subsecond timescale to a red hydrate in the presence of parts-per-thousand levels of atmospheric water vapour. Exposure to methanol induces a similarly-rapid and reversible colour change to a blue methanol solvate. Stable smart coatings on glass demonstrate robust switching over 10 4 cycles, and flexible microporous polymer membranes incorporating microcrystals of the complex show identical vapochromic behaviour. The rapid vapochromic response can be rationalised from the crystal structure, and in combination with quantum-chemical modelling, we provide a complete microscopic picture of the switching mechanism. We discuss how this multiscale design approach can be used to obtain new compounds with tailored VOC selectivity and spectral responses.

  16. Improving plasma resistance and lowering roughness in an ArF photoresist by adding a chemical reaction inhibitor

    International Nuclear Information System (INIS)

    Jinnai, Butsurin; Uesugi, Takuji; Koyama, Koji; Samukawa, Seiji; Kato, Keisuke; Yasuda, Atsushi; Maeda, Shinichi; Momose, Hikaru

    2010-01-01

    Major challenges associated with 193 nm lithography using an ArF photoresist are low plasma resistance and roughness formation in the ArF photoresist during plasma processes. We have previously found decisive factors affecting the plasma resistance and roughness formation in an ArF photoresist: plasma resistance is determined by UV/VUV radiation, and roughness formation is dominated by chemical reactions. In this study, based on our findings on the interaction between plasma radiation species and ArF photoresist polymers, we proposed an ArF photoresist with a chemical reaction inhibitor, which can trap reactive species from the plasma, and characterized the performances of the resultant ArF photoresist through neutral beam experiments. Hindered amine light stabilizers, i.e. 4-hydroxy-2,2,6,6-tetramethyl-1-piperidinyloxy (HO-TEMPO), were used as the chemical reaction inhibitor. Etching rates of the ArF photoresist films were not dependent on the HO-TEMPO content in the irradiations without chemical reactions or under UV/VUV radiation. However, in the irradiation with chemical reactions, the etching rates of the ArF photoresist films decreased as the HO-TEMPO content increased. In addition, the surface roughness decreased with the increase in the additive amount of chemical reaction inhibitor. According to FTIR analysis, a chemical reaction inhibitor can inhibit the chemical reactions in ArF photoresist films through plasma radicals. These results indicate that a chemical reaction inhibitor is effective against chemical reactions, resulting in improved plasma resistance and less roughness in an ArF photoresist. These results also support our suggested mechanism of plasma resistance and roughness formation in an ArF photoresist.

  17. High resolution time-of-flight spectrometer for crossed molecular beam study of elementary chemical reactions

    International Nuclear Information System (INIS)

    Qiu Minghui; Che Li; Ren Zefeng; Dai Dongxu; Wang Xiuyan; Yang Xueming

    2005-01-01

    In this article, we describe an apparatus in our laboratory for investigating elementary chemical reactions using the high resolution time-of-flight Rydberg tagging method. In this apparatus, we have adopted a rotating source design so that collision energy can be changed for crossed beam studies of chemical reactions. Preliminary results on the HI photodissociation and the F atom reaction with H 2 are reported here. These results suggest that the experimental apparatus is potentially a powerful tool for investigating state-to-state dynamics of elementary chemical reactions

  18. Iteration scheme for implicit calculations of kinetic and equilibrium chemical reactions in fluid dynamics

    International Nuclear Information System (INIS)

    Ramshaw, J.D.; Chang, C.H.

    1995-01-01

    An iteration scheme for the implicit treatment of equilibrium chemical reactions in partial equilibrium flow has previously been described. Here we generalize this scheme to kinetic reactions as well as equilibrium reactions. This extends the applicability of the scheme to problems with kinetic reactions that are fast in regions of the flow field but slow in others. The resulting scheme thereby provides a single unified framework for the implicit treatment of an arbitrary number of coupled equilibrium and kinetic reactions in chemically reacting fluid flow. 10 refs., 2 figs

  19. Results of the 2010 Survey on Teaching Chemical Reaction Engineering

    Science.gov (United States)

    Silverstein, David L.; Vigeant, Margot A. S.

    2012-01-01

    A survey of faculty teaching the chemical reaction engineering course or sequence during the 2009-2010 academic year at chemical engineering programs in the United States and Canada reveals change in terms of content, timing, and approaches to teaching. The report consists of two parts: first, a statistical and demographic characterization of the…

  20. Scandium(III) catalysis of transimination reactions. Independent and constitutionally coupled reversible processes.

    Science.gov (United States)

    Giuseppone, Nicolas; Schmitt, Jean-Louis; Schwartz, Evan; Lehn, Jean-Marie

    2005-04-20

    Sc(OTf)(3) efficiently catalyzes the self-sufficient transimination reaction between various types of C=N bonds in organic solvents, with turnover frequencies up to 3600 h(-)(1) and rate accelerations up to 6 x 10(5). The mechanism of the crossover reaction in mixtures of amines and imines is studied, comparing parallel individual reactions with coupled equilibria. The intrinsic kinetic parameters for isolated reactions cannot simply be added up when several components are mixed, and the behavior of the system agrees with the presence of a unique mediator that constitutes the core of a network of competing reactions. In mixed systems, every single amine or imine competes for the same central hub, in accordance with their binding affinity for the catalyst metal ion center. More generally, the study extends the basic principles of constitutional dynamic chemistry to interconnected chemical transformations and provides a step toward dynamic systems of increasing complexity.

  1. Microbial reverse-electrodialysis chemical-production cell for acid and alkali production

    KAUST Repository

    Zhu, Xiuping

    2013-06-01

    A new type of bioelectrochemical system, called a microbial reverse-electrodialysis chemical-production cell (MRCC), was developed to produce acid and alkali using energy derived from organic matter (acetate) and salinity gradients (NaCl solutions representative of seawater and river water). A bipolar membrane (BPM) was placed next to the anode to prevent Cl- contamination and acidification of the anolyte, and to produce protons for HCl recovery. A 5-cell paired reverse-electrodialysis (RED) stack provided the electrical energy required to overcome the BPM over-potential (0.3-0.6 V), making the overall process spontaneous. The MRCC reactor produced electricity (908 mW/m2) as well as concentrated acidic and alkaline solutions, and therefore did not require an external power supply. After a fed-batch cycle, the pHs of the chemical product solutions were 1.65 ± 0.04 and 11.98 ± 0.10, due to the production of 1.35 ± 0.13 mmol of acid, and 0.59 ± 0.14 mmol of alkali. The acid- and alkali-production efficiencies based on generated current were 58 ± 3% and 25 ± 3%. These results demonstrated proof-of-concept acid and alkali production using only renewable energy sources. © 2013 Elsevier B.V.

  2. Nonlinear magnetoacoustic wave propagation with chemical reactions

    Science.gov (United States)

    Margulies, Timothy Scott

    2002-11-01

    The magnetoacoustic problem with an application to sound wave propagation through electrically conducting fluids such as the ocean in the Earth's magnetic field, liquid metals, or plasmas has been addressed taking into account several simultaneous chemical reactions. Using continuum balance equations for the total mass, linear momentum, energy; as well as Maxwell's electrodynamic equations, a nonlinear beam equation has been developed to generalize the Khokhlov-Zabolotskaya-Kuznetsov (KZK) equation for a fluid with linear viscosity but nonlinear and diffraction effects. Thermodynamic parameters are used and not tailored to only an adiabatic fluid case. The chemical kinetic equations build on a relaxing media approach presented, for example, by K. Naugolnukh and L. Ostrovsky [Nonlinear Wave Processes in Acoustics (Cambridge Univ. Press, Cambridge, 1998)] for a linearized single reaction and thermodynamic pressure equation of state. Approximations for large and small relaxation times and for magnetohydrodynamic parameters [Korsunskii, Sov. Phys. Acoust. 36 (1990)] are examined. Additionally, Cattaneo's equation for heat conduction and its generalization for a memory process rather than a Fourier's law are taken into account. It was introduced for the heat flux depends on the temperature gradient at an earlier time to generate heat pulses of finite speed.

  3. On the mechanism of effective chemical reactions with turbulent mixing of reactants and finite rate of molecular reactions

    Energy Technology Data Exchange (ETDEWEB)

    Vorotilin, V. P., E-mail: VPVorotilin@yandex.ru [Russian Academy of Sciences, Institute of Applied Mechanics (Russian Federation)

    2017-01-15

    A generalization of the theory of chemical transformation processes under turbulent mixing of reactants and arbitrary values of the rate of molecular reactions is presented that was previously developed for the variant of an instantaneous reaction [13]. The use of the features of instantaneous reactions when considering the general case, namely, the introduction of the concept of effective reaction for the reactant volumes and writing a closing conservation equation for these volumes, became possible due to the partition of the whole amount of reactants into “active” and “passive” classes; the reactants of the first class are not mixed and react by the mechanism of instantaneous reactions, while the reactants of the second class approach each other only through molecular diffusion, and therefore their contribution to the reaction process can be neglected. The physical mechanism of reaction for the limit regime of an ideal mixing reactor (IMR) is revealed and described. Although formally the reaction rate in this regime depends on the concentration of passive fractions of the reactants, according to the theory presented, the true (hidden) mechanism of the reaction is associated only with the reaction of the active fractions of the reactants with vanishingly small concentration in the volume of the reactor. It is shown that the rate constant of fast chemical reactions can be evaluated when the mixing intensity of reactants is much less than that needed to reach the mixing conditions in an IMR.

  4. Achieving Chemical Equilibrium: The Role of Imposed Conditions in the Ammonia Formation Reaction

    Science.gov (United States)

    Tellinghuisen, Joel

    2006-01-01

    Under conditions of constant temperature T and pressure P, chemical equilibrium occurs in a closed system (fixed mass) when the Gibbs free energy G of the reaction mixture is minimized. However, when chemical reactions occur under other conditions, other thermodynamic functions are minimized or maximized. For processes at constant T and volume V,…

  5. Computing multi-species chemical equilibrium with an algorithm based on the reaction extents

    DEFF Research Database (Denmark)

    Paz-Garcia, Juan Manuel; Johannesson, Björn; Ottosen, Lisbeth M.

    2013-01-01

    -negative constrains. The residual function, representing the distance to the equilibrium, is defined from the chemical potential (or Gibbs energy) of the chemical system. Local minimums are potentially avoided by the prioritization of the aqueous reactions with respect to the heterogeneous reactions. The formation......A mathematical model for the solution of a set of chemical equilibrium equations in a multi-species and multiphase chemical system is described. The computer-aid solution of model is achieved by means of a Newton-Raphson method enhanced with a line-search scheme, which deals with the non...... and release of gas bubbles is taken into account in the model, limiting the concentration of volatile aqueous species to a maximum value, given by the gas solubility constant.The reaction extents are used as state variables for the numerical method. As a result, the accepted solution satisfies the charge...

  6. Laser studies of chemical reaction and collision processes

    Energy Technology Data Exchange (ETDEWEB)

    Flynn, G. [Columbia Univ., New York, NY (United States)

    1993-12-01

    This work has concentrated on several interrelated projects in the area of laser photochemistry and photophysics which impinge on a variety of questions in combustion chemistry and general chemical kinetics. Infrared diode laser probes of the quenching of molecules with {open_quotes}chemically significant{close_quotes} amounts of energy in which the energy transferred to the quencher has, for the first time, been separated into its vibrational, rotational, and translational components. Probes of quantum state distributions and velocity profiles for atomic fragments produced in photodissociation reactions have been explored for iodine chloride.

  7. NATO Advanced Study Institute on Advances in Chemical Reaction Dynamics

    CERN Document Server

    Capellos, Christos

    1986-01-01

    This book contains the formal lectures and contributed papers presented at the NATO Advanced Study Institute on. the Advances in Chemical Reaction Dynamics. The meeting convened at the city of Iraklion, Crete, Greece on 25 August 1985 and continued to 7 September 1985. The material presented describes the fundamental and recent advances in experimental and theoretical aspects of, reaction dynamics. A large section is devoted to electronically excited states, ionic species, and free radicals, relevant to chemical sys­ tems. In addition recent advances in gas phase polymerization, formation of clusters, and energy release processes in energetic materials were presented. Selected papers deal with topics such as the dynamics of electric field effects in low polar solutions, high electric field perturbations and relaxation of dipole equilibria, correlation in picosecond/laser pulse scattering, and applications to fast reaction dynamics. Picosecond transient Raman spectroscopy which has been used for the elucidati...

  8. A kinetic model for chemical reactions without barriers: transport coefficients and eigenmodes

    International Nuclear Information System (INIS)

    Alves, Giselle M; Kremer, Gilberto M; Marques, Wilson Jr; Soares, Ana Jacinta

    2011-01-01

    The kinetic model of the Boltzmann equation proposed in the work of Kremer and Soares 2009 for a binary mixture undergoing chemical reactions of symmetric type which occur without activation energy is revisited here, with the aim of investigating in detail the transport properties of the reactive mixture and the influence of the reaction process on the transport coefficients. Accordingly, the non-equilibrium solutions of the Boltzmann equations are determined through an expansion in Sonine polynomials up to the first order, using the Chapman–Enskog method, in a chemical regime for which the reaction process is close to its final equilibrium state. The non-equilibrium deviations are explicitly calculated for what concerns the thermal–diffusion ratio and coefficients of shear viscosity, diffusion and thermal conductivity. The theoretical and formal analysis developed in the present paper is complemented with some numerical simulations performed for different concentrations of reactants and products of the reaction as well as for both exothermic and endothermic chemical processes. The results reveal that chemical reactions without energy barrier can induce an appreciable influence on the transport properties of the mixture. Oppositely to the case of reactions with activation energy, the coefficients of shear viscosity and thermal conductivity become larger than those of an inert mixture when the reactions are exothermic. An application of the non-barrier model and its detailed transport picture are included in this paper, in order to investigate the dynamics of the local perturbations on the constituent number densities, and velocity and temperature of the whole mixture, induced by spontaneous internal fluctuations. It is shown that for the longitudinal disturbances there exist two hydrodynamic sound modes, one purely diffusive hydrodynamic mode and one kinetic mode

  9. A kinetic model for chemical reactions without barriers: transport coefficients and eigenmodes

    Science.gov (United States)

    Alves, Giselle M.; Kremer, Gilberto M.; Marques, Wilson, Jr.; Jacinta Soares, Ana

    2011-03-01

    The kinetic model of the Boltzmann equation proposed in the work of Kremer and Soares 2009 for a binary mixture undergoing chemical reactions of symmetric type which occur without activation energy is revisited here, with the aim of investigating in detail the transport properties of the reactive mixture and the influence of the reaction process on the transport coefficients. Accordingly, the non-equilibrium solutions of the Boltzmann equations are determined through an expansion in Sonine polynomials up to the first order, using the Chapman-Enskog method, in a chemical regime for which the reaction process is close to its final equilibrium state. The non-equilibrium deviations are explicitly calculated for what concerns the thermal-diffusion ratio and coefficients of shear viscosity, diffusion and thermal conductivity. The theoretical and formal analysis developed in the present paper is complemented with some numerical simulations performed for different concentrations of reactants and products of the reaction as well as for both exothermic and endothermic chemical processes. The results reveal that chemical reactions without energy barrier can induce an appreciable influence on the transport properties of the mixture. Oppositely to the case of reactions with activation energy, the coefficients of shear viscosity and thermal conductivity become larger than those of an inert mixture when the reactions are exothermic. An application of the non-barrier model and its detailed transport picture are included in this paper, in order to investigate the dynamics of the local perturbations on the constituent number densities, and velocity and temperature of the whole mixture, induced by spontaneous internal fluctuations. It is shown that for the longitudinal disturbances there exist two hydrodynamic sound modes, one purely diffusive hydrodynamic mode and one kinetic mode.

  10. Deviation from the kinetic law of mass action for reactions induced by binary encounters in liquid solutions

    International Nuclear Information System (INIS)

    Doktorov, Alexander B; Kipriyanov, Alexey A

    2007-01-01

    In considering the irreversible chemical reaction A+B→ C+B in liquid solutions two many-particle approaches to the derivation of binary non-Markovian kinetic equations are compared: simple superposition decoupling and a method of extracting 'pair' channels from three-particle correlation evolution. It is shown that both methods provide an almost identical description of this reaction. However, in studies of reversible reactions in liquid solutions only the channel extraction method gives a correct physically clear description of the reaction though it consists of a sequence of steps: the development of integral encounter theory (IET), effective pairs approximation (EPA), modified encounter theory (MET), and the final regular form (RF) of kinetic equations. It is shown that the rate equations often encountered in the literature correspond to the independence of transient channels of 'scattering' in the bimolecular reversible reaction (A+B -B), while the independent transient channel of 'decay' in the reversible reactionA+B -C is defined solely by time integral convolution. In the general case transient channels in non-Markovian theory are not independent, and their interference manifests itself as a non-Markovian inhomogeneous source in binary non-Markovian kinetic equations in regular form. Based on the derived equations new universal kinetics (independent of models) of chemical equilibrium attainment have been obtained. It is shown that these kinetics can differ essentially from the kinetics corresponding to the kinetic law of mass action of formal chemical kinetics

  11. Phenomenon of quantum low temperature limit of chemical reaction rates

    International Nuclear Information System (INIS)

    Gol'danskij, V.I.

    1975-01-01

    The influence of quantum-mechanical effects on one of the fundamental laws of chemical kinetics - the Arrhenius law - is considered. Criteria characterising the limits of the low-temperature region where the extent of quantum-mechanical tunnelling transitions exceeds exponentially the transitions over the barrier are quoted. Studies of the low-temperature tunnelling of electrons and hydrogen atoms are briefly mentioned and the history of research on low-temperature radiation-induced solid-phase polymerisation, the development of which led to the discovery of the phenomenon of the low-temperature quantum-mechanical limit for the rates of chemical reactions in relation to the formaldehyde polymerisation reaction, is briefly considered. The results of experiments using low-inertia calorimeters, whereby it is possible to determine directly the average time (tau 0 ) required to add one new link to the polymer chain of formaldehyde during its polymerisation by radiation and during postpolymerisation and to establish that below 80K the increase of tau 0 slows down and that at T approximately equal to 10-4K the time tau 0 reaches a plateau (tau 0 approximately equals 0.01s), are described. Possible explanations of the observed low-temperature limit for the rate of a chemical reaction are critically examined and a semiquantitative explanation is given for this phenomenon, which may be particularly common in combined electronic-confirmational transitions in complex biological molecules and may play a definite role in chemical and biological evolution (cold prehistory of life)

  12. Phenomenon of quantum low temperature limit of chemical reaction rates

    Energy Technology Data Exchange (ETDEWEB)

    Gol' danskii, V I [AN SSSR, Moscow. Inst. Khimicheskoj Fiziki

    1975-12-01

    The influence of quantum-mechanical effects on one of the fundamental laws of chemical kinetics - the Arrhenius Law - is considered. Criteria characterising the limits of the low-temperature region where the extent of quantum-mechanical tunnelling transitions exceeds exponentially the transitions over the barrier are quoted. Studies of the low-temperature tunnelling of electrons and hydrogen atoms are briefly mentioned and the history of research on low-temperature radiation-induced solid-phase polymerization, the development of which led to the discovery of the phenomenon of the low-temperature quantum-mechanical limit for the rates of chemical reactions in relation to the formaldehyde polymerization reaction, is briefly considered. The results of experiments using low-inertia calorimeters, whereby it is possible to determine directly the average time (tau/sub 0/) required to add one new link to the polymer chain of formaldehyde during its polymerization by radiation and during postpolymerization and to establish that below 80K the increase of tau/sub 0/ slows down and that at T approximately equal to 10-4K the time tau/sub 0/ reaches a plateau (tau/sub 0/ approximately equals 0.01s), are described. Possible explanations of the observed low-temperature limit for the rate of a chemical reaction are critically examined and a semiquantitative explanation is given for this phenomenon, which may be particularly common in combined electronic-confirmational transitions in complex biological molecules and may play a definite role in chemical and biological evolution (cold prehistory of life).

  13. An in-situ chemical reaction deposition of nanosized wurtzite CdS thin films

    International Nuclear Information System (INIS)

    Chu Juan; Jin Zhengguo; Cai Shu; Yang Jingxia; Hong Zhanglian

    2012-01-01

    Nanocrystalline CdS thin films were deposited on glass substrates by an ammonia-free in-situ chemical reaction synthesis technique using cadmium cationic precursor solid films as reaction source and sodium sulfide based solutions as anionic reaction medium. Effects of ethanolamine addition to the cadmium cationic precursor solid films, deposition cycle numbers and annealing treatments in Ar atmosphere on structure, morphology, chemical composition and optical properties of the resultant films were investigated by X-ray diffraction, field emission scanning electron microscope, energy dispersive X-ray analysis and UV–Vis spectra measurements. The results show that CdS thin films deposited by the in-situ chemical reaction synthesis have wurtzite structure with (002) plane preferential orientation and crystallite size is in the range of 16 nm–19 nm. The growth of film thickness is almost constant with deposition cycle numbers and about 96 nm per cycle.

  14. Chemical reactions induced by fast neutron irradiation

    International Nuclear Information System (INIS)

    Katsumura, Y.

    1989-01-01

    Here, several studies on fast neutron irradiation effects carried out at the reactor 'YAYOI' are presented. Some indicate a significant difference in the effect from those by γ-ray irradiation but others do not, and the difference changes from subject to subject which we observed. In general, chemical reactions induced by fast neutron irradiation expand in space and time, and there are many aspects. In the time region just after the deposition of neutron energy in the system, intermediates are formed densely and locally reflecting high LET of fast neutrons and, with time, successive reactions proceed parallel to dissipation of localized energy and to diffusion of the intermediates. Finally the reactions are completed in longer time region. If we pick up the effects which reserve the locality of the initial processes, a significant different effect between in fast neutron radiolysis and in γ-ray radiolysis would be derived. If we observe the products generated after dissipation and diffusion in longer time region, a clear difference would not be observed. Therefore, in order to understand the fast neutron irradiation effects, it is necessary to know the fundamental processes of the reactions induced by radiations. (author)

  15. From simple to complex and backwards. Chemical reactions under very high pressure

    International Nuclear Information System (INIS)

    Bini, Roberto; Ceppatelli, Matteo; Citroni, Margherita; Schettino, Vincenzo

    2012-01-01

    Highlights: ► High pressure reactivity of several molecular systems. ► Reaction kinetics and dynamics in high density conditions. ► Key role of optical pumping and electronic excitation. ► Perspectives for the synthesis of hydrogen. - Abstract: High pressure chemical reactions of molecular systems are discussed considering the various factors that can affect the reactivity. These include steric hindrance and geometrical constraints in the confined environment of crystals at high pressure, changes of the free energy landscape with pressure, photoactivation by two-photon absorption, local and collective effects. A classification of the chemical reactions at high pressure is attempted on the basis of the prevailing factors.

  16. Sintering with a chemical reaction as applied to uranium monocarbide; Frittage-reaction dans le cas du monocarbure d'uranium

    Energy Technology Data Exchange (ETDEWEB)

    Accary, A; Caillat, R [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1960-07-01

    The present paper provides a survey of different investigations whose aim was the preparation and fabrication of uranium monocarbide for nuclear use. If a chemical reaction takes place in the sample during the sintering operation, it may be expected that the atom rearrangements involved in this reaction should favour the sintering process and thereby lower the temperature needed to yield a body of a given density. With this hypothesis in mind, the following methods have been studied: - Sintering of U-C mixtures; - Sintering of UO{sub 2}-C mixtures; - Hot pressing of U-C mixtures; - Extrusion of U-C mixtures. To generalize our result, it could be said that a chemical reaction does not lead to high densification, if one depends on a simple contact between discrete particles. On the contrary, a chemical reaction can help sintering if, as our hot pressing experiments shows, the densification can be achieved prior to the reaction. (author) [French] Le present article resume les etudes faites pour le compte du Commissariat a l'Energie Atomique dans le but de preparer du monocarbure d'uranium pour usage nucleaire. Si, en meme temps que l'on fritte une poudre, celle-ci est le siege d'une reaction chimique, on peut s'attendre a ce que le rearrangement atomique d'une reaction chimique favorise le frittage et, ainsi abaisse la temperature de travail necessaire pour obtenir une densite donnee. Nous avons etudie les methodes suivantes: - frittage des melanges U-C; - frittage des melanges UO{sub 2}-C; - frittage sous charge des melanges U-C; - filage des melanges U-C. Nos resultats montrent qu'une reaction chimique en cours de frittage ne conduit pas a un produit de haute densite si on opere sur un melange de poudres. Par contre, elle permet d'atteindre de hautes densites si la densification peut etre obtenue avant la reaction chimique. (auteur)

  17. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    Science.gov (United States)

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Introduction to time reversal theory

    International Nuclear Information System (INIS)

    Henley, E.M.

    1987-01-01

    Theory and reaction mechanisms relevant to time reversal invariance are reviewed. Consequences of time reversal invariance are presented under the headings of CP tests, electromagnetic moments, weak emissions or absorptions, and scattering reactions. 8 refs., 4 figs

  19. A method for carrying out radiolysis and chemical reactions by means of the radiations resulting from a thermonuclear reaction

    International Nuclear Information System (INIS)

    Gomberg, H.J.

    1974-01-01

    The invention relates to the use of the radiations resulting from thermonuclear reactions. It deals with a method comprising a combination of thermo-chemical and radiolytic reactions for treating a molecule having a high absorption rate, by the radiations of a thermonuclear reaction. This is applicable to the dissociation of water into oxygen and hydrogen [fr

  20. Chemical markup, XML, and the world wide web. 6. CMLReact, an XML vocabulary for chemical reactions.

    Science.gov (United States)

    Holliday, Gemma L; Murray-Rust, Peter; Rzepa, Henry S

    2006-01-01

    A set of components (CMLReact) for managing chemical and biochemical reactions has been added to CML. These can be combined to support most of the strategies for the formal representation of reactions. The elements, attributes, and types are formally defined as XMLSchema components, and their semantics are developed. New syntax and semantics in CML are reported and illustrated with 10 examples.

  1. [Are there pseudophototropic reactions in biology? Part 4: On the reversibility of biologic/synthetic polymere systems (author's transl)].

    Science.gov (United States)

    Patschorke, J

    1979-01-01

    In further research on pseudophototropic behaviour in cellular membranes of halobacteria the reversibility of vinylmethylethermaleic anhydride-copolymeres with biological liquids is tested and the basic principles of different colour generating reactions are studied.

  2. A kinetic-theory approach for computing chemical-reaction rates in upper-atmosphere hypersonic flows.

    Science.gov (United States)

    Gallis, Michael A; Bond, Ryan B; Torczynski, John R

    2009-09-28

    Recently proposed molecular-level chemistry models that predict equilibrium and nonequilibrium reaction rates using only kinetic theory and fundamental molecular properties (i.e., no macroscopic reaction-rate information) are investigated for chemical reactions occurring in upper-atmosphere hypersonic flows. The new models are in good agreement with the measured Arrhenius rates for near-equilibrium conditions and with both measured rates and other theoretical models for far-from-equilibrium conditions. Additionally, the new models are applied to representative combustion and ionization reactions and are in good agreement with available measurements and theoretical models. Thus, molecular-level chemistry modeling provides an accurate method for predicting equilibrium and nonequilibrium chemical-reaction rates in gases.

  3. Thermomchromic Reaction-Induced Reversible Upconversion Emission Modulation for Switching Devices and Tunable Upconversion Emission Based on Defect Engineering of WO3:Yb3+,Er3+ Phosphor.

    Science.gov (United States)

    Ruan, Jiufeng; Yang, Zhengwen; Huang, Anjun; Zhang, Hailu; Qiu, Jianbei; Song, Zhiguo

    2018-05-02

    Reversible luminescence modulation of upconversion phosphors has the potential applications as photoswitches and optical memory and data storage devices. Previously, the photochromic reaction was extensively used for the realization of reversible luminescence modulation. It is very necessary to develop other approaches such as thermomchromic reaction to obtain the reversible upconversion luminescence modulation. In this work, the WO 3 :Yb 3+ ,Er 3+ phosphors with various colors were prepared at various temperatures, exhibiting tunable upconversion luminescence attributed to the formation of oxygen vacancies in the host. Upon heat treatment in the reducing atmosphere or air, the WO 3 :Yb 3+ ,Er 3+ phosphors show a reversible thermomchromic property. The reversible upconversion luminescence modulation of WO 3 :Yb 3+ ,Er 3+ phosphors was observed based on thermomchromic reaction. Additionally, the upconversion luminescence modulation is maintained after several cycles, indicating its excellent stability. The WO 3 :Yb 3+ ,Er 3+ phosphors with reversible upconversion luminescence and excellent reproducibility have potential applications as the photoswitches and optical memory and data storage devices.

  4. Motivational Factors Contributing to Turkish High School Students' Achievement in Gases and Chemical Reactions

    Science.gov (United States)

    Kadioglu, Cansel; Uzuntiryaki, Esen

    2008-01-01

    This study aimed to investigate the contribution of motivational factors to 10th grade students' achievement in gases and chemical reactions in chemistry. Three hundred fifty nine 10th grade students participated in the study. The Gases and Chemical Reactions Achievement Test and the Motivated Strategies for Learning Questionnaire were…

  5. On microscopic simulations of systems with model chemical reactions

    International Nuclear Information System (INIS)

    Gorecki, J.; Gorecka, J.N.

    1998-01-01

    Large scale computer simulations of model chemical systems play the role of idealized experiments in which theories may be tested. In this paper we present two applications of microscopic simulations based on the reactive hard sphere model. We investigate the influence of internal fluctuations on an oscillating chemical system and observe how they modify the phase portrait of it. Another application, we consider, is concerned with the propagation of a chemical wave front associated with a thermally activated reaction. It is shown that the nonequilibrium effects increase the front velocity if compared with the velocity of the front generated by a nonactivated process characterized by the same rate constant. (author)

  6. I + (H2O)2 → HI + (H2O)OH Forward and Reverse Reactions. CCSD(T) Studies Including Spin-Orbit Coupling.

    Science.gov (United States)

    Wang, Hui; Li, Guoliang; Li, Qian-Shu; Xie, Yaoming; Schaefer, Henry F

    2016-03-03

    The potential energy profile for the atomic iodine plus water dimer reaction I + (H2O)2 → HI + (H2O)OH has been explored using the "Gold Standard" CCSD(T) method with quadruple-ζ correlation-consistent basis sets. The corresponding information for the reverse reaction HI + (H2O)OH → I + (H2O)2 is also derived. Both zero-point vibrational energies (ZPVEs) and spin-orbit (SO) coupling are considered, and these notably alter the classical energetics. On the basis of the CCSD(T)/cc-pVQZ-PP results, including ZPVE and SO coupling, the forward reaction is found to be endothermic by 47.4 kcal/mol, implying a significant exothermicity for the reverse reaction. The entrance complex I···(H2O)2 is bound by 1.8 kcal/mol, and this dissociation energy is significantly affected by SO coupling. The reaction barrier lies 45.1 kcal/mol higher than the reactants. The exit complex HI···(H2O)OH is bound by 3.0 kcal/mol relative to the asymptotic limit. At every level of theory, the reverse reaction HI + (H2O)OH → I + (H2O)2 proceeds without a barrier. Compared with the analogous water monomer reaction I + H2O → HI + OH, the additional water molecule reduces the relative energies of the entrance stationary point, transition state, and exit complex by 3-5 kcal/mol. The I + (H2O)2 reaction is related to the valence isoelectronic bromine and chlorine reactions but is distinctly different from the F + (H2O)2 system.

  7. Fractal sets generated by chemical reactions discrete chaotic dynamics

    International Nuclear Information System (INIS)

    Gontar, V.; Grechko, O.

    2007-01-01

    Fractal sets composed by the parameters values of difference equations derived from chemical reactions discrete chaotic dynamics (DCD) and corresponding to the sequences of symmetrical patterns were obtained in this work. Examples of fractal sets with the corresponding symmetrical patterns have been presented

  8. Invariant boxes and stability of some systems from biomathematics and chemical reactions

    International Nuclear Information System (INIS)

    Pavel, N.H.

    1984-08-01

    A general theorem on the flow-invariance of a time-dependent rectangular box with respect to a differential system is first recalled [''Analysis of some non-linear problems'' in Banach Spaces and Applications, Univ. of Iasi (Romania) (1982)]. Then a theorem applicable to the study of some differential systems from biomathematics and chemical reactions is given and proved. The theorem can be applied to enzymatic reactions, the chemical mechanism in the Belousov reaction, and the kinetic system for the chemical scheme of Hanusse of two processes with three intermediate species [in Pavel, N.H., Differential Equations, Flow-invariance and Applications, Pitman Publishing, Ltd., London (to appear)]. Next, the matrices A for which the corresponding linear system x'=Ax is component-wise positive asymptotically stable are characterized. In the Appendix a partial answer to an open problem regarding the preservation of both continuity and dissipativity in the extension of functions to a Banach space is given

  9. Reactions driving conformational movements (molecular motors) in gels: conformational and structural chemical kinetics.

    Science.gov (United States)

    Otero, Toribio F

    2017-01-18

    In this perspective the empirical kinetics of conducting polymers exchanging anions and solvent during electrochemical reactions to get dense reactive gels is reviewed. The reaction drives conformational movements of the chains (molecular motors), exchange of ions and solvent with the electrolyte and structural (relaxation, swelling, shrinking and compaction) gel changes. Reaction-driven structural changes are identified and quantified from electrochemical responses. The empirical reaction activation energy (E a ), the reaction coefficient (k) and the reaction orders (α and β) change as a function of the conformational energy variation during the reaction. This conformational energy becomes an empirical magnitude. E a , k, α and β include and provide quantitative conformational and structural information. The chemical kinetics becomes structural chemical kinetics (SCK) for reactions driving conformational movements of the reactants. The electrochemically stimulated conformational relaxation model describes empirical results and some results from the literature for biochemical reactions. In parallel the development of an emerging technological world of soft, wet, multifunctional and biomimetic tools and anthropomorphic robots driven by reactions of the constitutive material, as in biological organs, can be now envisaged being theoretically supported by the kinetic model.

  10. Reciprocity theory of homogeneous reactions

    Science.gov (United States)

    Agbormbai, Adolf A.

    1990-03-01

    The reciprocity formalism is applied to the homogeneous gaseous reactions in which the structure of the participating molecules changes upon collision with one another, resulting in a change in the composition of the gas. The approach is applied to various classes of dissociation, recombination, rearrangement, ionizing, and photochemical reactions. It is shown that for the principle of reciprocity to be satisfied it is necessary that all chemical reactions exist in complementary pairs which consist of the forward and backward reactions. The backward reaction may be described by either the reverse or inverse process. The forward and backward processes must satisfy the same reciprocity equation. Because the number of dynamical variables is usually unbalanced on both sides of a chemical equation, it is necessary that this balance be established by including as many of the dynamical variables as needed before the reciprocity equation can be formulated. Statistical transformation models of the reactions are formulated. The models are classified under the titles free exchange, restricted exchange and simplified restricted exchange. The special equations for the forward and backward processes are obtained. The models are consistent with the H theorem and Le Chatelier's principle. The models are also formulated in the context of the direct simulation Monte Carlo method.

  11. Chemical reaction vector embeddings: towards predicting drug metabolism in the human gut microbiome.

    Science.gov (United States)

    Mallory, Emily K; Acharya, Ambika; Rensi, Stefano E; Turnbaugh, Peter J; Bright, Roselie A; Altman, Russ B

    2018-01-01

    Bacteria in the human gut have the ability to activate, inactivate, and reactivate drugs with both intended and unintended effects. For example, the drug digoxin is reduced to the inactive metabolite dihydrodigoxin by the gut Actinobacterium E. lenta, and patients colonized with high levels of drug metabolizing strains may have limited response to the drug. Understanding the complete space of drugs that are metabolized by the human gut microbiome is critical for predicting bacteria-drug relationships and their effects on individual patient response. Discovery and validation of drug metabolism via bacterial enzymes has yielded >50 drugs after nearly a century of experimental research. However, there are limited computational tools for screening drugs for potential metabolism by the gut microbiome. We developed a pipeline for comparing and characterizing chemical transformations using continuous vector representations of molecular structure learned using unsupervised representation learning. We applied this pipeline to chemical reaction data from MetaCyc to characterize the utility of vector representations for chemical reaction transformations. After clustering molecular and reaction vectors, we performed enrichment analyses and queries to characterize the space. We detected enriched enzyme names, Gene Ontology terms, and Enzyme Consortium (EC) classes within reaction clusters. In addition, we queried reactions against drug-metabolite transformations known to be metabolized by the human gut microbiome. The top results for these known drug transformations contained similar substructure modifications to the original drug pair. This work enables high throughput screening of drugs and their resulting metabolites against chemical reactions common to gut bacteria.

  12. On energetics of hydrocarbon chemical reactions by ionizing irradiation

    International Nuclear Information System (INIS)

    Zaykin, Yu.A.; Zaykina, R.F.; Mirkin, G.

    2002-01-01

    Complete text of publication follows. The present global energy crisis requires the industry to look for technologies that are more effective and, particularly, less energy consuming. The hydrocarbon processing technology based on the electron radiation-induced thermal chemical conversion has a great potential. Comparing the presently predominant thermocatalytic processing, it is much more energy efficient, because chemical conversions go at a minimal processing temperature and pressure. To compare energy consumption by electron irradiation with thermal and thermocatalytic technologies of hydrocarbon processing one must see major differences between them. While traditional thermocatalytic processes are equilibrium and their energetics can be evaluated based on principles of classic thermodynamics, HEET processing is non-equilibrium and this evaluation approach is not valid for it. However, a theoretical description of radiation-chemical conversion using reaction rate constants determined in thermally equilibrium systems is approximately adequate to radiation processes by substituting equilibrium concentrations of reacting particles as their non-equilibrium concentrations under irradiation. In particular, description of radical reactions initiated by radiation requires substitution of thermally equilibrium radical concentration by much higher concentration defined by the dynamic equilibrium of radical radiation generation and their recombination. The paper presents the comparative analysis of energy consumption in different stages of hydrocarbon processing using classic thermal cracking by heating versus radiation induced cracking. It is shown that in the most energy-consuming stage of processing - the chain reaction initiation necessary for concentration of active radicals, irradiation processing has the great advantage compared to thermal cracking by heating and allows cutting down the total energy consumption by approximately 40%

  13. Femtosecond laser induced and controlled chemical reaction of carbon monoxide and hydrogen

    CSIR Research Space (South Africa)

    Du Plessis, A

    2011-07-01

    Full Text Available Results from experiments aimed at bimolecular chemical reaction control of CO and H2 at room temperature and pressure, without any catalyst, using shaped femtosecond laser pulses are presented. A stable reaction product (CO2) was measured after...

  14. Method and apparatus for controlling gas evolution from chemical reactions

    Science.gov (United States)

    Skorpik, James R.; Dodson, Michael G.

    1999-01-01

    The present invention is directed toward monitoring a thermally driven gas evolving chemical reaction with an acoustic apparatus. Signals from the acoustic apparatus are used to control a heater to prevent a run-away condition. A digestion module in combination with a robotic arm further automate physical handling of sample material reaction vessels. The invention is especially useful for carrying out sample procedures defined in EPA Methods SW-846.

  15. Localized temperature and chemical reaction control in nanoscale space by nanowire array.

    Science.gov (United States)

    Jin, C Yan; Li, Zhiyong; Williams, R Stanley; Lee, K-Cheol; Park, Inkyu

    2011-11-09

    We introduce a novel method for chemical reaction control with nanoscale spatial resolution based on localized heating by using a well-aligned nanowire array. Numerical and experimental analysis shows that each individual nanowire could be selectively and rapidly Joule heated for local and ultrafast temperature modulation in nanoscale space (e.g., maximum temperature gradient 2.2 K/nm at the nanowire edge; heating/cooling time chemical reactions such as polymer decomposition/cross-linking and direct and localized hydrothermal synthesis of metal oxide nanowires were demonstrated.

  16. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  17. Cellular automaton model of coupled mass transport and chemical reactions

    International Nuclear Information System (INIS)

    Karapiperis, T.

    1994-01-01

    Mass transport, coupled with chemical reactions, is modelled as a cellular automaton in which solute molecules perform a random walk on a lattice and react according to a local probabilistic rule. Assuming molecular chaos and a smooth density function, we obtain the standard reaction-transport equations in the continuum limit. The model is applied to the reactions a + b ↔c and a + b →c, where we observe interesting macroscopic effects resulting from microscopic fluctuations and spatial correlations between molecules. We also simulate autocatalytic reaction schemes displaying spontaneous formation of spatial concentration patterns. Finally, we propose and discuss the limitations of a simple model for mineral-solute interaction. (author) 5 figs., 20 refs

  18. ReactionPredictor: prediction of complex chemical reactions at the mechanistic level using machine learning.

    Science.gov (United States)

    Kayala, Matthew A; Baldi, Pierre

    2012-10-22

    Proposing reasonable mechanisms and predicting the course of chemical reactions is important to the practice of organic chemistry. Approaches to reaction prediction have historically used obfuscating representations and manually encoded patterns or rules. Here we present ReactionPredictor, a machine learning approach to reaction prediction that models elementary, mechanistic reactions as interactions between approximate molecular orbitals (MOs). A training data set of productive reactions known to occur at reasonable rates and yields and verified by inclusion in the literature or textbooks is derived from an existing rule-based system and expanded upon with manual curation from graduate level textbooks. Using this training data set of complex polar, hypervalent, radical, and pericyclic reactions, a two-stage machine learning prediction framework is trained and validated. In the first stage, filtering models trained at the level of individual MOs are used to reduce the space of possible reactions to consider. In the second stage, ranking models over the filtered space of possible reactions are used to order the reactions such that the productive reactions are the top ranked. The resulting model, ReactionPredictor, perfectly ranks polar reactions 78.1% of the time and recovers all productive reactions 95.7% of the time when allowing for small numbers of errors. Pericyclic and radical reactions are perfectly ranked 85.8% and 77.0% of the time, respectively, rising to >93% recovery for both reaction types with a small number of allowed errors. Decisions about which of the polar, pericyclic, or radical reaction type ranking models to use can be made with >99% accuracy. Finally, for multistep reaction pathways, we implement the first mechanistic pathway predictor using constrained tree-search to discover a set of reasonable mechanistic steps from given reactants to given products. Webserver implementations of both the single step and pathway versions of Reaction

  19. Post-irradiation chemical reactions during devitrification of molecular matrices (review)

    International Nuclear Information System (INIS)

    Barkalov, I.M.; Kiryukhin, D.P.

    1993-01-01

    At temperatures above the melting point (mp) a material is in a thermodynamic equilibrium state, in which any thermodynamic function of state (specific volume, enthalpy, and entrophy) is governed unambiguously by the temperature, pressure, etc. At temperatures below the mp, the material is converted to another equilibrium state, i.e., a crystal. However, during rapid cooling, a state of a nonequilibrium supercooled liquid can be obtained. Further cooling of this state below the glass-transition temperature, T g1 , leads to the additional formation of a nonequilibrium solid amorphous state, often simply called glass. In the vitreous state, species are capable of only vibrational and small-scale rotational motions. The translational mobility that is characteristic of the liquid state is completely lost. Very important for what follows is the fact that the transition from a supercooled liquid to the vitreous state or the reverse transition (devitrification) is accompanied by a sharp change of properties: the viscosity changes by 10-15 orders of magnitude, the modulus of elasticity changes 10-1000 fold, the coefficient of thermal expansion changes 10-100 fold, etc. Most impressive is the gigantic viscosity jump in the narrow temperature-dependent glass-transition region. This means that the molecular mobility governing the chemical-transformation dynamics undergoes a sharp change in this region. The nature of the chemical process during passage through the glass-softening region should change because of a sharp change of the mobility of the reactants, with a huge change of molecular mobility being attained by a temperature change of only a few degrees. During radiolysis of vitreous matrices, active species of radical and ionic nature are formed. This review discusses the recombination reactions of radiolysis products during heating to the supercooled state

  20. Theoretical study of chemical reaction effects on vertical oscillating plate with variable temperature

    Directory of Open Access Journals (Sweden)

    Muthucumaraswamy R.

    2006-01-01

    Full Text Available An exact solution to the flow of a viscous incompressible unsteady flow past an infinite vertical oscillating plate with variable temperature and mass diffusion is presented here, taking into account of the homogeneous chemical reaction of first-order. Both the plate temperature and the concentration level near the plate are raised linearly with respect to time. The dimensionless governing equations has been obtained by the Laplace transform method, when the plate is oscillating harmonically in its own plane. The effects of velocity and concentration are studied for different parameters like phase angle, chemical reaction parameter, thermal Grashof number, mass Grashof number, Schmidt number and time are studied. The solutions are valid only for small values of time t. It is observed that the velocity increases with decreasing phase angle ωt or chemical reaction parameter. .

  1. Coupling between solute transport and chemical reactions models

    International Nuclear Information System (INIS)

    Samper, J.; Ajora, C.

    1993-01-01

    During subsurface transport, reactive solutes are subject to a variety of hydrodynamic and chemical processes. The major hydrodynamic processes include advection and convection, dispersion and diffusion. The key chemical processes are complexation including hydrolysis and acid-base reactions, dissolution-precipitation, reduction-oxidation, adsorption and ion exchange. The combined effects of all these processes on solute transport must satisfy the principle of conservation of mass. The statement of conservation of mass for N mobile species leads to N partial differential equations. Traditional solute transport models often incorporate the effects of hydrodynamic processes rigorously but oversimplify chemical interactions among aqueous species. Sophisticated chemical equilibrium models, on the other hand, incorporate a variety of chemical processes but generally assume no-flow systems. In the past decade, coupled models accounting for complex hydrological and chemical processes, with varying degrees of sophistication, have been developed. The existing models of reactive transport employ two basic sets of equations. The transport of solutes is described by a set of partial differential equations, and the chemical processes, under the assumption of equilibrium, are described by a set of nonlinear algebraic equations. An important consideration in any approach is the choice of primary dependent variables. Most existing models cannot account for the complete set of chemical processes, cannot be easily extended to include mixed chemical equilibria and kinetics, and cannot handle practical two and three dimensional problems. The difficulties arise mainly from improper selection of the primary variables in the transport equations. (Author) 38 refs

  2. Chemical Exchange Saturation Transfer in Chemical Reactions: A Mechanistic Tool for NMR Detection and Characterization of Transient Intermediates.

    Science.gov (United States)

    Lokesh, N; Seegerer, Andreas; Hioe, Johnny; Gschwind, Ruth M

    2018-02-07

    The low sensitivity of NMR and transient key intermediates below detection limit are the central problems studying reaction mechanisms by NMR. Sensitivity can be enhanced by hyperpolarization techniques such as dynamic nuclear polarization or the incorporation/interaction of special hyperpolarized molecules. However, all of these techniques require special equipment, are restricted to selective reactions, or undesirably influence the reaction pathways. Here, we apply the chemical exchange saturation transfer (CEST) technique for the first time to NMR detect and characterize previously unobserved transient reaction intermediates in organocatalysis. The higher sensitivity of CEST and chemical equilibria present in the reaction pathway are exploited to access population and kinetics information on low populated intermediates. The potential of the method is demonstrated on the proline-catalyzed enamine formation for unprecedented in situ detection of a DPU stabilized zwitterionic iminium species, the elusive key intermediate between enamine and oxazolidinones. The quantitative analysis of CEST data at 250 K revealed the population ratio of [Z-iminium]/[exo-oxazolidinone] 0.02, relative free energy +8.1 kJ/mol (calculated +7.3 kJ/mol), and free energy barrier of +45.9 kJ/mol (ΔG ⧧ calc. (268 K) = +42.2 kJ/mol) for Z-iminium → exo-oxazolidinone. The findings underpin the iminium ion participation in enamine formation pathway corroborating our earlier theoretical prediction and help in better understanding. The reliability of CEST is validated using 1D EXSY-build-up techniques at low temperature (213 K). The CEST method thus serves as a new tool for mechanistic investigations in organocatalysis to access key information, such as chemical shifts, populations, and reaction kinetics of intermediates below the standard NMR detection limit.

  3. Interaction of chemical reactions and radiant heat transfer with temperature turbulent pulsations and its effect on heat traner in high-temperature gas flows

    International Nuclear Information System (INIS)

    Petukhov, B.S.; Zal'tsman, I.G.; Shikov, V.K.

    1980-01-01

    Methods of taking account of mutual effect of chemical transformations, radiation and turbulence in the calculations of heat transfer in gas flows are considered. Exponential functions of medium parameters are used to describe chemical sources and optical properties of media. It is shown using as an example the dissociation reaction C 2 reversible 2C that the effect of temperature and composition pulsations on recombination rates is negligibly small. It is also shown on the example of turbulent flow of hot molecular gas in a flat channel with cold walls that at moderate temperatures the effect of temperature pulsations on heat radiation flow can be significant (30-40%). The calculational results also show that there is a region in a turbulent boundary layer where the radiation greatly affects the coefficient of turbulent heat transfer

  4. On the deduction of chemical reaction pathways from measurements of time series of concentrations.

    Science.gov (United States)

    Samoilov, Michael; Arkin, Adam; Ross, John

    2001-03-01

    We discuss the deduction of reaction pathways in complex chemical systems from measurements of time series of chemical concentrations of reacting species. First we review a technique called correlation metric construction (CMC) and show the construction of a reaction pathway from measurements on a part of glycolysis. Then we present two new improved methods for the analysis of time series of concentrations, entropy metric construction (EMC), and entropy reduction method (ERM), and illustrate (EMC) with calculations on a model reaction system. (c) 2001 American Institute of Physics.

  5. Modular rate laws for enzymatic reactions: thermodynamics, elasticities and implementation.

    Science.gov (United States)

    Liebermeister, Wolfram; Uhlendorf, Jannis; Klipp, Edda

    2010-06-15

    Standard rate laws are a key requisite for systematically turning metabolic networks into kinetic models. They should provide simple, general and biochemically plausible formulae for reaction velocities and reaction elasticities. At the same time, they need to respect thermodynamic relations between the kinetic constants and the metabolic fluxes and concentrations. We present a family of reversible rate laws for reactions with arbitrary stoichiometries and various types of regulation, including mass-action, Michaelis-Menten and uni-uni reversible Hill kinetics as special cases. With a thermodynamically safe parameterization of these rate laws, parameter sets obtained by model fitting, sampling or optimization are guaranteed to lead to consistent chemical equilibrium states. A reformulation using saturation values yields simple formulae for rates and elasticities, which can be easily adjusted to the given stationary flux distributions. Furthermore, this formulation highlights the role of chemical potential differences as thermodynamic driving forces. We compare the modular rate laws to the thermodynamic-kinetic modelling formalism and discuss a simplified rate law in which the reaction rate directly depends on the reaction affinity. For automatic handling of modular rate laws, we propose a standard syntax and semantic annotations for the Systems Biology Markup Language. An online tool for inserting the rate laws into SBML models is freely available at www.semanticsbml.org. Supplementary data are available at Bioinformatics online.

  6. Purification of free hydrogen or hydrogen combined in a gaseous mixture by chemical reactions with uranium

    International Nuclear Information System (INIS)

    Caron-Charles, M.; Gilot, B.

    1989-01-01

    Within the framework of the European fusion program, the authors are dealing with the tritium technology aspect. Hydrogen, free or under a combined form within a H 2 , N 2 , NH 3 , O 2 , gaseous mixture, can be purified by chemical reactions with uranium metal. The resulting reactions consist in absorbing the impurities without holding back H 2 . Working conditions have been defined according to two main goals: the formation of stable solid products, especially under hydrogenated atmosphere and the optimization of the material quantities to be used. Thermodynamical considerations have shown that the 950-1300 K temperature range should be suitable for this chemical process. Experiments performed with massive uranium set in a closed reactor at 973 K, have produced hydrogen according to the predicted reactions rates. But they have also pointed out the importance of interferences that might occur in the uranium-gas system, on the gases conversion rates. The comparison between the chemical kinetic ratings of the reactions of pure gases and the chemical kinetic ratings of the reactions of the same gases in mixture, has been set up. It proves that simultaneous reactions can modify the working conditions of the solid products formation, and particularly modify their structure. In this case, chemical kinetic ratings are increased up to their maximal value; that means surface phenomena are favoured as with uranium powder gases reactions. (orig.)

  7. The Role of Electronic Excitations on Chemical Reaction Dynamics at Metal, Semiconductor and Nanoparticle Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Tully, John C. [Yale Univ., New Haven, CT (United States)

    2017-06-10

    Chemical reactions are often facilitated and steered when carried out on solid surfaces, essential for applications such as heterogeneous catalysis, solar energy conversion, corrosion, materials processing, and many others. A critical factor that can determine the rates and pathways of chemical reactions at surfaces is the efficiency and specificity of energy transfer; how fast does energy move around and where does it go? For reactions on insulator surfaces energy transfer generally moves in and out of vibrations of the adsorbed molecule and the underlying substrate. By contrast, on metal surfaces, metallic nanoparticles and semiconductors, another pathway for energy flow opens up, excitation and de-excitation of electrons. This so-called “nonadiabatic” mechanism often dominates the transfer of energy and can directly impact the course of a chemical reaction. Conventional computational methods such as molecular dynamics simulation do not account for this nonadiabatic behavior. The current DOE-BES funded project has focused on developing the underlying theoretical foundation and the computational methodology for the prediction of nonadiabatic chemical reaction dynamics at surfaces. The research has successfully opened up new methodology and new applications for molecular simulation. In particular, over the last three years, the “Electronic Friction” theory, pioneered by the PI, has now been developed into a stable and accurate computational method that is sufficiently practical to allow first principles “on-the-fly” simulation of chemical reaction dynamics at metal surfaces.

  8. Thin liquid films with time-dependent chemical reactions sheared by an ambient gas flow

    Science.gov (United States)

    Bender, Achim; Stephan, Peter; Gambaryan-Roisman, Tatiana

    2017-08-01

    Chemical reactions in thin liquid films are found in many industrial applications, e.g., in combustion chambers of internal combustion engines where a fuel film can develop on pistons or cylinder walls. The reactions within the film and the turbulent outer gas flow influence film stability and lead to film breakup, which in turn can lead to deposit formation. In this work we examine the evolution and stability of a thin liquid film in the presence of a first-order chemical reaction and under the influence of a turbulent gas flow. Long-wave theory with a double perturbation analysis is used to reduce the complexity of the problem and obtain an evolution equation for the film thickness. The chemical reaction is assumed to be slow compared to film evolution and the amount of reactant in the film is limited, which means that the reaction rate decreases with time as the reactant is consumed. A linear stability analysis is performed to identify the influence of reaction parameters, material properties, and environmental conditions on the film stability limits. Results indicate that exothermic reactions have a stabilizing effect whereas endothermic reactions destabilize the film and can lead to rupture. It is shown that an initially unstable film can become stable with time as the reaction rate decreases. The shearing of the film by the external gas flow leads to the appearance of traveling waves. The shear stress magnitude has a nonmonotonic influence on film stability.

  9. Reversible alkyne insertion in the benzannulation reaction of Fischer carbene complexes with alkynes

    Energy Technology Data Exchange (ETDEWEB)

    Waters, M.L.; Bos, M.E.; Wulff, W.D. [Univ. of Chicago, IL (United States)

    1995-12-31

    The benzannulation reaction of Fischer carbene complexes with alkynes to give phenols is highly regioselective with terminal alkynes, and reasonably regioselective with internal alkynes. This has been attributed to steric factors in intermediates, where one form is favored due to close contact between the R substituent and a cis-CO ligand. Whether alkyne insertion is kinetically or thermodynamically controlled has not been determined. The authors now have evidence from regioselectivity studies that alkyne insertion into the metal-carbon bond is reversible. Implications of these results and further mechanistic considerations will be presented.

  10. Implementation of a vibrationally linked chemical reaction model for DSMC

    Science.gov (United States)

    Carlson, A. B.; Bird, Graeme A.

    1994-01-01

    A new procedure closely linking dissociation and exchange reactions in air to the vibrational levels of the diatomic molecules has been implemented in both one- and two-dimensional versions of Direct Simulation Monte Carlo (DSMC) programs. The previous modeling of chemical reactions with DSMC was based on the continuum reaction rates for the various possible reactions. The new method is more closely related to the actual physics of dissociation and is more appropriate to the particle nature of DSMC. Two cases are presented: the relaxation to equilibrium of undissociated air initially at 10,000 K, and the axisymmetric calculation of shuttle forebody heating during reentry at 92.35 km and 7500 m/s. Although reaction rates are not used in determining the dissociations or exchange reactions, the new method produces rates which agree astonishingly well with the published rates derived from experiment. The results for gas properties and surface properties also agree well with the results produced by earlier DSMC models, equilibrium air calculations, and experiment.

  11. Chemical reactions in the presence of surface modulation and stirring

    OpenAIRE

    Kamhawi, Khalid; Náraigh, Lennon Ó

    2009-01-01

    We study the dynamics of simple reactions where the chemical species are confined on a general, time-modulated surface, and subjected to externally-imposed stirring. The study of these inhomogeneous effects requires a model based on a reaction-advection-diffusion equation, which we derive. We use homogenization methods to show that up to second order in a small scaling parameter, the modulation effects on the concentration field are asymptotically equivalent for systems with or without stirri...

  12. Mapping the dark space of chemical reactions with extended nanomole synthesis and MALDI-TOF MS.

    Science.gov (United States)

    Lin, Shishi; Dikler, Sergei; Blincoe, William D; Ferguson, Ronald D; Sheridan, Robert P; Peng, Zhengwei; Conway, Donald V; Zawatzky, Kerstin; Wang, Heather; Cernak, Tim; Davies, Ian W; DiRocco, Daniel A; Sheng, Huaming; Welch, Christopher J; Dreher, Spencer D

    2018-05-24

    Understanding the practical limitations of chemical reactions is critically important for efficiently planning the synthesis of compounds in pharmaceutical, agrochemical and specialty chemical research and development. However, literature reports of the scope of new reactions are often cursory and biased toward successful results, severely limiting the ability to predict reaction outcomes for untested substrates. We herein illustrate strategies for carrying out large scale surveys of chemical reactivity using a material-sparing nanomole-scale automated synthesis platform with greatly expanded synthetic scope combined with ultra-high throughput (uHT) matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS). Copyright © 2018, American Association for the Advancement of Science.

  13. Simplified mathematical model for heat supply and removal with allowance for chemical reaction kinetics in the N2O4 reversible 2NO2 reversible 2NO + O2 system

    International Nuclear Information System (INIS)

    Shiryaeva, N.M.

    1977-01-01

    The processes of heat supply and removal with chemical reactions proceeding in the circuit are usually described by a set of nonlinear ordinary differential equations. Considering a non-equilibrium state of a chemically reacting gas relative to equilibrium, to which the nonequilibrium system approaches according to a certain process and applying the Tailor series expansion near this equilibrium point, a set of differential equations can be reduced to one differential and some algebraic equations. The analysis shows that of the differential equation obtained can be quasilinearized, and then the linear differential equation can be solved. On the basis of the analytical solutions obtained the calculations of flow parameters have been performed for the cases of cooling and heating the dissociating coolant in channels of a constant cross-section at various pressures. The calculation results are in a satisfactory agreement with the numerical solution of a set of differential equations performed on the ''Minsk-22'' computer. The solution may be applied to calculate isobaric processes in thermodynamic cycles, where the N 2 O 4 coolant is used

  14. Mapping Students' Conceptual Modes When Thinking about Chemical Reactions Used to Make a Desired Product

    Science.gov (United States)

    Weinrich, M. L.; Talanquer, V.

    2015-01-01

    The central goal of this qualitative research study was to uncover major implicit assumptions that students with different levels of training in the discipline apply when thinking and making decisions about chemical reactions used to make a desired product. In particular, we elicited different ways of conceptualizing why chemical reactions happen…

  15. Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

    Science.gov (United States)

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

    2004-03-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  16. On some limitations of reaction-diffusion chemical computers in relation to Voronoi diagram and its inversion

    International Nuclear Information System (INIS)

    Adamatzky, Andrew; Lacy Costello, Benjamin de

    2003-01-01

    A reaction-diffusion chemical computer in this context is a planar uniform chemical reactor, where data and results of a computation are represented by concentration profiles of reactants and the computation itself is implemented via the spreading and interaction of diffusive and phase waves. This class of chemical computers are efficient at solving problems with a 'natural' parallelism where data sets are decomposable onto a large number of geographically neighboring domains which are then processed in parallel. Typical problems of this type include image processing, geometrical transformations and optimisation. When chemical based devices are used to solve such problems questions regarding their reproducible, efficiency and the accuracy of their computations arise. In addition to these questions what are the limitations of reaction-diffusion chemical processors--what type of problems cannot currently and are unlikely ever to be solved? To answer the questions we study how a Voronoi diagram is constructed and how it is inverted in a planar chemical processor. We demonstrate that a Voronoi diagram is computed only partially in the chemical processor. We also prove that given a specific Voronoi diagram it is impossible to reconstruct the planar set (from which diagram was computed) in the reaction-diffusion chemical processor. In the Letter we open the first ever line of enquiry into the computational inability of reaction-diffusion chemical computers

  17. Influence of polymerisation on the reversibility of low-energy proton exchange reactions by Para-Aminothiolphenol.

    Science.gov (United States)

    Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; van den Berg, Albert; Olthuis, Wouter; Pascual-García, César

    2017-11-13

    The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used electrochemical and photo-polymerisation in neutral buffers and plasma polymerisation in air to induce reversible redox states. The chemical stoichiometry and surface coverage of PATP in the polymerized layers were characterized by X-ray photoelectron spectroscopy (XPS), while cyclic voltammetry (CV) was used to measure the charge transfer, double layer capacitance and electrochemical rate of the layers during successive potential cycles. Our results show that the surface coverage of the redox active species is higher on electro-polymerised samples, however, after consecutive cycles all the methods converge to the same charge transfer, while the plasma polymerised samples achieve higher efficiency per molecule and UV polymerised samples have a higher electron transfer rate.

  18. Non-invasive estimation of dissipation from non-equilibrium fluctuations in chemical reactions.

    Science.gov (United States)

    Muy, S; Kundu, A; Lacoste, D

    2013-09-28

    We show how to extract an estimate of the entropy production from a sufficiently long time series of stationary fluctuations of chemical reactions. This method, which is based on recent work on fluctuation theorems, is direct, non-invasive, does not require any knowledge about the underlying dynamics and is applicable even when only partial information is available. We apply it to simple stochastic models of chemical reactions involving a finite number of states, and for this case, we study how the estimate of dissipation is affected by the degree of coarse-graining present in the input data.

  19. S-factor measurement of the 13C(p,γ)14N reaction in reverse kinematics

    International Nuclear Information System (INIS)

    Genard, G; Terwagne, G; Descouvemont, P

    2010-01-01

    We measure the S-factor of the 13 C(p,γ) 14 N reaction in reverse kinematics for energies ranging from 561 down to 225 keV with a low background experimental setup. The results are compared with previous measurements and an R-matrix treatment is applied to the data in order to obtain the properties of the 511 keV resonance that dominates the cross section at low energies.

  20. Monitoring chemical reactions by low-field benchtop NMR at 45 MHz: pros and cons.

    Science.gov (United States)

    Silva Elipe, Maria Victoria; Milburn, Robert R

    2016-06-01

    Monitoring chemical reactions is the key to controlling chemical processes where NMR can provide support. High-field NMR gives detailed structural information on chemical compounds and reactions; however, it is expensive and complex to operate. Conversely, low-field NMR instruments are simple and relatively inexpensive alternatives. While low-field NMR does not provide the detailed information as the high-field instruments as a result of their smaller chemical shift dispersion and the complex secondary coupling, it remains of practical value as a process analytical technology (PAT) tool and is complimentary to other established methods, such as ReactIR and Raman spectroscopy. We have tested a picoSpin-45 (currently under ThermoFisher Scientific) benchtop NMR instrument to monitor three types of reactions by 1D (1) H NMR: a Fischer esterification, a Suzuki cross-coupling, and the formation of an oxime. The Fischer esterification is a relatively simple reaction run at high concentration and served as proof of concept. The Suzuki coupling is an example of a more complex, commonly used reaction involving overlapping signals. Finally, the oxime formation involved a reaction in two phases that cannot be monitored by other PAT tools. Here, we discuss the pros and cons of monitoring these reactions at a low-field of 45 MHz by 1D (1) H NMR. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  1. A meson-exchange isobar model for the {pi}{sup +}d {r_reversible} pp reaction

    Energy Technology Data Exchange (ETDEWEB)

    Canton, L.; Cattapan, G.; Dortmans, P.J.; Pisent, G. [Istituto Nazionale di Fisica Nucleare, Padua (Italy); Svenne, J.P. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Physics]|[Winnipeg Inst. for Theoretical Physics, Winnipeg, MB (Canada)

    1994-10-10

    A broad set of observables are calculated for the {pi}{sup +} d {r_reversible} pp reaction with a relatively simple meson-exchange isobar model. The comparison between the calculated results and experimental data (including spin observables), shows that the model gives an overall phenomenologically acceptable description of the reaction around the {Delta} resonance. The effects due to the inclusion of Galilei invariant (pseudovector) recoil term in the {pi}NN vertex, of relativistic corrections to the {rho}-exchange component of the {Delta}N transition potential, and of NN final state interaction in the {pi}{sup +}d {yields} p+p process are also discussed. It is estimated that the model is sufficiently simple to be extended to the case of pion absorption on other light nuclei, in particular {sup 3}He (or tritium). 32 refs., 13 figs.

  2. Simulating chemical reactions in ionic liquids using QM/MM methodology.

    Science.gov (United States)

    Acevedo, Orlando

    2014-12-18

    The use of ionic liquids as a reaction medium for chemical reactions has dramatically increased in recent years due in large part to the numerous reported advances in catalysis and organic synthesis. In some extreme cases, ionic liquids have been shown to induce mechanistic changes relative to conventional solvents. Despite the large interest in the solvents, a clear understanding of the molecular factors behind their chemical impact is largely unknown. This feature article reviews our efforts developing and applying mixed quantum and molecular mechanical (QM/MM) methodology to elucidate the microscopic details of how these solvents operate to enhance rates and alter mechanisms for industrially and academically important reactions, e.g., Diels-Alder, Kemp eliminations, nucleophilic aromatic substitutions, and β-eliminations. Explicit solvent representation provided the medium dependence of the activation barriers and atomic-level characterization of the solute-solvent interactions responsible for the experimentally observed "ionic liquid effects". Technical advances are also discussed, including a linear-scaling pairwise electrostatic interaction alternative to Ewald sums, an efficient polynomial fitting method for modeling proton transfers, and the development of a custom ionic liquid OPLS-AA force field.

  3. Investigation of a Monte Carlo model for chemical reactions

    International Nuclear Information System (INIS)

    Hamm, R.N.; Turner, J.E.; Stabin, M.G.

    1998-01-01

    Monte Carlo computer simulations are in use at a number of laboratories for calculating time-dependent yields, which can be compared with experiments in the radiolysis of water. We report here on calculations to investigate the validity and consistency of the procedures used for simulating chemical reactions in our code, RADLYS. Model calculations were performed of the rate constants themselves. The rates thus determined showed an expected rapid decline over the first few hundred ps and a very gradual decline thereafter out to the termination of the calculations at 4.5 ns. Results are reported for different initial concentrations and numbers of reactive species. Generally, the calculated rate constants are smallest when the initial concentrations of the reactants are largest. It is found that inhomogeneities that quickly develop in the initial random spatial distribution of reactants persist in time as a result of subsequent chemical reactions, and thus conditions may poorly approximate those assumed from diffusion theory. We also investigated the reaction of a single species of one type placed among a large number of randomly distributed species of another type with which it could react. The distribution of survival times of the single species was calculated by using three different combinations of the diffusion constants for the two species, as is sometimes discussed in diffusion theory. The three methods gave virtually identical results. (orig.)

  4. Regression analysis of a chemical reaction fouling model

    International Nuclear Information System (INIS)

    Vasak, F.; Epstein, N.

    1996-01-01

    A previously reported mathematical model for the initial chemical reaction fouling of a heated tube is critically examined in the light of the experimental data for which it was developed. A regression analysis of the model with respect to that data shows that the reference point upon which the two adjustable parameters of the model were originally based was well chosen, albeit fortuitously. (author). 3 refs., 2 tabs., 2 figs

  5. Chemical encapsulation of rocuronium by synthetic cyclodextrin derivatives: reversal of neuromuscular block in anaesthetized Rhesus monkeys.

    NARCIS (Netherlands)

    Boer, H.D. de; Egmond, J. van; Pol, F. van de; Bom, A.; Booij, L.H.D.J.

    2006-01-01

    BACKGROUND: At present, reversal of neuromuscular block induced by steroidal neuromuscular blocking agents (NMBAs) is achieved by administration of cholinesterase inhibitors. Chemical encapsulation of steroidal NMBAs, such as rocuronium, by a cyclodextrin is a new concept in neuromuscular block

  6. Time-resolved resonance fluorescence spectroscopy for study of chemical reactions in laser-induced plasmas.

    Science.gov (United States)

    Liu, Lei; Deng, Leimin; Fan, Lisha; Huang, Xi; Lu, Yao; Shen, Xiaokang; Jiang, Lan; Silvain, Jean-François; Lu, Yongfeng

    2017-10-30

    Identification of chemical intermediates and study of chemical reaction pathways and mechanisms in laser-induced plasmas are important for laser-ablated applications. Laser-induced breakdown spectroscopy (LIBS), as a promising spectroscopic technique, is efficient for elemental analyses but can only provide limited information about chemical products in laser-induced plasmas. In this work, time-resolved resonance fluorescence spectroscopy was studied as a promising tool for the study of chemical reactions in laser-induced plasmas. Resonance fluorescence excitation of diatomic aluminum monoxide (AlO) and triatomic dialuminum monoxide (Al 2 O) was used to identify these chemical intermediates. Time-resolved fluorescence spectra of AlO and Al 2 O were used to observe the temporal evolution in laser-induced Al plasmas and to study their formation in the Al-O 2 chemistry in air.

  7. Force-induced chemical reactions on the metal centre in a single metalloprotein molecule

    Science.gov (United States)

    Zheng, Peng; Arantes, Guilherme M.; Field, Martin J.; Li, Hongbin

    2015-01-01

    Metalloproteins play indispensable roles in biology owing to the versatile chemical reactivity of metal centres. However, studying their reactivity in many metalloproteins is challenging, as protein three-dimensional structure encloses labile metal centres, thus limiting their access to reactants and impeding direct measurements. Here we demonstrate the use of single-molecule atomic force microscopy to induce partial unfolding to expose metal centres in metalloproteins to aqueous solution, thus allowing for studying their chemical reactivity in aqueous solution for the first time. As a proof-of-principle, we demonstrate two chemical reactions for the FeS4 centre in rubredoxin: electrophilic protonation and nucleophilic ligand substitution. Our results show that protonation and ligand substitution result in mechanical destabilization of the FeS4 centre. Quantum chemical calculations corroborated experimental results and revealed detailed reaction mechanisms. We anticipate that this novel approach will provide insights into chemical reactivity of metal centres in metalloproteins under biologically more relevant conditions. PMID:26108369

  8. Estrogenic chemical effects are independent from the degree of sex role reversal in pipefish.

    Science.gov (United States)

    Sárria, Marisa P; Santos, Miguel M; Castro, L Filipe C; Vieira, Natividade M; Monteiro, Nuno M

    2013-12-15

    Endocrine disrupting chemicals (EDCs) have been reported to disturb several ecological relevant endpoints. Surprisingly, EDC-induced effects on fish sexual behaviour have been poorly studied despite the fact that even subtle alterations might contribute to a disruption of sexual interactions, thus negatively impacting reproduction. As the few assessments on sexual behaviour have been conducted in species with orthodox sex roles, it might be argued that sex-role reversed species might provide a potentially complementary system to further explore the effects of EDCs on reproduction. In the present study, two pipefish species with distinct degrees of sex-role reversal were selected to further elucidate the impact of chronic EE2 exposure on sexual behaviour and reproduction-related endpoints. The obtained results indicate that, independently of the degree of sex role reversal, courtship behaviour seems to resist oestrogenic chemical exposure. However, exposure to environmentally relevant EE2 levels did induce a complete absence of pregnancies at 18 ng/L. Even though pregnancies were observed at intermediate concentrations, the percentage of non-transferred or misplaced oocytes increased and a dose-dependent decrease of oocyte volume was observed. Imbalances in the oogenesis process, induction of vitellogenin in males and the absence of pregnancies highlight that environmental relevant concentrations of EE2 have the potential to negatively affect pipefish populations, most of them inhabiting coastal areas where oestrogenic contamination is more prevalent. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Chemical cleavage reactions of DNA on solid support: application in mutation detection

    Directory of Open Access Journals (Sweden)

    Cotton Richard GH

    2003-05-01

    Full Text Available Abstract Background The conventional solution-phase Chemical Cleavage of Mismatch (CCM method is time-consuming, as the protocol requires purification of DNA after each reaction step. This paper describes a new version of CCM to overcome this problem by immobilizing DNA on silica solid supports. Results DNA test samples were loaded on to silica beads and the DNA bound to the solid supports underwent chemical modification reactions with KMnO4 (potassium permanganate and hydroxylamine in 3M TEAC (tetraethylammonium chloride solution. The resulting modified DNA was then simultaneously cleaved by piperidine and removed from the solid supports to afford DNA fragments without the requirement of DNA purification between reaction steps. Conclusions The new solid-phase version of CCM is a fast, cost-effective and sensitive method for detection of mismatches and mutations.

  10. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  11. Chemical reaction dynamics using the Advanced Light Source

    International Nuclear Information System (INIS)

    Yang, X.; Blank, D.A.; Heimann, P.A.; Lee, Y.T.; Suits, A.G.; Lin, J.; Wodtke, A.M.

    1995-01-01

    The recently commissioned Advanced Light Source (ALS) at Berkeley provides a high brightness, tunable VUV light source for chemical dynamics studies. A dedicated chemical dynamics beamline has been built at the ALS for studies of fundamental chemical processes. High flux (10(sup 16) photon/s with 2% bandwidth) VUV synchrotron radiation from 5 to 30 eV can be obtained from the beamline, whose source is the U8/10 undulator. Three endstations will be in operation for studies ranging from crossed beam reaction dynamics and photodissociation to high resolution photoionization dynamics and spectroscopy. A rotatable source crossed molecular beam apparatus (endstation one) has been established for unimolecular and bimolecular reactive scattering studies. Photodissociation of methylamine and ozone were carried out using VUV synchrotron radiation as the ionization detection technique at this endstation. Results show the advantages of the new endstation using VUV ionization as the detection scheme over similar machines using electron bombardment as the ionization source

  12. Chemical reaction dynamics using the Advanced Light Source

    International Nuclear Information System (INIS)

    Yang, X.; Blank, D.A.; Heimann, P.A.; Lee, Y.T.; Suits, A.G.; Lin, J.; Wodtke, A.M.

    1995-09-01

    The recently commissioned Advanced Light Source (ALS) at Berkeley provides a high brightness, tunable VUV light source for chemical dynamics studies. A dedicated chemical dynamics beamline has been built at the ALS for studies of fundamental chemical processes. High flux (10 16 photon/s with 2% bandwidth) VUV synchrotron radiation from 5 to 30 eV can be obtained from the beamline, whose source is the U8/10 undulator. Three endstations will be in operation for studies ranging from crossed beam reaction dynamics and photodissociation to high resolution photoionization dynamics and spectroscopy. A rotatable source crossed molecular beam apparatus (endstation one) has been established for unimolecular and bimolecular reactive scattering studies. Photodissociation of methylamine and ozone were carried out using VUV synchrotron radiation as the ionization detection technique at this endstation. Results show the advantages of the new endstation using VUV ionization as the detection scheme over similar machines using electron bombardment as the ionization source

  13. Chemical Reactions of Molecules Promoted and Simultaneously Imaged by the Electron Beam in Transmission Electron Microscopy.

    Science.gov (United States)

    Skowron, Stephen T; Chamberlain, Thomas W; Biskupek, Johannes; Kaiser, Ute; Besley, Elena; Khlobystov, Andrei N

    2017-08-15

    The main objective of this Account is to assess the challenges of transmission electron microscopy (TEM) of molecules, based on over 15 years of our work in this field, and to outline the opportunities in studying chemical reactions under the electron beam (e-beam). During TEM imaging of an individual molecule adsorbed on an atomically thin substrate, such as graphene or a carbon nanotube, the e-beam transfers kinetic energy to atoms of the molecule, displacing them from equilibrium positions. Impact of the e-beam triggers bond dissociation and various chemical reactions which can be imaged concurrently with their activation by the e-beam and can be presented as stop-frame movies. This experimental approach, which we term ChemTEM, harnesses energy transferred from the e-beam to the molecule via direct interactions with the atomic nuclei, enabling accurate predictions of bond dissociation events and control of the type and rate of chemical reactions. Elemental composition and structure of the reactant molecules as well as the operating conditions of TEM (particularly the energy of the e-beam) determine the product formed in ChemTEM processes, while the e-beam dose rate controls the reaction rate. Because the e-beam of TEM acts simultaneously as a source of energy for the reaction and as an imaging tool monitoring the same reaction, ChemTEM reveals atomic-level chemical information, such as pathways of reactions imaged for individual molecules, step-by-step and in real time; structures of illusive reaction intermediates; and direct comparison of catalytic activity of different transition metals filmed with atomic resolution. Chemical transformations in ChemTEM often lead to previously unforeseen products, demonstrating the potential of this method to become not only an analytical tool for studying reactions, but also a powerful instrument for discovery of materials that can be synthesized on preparative scale.

  14. Coarse grain model for coupled thermo-mechano-chemical processes and its application to pressure-induced endothermic chemical reactions

    International Nuclear Information System (INIS)

    Antillon, Edwin; Banlusan, Kiettipong; Strachan, Alejandro

    2014-01-01

    We extend a thermally accurate model for coarse grain dynamics (Strachan and Holian 2005 Phys. Rev. Lett. 94 014301) to enable the description of stress-induced chemical reactions in the degrees of freedom internal to the mesoparticles. Similar to the breathing sphere model, we introduce an additional variable that describes the internal state of the particles and whose dynamics is governed both by an internal potential energy function and by interparticle forces. The equations of motion of these new variables are derived from a Hamiltonian and the model exhibits two desired features: total energy conservation and Galilean invariance. We use a simple model material with pairwise interactions between particles and study pressure-induced chemical reactions induced by hydrostatic and uniaxial compression. These examples demonstrate the ability of the model to capture non-trivial processes including the interplay between mechanical, thermal and chemical processes of interest in many applications. (paper)

  15. A Simple Model to Access Equilibrium Constants of Reactions Type A ⇋ B Using Monte Carlo Simulation.

    Directory of Open Access Journals (Sweden)

    R. R. Farias, L. A. M. Cardoso, N. M. Oliveira Neto

    2011-01-01

    Full Text Available A simple theoretical model to describe equilibrium properties of homogeneous re-versible chemical reactions is proposed and applied to an A ⇋ B type reaction. Forthis purpose the equilibrium properties are analyzed by usual Monte Carlo simula-tion. It is shown that the equilibrium constant (Ke for this kind of reaction exhibitsdistinct characteristics for Eba 1, where Eba is the ratio be-tween the reverse and forward activation energies. For Eba 1 and increase(decrease the temperature our results recover the principle of Le Chˆtelier applied ato temperature effects. The special and interesting case is obtained for Eba = 1 sinceKe = 1 for all range of temperature. Another important parameter in our analysisis θA , defined as temperature measured with relation the activation energy of theforward reaction. For fixed values of Eba and for θA ≫ 1 the equilibrium constantapproaches 1, showing that all transitions are equally likely, no matter the differencein the energy barriers. The data obtained in our simulations show the well knownrelationship between Ke , Eb , Ea and kB T . Finally we argue that this theoreticalmodel can be applied to a family of homogeneous chemical reactions characterizedby the same Eba and θA showing the broad application of this stochastic model tostudy chemical reactions. Some of these results will be discussed in terms of collisiontheory.

  16. Chemical Characterization and Reactivity of Fuel-Oxidizer Reaction Product

    Science.gov (United States)

    David, Dennis D.; Dee, Louis A.; Beeson, Harold D.

    1997-01-01

    Fuel-oxidizer reaction product (FORP), the product of incomplete reaction of monomethylhydrazine and nitrogen tetroxide propellants prepared under laboratory conditions and from firings of Shuttle Reaction Control System thrusters, has been characterized by chemical and thermal analysis. The composition of FORP is variable but falls within a limited range of compositions that depend on three factors: the fuel-oxidizer ratio at the time of formation; whether the composition of the post-formation atmosphere is reducing or oxidizing; and the reaction or post-reaction temperature. A typical composition contains methylhydrazinium nitrate, ammonium nitrate, methylammonium nitrate, and trace amounts of hydrazinium nitrate and 1,1-dimethylhydrazinium nitrate. Thermal decomposition reactions of the FORP compositions used in this study were unremarkable. Neither the various compositions of FORP, the pure major components of FORP, nor mixtures of FORP with propellant system corrosion products showed any unusual thermal activity when decomposed under laboratory conditions. Off-limit thruster operations were simulated by rapid mixing of liquid monomethylhydrazine and liquid nitrogen tetroxide in a confined space. These tests demonstrated that monomethylhydrazine, methylhydrazinium nitrate, ammonium nitrate, or Inconel corrosion products can induce a mixture of monomethylhydrazine and nitrogen tetroxide to produce component-damaging energies. Damaging events required FORP or metal salts to be present at the initial mixing of monomethylhydrazine and nitrogen tetroxide.

  17. Chemical reaction rates and non-equilibrium pressure of reacting gas mixtures in the state-to-state approach

    International Nuclear Information System (INIS)

    Kustova, Elena V.; Kremer, Gilberto M.

    2014-01-01

    Highlights: • State-to-state approach for coupled vibrational relaxation and chemical reactions. • Self-consistent model for rates of non-equilibrium reactions and energy transitions. • In viscous flows mass action law is violated. • Cross coupling between reaction rates and non-equilibrium pressure in viscous flow. • Results allow implementing the state-to-state approach for viscous flow simulations. - Abstract: Viscous gas flows with vibrational relaxation and chemical reactions in the state-to-state approach are analyzed. A modified Chapman–Enskog method is used for the determination of chemical reaction and vibrational transition rates and non-equilibrium pressure. Constitutive equations depend on the thermodynamic forces: velocity divergence and chemical reaction/transition affinity. As an application, N 2 flow with vibrational relaxation across a shock wave is investigated. Two distinct processes occur behind the shock: for small values of the distance the affinity is large and vibrational relaxation is in its initial stage; for large distances the affinity is small and the chemical reaction is in its final stage. The affinity contributes more to the transition rate than the velocity divergence and the effect of these two contributions are more important for small distances from the shock front. For the non-equilibrium pressure, the term associated with the bulk viscosity increases by a small amount the hydrostatic pressure

  18. Chemical reaction rates and non-equilibrium pressure of reacting gas mixtures in the state-to-state approach

    Energy Technology Data Exchange (ETDEWEB)

    Kustova, Elena V., E-mail: e.kustova@spbu.ru [Department of Mathematics and Mechanics, Saint Petersburg State University, 198504 Universitetskiy pr. 28, Saint Petersburg (Russian Federation); Kremer, Gilberto M., E-mail: kremer@fisica.ufpr.br [Departamento de Física, Universidade Federal do Paraná, Caixa Postal 19044, 81531-980 Curitiba (Brazil)

    2014-12-05

    Highlights: • State-to-state approach for coupled vibrational relaxation and chemical reactions. • Self-consistent model for rates of non-equilibrium reactions and energy transitions. • In viscous flows mass action law is violated. • Cross coupling between reaction rates and non-equilibrium pressure in viscous flow. • Results allow implementing the state-to-state approach for viscous flow simulations. - Abstract: Viscous gas flows with vibrational relaxation and chemical reactions in the state-to-state approach are analyzed. A modified Chapman–Enskog method is used for the determination of chemical reaction and vibrational transition rates and non-equilibrium pressure. Constitutive equations depend on the thermodynamic forces: velocity divergence and chemical reaction/transition affinity. As an application, N{sub 2} flow with vibrational relaxation across a shock wave is investigated. Two distinct processes occur behind the shock: for small values of the distance the affinity is large and vibrational relaxation is in its initial stage; for large distances the affinity is small and the chemical reaction is in its final stage. The affinity contributes more to the transition rate than the velocity divergence and the effect of these two contributions are more important for small distances from the shock front. For the non-equilibrium pressure, the term associated with the bulk viscosity increases by a small amount the hydrostatic pressure.

  19. Reversible Thermoset Adhesives

    Science.gov (United States)

    Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)

    2016-01-01

    Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.

  20. Two-Dimensional Resonance Raman Signatures of Vibronic Coherence Transfer in Chemical Reactions.

    Science.gov (United States)

    Guo, Zhenkun; Molesky, Brian P; Cheshire, Thomas P; Moran, Andrew M

    2017-11-02

    Two-dimensional resonance Raman (2DRR) spectroscopy has been developed for studies of photochemical reaction mechanisms and structural heterogeneity in condensed phase systems. 2DRR spectroscopy is motivated by knowledge of non-equilibrium effects that cannot be detected with traditional resonance Raman spectroscopy. For example, 2DRR spectra may reveal correlated distributions of reactant and product geometries in systems that undergo chemical reactions on the femtosecond time scale. Structural heterogeneity in an ensemble may also be reflected in the 2D spectroscopic line shapes of both reactive and non-reactive systems. In this chapter, these capabilities of 2DRR spectroscopy are discussed in the context of recent applications to the photodissociation reactions of triiodide. We show that signatures of "vibronic coherence transfer" in the photodissociation process can be targeted with particular 2DRR pulse sequences. Key differences between the signal generation mechanisms for 2DRR and off-resonant 2D Raman spectroscopy techniques are also addressed. Overall, recent experimental developments and applications of the 2DRR method suggest that it will be a valuable tool for elucidating ultrafast chemical reaction mechanisms.

  1. Plant Acyl-CoA:Lysophosphatidylcholine Acyltransferases (LPCATs) Have Different Specificities in Their Forward and Reverse Reactions*

    Science.gov (United States)

    Lager, Ida; Yilmaz, Jenny Lindberg; Zhou, Xue-Rong; Jasieniecka, Katarzyna; Kazachkov, Michael; Wang, Peng; Zou, Jitao; Weselake, Randall; Smith, Mark A.; Bayon, Shen; Dyer, John M.; Shockey, Jay M.; Heinz, Ernst; Green, Allan; Banas, Antoni; Stymne, Sten

    2013-01-01

    Acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT) enzymes have central roles in acyl editing of phosphatidylcholine (PC). Plant LPCAT genes were expressed in yeast and characterized biochemically in microsomal preparations of the cells. Specificities for different acyl-CoAs were similar for seven LPCATs from five different species, including species accumulating hydroxylated acyl groups in their seed oil, with a preference for C18-unsaturated acyl-CoA and low activity with palmitoyl-CoA and ricinoleoyl (12-hydroxyoctadec-9-enoyl)-CoA. We showed that Arabidopsis LPCAT1 and LPCAT2 enzymes catalyzed the acylation and de-acylation of both sn positions of PC, with a preference for the sn-2 position. When acyl specificities of the Arabidopsis LPCATs were measured in the reverse reaction, sn-2-bound oleoyl, linoleoyl, and linolenoyl groups from PC were transferred to acyl-CoA to a similar extent. However, a ricinoleoyl group at the sn-2-position of PC was removed 4–6-fold faster than an oleoyl group in the reverse reaction, despite poor utilization in the forward reaction. The data presented, taken together with earlier published reports on in vivo lipid metabolism, support the hypothesis that plant LPCAT enzymes play an important role in regulating the acyl-CoA composition in plant cells by transferring polyunsaturated and hydroxy fatty acids produced on PC directly to the acyl-CoA pool for further metabolism or catabolism. PMID:24189065

  2. Discovery of Rapid and Reversible Water Insertion in Rare Earth Sulfates: A New Process for Thermochemical Heat Storage.

    Science.gov (United States)

    Hatada, Naoyuki; Shizume, Kunihiko; Uda, Tetsuya

    2017-07-01

    Thermal energy storage based on chemical reactions is a prospective technology for the reduction of fossil-fuel consumption by storing and using waste heat. For widespread application, a critical challenge is to identify appropriate reversible reactions that occur below 250 °C, where abundant low-grade waste heat and solar energy might be available. Here, it is shown that lanthanum sulfate monohydrate La 2 (SO 4 ) 3 ⋅H 2 O undergoes rapid and reversible dehydration/hydration reactions in the temperature range from 50 to 250 °C upon heating/cooling with remarkably small thermal hysteresis (water is removed from, or inserted in La 2 (SO 4 ) 3 ⋅H 2 O with progressive change in hydration number x without phase change. It is also revealed that only a specific structural modification of La 2 (SO 4 ) 3 exhibits this reversible dehydration/hydration behavior. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Accurate and approximate thermal rate constants for polyatomic chemical reactions

    International Nuclear Information System (INIS)

    Nyman, Gunnar

    2007-01-01

    In favourable cases it is possible to calculate thermal rate constants for polyatomic reactions to high accuracy from first principles. Here, we discuss the use of flux correlation functions combined with the multi-configurational time-dependent Hartree (MCTDH) approach to efficiently calculate cumulative reaction probabilities and thermal rate constants for polyatomic chemical reactions. Three isotopic variants of the H 2 + CH 3 → CH 4 + H reaction are used to illustrate the theory. There is good agreement with experimental results although the experimental rates generally are larger than the calculated ones, which are believed to be at least as accurate as the experimental rates. Approximations allowing evaluation of the thermal rate constant above 400 K are treated. It is also noted that for the treated reactions, transition state theory (TST) gives accurate rate constants above 500 K. TST theory also gives accurate results for kinetic isotope effects in cases where the mass of the transfered atom is unchanged. Due to neglect of tunnelling, TST however fails below 400 K if the mass of the transferred atom changes between the isotopic reactions

  4. Kinetics of heterogeneous chemical reactions: a theoretical model for the accumulation of pesticides in soil.

    Science.gov (United States)

    Lin, S H; Sahai, R; Eyring, H

    1971-04-01

    A theoretical model for the accumulation of pesticides in soil has been proposed and discussed from the viewpoint of heterogeneous reaction kinetics with a basic aim to understand the complex nature of soil processes relating to the environmental pollution. In the bulk of soil, the pesticide disappears by diffusion and a chemical reaction; the rate processes considered on the surface of soil are diffusion, chemical reaction, vaporization, and regular pesticide application. The differential equations involved have been solved analytically by the Laplace-transform method.

  5. Controlling Solid–Liquid Conversion Reactions for a Highly Reversible Aqueous Zinc–Iodine Battery

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Huilin; Li, Bin; Mei, Donghai; Nie, Zimin; Shao, Yuyan; Li, Guosheng; Li, Xiaohong S.; Han, Kee Sung; Muller, Karl T.; Sprenkle, Vincent L.; Liu, Jun

    2017-10-30

    Aqueous rechargeable batteries are desirable for many energy storage applications due to their low cost and high safety. However, low capacity and short cycle life are the significant obstacles to their practical applications. Here, we demonstrate a highly reversible aqueous zinc-iodine battery using encapsulated iodine in microporous active carbon fibers (ACFs) as cathode materials through the rational control of solid-liquid conversion reactions. The experiments and density function theory (DFT) calculations were employed to investigate the effects of solvents and properties of carbon hosts, e.g. pore size, surface chemistries, on the adsorption of iodine species. The rational manipulation of the competition between the adsorption in carbon and solvation in electrolytes for iodine species is responsible for the high reversibility and cycling stability. The zinc-iodine batteries deliver a high capacity of 180 mAh g-1 at 1C and a stable cycle life over 3000 cycles with ~90% capacity retention as well as negligible self-discharge. We believe the principles for stabilizing the zinc-iodine system could provide new insight into conversion systems such as Li-S systems.

  6. Study of Horseradish Peroxidase Fixed on Mesoporous Materials as a Chemical Reaction Catalyst

    Science.gov (United States)

    Gao, Mengdan; Dai, Rongji

    2017-12-01

    Nanostructured mesoporous materials is a new type of porous materials, which has been widely used. It has excellent capability in enzymes immobilization, but modification on the chemical bonds of the enzyme reduce the enzymatic activity and rarely used in chemical reactions. The horseradish peroxidase was immobilized on the mesoporous materials with appropriate aperture and its activity and stability was evaluated when catalyzing the nitration reaction of amines and oxidation reaction of thiourea. The optimum mesoporous material to fix the horseradish peroxidase can be obtained by mixing polyoxyethylene - polyoxypropylene-pol, yoxyethylene(P123), 1,3,5-trimethylbenzene(TMB), and tetramethoxysilane (TMOS) at a ratio of 10:1:1, whose surface area and pore volume and pore diameter calculated by BET and BJH model were 402.903m2/g, 1.084cm2/g, 1.084cm2/g respectively. The horseradish peroxidase, immobilized on the mesoporous materials, was applied for catalyzing the nitration reaction of anilines and oxidation reaction of thiourea, produced a high product yield and can be recycled. Thus, it is a strong candidate as a catalysts for oxidation reactions, to be produced at industral scale, due to its high efficiency and low cost.

  7. Chemical reaction surface vibrational frequencies evaluated in curvilinear internal coordinates: Application to H + CH(4) H(2) + CH(3).

    Science.gov (United States)

    Banks, Simon T; Clary, David C

    2009-01-14

    We consider the general problem of vibrational analysis at nonglobally optimized points on a reduced dimensional reaction surface. We discuss the importance of the use of curvilinear internal coordinates to describe molecular motion and derive a curvilinear projection operator to remove the contribution of nonzero gradients from the Hessian matrix. Our projection scheme is tested in the context of a two-dimensional quantum scattering calculation for the reaction H + CH(4) --> H(2) + CH(3) and its reverse H(2) + CH(3) --> H + CH(4). Using zero-point energies calculated via rectilinear and curvilinear projections we construct two two-dimensional, adiabatically corrected, ab initio reaction surfaces for this system. It is shown that the use of curvilinear coordinates removes unphysical imaginary frequencies observed with rectilinear projection and leads to significantly improved thermal rate constants for both the forward and reverse reactions.

  8. Quantum chemical modeling of enzymatic reactions: the case of 4-oxalocrotonate tautomerase.

    Science.gov (United States)

    Sevastik, Robin; Himo, Fahmi

    2007-12-01

    The reaction mechanism of 4-oxalocrotonate tautomerase (4-OT) is studied using the density functional theory method B3LYP. This enzyme catalyzes the isomerisation of unconjugated alpha-keto acids to their conjugated isomers. Two different quantum chemical models of the active site are devised and the potential energy curves for the reaction are computed. The calculations support the proposed reaction mechanism in which Pro-1 acts as a base to shuttle a proton from the C3 to the C5 position of the substrate. The first step (proton transfer from C3 to proline) is shown to be the rate-limiting step. The energy of the charge-separated intermediate (protonated proline-deprotonated substrate) is calculated to be quite low, in accordance with measured pKa values. The results of the two models are used to evaluate the methodology employed in modeling enzyme active sites using quantum chemical cluster models.

  9. Analysis of mechanism of complex chemical reaction taking radiation chemical purification of gases from impurities as an example

    International Nuclear Information System (INIS)

    Gerasimov, G.Ya.; Makarov, V.N.

    1997-01-01

    Algorithm of selecting optimal mechanism of complex chemical reaction, enabling to reduce the number of its stages, is suggested. Main steps of constructing the kinetic model of the medium are considered, taking the radiation chemical purification (using fast electron radiation) of gases (N 2 , CO 2 , O 2 and others) from impurities as an example. 17 refs., 3 figs., 2 tabs

  10. KEMOD: A mixed chemical kinetic and equilibrium model of aqueous and solid phase geochemical reactions

    International Nuclear Information System (INIS)

    Yeh, G.T.; Iskra, G.A.

    1995-01-01

    This report presents the development of a mixed chemical Kinetic and Equilibrium MODel in which every chemical species can be treated either as a equilibrium-controlled or as a kinetically controlled reaction. The reaction processes include aqueous complexation, adsorption/desorption, ion exchange, precipitation/dissolution, oxidation/reduction, and acid/base reactions. Further development and modification of KEMOD can be made in: (1) inclusion of species switching solution algorithms, (2) incorporation of the effect of temperature and pressure on equilibrium and rate constants, and (3) extension to high ionic strength

  11. [Recent results in research on oscillatory chemical reactions].

    Science.gov (United States)

    Poros, Eszter; Kurin-Csörgei, Krisztina

    2014-01-01

    The mechanisms of the complicated periodical phenomenas in the nature (e.g. hearth beat, sleep cycle, circadian rhythms, etc) could be understood with using the laws of nonlinear chemical systems. In this article the newest result in the research of the subfield of nonlinear chemical dynamics aimed at constructing oscillatory chemical reactions, which are novel either in composition or in configuration, are presented. In the introductory part the concept of chemical periodicity is defined, then the forms as it can appear in time and space and the methods of their study are discussed. Detailed description of the experimental work that has resulted in two significant discoveries is provided. A method was developed to design pH-oscillators which are capable of operating under close conditions. The batch pH-oscillators are more convenient to use in some proposed applications than the equivalent CSTR variant. A redox oscillator that is new in composition was found. The permanganate oxidation of some amino acids was shown to take place according to oscillatory kinetics in a narrow range of the experimental parameters. The KMnO4 - glycine - Na2HPO4 system represents the first example in the family of manganese based oscillators where amino acids is involved. In the conclusion formal analogies between the simple chemical and some more complicated biological oscillatory phenomena are mentioned and the possibility of modeling periodic processes with the use of information gained from the studies of chemical oscillations is pointed out.

  12. Fast screening of analytes for chemical reactions by reactive low-temperature plasma ionization mass spectrometry.

    Science.gov (United States)

    Zhang, Wei; Huang, Guangming

    2015-11-15

    Approaches for analyte screening have been used to aid in the fine-tuning of chemical reactions. Herein, we present a simple and straightforward analyte screening method for chemical reactions via reactive low-temperature plasma ionization mass spectrometry (reactive LTP-MS). Solution-phase reagents deposited on sample substrates were desorbed into the vapor phase by action of the LTP and by thermal desorption. Treated with LTP, both reagents reacted through a vapor phase ion/molecule reaction to generate the product. Finally, protonated reagents and products were identified by LTP-MS. Reaction products from imine formation reaction, Eschweiler-Clarke methylation and the Eberlin reaction were detected via reactive LTP-MS. Products from the imine formation reaction with reagents substituted with different functional groups (26 out of 28 trials) were successfully screened in a time of 30 s each. Besides, two short-lived reactive intermediates of Eschweiler-Clarke methylation were also detected. LTP in this study serves both as an ambient ionization source for analyte identification (including reagents, intermediates and products) and as a means to produce reagent ions to assist gas-phase ion/molecule reactions. The present reactive LTP-MS method enables fast screening for several analytes from several chemical reactions, which possesses good reagent compatibility and the potential to perform high-throughput analyte screening. In addition, with the detection of various reactive intermediates (intermediates I and II of Eschweiler-Clarke methylation), the present method would also contribute to revealing and elucidating reaction mechanisms. Copyright © 2015 John Wiley & Sons, Ltd.

  13. Variable elimination in chemical reaction networks with mass-action kinetics

    DEFF Research Database (Denmark)

    Feliu, Elisenda; Wiuf, C.

    2012-01-01

    We consider chemical reaction networks taken with mass-action kinetics. The steady states of such a system are solutions to a system of polynomial equations. Even for small systems the task of finding the solutions is daunting. We develop an algebraic framework and procedure for linear elimination...

  14. In Situ Monitoring of Chemical Reactions at a Solid-Water Interface by Femtosecond Acoustics.

    Science.gov (United States)

    Shen, Chih-Chiang; Weng, Meng-Yu; Sheu, Jinn-Kong; Yao, Yi-Ting; Sun, Chi-Kuang

    2017-11-02

    Chemical reactions at a solid-liquid interface are of fundamental importance. Interfacial chemical reactions occur not only at the very interface but also in the subsurface area, while existing monitoring techniques either provide limited spatial resolution or are applicable only for the outmost atomic layer. Here, with the aid of the time-domain analysis with femtosecond acoustics, we demonstrate a subatomic-level-resolution technique to longitudinally monitor chemical reactions at solid-water interfaces, capable of in situ monitoring even the subsurface area under atmospheric conditions. Our work was proven by monitoring the already-known anode oxidation process occurring during photoelectrochemical water splitting. Furthermore, whenever the oxide layer thickness equals an integer  number of the effective atomic layer thickness, the measured acoustic echo will show higher signal-to-noise ratios with reduced speckle noise, indicating the quantum-like behavior of this coherent-phonon-based technique.

  15. Driving Chemical Reactions in Plasmonic Nanogaps with Electrohydrodynamic Flow.

    Science.gov (United States)

    Thrift, William J; Nguyen, Cuong Q; Darvishzadeh-Varcheie, Mahsa; Zare, Siavash; Sharac, Nicholas; Sanderson, Robert N; Dupper, Torin J; Hochbaum, Allon I; Capolino, Filippo; Abdolhosseini Qomi, Mohammad Javad; Ragan, Regina

    2017-11-28

    Nanoparticles from colloidal solution-with controlled composition, size, and shape-serve as excellent building blocks for plasmonic devices and metasurfaces. However, understanding hierarchical driving forces affecting the geometry of oligomers and interparticle gap spacings is still needed to fabricate high-density architectures over large areas. Here, electrohydrodynamic (EHD) flow is used as a long-range driving force to enable carbodiimide cross-linking between nanospheres and produces oligomers exhibiting sub-nanometer gap spacing over mm 2 areas. Anhydride linkers between nanospheres are observed via surface-enhanced Raman scattering (SERS) spectroscopy. The anhydride linkers are cleavable via nucleophilic substitution and enable placement of nucleophilic molecules in electromagnetic hotspots. Atomistic simulations elucidate that the transient attractive force provided by EHD flow is needed to provide a sufficient residence time for anhydride cross-linking to overcome slow reaction kinetics. This synergistic analysis shows assembly involves an interplay between long-range driving forces increasing nanoparticle-nanoparticle interactions and probability that ligands are in proximity to overcome activation energy barriers associated with short-range chemical reactions. Absorption spectroscopy and electromagnetic full-wave simulations show that variations in nanogap spacing have a greater influence on optical response than variations in close-packed oligomer geometry. The EHD flow-anhydride cross-linking assembly method enables close-packed oligomers with uniform gap spacings that produce uniform SERS enhancement factors. These results demonstrate the efficacy of colloidal driving forces to selectively enable chemical reactions leading to future assembly platforms for large-area nanodevices.

  16. Kinetic calorimetry in the study of the mechanism of low-temperature chemical reactions

    Science.gov (United States)

    Barkalov, I. M.; Kiryukhin, D. P.

    Chemical reactions are always followed by a change in the reacting system enthalpy, hence, calorimetry as a method of enthalpy and heat capacity measuring is a universal and, sometimes, even the only possible way of studying chemical reaction kinetics. Throughout its long history, the calorimeter, having preserved the positions of the main method of thermodynamic studies, has conquered a new field of application: that of kinetic study of chemical reactions. The advantages and disadvantages of the kinetic calorimeter are now obvious. First, the advantages are: (1) the possibility of measuring the rate of a chemical reaction without any special requirements being imposed on the reaction medium (solid, viscous, multicomponent systems); (2) the high efficiency: a large volume of kinetic information in one experiment and a non-destructive character of changes; (3) the possibility of measuring directly in the field of ionizing radiation (γ-radiation, accelerated electrons) and light; and (4) recording of the chemical conversion directly at the time of its occurrence. The disadvantages of this method are: (1) the high inertia of standard calorimeter systems (τC⋍102-103S), which restricts the possibilities of studying fast processes; and (2) the complexity of the correct organization of the calorimeter experiment when the parameters of the process are changed (overheating in the sample, conversion of the process to explosive and auto wave regimens). One of the oldest and most universal methods of studying the mechanism of chemical reactions, calorimetry, is now passing through a period of turbulent development due to the advances in electronics and computerization. The wide variety of types of calorimeter set-ups and the large assortment of measurement schemes in the currently described methods complicate the experimental selection of the necessary instrument rather than facilitate it. The basic principles of the method, the types of calorimeters, and the measuring

  17. Combining chemoinformatics with bioinformatics: in silico prediction of bacterial flavor-forming pathways by a chemical systems biology approach "reverse pathway engineering".

    Science.gov (United States)

    Liu, Mengjin; Bienfait, Bruno; Sacher, Oliver; Gasteiger, Johann; Siezen, Roland J; Nauta, Arjen; Geurts, Jan M W

    2014-01-01

    The incompleteness of genome-scale metabolic models is a major bottleneck for systems biology approaches, which are based on large numbers of metabolites as identified and quantified by metabolomics. Many of the revealed secondary metabolites and/or their derivatives, such as flavor compounds, are non-essential in metabolism, and many of their synthesis pathways are unknown. In this study, we describe a novel approach, Reverse Pathway Engineering (RPE), which combines chemoinformatics and bioinformatics analyses, to predict the "missing links" between compounds of interest and their possible metabolic precursors by providing plausible chemical and/or enzymatic reactions. We demonstrate the added-value of the approach by using flavor-forming pathways in lactic acid bacteria (LAB) as an example. Established metabolic routes leading to the formation of flavor compounds from leucine were successfully replicated. Novel reactions involved in flavor formation, i.e. the conversion of alpha-hydroxy-isocaproate to 3-methylbutanoic acid and the synthesis of dimethyl sulfide, as well as the involved enzymes were successfully predicted. These new insights into the flavor-formation mechanisms in LAB can have a significant impact on improving the control of aroma formation in fermented food products. Since the input reaction databases and compounds are highly flexible, the RPE approach can be easily extended to a broad spectrum of applications, amongst others health/disease biomarker discovery as well as synthetic biology.

  18. A mathematical model for chemical reactions with actinide elements in the aqueous nitric acid solution: REACT

    International Nuclear Information System (INIS)

    Tachimori, Shoichi

    1990-02-01

    A mathematical model of chemical reactions with actinide elements: REACT code, was developed to simulate change of valency states of U, Pu and Np in the aqueous nitric acid solution. Twenty seven rate equations for the redox reactions involving some reductants, disproportionation reactions, and radiolytic growth and decay reaction of nitrous acid were programmed in the code . Eight numerical solution methods such as Porsing method to solve the rate equations were incorporated parallel as options depending on the characteristics of the reaction systems. The present report gives a description of the REACT code, e.g., chemical reactions and their rate equations, numerical solution methods, and some examples of the calculation results. A manual and a source file of the program was attached to the appendix. (author)

  19. Unsteady Bioconvection Squeezing Flow in a Horizontal Channel with Chemical Reaction and Magnetic Field Effects

    Directory of Open Access Journals (Sweden)

    Qingkai Zhao

    2017-01-01

    Full Text Available The time-dependent mixed bioconvection flow of an electrically conducting fluid between two infinite parallel plates in the presence of a magnetic field and a first-order chemical reaction is investigated. The fully coupled nonlinear systems describing the total mass, momentum, thermal energy, mass diffusion, and microorganisms equations are reduced to a set of ordinary differential equations via a set of new similarity transformations. The detailed analysis illustrating the influences of various physical parameters such as the magnetic, squeezing, and chemical reaction parameters and the Schmidt and Prandtl numbers on the distributions of temperature and microorganisms as well as the skin friction and the Nusselt number is presented. The conclusion is drawn that the flow field, temperature, and chemical reaction profiles are significantly influenced by magnetic parameter, heat generation/absorption parameter, and chemical parameter. Some examples of potential applications of such bioconvection could be found in pharmaceutical industry, microfluidic devices, microbial enhanced oil recovery, modeling oil, and gas-bearing sedimentary basins.

  20. On the chemical reaction of matter with antimatter.

    Science.gov (United States)

    Lodi Rizzini, Evandro; Venturelli, Luca; Zurlo, Nicola

    2007-06-04

    A chemical reaction between the building block antiatomic nucleus, the antiproton (p or H- in chemical notation), and the hydrogen molecular ion (H2+) has been observed by the ATHENA collaboration at CERN. The charged pair interact via the long-range Coulomb force in the environment of a Penning trap which is purpose-built to observe antiproton interactions. The net result of the very low energy collision of the pair is the creation of an antiproton-proton bound state, known as protonium (Pn), together with the liberation of a hydrogen atom. The Pn is formed in a highly excited, metastable, state with a lifetime against annihilation of around 1 micros. Effects are observed related to the temperature of the H2+ prior to the interaction, and this is discussed herein.

  1. Chemical research on red pigments after adverse reactions to tattoo.

    Science.gov (United States)

    Tammaro, A; Toniolo, C; Giulianelli, V; Serafini, M; Persechino, S

    2016-03-01

    Currently, the incidence of tattooing is on the rise compared to the past, especially among adolescents, and it leads to the urgency of monitoring the security status of tattooing centers, as well as to inform people about the risks of tattoo practice. In our clinical experience, 20% of tattooed patients presented adverse reactions, like allergic contact dermatitis, psoriasis with Koebner's phenomena and granulomatous reactions, with the latter most prevalent and most often related to red pigment. Adverse reactions to tattoo pigments, especially the red one, are well known and described in literature. Great attention has to be focused on the pigments used, especially for the presence of new substances, often not well known. For this reason, we decided to perform a study on 12 samples of red tattoo ink, obtained by patients affected by different cutaneous reactions in the site of tattoo, to analyze their chemical composition.

  2. Chemical reaction of hexagonal boron nitride and graphite nanoclusters in mechanical milling systems

    Energy Technology Data Exchange (ETDEWEB)

    Muramatsu, Y.; Grush, M.; Callcott, T.A. [Univ. of Tennessee, Knoxville, TN (United States)] [and others

    1997-04-01

    Synthesis of boron-carbon-nitride (BCN) hybrid alloys has been attempted extensively by many researchers because the BCN alloys are considered an extremely hard material called {open_quotes}super diamond,{close_quotes} and the industrial application for wear-resistant materials is promising. A mechanical alloying (MA) method of hexagonal boron nitride (h-BN) with graphite has recently been studied to explore the industrial synthesis of the BCN alloys. To develop the MA method for the BCN alloy synthesis, it is necessary to confirm the chemical reaction processes in the mechanical milling systems and to identify the reaction products. Therefore, the authors have attempted to confirm the chemical reaction process of the h-BN and graphite in mechanical milling systems using x-ray absorption near edge structure (XANES) methods.

  3. Chemical reaction of hexagonal boron nitride and graphite nanoclusters in mechanical milling systems

    International Nuclear Information System (INIS)

    Muramatsu, Y.; Grush, M.; Callcott, T.A.

    1997-01-01

    Synthesis of boron-carbon-nitride (BCN) hybrid alloys has been attempted extensively by many researchers because the BCN alloys are considered an extremely hard material called open-quotes super diamond,close quotes and the industrial application for wear-resistant materials is promising. A mechanical alloying (MA) method of hexagonal boron nitride (h-BN) with graphite has recently been studied to explore the industrial synthesis of the BCN alloys. To develop the MA method for the BCN alloy synthesis, it is necessary to confirm the chemical reaction processes in the mechanical milling systems and to identify the reaction products. Therefore, the authors have attempted to confirm the chemical reaction process of the h-BN and graphite in mechanical milling systems using x-ray absorption near edge structure (XANES) methods

  4. Chemiluminescence from an oxidation reaction of rhodamine B with cerium(IV) in a reversed micellar medium of cetyltrimethylammonium chloride in 1-hexanol-cyclohexane/water.

    Science.gov (United States)

    Hasanin, Tamer H A; Tsunemine, Yusuke; Tsukahara, Satoshi; Okamoto, Yasuaki; Fujiwara, Terufumi

    2011-01-01

    The chemiluminescence (CL) emission, observed when rhodamine B (RB) in 1-hexanol-cyclohexane was mixed with cerium(IV) sulfate in sulfuric acid dispersed in a reversed micellar medium of cetyltrimethylammonium chloride (CTAC) in 1-hexanol-cyclohexane/water, was investigated using a flow-injection system. The CL emission from the oxidation reaction of RB with Ce(IV) was found to be stronger in the CTAC reversed micellar solution compared with an aqueous solution. Bearing on the enhancement effect of the CTAC reverse micelles on the RB-Ce(IV) CL, several studies including stopped-flow, fluorescence and electron spin resonance (ESR) spectrometries were performed. Rapid spectral changes of an intermediate in the RB-Ce(IV) reaction in the aqueous and reversed micellar solutions were successfully observed using a stopped-flow method. The effect of the experimental variables, i.e., oxidant concentration, sulfuric acid concentration, the mole fraction of 1-hexanol, water-to-surfactant molar concentration ratio, flow rate, upon the CL intensity was evaluated. Under the experimental conditions optimized for a flow-injection determination of RB based on the new reversed micellar-mediated CL reaction with Ce(IV), a detection limit of 0.08 µmol dm(-3) RB was achieved, and a linear calibration graph was obtained with a dynamic range from 0.5 to 20 µmol dm(-3). The relative standard deviation (n = 6) obtained at an RB concentration of 3 µmol dm(-3) was 3%.

  5. Do High School Chemistry Examinations Inhibit Deeper Level Understanding of Dynamic Reversible Chemical Reactions?

    Science.gov (United States)

    Wheeldon, R.; Atkinson, R.; Dawes, A.; Levinson, R.

    2012-01-01

    Background and purpose: Chemistry examinations can favour the deployment of algorithmic procedures like Le Chatelier's Principle (LCP) rather than reasoning using chemical principles. This study investigated the explanatory resources which high school students use to answer equilibrium problems and whether the marks given for examination answers…

  6. EXPLORING THE DESIGN AND USE OF MOLECULAR ANIMATIONS THAT CONFLICT FOR UNDERSTANDING CHEMICAL REACTIONS

    Directory of Open Access Journals (Sweden)

    Resa M. Kelly

    Full Text Available Understanding chemical reactions conceptually involves recognizing characteristics of observable phenomena and envisioning how atoms, ions and molecules move and interact to cause the macroscopic changes. Our research focuses on the development of effective strategies for designing and presenting visualizations (videos and animations to assist students with making connections between macroscopic and molecular level behaviors of chemical reactions. Specifically, we study how students, who view videos of a redox reaction that exhibits obvious signs of macroscopic chemical change, can determine which molecular animation of a set of contrasting animations is best supported by its fit with experimental evidence. Herein we describe how we develop our videos and animations, and how students are learning from this animation task. Students who select inaccurate animation models are often enticed by a model that is easier to explain and fits with their understanding of reaction equations. We note that even though students indicate a preference for one animation over another, they often revise their drawn representations to fit with features from multiple animations. With the assistance of eye tracking research, we are gaining a better understanding of what students view and how they make sense of it.

  7. Chemical reaction on solid surface observed through isotope tracer technique

    International Nuclear Information System (INIS)

    Tanaka, Ken-ichi

    1983-01-01

    In order to know the role of atoms and ions on solid surfaces as the partners participating in elementary processes, the literatures related to the isomerization and hydrogen exchanging reaction of olefines, the hydrogenation of olefines, the metathesis reaction and homologation of olefines based on solid catalysts were reviewed. Various olefines, of which the hydrogen atoms were substituted with deuterium at desired positions, were reacted using various solid catalysts such as ZnO, K 2 CO 3 on C, MoS 2 (single crystal and powder) and molybdenum oxide (with various carriers), and the infra-red spectra of adsorbed olefines on catalysts, the isotope composition of reaction products and the production rate of the reaction products were measured. From the results, the bonding mode of reactant with the atoms and ions on solid surfaces, and the mechanism of the elementary process were considered. The author emphasized that the mechanism of the chemical reaction on solid surfaces and the role of active points or catalysts can be made clear to the considerable extent by combining isotopes suitably. (Yoshitake, I.)

  8. Contribution to an effective design method for stationary reaction-diffusion patterns

    International Nuclear Information System (INIS)

    Szalai, István; Horváth, Judit; De Kepper, Patrick

    2015-01-01

    The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences

  9. Contribution to an effective design method for stationary reaction-diffusion patterns

    Energy Technology Data Exchange (ETDEWEB)

    Szalai, István; Horváth, Judit [Laboratory of Nonlinear Chemical Dynamics, Institute of Chemistry, Eötvös Loránd University, P.O. Box 32, H-1518 Budapest 112 (Hungary); De Kepper, Patrick [Centre de Recherche Paul Pascal, CNRS, University of Bordeaux, 115, Avenue Schweitzer, F-33600 Pessac (France)

    2015-06-15

    The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences.

  10. Modelling of structural effects on chemical reactions in turbulent flows

    Energy Technology Data Exchange (ETDEWEB)

    Gammelsaeter, H.R.

    1997-12-31

    Turbulence-chemistry interactions are analysed using algebraic moment closure for the chemical reaction term. The coupling between turbulence and chemical length and time scales generate a complex interaction process. This interaction process is called structural effects in this work. The structural effects are shown to take place on all scales between the largest scale of turbulence and the scales of the molecular motions. The set of equations describing turbulent correlations involved in turbulent reacting flows are derived. Interactions are shown schematically using interaction charts. Algebraic equations for the turbulent correlations in the reaction rate are given using the interaction charts to include the most significant couplings. In the frame of fundamental combustion physics, the structural effects appearing on the small scales of turbulence are proposed modelled using a discrete spectrum of turbulent scales. The well-known problem of averaging the Arrhenius law, the specific reaction rate, is proposed solved using a presumed single variable probability density function and a sub scale model for the reaction volume. Although some uncertainties are expected, the principles are addressed. Fast chemistry modelling is shown to be consistent in the frame of algebraic moment closure when the turbulence-chemistry interaction is accounted for in the turbulent diffusion. The modelling proposed in this thesis is compared with experimental data for an laboratory methane flame and advanced probability density function modelling. The results show promising features. Finally it is shown a comparison with full scale measurements for an industrial burner. All features of the burner are captured with the model. 41 refs., 33 figs.

  11. Implementation of the chemical PbLi/water reaction in the SIMMER code

    Energy Technology Data Exchange (ETDEWEB)

    Eboli, Marica, E-mail: marica.eboli@for.unipi.it [DICI—University of Pisa, Largo Lucio Lazzarino 2, 56122 Pisa (Italy); Forgione, Nicola [DICI—University of Pisa, Largo Lucio Lazzarino 2, 56122 Pisa (Italy); Del Nevo, Alessandro [ENEA FSN-ING-PAN, CR Brasimone, 40032 Camugnano, BO (Italy)

    2016-11-01

    Highlights: • Updated predictive capabilities of SIMMER-III code. • Verification of the implemented PbLi/Water chemical reactions. • Identification of code capabilities in modelling phenomena relevant to safety. • Validation against BLAST Test No. 5 experimental data successfully completed. • Need for new experimental campaign in support of code validation on LIFUS5/Mod3. - Abstract: The availability of a qualified system code for the deterministic safety analysis of the in-box LOCA postulated accident is of primary importance. Considering the renewed interest for the WCLL breeding blanket, such code shall be multi-phase, shall manage the thermodynamic interaction among the fluids, and shall include the exothermic chemical reaction between lithium-lead and water, generating oxides and hydrogen. The paper presents the implementation of the chemical correlations in SIMMER-III code, the verification of the code model in simple geometries and the first validation activity based on BLAST Test N°5 experimental data.

  12. Chemical Synthesis of Proanthocyanidins in Vitro and Their Reactions in Aging Wines

    Directory of Open Access Journals (Sweden)

    Qiu-Hong Pan

    2008-12-01

    Full Text Available Proanthocyanidins are present in many fruits and plant products like grapes and wine, and contribute to their taste and health benefits. In the past decades of years, substantial progresses has been achieved in the identification of composition and structure of proanthocyanidins, but the debate concerning the existence of an enzymatic or nonenzymatic mechanism for proanthocyanidin condensation still goes on. Substantial attention has been paid to elucidating the potential mechanism of formation by means of biomimetic and chemical synthesis in vitro. The present paper aims at summarizing the research status on chemical synthesis of proanthocyanidins, including non-enzymatic synthesis of proanthocyanidin precursors, chemical synthesis of proanthocyanidins with direct condensation of flavanols and stereoselective synthesis of proanthocyanidins. Proanthocyanidin-involved reactions in aging wines are also reviewed such as direct and indirect reactions among proanthocyanidins, flavanols and anthocyanins. Topics for future research in this field are also put forward in this paper.

  13. Chemical methods and techniques to monitor early Maillard reaction in milk products; A review.

    Science.gov (United States)

    Aalaei, Kataneh; Rayner, Marilyn; Sjöholm, Ingegerd

    2018-01-23

    Maillard reaction is an extensively studied, yet unresolved chemical reaction that occurs as a result of application of the heat and during the storage of foods. The formation of advanced glycation end products (AGEs) has been the focus of several investigations recently. These molecules which are formed at the advanced stage of the Maillard reaction, are suspected to be involved in autoimmune diseases in humans. Therefore, understanding to which extent this reaction occurs in foods, is of vital significance. Because of their composition, milk products are ideal media for this reaction, especially when application of heat and prolonged storage are considered. Thus, in this work several chemical approaches to monitor this reaction in an early stage are reviewed. This is mostly done regarding available lysine blockage which takes place in the very beginning of the reaction. The most popular methods and their applications to various products are reviewed. The methods including their modifications are described in detail and their findings are discussed. The present paper provides an insight into the history of the most frequently-used methods and provides an overview on the indicators of the Maillard reaction in the early stage with its focus on milk products and especially milk powders.

  14. The chemical foundations of nitroalkene fatty acid signaling through addition reactions with thiols.

    Science.gov (United States)

    Turell, Lucía; Steglich, Martina; Alvarez, Beatriz

    2018-03-22

    Nitroalkene fatty acids can be formed in vivo and administered exogenously. They exert pleiotropic signaling actions with cytoprotective and antiinflammatory effects. The presence of the potent electron withdrawing nitro group confers electrophilicity to the adjacent β-carbon. Thiols (precisely, thiolates) are strong nucleophiles and can react with nitroalkene fatty acids through reversible Michael addition reactions. In addition, nitroalkene fatty acids can undergo several other processes including metabolic oxidation, reduction, esterification, nitric oxide release and partition into hydrophobic compartments. The signaling actions of nitroalkenes are mainly mediated by reactions with critical thiols in regulatory proteins. Thus, the thio-Michael addition reaction provides a framework for understanding the molecular basis of the biological effects of nitroalkene fatty acids at the crossroads of thiol signaling and electrophilic lipid signaling. In this review, we describe the reactions of nitroalkene fatty acids in biological contexts. We focus on the Michael addition-elimination reaction with thiols and its mechanism, and extrapolate kinetic and thermodynamic considerations to in vivo settings. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. An efficient forward–reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Bayer, Christian

    2016-02-20

    © 2016 Taylor & Francis Group, LLC. ABSTRACT: In this work, we present an extension of the forward–reverse representation introduced by Bayer and Schoenmakers (Annals of Applied Probability, 24(5):1994–2032, 2014) to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, that is, SRNs conditional on their values in the extremes of given time intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the expectation-maximization algorithm to the phase I output. By selecting a set of overdispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.

  16. CHEMSIMUL - A program package for numerical simulation of chemical reaction systems

    International Nuclear Information System (INIS)

    Lang Rasmussen, O.; Bjergbakke, E.

    1984-01-01

    A description is given of a program package, CHEMSIMUL, for numerical simulation of chemical reaction systems. The main components in the package are a translator of chemical equations to differential equations, a balance equation program, a differential equation solver, EPISODE, and an input/output program. The performance of the program is demonstrated by four examples. A manual for the input file and the complete program text with comments are given in Appendices I and II. (author)

  17. Cascade enzymatic reactions for efficient carbon sequestration.

    Science.gov (United States)

    Xia, Shunxiang; Zhao, Xueyan; Frigo-Vaz, Benjamin; Zheng, Wenyun; Kim, Jungbae; Wang, Ping

    2015-04-01

    Thermochemical processes developed for carbon capture and storage (CCS) offer high carbon capture capacities, but are generally hampered by low energy efficiency. Reversible cascade enzyme reactions are examined in this work for energy-efficient carbon sequestration. By integrating the reactions of two key enzymes of RTCA cycle, isocitrate dehydrogenase and aconitase, we demonstrate that intensified carbon capture can be realized through such cascade enzymatic reactions. Experiments show that enhanced thermodynamic driving force for carbon conversion can be attained via pH control under ambient conditions, and that the cascade reactions have the potential to capture 0.5 mol carbon at pH 6 for each mole of substrate applied. Overall it manifests that the carbon capture capacity of biocatalytic reactions, in addition to be energy efficient, can also be ultimately intensified to approach those realized with chemical absorbents such as MEA. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Relation between the 16O(α,γ)20Ne capture reaction and its reverse 20Ne(γ,α)16O photodisintegration reaction in stars and in the lab

    International Nuclear Information System (INIS)

    Mohr, P.; Angulo, C.; Descouvemont, P.

    2005-01-01

    The astrophysical reaction rates of the 16 O(α,γ) 20 Ne capture reaction and its reverse 20 Ne(γ,α) 16 O photodisintegration reaction are dominated by a few narrow resonances. Only at very low temperatures direct capture plays a significant role. Usually the reaction rate of photodisintegration reactions is calculated from the reaction rate of the corresponding capture reaction using the detailed balanced theorem. This is only valid for nuclei which are thermalized. The reaction rates of the 16 O(α,γ) 20 Ne capture reaction in the lab and under stellar conditions are identical. However, for the inverse 20 Ne(γ,α) 16 O photodisintegration reaction one finds a significant contribution of the thermally populated first excited state at E x = 1634 keV in 20 Ne. Consequently, the reaction rates of the 20 Ne(γ,α) 16 O photodisintegration reaction are different in the lab and under stellar conditions. It is shown that the detailed balance theorem remains valid for the reaction rates under stellar conditions. Photodisintegration rates in the lab have been measured recently using a quasi-thermal photon spectrum from bremsstrahlung, and a quasi-thermal photon spectrum with superior quality has been suggested using high-energy synchrotron radiation. (author)

  19. Nanostructured palladium tailored via carbonyl chemical route towards oxygen reduction reaction

    International Nuclear Information System (INIS)

    Luo, Y.; Mora-Hernández, J.M.; Estudillo-Wong, L.A.; Arce-Estrada, E.M.; Alonso-Vante, N.

    2015-01-01

    Graphical Abstract: Mass-depending morphologies of nanostructured Palladium obtained via the carbonyl chemical route. Display Omitted -- Highlights: •Mass-depending morphology was observed in nanostructured palladium supported on carbon prepared by the carbonyl chemical route. •The Morphological effect of carbon supported Pd was investigated towards ORR. -- Abstract: Carbon supported palladium nanostructures were synthesized via the carbonyl chemical route. Compared with nanostructured platinum, prepared via carbonyl chemical route, Pd nanomaterials showed mass-loading morphology, whereas particle size and morphology of Pt nanostructures was constant. The oxygen reduction reaction (ORR) on nanostructured Pd, with different morphology in both acid and alkaline medium was investigated. A relationship, based on X-ray diffraction structural analysis pattern, transmission electron microscope, with the Pd morphological effect on ORR activity was identified

  20. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  1. Uptake of gaseous formaldehyde by soil surfaces: a combination of adsorption/desorption equilibrium and chemical reactions

    Directory of Open Access Journals (Sweden)

    G. Li

    2016-08-01

    Full Text Available Gaseous formaldehyde (HCHO is an important precursor of OH radicals and a key intermediate molecule in the oxidation of atmospheric volatile organic compounds (VOCs. Budget analyses reveal large discrepancies between modeled and observed HCHO concentrations in the atmosphere. Here, we investigate the interactions of gaseous HCHO with soil surfaces through coated-wall flow tube experiments applying atmospherically relevant HCHO concentrations of  ∼  10 to 40 ppbv. For the determination of uptake coefficients (γ, we provide a Matlab code to account for the diffusion correction under laminar flow conditions. Under dry conditions (relative humidity  =  0 %, an initial γ of (1.1 ± 0.05  ×  10−4 is determined, which gradually drops to (5.5 ± 0.4  ×  10−5 after 8 h experiments. Experiments under wet conditions show a smaller γ that drops faster over time until reaching a plateau. The drop of γ with increasing relative humidity as well as the drop over time can be explained by the adsorption theory in which high surface coverage leads to a reduced uptake rate. The fact that γ stabilizes at a non-zero plateau suggests the involvement of irreversible chemical reactions. Further back-flushing experiments show that two-thirds of the adsorbed HCHO can be re-emitted into the gas phase while the residual is retained by the soil. This partial reversibility confirms that HCHO uptake by soil is a complex process involving both adsorption/desorption and chemical reactions which must be considered in trace gas exchange (emission or deposition at the atmosphere–soil interface. Our results suggest that soil and soil-derived airborne particles can either act as a source or a sink for HCHO, depending on ambient conditions and HCHO concentrations.

  2. Uptake of gaseous formaldehyde by soil surfaces: a combination of adsorption/desorption equilibrium and chemical reactions

    Science.gov (United States)

    Li, Guo; Su, Hang; Li, Xin; Kuhn, Uwe; Meusel, Hannah; Hoffmann, Thorsten; Ammann, Markus; Pöschl, Ulrich; Shao, Min; Cheng, Yafang

    2016-08-01

    Gaseous formaldehyde (HCHO) is an important precursor of OH radicals and a key intermediate molecule in the oxidation of atmospheric volatile organic compounds (VOCs). Budget analyses reveal large discrepancies between modeled and observed HCHO concentrations in the atmosphere. Here, we investigate the interactions of gaseous HCHO with soil surfaces through coated-wall flow tube experiments applying atmospherically relevant HCHO concentrations of ˜ 10 to 40 ppbv. For the determination of uptake coefficients (γ), we provide a Matlab code to account for the diffusion correction under laminar flow conditions. Under dry conditions (relative humidity = 0 %), an initial γ of (1.1 ± 0.05) × 10-4 is determined, which gradually drops to (5.5 ± 0.4) × 10-5 after 8 h experiments. Experiments under wet conditions show a smaller γ that drops faster over time until reaching a plateau. The drop of γ with increasing relative humidity as well as the drop over time can be explained by the adsorption theory in which high surface coverage leads to a reduced uptake rate. The fact that γ stabilizes at a non-zero plateau suggests the involvement of irreversible chemical reactions. Further back-flushing experiments show that two-thirds of the adsorbed HCHO can be re-emitted into the gas phase while the residual is retained by the soil. This partial reversibility confirms that HCHO uptake by soil is a complex process involving both adsorption/desorption and chemical reactions which must be considered in trace gas exchange (emission or deposition) at the atmosphere-soil interface. Our results suggest that soil and soil-derived airborne particles can either act as a source or a sink for HCHO, depending on ambient conditions and HCHO concentrations.

  3. Reaction of mutualistic and granivorous ants to ulex elaiosome chemicals.

    Science.gov (United States)

    Gammans, Nicola; Bullock, James M; Gibbons, Hannah; Schönrogge, Karsten

    2006-09-01

    It has been proposed that chemicals on plant elaiosomes aid seed detection by seed-dispersing ants. We hypothesized that the chemical interaction between ants and elaiosomes is more intimate than a generic attraction, and that elaiosome chemicals will attract mutualistic but not granivorous ant species. We investigated this by using two gorse species, Ulex minor and U. europaeus, and two associated ant species from European heathlands, the mutualist Myrmica ruginodis and the granivore Tetramorium caespitum. Behavioral studies were conducted with laboratory nests and foraging arenas. Both ants will take Ulex seeds, but while M. ruginodis showed increased antennation toward ether extracts of elaiosome surface chemicals compared with controls, T. caespitum showed no response. Elaiosome extracts were separated into seven lipid fractions. M. ruginodis showed increased antennation only toward the diglyceride fractions of both Ulex species, whereas T. caespitum showed no consistent reaction. This indicates that M. ruginodis can detect the elaiosome by responding to its surface chemicals, but T. caespitum is unresponsive to these chemicals. Responses to surface chemicals could increase the rate of seed detection in the field, and so these results suggest that Ulex elaiosomes produce chemicals that facilitate attraction of mutualistic rather than granivorous ant species. This could reduce seed predation and increase Ulex fitness.

  4. Thermodynamics in finite time: A chemically driven engine

    International Nuclear Information System (INIS)

    Ondrechen, M.J.; Berry, R.S.; Andresen, B.

    1980-01-01

    The methods of finite time thermodynamics are applied to processes whose relaxation parameters are chemical rate coefficients within the working fluid. The direct optimization formalism used previously for heat engines with friction and finite heat transfer rates: termed the tricycle method: is extended to heat engines driven by exothermic reactions. The model is a flow reactor coupled by a heat exchanger to an engine. Conditions are established for the achievement of maximum power from such a system. Emphasis is on how the chemical kinetics control the finite-time thermodynamic extrema; first order, first order reversible, and second order reaction kinetics are analyzed. For the types of reactions considered here, there is always a finite positive flow rate in the reactor that yields maximum engine power. Maximum fuel efficiency is always attained in these systems at the uninteresting limit of zero flow rate

  5. Development of a quantum chemical molecular dynamics tribochemical simulator and its application to tribochemical reaction dynamics of lubricant additives

    International Nuclear Information System (INIS)

    Onodera, T; Tsuboi, H; Hatakeyama, N; Endou, A; Miyamoto, A; Miura, R; Takaba, H; Suzuki, A; Kubo, M

    2010-01-01

    Tribology at the atomistic and molecular levels has been theoretically studied by a classical molecular dynamics (MD) method. However, this method inherently cannot simulate the tribochemical reaction dynamics because it does not consider the electrons in nature. Although the first-principles based MD method has recently been used for understanding the chemical reaction dynamics of several molecules in the tribology field, the method cannot simulate the tribochemical reaction dynamics of a large complex system including solid surfaces and interfaces due to its huge computation costs. On the other hand, we have developed a quantum chemical MD tribochemical simulator on the basis of a hybrid tight-binding quantum chemical/classical MD method. In the simulator, the central part of the chemical reaction dynamics is calculated by the tight-binding quantum chemical MD method, and the remaining part is calculated by the classical MD method. Therefore, the developed tribochemical simulator realizes the study on tribochemical reaction dynamics of a large complex system, which cannot be treated by using the conventional classical MD or the first-principles MD methods. In this paper, we review our developed quantum chemical MD tribochemical simulator and its application to the tribochemical reaction dynamics of a few lubricant additives

  6. On the Mathematical Structure of Balanced Chemical Reaction Networks Governed by Mass Action Kinetics

    NARCIS (Netherlands)

    Schaft, Arjan van der; Rao, Shodhan; Jayawardhana, Bayu

    2013-01-01

    Motivated by recent progress on the interplay between graph theory, dynamics, and systems theory, we revisit the analysis of chemical reaction networks described by mass action kinetics. For reaction networks possessing a thermodynamic equilibrium we derive a compact formulation exhibiting at the

  7. Quantum theory of exchange reactions: Use of nonorthogonal bases and coordinates

    International Nuclear Information System (INIS)

    Stechel, E.B.; Schmalz, T.G.; Light, J.C.

    1979-01-01

    A general approach to quantum scattering theory of exchange reactions utilizing nonorthogonal (''over-complete'') basis sets and nonorthogonal coordinates is presented. The method is shown to resolve many of the formal and practical difficulties attending earlier theories. Although the inspiration came from the early and accurate work on the collinear H+H 2 reaction by Diestler possible applications include electron transfer processes as well as chemical exchange reactions. The mathematics is formulated in detail and the solution is presented in terms of the R-matrix propagation method preserving all the symmetries of the physical process, i.e., conservation of flux and microscopic reversibility

  8. The effect of flow and chemical corrosion in reverse osmosis over desalinated water

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Jae [Chunnam National Univ., Gwangju (Korea, Republic of); Pak, Byung Gu [Doosan Heavy Industry Co., Tongyoung (Korea, Republic of)

    2015-12-15

    Desalinated water produced by a reverse osmosis (RO) filtering method forms about 22% of total production of desalinated water in the world. However, the RO environment is very corrosive due to the presence of various chemicals for water treatment and the flow of sand particles leading to corrosion. Recently, there has been much effort to substitute cheaper and more corrosion resistant stainless steels for copper based alloys as a valve material in RO. Nevertheless, the effects of chemicals and particles on the corrosion of stainless steels have rarely been studied. Erosion phenomenon was detected under the condition with the flow rate of more than 8ms{sup -1} in spite of the absence of sand particles. In seawater containing sand particles, the erosion in stainless steels was accelerated further.

  9. Enhanced reversibility and durability of a solid oxide Fe-air redox battery by carbothermic reaction derived energy storage materials.

    Science.gov (United States)

    Zhao, Xuan; Li, Xue; Gong, Yunhui; Huang, Kevin

    2014-01-18

    The recently developed solid oxide metal-air redox battery is a new technology capable of high-rate chemistry. Here we report that the performance, reversibility and stability of a solid oxide iron-air redox battery can be significantly improved by nanostructuring energy storage materials from a carbothermic reaction.

  10. Students' Ideas about How and Why Chemical Reactions Happen: Mapping the Conceptual Landscape

    Science.gov (United States)

    Yan, Fan; Talanquer, Vicente

    2015-01-01

    Research in science education has revealed that many students struggle to understand chemical reactions. Improving teaching and learning about chemical processes demands that we develop a clearer understanding of student reasoning in this area and of how this reasoning evolves with training in the domain. Thus, we have carried out a qualitative…

  11. Nuclear reaction studies using inverse kinematics

    International Nuclear Information System (INIS)

    Shapira, D.

    1985-01-01

    Reaction studies with reversed kinematics refer to studies of nuclear reactions induced by a heavy projectile colliding with lighter target nuclei. The technique of using reversed kinematics is costly in terms of the available center-of-mass energy. Most of the projectile's energy goes into forward motion of the reaction products in the laboratory system. Examples are presented where the use of reversed kinematics techniques has provided new information on certain reaction processes. A list of kinematic properties and advantages they may afford is shown. Clearly the possible studies listed can be done without using reversed kinematics but because of the difficulty associated with some of these studies they were never performed until more energetic heavier beams have become available and the reversed kinematics technique was utilized

  12. Environmental high resolution electron microscopy and applications to chemical science

    OpenAIRE

    Boyes, Edward; Gai, Pratibha

    2017-01-01

    An environmental cell high resolution electron microscope (EHREM) has been developed for in situ studies of dynamic chemical reactions on the atomic scale. It allows access to metastable intermediate phases of catalysts and to sequences of reversible microstructural and chemical development associated with the activation, deactivation and poisoning of a catalyst. Materials transported through air can be restored or recreated and samples damaged, e.g. by dehydration, by the usual vacuum enviro...

  13. Computed Potential Energy Surfaces and Minimum Energy Pathway for Chemical Reactions

    Science.gov (United States)

    Walch, Stephen P.; Langhoff, S. R. (Technical Monitor)

    1994-01-01

    Computed potential energy surfaces are often required for computation of such observables as rate constants as a function of temperature, product branching ratios, and other detailed properties. We have found that computation of the stationary points/reaction pathways using CASSCF/derivative methods, followed by use of the internally contracted CI method with the Dunning correlation consistent basis sets to obtain accurate energetics, gives useful results for a number of chemically important systems. Applications to complex reactions leading to NO and soot formation in hydrocarbon combustion are discussed.

  14. Exploring chemical reaction mechanisms through harmonic Fourier beads path optimization.

    Science.gov (United States)

    Khavrutskii, Ilja V; Smith, Jason B; Wallqvist, Anders

    2013-10-28

    Here, we apply the harmonic Fourier beads (HFB) path optimization method to study chemical reactions involving covalent bond breaking and forming on quantum mechanical (QM) and hybrid QM∕molecular mechanical (QM∕MM) potential energy surfaces. To improve efficiency of the path optimization on such computationally demanding potentials, we combined HFB with conjugate gradient (CG) optimization. The combined CG-HFB method was used to study two biologically relevant reactions, namely, L- to D-alanine amino acid inversion and alcohol acylation by amides. The optimized paths revealed several unexpected reaction steps in the gas phase. For example, on the B3LYP∕6-31G(d,p) potential, we found that alanine inversion proceeded via previously unknown intermediates, 2-iminopropane-1,1-diol and 3-amino-3-methyloxiran-2-ol. The CG-HFB method accurately located transition states, aiding in the interpretation of complex reaction mechanisms. Thus, on the B3LYP∕6-31G(d,p) potential, the gas phase activation barriers for the inversion and acylation reactions were 50.5 and 39.9 kcal∕mol, respectively. These barriers determine the spontaneous loss of amino acid chirality and cleavage of peptide bonds in proteins. We conclude that the combined CG-HFB method further advances QM and QM∕MM studies of reaction mechanisms.

  15. Laser-enhanced chemical reactions and the liquid state. II. Possible applications to nuclear fuel reprocessing

    International Nuclear Information System (INIS)

    DePoorter, G.L.; Rofer-DePoorter, C.K.

    1976-01-01

    Laser photochemistry is surveyed as a possible improvement upon the Purex process for reprocessing spent nuclear fuel. Most of the components of spent nuclear fuel are photochemically active, and lasers can be used to selectively excite individual chemical species. The great variety of chemical species present and the degree of separation that must be achieved present difficulties in reprocessing. Lasers may be able to improve the necessary separations by photochemical reaction or effects on rates and equilibria of reactions

  16. The Oxford-Diamond In Situ Cell for studying chemical reactions using time-resolved X-ray diffraction

    Science.gov (United States)

    Moorhouse, Saul J.; Vranješ, Nenad; Jupe, Andrew; Drakopoulos, Michael; O'Hare, Dermot

    2012-08-01

    A versatile, infrared-heated, chemical reaction cell has been assembled and commissioned for the in situ study of a range of chemical syntheses using time-resolved energy-dispersive X-ray diffraction (EDXRD) on Beamline I12 at the Diamond Light Source. Specialized reactor configurations have been constructed to enable in situ EDXRD investigation of samples under non-ambient conditions. Chemical reactions can be studied using a range of sample vessels such as alumina crucibles, steel hydrothermal autoclaves, and glassy carbon tubes, at temperatures up to 1200 °C.

  17. Radiation-induced chemical reactions of carbon monoxide and hydrogen mixture

    International Nuclear Information System (INIS)

    Sugimoto, S.; Nishii, M.; Sugiura, T.

    1984-01-01

    The radiation chemical reaction of CO-H 2 mixture has been studied in the pressure range from 10 4 to 1.3 x 10 5 Pa using 7 l. reaction vessel made of stainless steel. Various hydrocarbons and oxygen containing compounds such as methane, formaldehyde, acetaldehyde, and methanol have been obtained as radiolytic products. The amounts and the G values of these products depended upon the irradiation conditions such as composition of reactant, total pressure, reaction temperature, and dose. It was found that the irradiation at low dose produced small amounts of trioxane and tetraoxane, which have not yet been reported in literature. The yields of these cyclic ethers increased at high pressure and at low temperature. An experiment was also made on CO-H 2 mixture containing ammonia as a cation scavenger to investigate the precursor of these products. (author)

  18. Chemical Reaction Engineering Applications in Non-traditional Technologies. A Textbook Supplement.

    Science.gov (United States)

    Savage, Phillip E.; Blaine, Steven

    1991-01-01

    A set of educational materials that have been developed which deal with chemical engineering applications in emerging technologies is described. The organization and the content of the supplemental textbook materials and how they can be integrated into an undergraduate reaction engineering course are discussed. (KR)

  19. Chemical equilibrium and reaction modeling of arsenic and selenium in soils

    Science.gov (United States)

    The chemical processes and soil factors that affect the concentrations of As and Se in soil solution were discussed. Both elements occur in two redox states differing in toxicity and reactivity. Methylation and volatilization reactions occur in soils and can act as detoxification pathways. Precip...

  20. Holistic Metrics for Assessment of the Greenness of Chemical Reactions in the Context of Chemical Education

    Science.gov (United States)

    Ribeiro, M. Gabriela T. C.; Machado, Adelio A. S. C.

    2013-01-01

    Two new semiquantitative green chemistry metrics, the green circle and the green matrix, have been developed for quick assessment of the greenness of a chemical reaction or process, even without performing the experiment from a protocol if enough detail is provided in it. The evaluation is based on the 12 principles of green chemistry. The…

  1. Magnetic isotope effect and theory of atomic orbital hybridization to predict a mechanism of chemical exchange reactions.

    Science.gov (United States)

    Epov, Vladimir N

    2011-08-07

    A novel approach is suggested to investigate the mechanisms of chemical complexation reactions based on the results of Fujii with co-workers; they have experimentally observed that several metals and metalloids demonstrate mass-independent isotope fractionation during the reactions with the DC18C6 crown ether using solvent-solvent extraction. In this manuscript, the isotope fractionation caused by the magnetic isotope effect is used to understand the mechanisms of chemical exchange reactions. Due to the rule that reactions are allowed for certain electron spin states, and forbidden for others, magnetic isotopes show chemical anomalies during these reactions. Mass-independent fractionation is suggested to take place due to the hyperfine interaction of the nuclear spin with the electron spin of the intermediate product. Moreover, the sign of the mass-independent fractionation is found to be dependent on the element and its species, which is also explained by the magnetic isotope effect. For example, highly negative mass-independent isotope fractionation of magnetic isotopes was observed for reactions of DC18C6 with SnCl(2) species and with several Ru(III) chloro-species, and highly positive for reactions of this ether with TeCl(6)(2-), and with several Cd(II) and Pd(II) species. The atomic radius of an element is also a critical parameter for the reaction with crown ether, particularly the element ions with [Kr]4d(n)5s(m) electron shell fits the best with the DC18C6 crown ring. It is demonstrated that the magnetic isotope effect in combination with the theory of orbital hybridization can help to understand the mechanism of complexation reactions. The suggested approach is also applied to explain previously published mass-independent fractionation of Hg isotopes in other types of chemical exchange reactions. This journal is © the Owner Societies 2011

  2. A Study of Interactions between Mixing and Chemical Reaction Using the Rate-Controlled Constrained-Equilibrium Method

    Science.gov (United States)

    Hadi, Fatemeh; Janbozorgi, Mohammad; Sheikhi, M. Reza H.; Metghalchi, Hameed

    2016-10-01

    The rate-controlled constrained-equilibrium (RCCE) method is employed to study the interactions between mixing and chemical reaction. Considering that mixing can influence the RCCE state, the key objective is to assess the accuracy and numerical performance of the method in simulations involving both reaction and mixing. The RCCE formulation includes rate equations for constraint potentials, density and temperature, which allows taking account of mixing alongside chemical reaction without splitting. The RCCE is a dimension reduction method for chemical kinetics based on thermodynamics laws. It describes the time evolution of reacting systems using a series of constrained-equilibrium states determined by RCCE constraints. The full chemical composition at each state is obtained by maximizing the entropy subject to the instantaneous values of the constraints. The RCCE is applied to a spatially homogeneous constant pressure partially stirred reactor (PaSR) involving methane combustion in oxygen. Simulations are carried out over a wide range of initial temperatures and equivalence ratios. The chemical kinetics, comprised of 29 species and 133 reaction steps, is represented by 12 RCCE constraints. The RCCE predictions are compared with those obtained by direct integration of the same kinetics, termed detailed kinetics model (DKM). The RCCE shows accurate prediction of combustion in PaSR with different mixing intensities. The method also demonstrates reduced numerical stiffness and overall computational cost compared to DKM.

  3. Time-resolved imaging of purely valence-electron dynamics during a chemical reaction

    DEFF Research Database (Denmark)

    Hockett, Paul; Bisgaard, Christer Z.; Clarkin, Owen J.

    2011-01-01

    Chemical reactions are manifestations of the dynamics of molecular valence electrons and their couplings to atomic motions. Emerging methods in attosecond science can probe purely electronic dynamics in atomic and molecular systems(1-6). By contrast, time-resolved structural-dynamics methods...... such as electron(7-10) or X-ray diffraction(11) and X-ray absorption(12) yield complementary information about the atomic motions. Time-resolved methods that are directly sensitive to both valence-electron dynamics and atomic motions include photoelectron spectroscopy(13-15) and high-harmonic generation(16......,17): in both cases, this sensitivity derives from the ionization-matrix element(18,19). Here we demonstrate a time-resolved molecular-frame photoelectron-angular-distribution (TRMFPAD) method for imaging the purely valence-electron dynamics during a chemical reaction. Specifically, the TRMFPADs measured during...

  4. Automated Discovery of New Chemical Reactions and Accurate Calculation of Their Rates

    Science.gov (United States)

    2015-06-02

    chemistry calculations are run. The product matrices P are obtained and converted to block structure by simple linear algebra operations...in the system, i.e. 0 , =∑ ji ija Usually in elementary reactions |aij|ɛ since the change by two implies a significant chemical process, for...instance, formation or rupture of a double bond in a single elementary step. After applying the reaction matrix A, the product matrix P can then be

  5. Isotope effects in gas-phase chemical reactions and photodissociation processes: Overview

    International Nuclear Information System (INIS)

    Kaye, J.A.

    1992-01-01

    The origins of isotope effects in equilibrium and non-equilibrium chemical processes are reviewed. In non-equilibrium processes, attention is given to isotope effects in simple bimolecular reactions, symmetry-related reactions, and photodissociation processes. Recent examples of isotope effects in these areas are reviewed. Some indication of other scientific areas for which measurements and/or calculations of isotope effects are used is also given. Examples presented focus on neutral molecule chemistry and in many cases complement examples considered in greater detail in the other chapters of this volume

  6. Reactive chemically modified piezoelectric crystal detectors: A new class of high-selectivity sensors

    International Nuclear Information System (INIS)

    Fadeev, A.Yu.; Filatov, A.L.; Lisichkin, G.V.

    1994-01-01

    A great number of works have focused on the study of properties of modified piezoelectric quartz crystal detectors (PQCDs) coated with sorbing substrates and on applying sensors based on them for the analysis of diluted gas mixtures and solutions. This work offers a new class of gravemetric sensors characterized by a reversible chemical reaction that occurs on their surface. Silica films are proposed as a sorbing coating of quartz detectors, and a chemical modification of a surface is suggested for covalent fixation of the necessary compounds. PQCDs were chemically modified with reactive diene derivatives that can also act as dienophiles. Hexachlorocyclopentadiene (HCCPD, resonater I) and cyclopentadiene (CPD, resonator II) were fixed on a PQCD surface in several stages. After treatment with the resonaters, the PQCD in a CPD gas phase exhibited time dependent frequency shifts from 20-100 Hz. The results suggest that there is a reversible chemical reaction on the electrode surface of resonators I and II when they interact with CPD vapors. Therefore, PQCDs modified with reactive dienes were prepared for the first time and may be employed as selective sensors for CPD

  7. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  8. Chemical reactions induced and probed by positive muons

    International Nuclear Information System (INIS)

    Ito, Yasuo

    1990-01-01

    The application of μ + science, collectively called μSR, but encompassing a variety of methods including muon spin rotation, muon spin relaxation, muon spin repolarization, muon spin resonance and level-crossing resonance, to chemistry is introduced emphasizing the special aspects of processes which are 'induced and probed' by the μ + itself. After giving a general introduction to the nature and methods of muon science and a short history of muon chemistry, selected topics are given. One concerns the usefulness of muonium as hydrogen-like probes of chemical reactions taking polymerization of vinyl monomers and reaction with thiosulphate as examples. Probing solitons in polyacetylene induced and probed by μ + is also an important example which shows the unique nature of muonium. Another important topic is 'lost polarization'. Although this term is particular to muonium. Another important topic is 'lost polarization'. Although this term is particular to muon chemistry, the chemistry underlining the phenomenon of lost polarization has an importance to both radiation and hot atom chemistries. (orig.)

  9. The mineralogic evolution of the Martian surface through time: Implications from chemical reaction path modeling studies

    Science.gov (United States)

    Plumlee, G. S.; Ridley, W. I.; Debraal, J. D.; Reed, M. H.

    1993-01-01

    Chemical reaction path calculations were used to model the minerals that might have formed at or near the Martian surface as a result of volcano or meteorite impact driven hydrothermal systems; weathering at the Martian surface during an early warm, wet climate; and near-zero or sub-zero C brine-regolith reactions in the current cold climate. Although the chemical reaction path calculations carried out do not define the exact mineralogical evolution of the Martian surface over time, they do place valuable geochemical constraints on the types of minerals that formed from an aqueous phase under various surficial and geochemically complex conditions.

  10. Effects of Confinement on Chemical Reaction Equilibrium in Nanoporous Materials

    Czech Academy of Sciences Publication Activity Database

    Smith, W.R.; Lísal, Martin; Brennan, J.K.

    2006-01-01

    Roč. 3984, - (2006), s. 743-751 ISSN 0302-9743 R&D Projects: GA ČR(CZ) GA203/05/0725; GA AV ČR 1ET400720507 Grant - others:NRCC(CA) OGP 1041 Institutional research plan: CEZ:AV0Z40720504 Keywords : nanoporous materials * chemical reaction equilibrium Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 0.402, year: 2005

  11. Effect of Chemical Reactions on the Hydrologic Properties of Fractured and Rubbelized Glass Media

    International Nuclear Information System (INIS)

    Saripalli, Prasad; Meyer, P D.; Parker, Kent E.; Lindberg, Michael J.

    2005-01-01

    Understanding the effect of chemical reactions on the hydrologic properties of geological media, such as porosity, permeability and dispersivity, is critical to many natural and engineered sub-surface systems. Influence of glass corrosion (precipitation and dissolution) reactions on fractured and rubbelized (crushed) forms HAN28 and LAWBP1, two candidate waste glass forms for a proposed immobilized low-activity waste (ILAW) disposal facility at the Hanford, WA site, was investigated. Flow and tracer transport experiments were conducted using fractured and rubbelized forms, before and after subjecting them to corrosion using Vapor Hydration Testing (VHT) at 200 C temperature and 200 psig pressure, causing the precipitation of alteration products. Data were analyzed using analytical expressions and CXTFIT, a transport parameter optimization code, for the estimation of the hydrologic characteristics before and after VHT. It was found that glass reactions significantly influence the hydrologic properties of ILAW glass media. Hydrologic properties of rubbelized glass decreased due to precipitation reactions, whereas those of fractured glass media increased due to reaction which led to unconfined expansion of fracture aperture. The results are unique and useful to better understand the effect of chemical reactions on the hydrologic properties of fractured and rubbelized stony media in general and glass media in particular

  12. In silico prediction of potential chemical reactions mediated by human enzymes.

    Science.gov (United States)

    Yu, Myeong-Sang; Lee, Hyang-Mi; Park, Aaron; Park, Chungoo; Ceong, Hyithaek; Rhee, Ki-Hyeong; Na, Dokyun

    2018-06-13

    Administered drugs are often converted into an ineffective or activated form by enzymes in our body. Conventional in silico prediction approaches focused on therapeutically important enzymes such as CYP450. However, there are more than thousands of different cellular enzymes that potentially convert administered drug into other forms. We developed an in silico model to predict which of human enzymes including metabolic enzymes as well as CYP450 family can catalyze a given chemical compound. The prediction is based on the chemical and physical similarity between known enzyme substrates and a query chemical compound. Our in silico model was developed using multiple linear regression and the model showed high performance (AUC = 0.896) despite of the large number of enzymes. When evaluated on a test dataset, it also showed significantly high performance (AUC = 0.746). Interestingly, evaluation with literature data showed that our model can be used to predict not only enzymatic reactions but also drug conversion and enzyme inhibition. Our model was able to predict enzymatic reactions of a query molecule with a high accuracy. This may foster to discover new metabolic routes and to accelerate the computational development of drug candidates by enabling the prediction of the potential conversion of administered drugs into active or inactive forms.

  13. High resolution studies of the effects of magnetic fields on chemical reactions

    OpenAIRE

    Hamilton, C. A.; Hewitt, J. P.; McLauchlan, Keith A.; Steiner, Ulrich

    1988-01-01

    A simple and inexpensive experiment is described which detects magnetic field effects on chemical reactions with high signal-to-noise ratio and high resolution. It consists in applying a small modulation field to the sample, whilst the main field it experiences is varied, with optical detection at the modulation frequency. It consequently measures the derivative of the normal MARY spectrum. It is shown by theoretical analysis that when using this method it is better to monitor reaction interm...

  14. MULTICOMPONENT DETERMINATION OF CHLORINATED HYDROCARBONS USING A REACTION-BASED CHEMICAL SENSOR .2. CHEMICAL SPECIATION USING MULTIVARIATE CURVE RESOLUTION

    NARCIS (Netherlands)

    Tauler, R.; Smilde, A. K.; HENSHAW, J. M.; BURGESS, L. W.; KOWALSKI, B. R.

    1994-01-01

    A new multivariate curve resolution method that can extract analytical information from UV/visible spectroscopic data collected from a reaction-based chemical sensor is proposed. The method is demonstrated with the determination of mixtures of chlorinated hydrocarbons by estimating the kinetic and

  15. Remarkable nanoconfinement effects on chemical equilibrium manifested in nucleotide dimerization and H-D exchange reactions.

    Science.gov (United States)

    Polak, Micha; Rubinovich, Leonid

    2011-10-06

    Nanoconfinement entropic effects on chemical equilibrium involving a small number of molecules, which we term NCECE, are revealed by two widely diverse types of reactions. Employing statistical-mechanical principles, we show how the NCECE effect stabilizes nucleotide dimerization observed within self-assembled molecular cages. Furthermore, the effect provides the basis for dimerization even under an aqueous environment inside the nanocage. Likewise, the NCECE effect is pertinent to a longstanding issue in astrochemistry, namely the extra deuteration commonly observed for molecules reacting on interstellar dust grain surfaces. The origin of the NCECE effect is elucidated by means of the probability distributions of the reaction extent and related variations in the reactant-product mixing entropy. Theoretical modelling beyond our previous preliminary work highlights the role of the nanospace size in addition to that of the nanosystem size, namely the limited amount of molecules in the reaction mixture. Furthermore, the NCECE effect can depend also on the reaction mechanism, and on deviations from stoichiometry. The NCECE effect, leading to enhanced, greatly variable equilibrium "constants", constitutes a unique physical-chemical phenomenon, distinguished from the usual thermodynamical properties of macroscopically large systems. Being significant particularly for weakly exothermic reactions, the effects should stabilize products in other closed nanoscale structures, and thus can have notable implications for the growing nanotechnological utilization of chemical syntheses conducted within confined nanoreactors.

  16. Two-scale large deviations for chemical reaction kinetics through second quantization path integral

    International Nuclear Information System (INIS)

    Li, Tiejun; Lin, Feng

    2016-01-01

    Motivated by the study of rare events for a typical genetic switching model in systems biology, in this paper we aim to establish the general two-scale large deviations for chemical reaction systems. We build a formal approach to explicitly obtain the large deviation rate functionals for the considered two-scale processes based upon the second quantization path integral technique. We get three important types of large deviation results when the underlying two timescales are in three different regimes. This is realized by singular perturbation analysis to the rate functionals obtained by the path integral. We find that the three regimes possess the same deterministic mean-field limit but completely different chemical Langevin approximations. The obtained results are natural extensions of the classical large volume limit for chemical reactions. We also discuss its implication on the single-molecule Michaelis–Menten kinetics. Our framework and results can be applied to understand general multi-scale systems including diffusion processes. (paper)

  17. Laser thermal effect on silicon nitride ceramic based on thermo-chemical reaction with temperature-dependent thermo-physical parameters

    International Nuclear Information System (INIS)

    Pan, A.F.; Wang, W.J.; Mei, X.S.; Wang, K.D.; Zhao, W.Q.; Li, T.Q.

    2016-01-01

    Highlights: • A two-dimensional thermo-chemical reaction model is creatively built. • Thermal conductivity and heat capacity of β-Si_3N_4 are computed accurately. • The appropriate thermo-chemical reaction rate is fitted and reaction element length is set to assure the constringency. • The deepest ablated position was not the center of the ablated area due to plasma absorption. • The simulation results demonstrate the thermo-chemical process cant be simplified to be physical phase transition. - Abstract: In this study, a two-dimensional thermo-chemical reaction model with temperature-dependent thermo-physical parameters on Si_3N_4 with 10 ns laser was developed to investigate the ablated size, volume and surface morphology after single pulse. For model parameters, thermal conductivity and heat capacity of β-Si_3N_4 were obtained from first-principles calculations. Thermal-chemical reaction rate was fitted by collision theory, and then, reaction element length was deduced using the relationship between reaction rate and temperature distribution. Furthermore, plasma absorption related to energy loss was approximated as a function of electron concentration in Si_3N_4. It turned out that theoretical ablated volume and radius increased and then remained constant with increasing laser energy, and the maximum ablated depth was not in the center of the ablated zone. Moreover, the surface maximum temperature of Si_3N_4 was verified to be above 3000 K within pulse duration, and it was much higher than its thermal decomposition temperature of 1800 K, which indicated that Si_3N_4 was not ablated directly above the thermal decomposition temperature. Meanwhile, the single pulse ablation of Si_3N_4 was performed at different powers using a TEM_0_0 10 ns pulse Nd:YAG laser to validate the model. The model showed a satisfactory consistence between the experimental data and numerical predictions, presenting a new modeling technology that may significantly increase the

  18. Acid-functionalized polyolefin materials and their use in acid-promoted chemical reactions

    Science.gov (United States)

    Oyola, Yatsandra; Tian, Chengcheng; Bauer, John Christopher; Dai, Sheng

    2016-06-07

    An acid-functionalized polyolefin material that can be used as an acid catalyst in a wide range of acid-promoted chemical reactions, wherein the acid-functionalized polyolefin material includes a polyolefin backbone on which acid groups are appended. Also described is a method for the preparation of the acid catalyst in which a precursor polyolefin is subjected to ionizing radiation (e.g., electron beam irradiation) of sufficient power and the irradiated precursor polyolefin reacted with at least one vinyl monomer having an acid group thereon. Further described is a method for conducting an acid-promoted chemical reaction, wherein an acid-reactive organic precursor is contacted in liquid form with a solid heterogeneous acid catalyst comprising a polyolefin backbone of at least 1 micron in one dimension and having carboxylic acid groups and either sulfonic acid or phosphoric acid groups appended thereto.

  19. Single-Molecule Sensing with Nanopore Confinement: from Chemical Reactions to Biological Interactions.

    Science.gov (United States)

    Lin, Yao; Ying, Yi-Lun; Gao, Rui; Long, Yi-Tao

    2018-03-25

    The nanopore can generate an electrochemical confinement for single-molecule sensing which help understand the fundamental chemical principle in nanoscale dimensions. By observing the generated ionic current, individual bond-making and bond-breaking steps, single biomolecule dynamic conformational changes and electron transfer processes that occur within pore can be monitored with high temporal and current resolution. These single-molecule studies in nanopore confinement are revealing information about the fundamental chemical and biological processes that cannot be extracted from ensemble measurements. In this concept, we introduce and discuss the electrochemical confinement effects on single-molecule covalent reactions, conformational dynamics of individual molecules and host-guest interactions in protein nanopores. Then, we extend the concept of nanopore confinement effects to confine electrochemical redox reactions in solid-state nanopores for developing new sensing mechanisms. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Computed Potential Energy Surfaces and Minimum Energy Pathways for Chemical Reactions

    Science.gov (United States)

    Walch, Stephen P.; Langhoff, S. R. (Technical Monitor)

    1994-01-01

    Computed potential energy surfaces are often required for computation of such parameters as rate constants as a function of temperature, product branching ratios, and other detailed properties. For some dynamics methods, global potential energy surfaces are required. In this case, it is necessary to obtain the energy at a complete sampling of all the possible arrangements of the nuclei, which are energetically accessible, and then a fitting function must be obtained to interpolate between the computed points. In other cases, characterization of the stationary points and the reaction pathway connecting them is sufficient. These properties may be readily obtained using analytical derivative methods. We have found that computation of the stationary points/reaction pathways using CASSCF/derivative methods, followed by use of the internally contracted CI method to obtain accurate energetics, gives usefull results for a number of chemically important systems. The talk will focus on a number of applications including global potential energy surfaces, H + O2, H + N2, O(3p) + H2, and reaction pathways for complex reactions, including reactions leading to NO and soot formation in hydrocarbon combustion.

  1. Design and Synthesis of novel CuxGeOy/Cu/C nanowires by in situ chemical reduction process with highly reversible capacity for Lithium Batteries

    International Nuclear Information System (INIS)

    Wang, Linlin; Zhang, Xiaozhu; Peng, Xia; Tang, Kaibin

    2015-01-01

    The synthesis and use of ternary metal oxides/metal particles/carbon hybrids, especially 1D naowires composed of MGeO 3 /M/C hybrids for energy storage, remains very few reports. In this work, 1D Cu x GeO y /Cu/C NWs (x < 1, y < 3) were successfully prepared by a simple method involving chemical reduction process and simultaneous carbon coating. It was found that through the polydopamine(PDA)-assisted chemical reduction process performed on the CuGeO 3 NWs, the phase partially transformed to a mixture of crystalline Cu (∼70 nm) and amorphous Cu x GeO y NWs with carbon coating, but the nanowire-shaped morphology was maintained. Electrochemical measurements showed that the Cu x GeO y /Cu/C NWs exhibited a stable reversible capacity of ∼900 mA h g −1 after 100 cycles. Even at 800 mA g −1 , it also exhibited excellent high rate capacity of 350 mA h g −1 . The newly generated Cu x GeO y @Cu@CNWs exhibit enhanced cycle stability with high lithium-storage capability compared to that of the as-preparedCuGeO 3 NWs. (*) The in situ-synthesized Cu nanoparticles, amorphous state and carbon coating might play an important role in activating and enhancing the reversibility of the conversion reaction of Cu x GeO y . In addition, this effective synthetic method might provide the methodology for the development of other ternary metal oxides/metal particles/carbon hybrids materials for energy storage.

  2. Tutorial Review: Simulation of Oscillating Chemical Reactions Using Microsoft Excel Macros

    Directory of Open Access Journals (Sweden)

    Abdolhossein Naseri

    2016-12-01

    Full Text Available Oscillating reactions are one of the most interesting topics in chemistry and analytical chemistry. Fluctuations in concentrations of one the reacting species (usually a reaction intermediate create an oscillating chemical reaction. In oscillating systems, the reaction is far from thermodynamic equilibrium. In these systems, at least one autocatalytic step is required. Developing an instinctive feeling for how oscillating reactions work will be invaluable to future generations of chemists. Some software programs have been released for simulating oscillating systems; however, the algorithm details of such software are not transparent to chemists. In contrast, function of spreadsheet tools, like Microsoft Excel, is well understood, and the software is nearly universally available. In this work, the simulation and visualization of different oscillating systems are performed using Microsoft excel. The simple repetitive solving of the ordinary differential equation of an autocatalytic reaction (a spreadsheet row followed by time, easily automated by a subroutine (a “Macro” in Excel, readily simulates an oscillating reaction. This permits the simulation of some oscillating systems such asBelousov-Zhabotinsky. The versatility of an easily understandable computational platform further enables the simulation of the effects of linear and nonlinear parameters such as concentrations of reactants and catalyst, and kinetic constants. These parameters are readily changed to examine their effects.

  3. Looking for chemical reaction networks exhibiting a drift along a manifold of marginally stable states.

    Science.gov (United States)

    Brogioli, Doriano

    2013-02-07

    I recently reported some examples of mass-action equations that have a continuous manifold of marginally stable stationary states [Brogioli, D., 2010. Marginally stable chemical systems as precursors of life. Phys. Rev. Lett. 105, 058102; Brogioli, D., 2011. Marginal stability in chemical systems and its relevance in the origin of life. Phys. Rev. E 84, 031931]. The corresponding chemical reaction networks show nonclassical effects, i.e. a violation of the mass-action equations, under the effect of the concentration fluctuations: the chemical system drifts along the marginally stable states. I proposed that this effect is potentially involved in abiogenesis. In the present paper, I analyze the mathematical properties of mass-action equations of marginally stable chemical reaction networks. The marginal stability implies that the mass-action equations obey some conservation law; I show that the mathematical properties of the conserved quantity characterize the motion along the marginally stable stationary state manifold, i.e. they allow to predict if the fluctuations give rise to a random walk or a drift under the effect of concentration fluctuations. Moreover, I show that the presence of the drift along the manifold of marginally stable stationary-states is a critical property, i.e. at least one of the reaction constants must be fine tuned in order to obtain the drift. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Thermodynamic analysis of chemical heat pumps

    International Nuclear Information System (INIS)

    Obermeier, Jonas; Müller, Karsten; Arlt, Wolfgang

    2015-01-01

    Thermal energy storages and heat pump units represent an important part of high efficient renewable energy systems. By using thermally driven, reversible chemical reactions a combination of thermal energy storage and heat pump can be realized. The influences of thermophysical properties of the involved components on the efficiency of a heat pump cycle is analysed and the relevance of the thermodynamic driving force is worked out. In general, the behaviour of energetic and exergetic efficiency is contrary. In a real cycle, higher enthalpies of reaction decrease the energetic efficiency but increase the exergetic efficiency. Higher enthalpies of reaction allow for lower offsets from equilibrium state for a default thermodynamic driving force of the reaction. - Highlights: • A comprehensive efficiency analysis of gas-solid heat pumps is proposed. • Link between thermodynamic driving force and equilibrium drop is shown. • Calculation of the equilibrium drop based on thermochemical properties. • Reaction equilibria of the decomposition reaction of salt hydrates. • Contrary behavior of energetic and exergetic efficiency

  5. Method and apparatus for obtaining enhanced production rate of thermal chemical reactions

    Science.gov (United States)

    Tonkovich, Anna Lee Y [Pasco, WA; Wang, Yong [Richland, WA; Wegeng, Robert S [Richland, WA; Gao, Yufei [Kennewick, WA

    2003-04-01

    The present invention is a method and apparatus (vessel) for providing a heat transfer rate from a reaction chamber through a wall to a heat transfer chamber substantially matching a local heat transfer rate of a catalytic thermal chemical reaction. The key to the invention is a thermal distance defined on a cross sectional plane through the vessel inclusive of a heat transfer chamber, reaction chamber and a wall between the chambers. The cross sectional plane is perpendicular to a bulk flow direction of the reactant stream, and the thermal distance is a distance between a coolest position and a hottest position on the cross sectional plane. The thermal distance is of a length wherein the heat transfer rate from the reaction chamber to the heat transfer chamber substantially matches the local heat transfer rate.

  6. Development of a novel fingerprint for chemical reactions and its application to large-scale reaction classification and similarity.

    Science.gov (United States)

    Schneider, Nadine; Lowe, Daniel M; Sayle, Roger A; Landrum, Gregory A

    2015-01-26

    Fingerprint methods applied to molecules have proven to be useful for similarity determination and as inputs to machine-learning models. Here, we present the development of a new fingerprint for chemical reactions and validate its usefulness in building machine-learning models and in similarity assessment. Our final fingerprint is constructed as the difference of the atom-pair fingerprints of products and reactants and includes agents via calculated physicochemical properties. We validated the fingerprints on a large data set of reactions text-mined from granted United States patents from the last 40 years that have been classified using a substructure-based expert system. We applied machine learning to build a 50-class predictive model for reaction-type classification that correctly predicts 97% of the reactions in an external test set. Impressive accuracies were also observed when applying the classifier to reactions from an in-house electronic laboratory notebook. The performance of the novel fingerprint for assessing reaction similarity was evaluated by a cluster analysis that recovered 48 out of 50 of the reaction classes with a median F-score of 0.63 for the clusters. The data sets used for training and primary validation as well as all python scripts required to reproduce the analysis are provided in the Supporting Information.

  7. Collisions of polyatomic ions with surfaces: incident energy partitioning and chemical reactions

    International Nuclear Information System (INIS)

    Zabka, J.; Roithova, J.; Dolejsek, Z.; Herman, Z.

    2002-01-01

    Collision of polyatomic ions with surfaces were investigated in ion-surface scattering experiments to obtain more information on energy partitioning in ion-surface collision and on chemical reactions at surfaces. Mass spectra, translation energy and angular distributions of product ions were measured in dependence on the incident energy and the incident angle of polyatomic projectiles. From these data distributions of energy fractions resulting in internal excitation of the projectile, translation energy of the product ions, and energy absorbed by the surface were determined. The surface investigated were a standard stainless steel surface, covered by hydrocarbons, carbon surfaces at room and elevated temperatures, and several surfaces covered by a self-assembled monolayers (C 12 -hydrocarbon SAM, C 11 -perfluorohydrocarbon SAM, and C 11 hydrocarbon with terminal -COOH group SAM). The main processes observed at collision energies of 10 - 50 eV were: neutralization of the ions at surfaces, inelastic scattering and dissociations of the projectile ions, quasi elastic scattering of the projectile ions, and chemical reactions with the surface material (usually hydrogen-atom transfer reactions). The ion survival factor was estimated to be a few percent for even-electron ions (like protonated ethanol ion, C 2 H 5 O + , CD 5 + ) and about 10 - 10 2 times lower for radical ions (like ethanol and benzene molecular ions, CD 4 + ). In the polyatomic ion -surface energy transfer experiments, the ethanol molecular ion was used as a well-characterized projectile ion. The results with most of the surfaces studied showed in the collision energy range of 13 - 32 eV that most collisions were strongly inelastic with about 6 - 8 % of the incident projectile energy transformed into internal excitation of the projectile (independent of the incident angle) and led partially to its further dissociation in a unimolecular way after the interaction with the surface. The incident energy

  8. Anomalous Hall effect assisted by interfacial chemical reaction in perpendicular Co/Pt multilayers

    Science.gov (United States)

    Liu, Qian; Jiang, Shaolong; Teng, Jiao

    2018-05-01

    To uncover the underlying mechanism of Mg effect on the improved anomalous Hall effect (AHE) of perpendicular [Pt/Co]3/Mg/HfO2 multilayers, the X-ray photoelectron spectroscopy analysis has been carried out. It is found that Mg interlayer at the Co/HfO2 interface could prevent the Co oxidation to some extent via interfacial chemical reaction. As a result, A large anomalous Hall resistivity (ρAH) is obtained in perpendicular [Pt/Co]3/Mg/HfO2 multilayers, with a maximum ρAH of 3.02 μΩ cm, which is 59% larger than that in Co/Pt multilayers without Mg insertion. This effective modification of the AHE based on interfacial chemical reaction provides a promising pathway for spintronic applications.

  9. Studying Chemical Reactions, One Bond at a Time, with Single Molecule AFM Techniques

    Science.gov (United States)

    Fernandez, Julio M.

    2008-03-01

    The mechanisms by which mechanical forces regulate the kinetics of a chemical reaction are unknown. In my lecture I will demonstrate how we use single molecule force-clamp spectroscopy and protein engineering to study the effect of force on the kinetics of thiol/disulfide exchange. Reduction of disulfide bond via the thiol/disulfide exchange chemical reaction is crucial in regulating protein function and is of common occurrence in mechanically stressed proteins. While reduction is thought to proceed through a substitution nucleophilic bimolecular (SN2) reaction, the role of a mechanical force in modulating this chemical reaction is unknown. We apply a constant stretching force to single engineered disulfide bonds and measure their rate of reduction by dithiothreitol (DTT). We find that while the reduction rate is linearly dependent on the concentration of DTT, it is exponentially dependent on the applied force, increasing 10-fold over a 300 pN range. This result predicts that the disulfide bond lengthens by 0.34 å at the transition state of the thiol/disulfide exchange reaction. In addition to DTT, we also study the reduction of the engineered disulfide bond by the E. coli enzyme thioredoxin (Trx). Thioredoxins are enzymes that catalyze disulfide bond reduction in all organisms. As before, we apply a mechanical force in the range of 25-450 pN to the engineered disulfide bond substrate and monitor the reduction of these bonds by individual enzymes. In sharp contrast with the data obtained with DTT, we now observe two alternative forms of the catalytic reaction, the first requiring a reorientation of the substrate disulfide bond, causing a shortening of the substrate polypeptide by 0.76±0.07 å, and the second elongating the substrate disulfide bond by 0.21±0.01 å. These results support the view that the Trx active site regulates the geometry of the participating sulfur atoms, with sub-ångström precision, in order to achieve efficient catalysis. Single molecule

  10. A coupled mechanical-chemical model for reflecting the influence of stress on oxidation reactions in thermal barrier coating

    Science.gov (United States)

    Chen, Lin; Yueming, Li

    2018-06-01

    In this paper, a coupled mechanical-chemical model is established based on the thermodynamic framework, in which the contribution of chemical expansion to free energy is introduced. The stress-dependent chemical potential equilibrium at the gas-solid interface and the stress gradient-dependent diffusion equation as well as a so-called generalized force which is conjugate to the oxidation rate are derived from the proposed model, which could reflect the influence of stresses on the oxidation reaction. Based on the proposed coupled mechanical-chemical model, a user element subroutine is developed in ABAQUS. The numerical simulation of the high temperature oxidation in the thermal barrier coating is carried out to verify the accuracy of the proposed model, and then the influence of stresses on the oxidation reaction is investigated. In thermally grown oxide, the considerable stresses would be induced by permanent volumetric swelling during the oxidation. The stresses play an important role in the chemical potential equilibrium at the gas-solid interface and strongly affect the oxidation reaction. The gradient of the stresses, however, only occurs in the extremely thin oxidation front layer, which plays a very limited role in the oxidation reaction. The generalized force could be divided into the stress-dependent and the stress-independent parts. Comparing with the stress-independent part, the stress-dependent part is smaller, which has little influence on oxidation reaction.

  11. Diversion of the melanin synthetic pathway by dopamine product scavengers: A quantum chemical modeling of the reaction mechanisms

    Directory of Open Access Journals (Sweden)

    T. B. Demissie

    2017-01-01

    Full Text Available We report the stability and reactivity of the oxidation products as well as L-cysteine and N-acetylcysteine adducts of dopamine studied using quantum chemical calculations. The overall reactions studied were subdivided into four reaction channels. The first reaction channel is the oxidation of dopamine to form dopaminoquinone. The second reaction channel leads to melanin formation through subsequent reactions. The third and fourth reaction channels are reactions leading to the formation of dopaminoquinone adducts which are aimed to divert the synthesis of melanin. The results indicate that L-cysteine and N-acetylcysteine undergo chemical reactions mainly at C5 position of dopaminoquinone. The analyses of the thermodynamic energies indicate that L-cysteine and N-acetylcysteine covalently bind to dopaminoquinone by competing with the internal cyclization reaction of dopaminoquinone which leads to the synthesis of melanin. The analysis of the results, based on the reaction free energies, is also supported by the investigation of the natural bond orbitals of the reactants and products.

  12. Understanding and Improvement of an Experiment Measuring Chemical Reaction Rates by Monitoring Volume Change of a Gas: On the Reaction between HCl(aq) and Mg(s)

    International Nuclear Information System (INIS)

    Bang, Jeong Ah; Yoon, Hee Sook; Jeong, Dae Hong; Choi, Won Ho

    2006-01-01

    In this study we analyzed and improved an experiment measuring chemical reaction rates introduced in the high school science textbooks through an understanding of the phenomena observed in carrying out the experiment. For this purpose, the contents of textbooks related to the experiment were analyzed, and the problems observed in carrying out the experiment were addressed through experimental analysis. When the experiment was carried out by the method of aquatic transposition presented in textbooks, the observed volume change of H 2 gas was delayed and chemical reaction rate was increased in the early stage of reaction period. To resolve these problems, an improved method for measuring the reaction rates was suggested. In the improved experiment the reaction rate was measured to be constant on time, which was interpreted in terms of the concentration of H + and the surface area of magnesium

  13. College Chemistry Students' Use of Memorized Algorithms in Chemical Reactions

    Science.gov (United States)

    Nyachwaya, James M.; Warfa, Abdi-Rizak M; Roehrig, Gillian H.; Schneider, Jamie L.

    2014-01-01

    This study sought to uncover memorized algorithms and procedures that students relied on in responding to questions based on the particulate nature of matter (PNM). We describe various memorized algorithms or processes used by students. In the study, students were asked to balance three equations of chemical reaction and then draw particulate…

  14. In Situ Environmental TEM in Imaging Gas and Liquid Phase Chemical Reactions for Materials Research.

    Science.gov (United States)

    Wu, Jianbo; Shan, Hao; Chen, Wenlong; Gu, Xin; Tao, Peng; Song, Chengyi; Shang, Wen; Deng, Tao

    2016-11-01

    Gas and liquid phase chemical reactions cover a broad range of research areas in materials science and engineering, including the synthesis of nanomaterials and application of nanomaterials, for example, in the areas of sensing, energy storage and conversion, catalysis, and bio-related applications. Environmental transmission electron microscopy (ETEM) provides a unique opportunity for monitoring gas and liquid phase reactions because it enables the observation of those reactions at the ultra-high spatial resolution, which is not achievable through other techniques. Here, the fundamental science and technology developments of gas and liquid phase TEM that facilitate the mechanistic study of the gas and liquid phase chemical reactions are discussed. Combined with other characterization tools integrated in TEM, unprecedented material behaviors and reaction mechanisms are observed through the use of the in situ gas and liquid phase TEM. These observations and also the recent applications in this emerging area are described. The current challenges in the imaging process are also discussed, including the imaging speed, imaging resolution, and data management. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Rock-fluid chemical interactions at reservoir conditions: The influence of brine chemistry and extent of reaction

    Science.gov (United States)

    Anabaraonye, B. U.; Crawshaw, J.; Trusler, J. P. M.

    2016-12-01

    Following carbon dioxide injection in deep saline aquifers, CO2 dissolves in the formation brines forming acidic solutions that can subsequently react with host reservoir minerals, altering both porosity and permeability. The direction and rates of these reactions are influenced by several factors including properties that are associated with the brine system. Consequently, understanding and quantifying the impacts of the chemical and physical properties of the reacting fluids on overall reaction kinetics is fundamental to predicting the fate of the injected CO2. In this work, we present a comprehensive experimental study of the kinetics of carbonate-mineral dissolution in different brine systems including sodium chloride, sodium sulphate and sodium bicarbonate of varying ionic strengths. The impacts of the brine chemistry on rock-fluid chemical reactions at different extent of reactions are also investigated. Using a rotating disk technique, we have investigated the chemical interactions between the CO2-saturated brines and carbonate minerals at conditions of pressure (up to 10 MPa) and temperature (up to 373 K) pertinent to carbon storage. The changes in surface textures due to dissolution reaction were studied by means of optical microscopy and vertical scanning interferometry. Experimental results are compared to previously derived models.

  16. Recent Trends in Quantum Chemical Modeling of Enzymatic Reactions.

    Science.gov (United States)

    Himo, Fahmi

    2017-05-24

    The quantum chemical cluster approach is a powerful method for investigating enzymatic reactions. Over the past two decades, a large number of highly diverse systems have been studied and a great wealth of mechanistic insight has been developed using this technique. This Perspective reviews the current status of the methodology. The latest technical developments are highlighted, and challenges are discussed. Some recent applications are presented to illustrate the capabilities and progress of this approach, and likely future directions are outlined.

  17. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  18. Time reversal tests in polarized neutron reactions

    International Nuclear Information System (INIS)

    Asahi, Koichiro; Bowman, J.D.; Crawford, B.

    1998-01-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). In recent years the nuclear weak interaction has been studied in the compound nucleus via parity violation. The observed parity-violating effects are strongly enhanced by nuclear structure. The predictions are that the interaction of polarized neutrons with polarized nuclear targets could be also used to perform sensitive tests of time-reversal-violation because of the nuclear enhancements. The author has designed experiments to search for time-reversal violation in neutron-nucleus interactions. He has also developed techniques to polarize neutrons with laser-polarized 3 He gas targets. Using the polarized 3 He neutron spin filter, he has performed two experiments at LANSCE: an absolute neutron beam polarization measurement with an accuracy of 0.2--0.3% and a neutron spin-rotation measurement on a 139 La sample

  19. Molecular Beam Studies of Hot Atom Chemical Reactions: Reactive Scattering of Energetic Deuterium Atoms

    Science.gov (United States)

    Continetti, R. E.; Balko, B. A.; Lee, Y. T.

    1989-02-01

    A brief review of the application of the crossed molecular beams technique to the study of hot atom chemical reactions in the last twenty years is given. Specific emphasis is placed on recent advances in the use of photolytically produced energetic deuterium atoms in the study of the fundamental elementary reactions D + H{sub 2} -> DH + H and the substitution reaction D + C{sub 2}H{sub 2} -> C{sub 2}HD + H. Recent advances in uv laser and pulsed molecular beam techniques have made the detailed study of hydrogen atom reactions under single collision conditions possible.

  20. Molecular beam studies of hot atom chemical reactions: Reactive scattering of energetic deuterium atoms

    International Nuclear Information System (INIS)

    Continetti, R.E.; Balko, B.A.; Lee, Y.T.

    1989-02-01

    A brief review of the application of the crossed molecular beams technique to the study of hot atom chemical reactions in the last twenty years is given. Specific emphasis is placed on recent advances in the use of photolytically produced energetic deuterium atoms in the study of the fundamental elementary reactions D + H 2 /minus/> DH + H and the substitution reaction D + C 2 H 2 /minus/> C 2 HD + H. Recent advances in uv laser and pulsed molecular beam techniques have made the detailed study of hydrogen atom reactions under single collision conditions possible. 18 refs., 9 figs

  1. On the feasibility of producing secondary radioactive nuclear beams using reactions in reversed geometries at HI-13 tandem accelerator

    International Nuclear Information System (INIS)

    Bai Xixiang; Liu Weiping

    1993-01-01

    Some of (p,n),(d,p),(d,n) and (d, 3 He) reactions involving heavy-ions in reversed geometries are proposed for producing the kinematically compressed beams of ions such as 6 He, 7 Be, 8 Li, 11 C, 12 B, 13 N, 15 O and 17 F. A simple facility being constructed to produce and utilize these beams is briefly described

  2. Theoretical and experimental study on solid chemical reaction between BaCO3 and TiO2 in microwave field

    International Nuclear Information System (INIS)

    Liu Hanxing; Guo, Liling; Zou Long; Cao Minhe; Zhou Jian; Ouyang Shixi

    2004-01-01

    Solid-state chemical reaction mechanism for the reaction between BaCO 3 and TiO 2 in microwave field was investigated based on X-ray power diffraction (XRD) data and theory of diffusion. The compositions of the resultant after reaction under different conditions were studied by employing XRD. The quantitative analyses based on XRD data showed the reaction in microwave field was quite different from that in the conventional method. A model was proposed to explain the change of the ratio between the reactant BaCO 3 , TiO 2 and the resultant BaTiO 3 for the chemical reaction. The formation kinetic of BaTiO 3 from the BaCO 3 and TiO 2 was calculated by employing this theoretical model. The reaction rate between BaCO 3 and TiO 2 in microwave field was much higher than that in conventional method. The activation energy of the atomic diffusions in this solid chemical reaction is only 58 kJ/mol, which was only about 1/4 of 232 kJ/mol in the conventional value. The result suggests that the microwave field enhance atomic diffusion during the reaction

  3. The use of the dusty-gas model for the description of mass transport with chemical reaction in porous media

    NARCIS (Netherlands)

    Veldsink, J.W.; Veldsink, J.W.; van Damme, Rudolf M.J.; Versteeg, Geert; van Swaaij, Willibrordus Petrus Maria

    1995-01-01

    In the present study, mass transport accompanied by chemical reactions in porous media is studied according to the Fick model and the dusty-gas model. For mass transport accompanied by a chemical reaction in catalyst structures showing a plane, line, or point of symmetry, the approximate analytical

  4. The Concentration Dependence of the (Delta)s Term in the Gibbs Free Energy Function: Application to Reversible Reactions in Biochemistry

    Science.gov (United States)

    Gary, Ronald K.

    2004-01-01

    The concentration dependence of (delta)S term in the Gibbs free energy function is described in relation to its application to reversible reactions in biochemistry. An intuitive and non-mathematical argument for the concentration dependence of the (delta)S term in the Gibbs free energy equation is derived and the applicability of the equation to…

  5. Surface Reaction Kinetics of Ga(1-x)In(x)P Growth During Pulsed Chemical Beam Epitaxy

    National Research Council Canada - National Science Library

    Dietz, N; Beeler, S. C; Schmidt, J. W; Tran, H. T

    2000-01-01

    ... into the surface reaction kinetics during an organometallic deposition process. These insights will allow us to move the control point closer to the point where the growth occurs, which in a chemical been epitaxy process is a surface reaction layer (SRL...

  6. Ionic Diffusion and Kinetic Homogeneous Chemical Reactions in the Pore Solution of Porous Materials with Moisture Transport

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2009-01-01

    Results from a systematic continuum mixture theory will be used to establish the governing equations for ionic diffusion and chemical reactions in the pore solution of a porous material subjected to moisture transport. The theory in use is the hybrid mixture theory (HMT), which in its general form......’s law of diffusion and the generalized Darcy’s law will be used together with derived constitutive equations for chemical reactions within phases. The mass balance equations for the constituents and the phases together with the constitutive equations gives the coupled set of non-linear differential...... general description of chemical reactions among constituents is described. The Petrov – Galerkin approach are used in favour of the standard Galerkin weighting in order to improve the solution when the convective part of the problem is dominant. A modified type of Newton – Raphson scheme is derived...

  7. Process for carrying out a chemical reaction with ionic liquid and carbon dioxide under pressure

    NARCIS (Netherlands)

    Kroon, M.C.; Shariati, A.; Florusse, L.J.; Peters, C.J.; Van Spronsen, J.; Witkamp, G.J.; Sheldon, R.A.; Gutkowski, K.I.

    2006-01-01

    The invention is directed to a process for carrying out a chemical reaction in an ionic liquid as solvent and CO2 as cosolvent, in which process reactants are reacted in a homogeneous phase at selected pressure and temperature to generate a reaction product at least containing an end-product of the

  8. Use of the nonsteady monotonic heating method for complex determination of thermophysical properties of chemically reacting mixture in the case of non-equilibrium proceeding of the chemical reaction

    International Nuclear Information System (INIS)

    Serebryanyj, G.Z.

    1984-01-01

    Theoretical analysis is made for the monotonic heating method as applied for complex determination of thermophysical properties of chemically reacting gases. The possibility is shown of simultaneous determination of frozen and equilibrium heat capacity, frozen and equilibrium heat conduction provided non-equilibrium occuring of the reaction in the wide range of temperatures and pressures. The monotonic heating method can be used for complex determination of thermophysical properties of chemically reacting systems in case of non-equilibrium proceeding of the chemical reaction

  9. The correlation schemes in calculations of the rate constants of some radiation chemical reactions

    International Nuclear Information System (INIS)

    Zagorets, P.A.; Shostenko, A.G.; Kim, V.

    1983-01-01

    The various correlation relationships of the evaluation of the rate constants of radiation chemical reactions of addition, abstraction and isomerization were considered. It was shown that neglection of the influence of solvent can result in errors in calculations of rate constants equalling two orders in magnitude. Several examples of isokinetic relationship are given. The methods of calculation of transmission coefficient of reaction addition have been discussed. (author)

  10. Dynamics of chemical reactions of multiply-charged cations: Information from beam scattering experiments

    Czech Academy of Sciences Publication Activity Database

    Herman, Zdeněk

    2015-01-01

    Roč. 378, FEB 2015 (2015), s. 113-126 ISSN 1387-3806 Institutional support: RVO:61388955 Keywords : Multiply-charged ions * Dynamics of chemical reactions * Beam scattering Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.183, year: 2015

  11. Chemical Reaction and Flow Modeling in Fullerene and Nanotube Production

    Science.gov (United States)

    Scott, Carl D.; Farhat, Samir; Greendyke, Robert B.

    2004-01-01

    The development of processes to produce fullerenes and carbon nanotubes has largely been empirical. Fullerenes were first discovered in the soot produced by laser ablation of graphite [1]and then in the soot of electric arc evaporated carbon. Techniques and conditions for producing larger and larger quantities of fullerenes depended mainly on trial and error empirical variations of these processes, with attempts to scale them up by using larger electrodes and targets and higher power. Various concepts of how fullerenes and carbon nanotubes were formed were put forth, but very little was done based on chemical kinetics of the reactions. This was mainly due to the complex mixture of species and complex nature of conditions in the reactors. Temperatures in the reactors varied from several thousand degrees Kelvin down to near room temperature. There are hundreds of species possible, ranging from atomic carbon to large clusters of carbonaceous soot, and metallic catalyst atoms to metal clusters, to complexes of metals and carbon. Most of the chemical kinetics of the reactions and the thermodynamic properties of clusters and complexes have only been approximated. In addition, flow conditions in the reactors are transient or unsteady, and three dimensional, with steep spatial gradients of temperature and species concentrations. All these factors make computational simulations of reactors very complex and challenging. This article addresses the development of the chemical reaction involved in fullerene production and extends this to production of carbon nanotubes by the laser ablation/oven process and by the electric arc evaporation process. In addition, the high-pressure carbon monoxide (HiPco) process is discussed. The article is in several parts. The first one addresses the thermochemical aspects of modeling; and considers the development of chemical rate equations, estimates of reaction rates, and thermodynamic properties where they are available. The second part

  12. Programming chemical kinetics: engineering dynamic reaction networks with DNA strand displacement

    Science.gov (United States)

    Srinivas, Niranjan

    Over the last century, the silicon revolution has enabled us to build faster, smaller and more sophisticated computers. Today, these computers control phones, cars, satellites, assembly lines, and other electromechanical devices. Just as electrical wiring controls electromechanical devices, living organisms employ "chemical wiring" to make decisions about their environment and control physical processes. Currently, the big difference between these two substrates is that while we have the abstractions, design principles, verification and fabrication techniques in place for programming with silicon, we have no comparable understanding or expertise for programming chemistry. In this thesis we take a small step towards the goal of learning how to systematically engineer prescribed non-equilibrium dynamical behaviors in chemical systems. We use the formalism of chemical reaction networks (CRNs), combined with mass-action kinetics, as our programming language for specifying dynamical behaviors. Leveraging the tools of nucleic acid nanotechnology (introduced in Chapter 1), we employ synthetic DNA molecules as our molecular architecture and toehold-mediated DNA strand displacement as our reaction primitive. Abstraction, modular design and systematic fabrication can work only with well-understood and quantitatively characterized tools. Therefore, we embark on a detailed study of the "device physics" of DNA strand displacement (Chapter 2). We present a unified view of strand displacement biophysics and kinetics by studying the process at multiple levels of detail, using an intuitive model of a random walk on a 1-dimensional energy landscape, a secondary structure kinetics model with single base-pair steps, and a coarse-grained molecular model that incorporates three-dimensional geometric and steric effects. Further, we experimentally investigate the thermodynamics of three-way branch migration. Our findings are consistent with previously measured or inferred rates for

  13. Chemical reaction at ferromagnet/oxide interface and its influence on anomalous Hall effect

    International Nuclear Information System (INIS)

    Liu, Yi-Wei; Teng, Jiao; Zhang, Jing-Yan; Liu, Yang; Chen, Xi; Li, Xu-Jing; Feng, Chun; Wang, Hai-Cheng; Li, Ming-Hua; Yu, Guang-Hua; Wu, Zheng-Long

    2014-01-01

    Chemical reactions at the ferromagnet/oxide interface in [Pt/Fe] 3 /MgO and [Pt/Fe] 3 /SiO 2 multilayers before and after annealing were investigated by X-ray photoelectron spectroscopy. The results show that Fe atoms at the Fe/MgO interface were completely oxidized in the as-grown state and significantly deoxidized after vacuum annealing. However, only some of the Fe atoms at the Fe/SiO 2 interface were oxidized and rarely deoxidized after annealing. The anomalous Hall effect was modified by this interfacial chemical reaction. The saturation anomalous Hall resistance (R xy ) was greatly increased in the [Pt/Fe] 3 /MgO multilayers after annealing and was 350% higher than that in the as-deposited film, while R xy of the [Pt/Fe] 3 /SiO 2 multilayer only increased 10% after annealing.

  14. Mass transfer rate through liquid membranes: interfacial chemical reactions and diffusion as simultaneous permeability controlling factors

    International Nuclear Information System (INIS)

    Danesi, P.R.; Horwitz, E.P.; Vandegrift, G.F.; Chiarizia, R.

    1981-01-01

    Equations describing the permeability of a liquid membrane to metal cations have been derived taking into account aqueous diffusion, membrane diffusion, and interfacial chemical reactions as simultaneous permeability controlling factors. Diffusion and chemical reactions have been coupled by a simple model analogous to the one previously described by us to represent liquid-liquid extraction kinetics. The derived equations, which make use of experimentally determined interfacial reaction mechanisms, qualitatively fit unexplained literature data regarding Cu 2+ transfer through liquid membranes. Their use to predict and optimize membrane permeability in practical separation processes by setting the appropriate concentration of the membrane carrier [LIX 64 (General Mills), a commercial β-hydroxy-oxime] and the pH of the aqueous copper feed solution is briefly discussed. 4 figures

  15. HELP: a model for evaluating the feasibility of using various chemical reaction systems as electronic lasers

    Energy Technology Data Exchange (ETDEWEB)

    Herbelin, J M; Cohen, N

    1975-09-01

    An analytical model for estimating the minimum requirements of a chemically pumped electronic laser is developed. From a knowledge of the basic spectroscopic and thermodynamic properties of a particular reaction, the model can quickly classify the system in accordance with the feasibility of generating stimulated emission at different possible wavelengths. Sample calculations of the reactions of barium atoms with nitrous oxide and nitrogen dioxide indicate that the model is sufficiently sensitive to distinguish between very similar systems and, therefore, should be useful in providing classification criteria in the search for a chemically pumped electronic laser.

  16. Substrate-Directed Catalytic Selective Chemical Reactions.

    Science.gov (United States)

    Sawano, Takahiro; Yamamoto, Hisashi

    2018-05-04

    The development of highly efficient reactions at only the desired position is one of the most important subjects in organic chemistry. Most of the reactions in current organic chemistry are reagent- or catalyst-controlled reactions, and the regio- and stereoselectivity of the reactions are determined by the inherent nature of the reagent or catalyst. In sharp contrast, substrate-directed reaction determines the selectivity of the reactions by the functional group on the substrate and can strictly distinguish sterically and electronically similar multiple reaction sites in the substrate. In this Perspective, three topics of substrate-directed reaction are mainly reviewed: (1) directing group-assisted epoxidation of alkenes, (2) ring-opening reactions of epoxides by various nucleophiles, and (3) catalytic peptide synthesis. Our newly developed synthetic methods with new ligands including hydroxamic acid derived ligands realized not only highly efficient reactions but also pinpointed reactions at the expected position, demonstrating the substrate-directed reaction as a powerful method to achieve the desired regio- and stereoselective functionalization of molecules from different viewpoints of reagent- or catalyst-controlled reactions.

  17. The quantum dynamics of electronically nonadiabatic chemical reactions

    Science.gov (United States)

    Truhlar, Donald G.

    1993-01-01

    Considerable progress was achieved on the quantum mechanical treatment of electronically nonadiabatic collisions involving energy transfer and chemical reaction in the collision of an electronically excited atom with a molecule. In the first step, a new diabatic representation for the coupled potential energy surfaces was created. A two-state diabatic representation was developed which was designed to realistically reproduce the two lowest adiabatic states of the valence bond model and also to have the following three desirable features: (1) it is more economical to evaluate; (2) it is more portable; and (3) all spline fits are replaced by analytic functions. The new representation consists of a set of two coupled diabatic potential energy surfaces plus a coupling surface. It is suitable for dynamics calculations on both the electronic quenching and reaction processes in collisions of Na(3p2p) with H2. The new two-state representation was obtained by a three-step process from a modified eight-state diatomics-in-molecules (DIM) representation of Blais. The second step required the development of new dynamical methods. A formalism was developed for treating reactions with very general basis functions including electronically excited states. Our formalism is based on the generalized Newton, scattered wave, and outgoing wave variational principles that were used previously for reactive collisions on a single potential energy surface, and it incorporates three new features: (1) the basis functions include electronic degrees of freedom, as required to treat reactions involving electronic excitation and two or more coupled potential energy surfaces; (2) the primitive electronic basis is assumed to be diabatic, and it is not assumed that it diagonalizes the electronic Hamiltonian even asymptotically; and (3) contracted basis functions for vibrational-rotational-orbital degrees of freedom are included in a very general way, similar to previous prescriptions for locally

  18. A coupled mechanical and chemical damage model for concrete affected by alkali–silica reaction

    Energy Technology Data Exchange (ETDEWEB)

    Pignatelli, Rossella, E-mail: rossellapignatelli@gmail.com [Department of Civil and Environmental Engineering, Politecnico di Milano, Piazza L. da Vinci 32, 20133 Milano (Italy); Lombardi Ingegneria S.r.l., Via Giotto 36, 20145 Milano (Italy); Comi, Claudia, E-mail: comi@stru.polimi.it [Department of Civil and Environmental Engineering, Politecnico di Milano, Piazza L. da Vinci 32, 20133 Milano (Italy); Monteiro, Paulo J.M., E-mail: monteiro@ce.berkeley.edu [Department of Civil and Environmental Engineering, University of California, Berkeley, CA 94720 (United States)

    2013-11-15

    To model the complex degradation phenomena occurring in concrete affected by alkali–silica reaction (ASR), we formulate a poro-mechanical model with two isotropic internal variables: the chemical and the mechanical damage. The chemical damage, related to the evolution of the reaction, is caused by the pressure generated by the expanding ASR gel on the solid concrete skeleton. The mechanical damage describes the strength and stiffness degradation induced by the external loads. As suggested by experimental results, degradation due to ASR is considered to be localized around reactive sites. The effect of the degree of saturation and of the temperature on the reaction development is also modeled. The chemical damage evolution is calibrated using the value of the gel pressure estimated by applying the electrical diffuse double-layer theory to experimental values of the surface charge density in ASR gel specimens reported in the literature. The chemo-damage model is first validated by simulating expansion tests on reactive specimens and beams; the coupled chemo-mechanical damage model is then employed to simulate compression and flexure tests results also taken from the literature. -- Highlights: •Concrete degradation due to ASR in variable environmental conditions is modeled. •Two isotropic internal variables – chemical and mechanical damage – are introduced. •The value of the swelling pressure is estimated by the diffuse double layer theory. •A simplified scheme is proposed to relate macro- and microscopic properties. •The chemo-mechanical damage model is validated by simulating tests in literature.

  19. Hot spot formation and chemical reaction initiation in shocked HMX crystals with nanovoids: a large-scale reactive molecular dynamics study.

    Science.gov (United States)

    Zhou, Tingting; Lou, Jianfeng; Zhang, Yangeng; Song, Huajie; Huang, Fenglei

    2016-07-14

    We report million-atom reactive molecular dynamic simulations of shock initiation of β-cyclotetramethylene tetranitramine (β-HMX) single crystals containing nanometer-scale spherical voids. Shock induced void collapse and subsequent hot spot formation as well as chemical reaction initiation are observed which depend on the void size and impact strength. For an impact velocity of 1 km s(-1) and a void radius of 4 nm, the void collapse process includes three stages; the dominant mechanism is the convergence of upstream molecules toward the centerline and the downstream surface of the void forming flowing molecules. Hot spot formation also undergoes three stages, and the principal mechanism is kinetic energy transforming to thermal energy due to the collision of flowing molecules on the downstream surface. The high temperature of the hot spot initiates a local chemical reaction, and the breakage of the N-NO2 bond plays the key role in the initial reaction mechanism. The impact strength and void size have noticeable effects on the shock dynamical process, resulting in a variation of the predominant mechanisms leading to void collapse and hot spot formation. Larger voids or stronger shocks result in more intense hot spots and, thus, more violent chemical reactions, promoting more reaction channels and generating more reaction products in a shorter duration. The reaction products are mainly concentrated in the developed hot spot, indicating that the chemical reactivity of the hmx crystal is greatly enhanced by void collapse. The detailed information derived from this study can aid a thorough understanding of the role of void collapse in hot spot formation and the chemical reaction initiation of explosives.

  20. Leading survey and research report for fiscal 1999. Survey and research on chemical reaction simulator technology; 1999 nendo kagaku hanno simulator gijutsu no chosa kenkyu hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Although various chemical reactions are made use of at scenes of chemical industry for the acquisition of desired chemicals, the control of reaction process governing factors, such as temperature, pressure, catalysts, solutions, etc., is found to be carried out only on the empirical basis. At the present time, rational or optimum reaction designs are not to be prepared in a short period of time in the presence of the widespread shortage of knowledge about chemical reactions and of the shortage of understanding of chemical reactions at the micro level. Leading survey and research are conducted for the development of a 'chemical reaction simulator' technology to enable the acquisition of optimum reaction designing guidelines in a short period of time. Using the simulator, a chemical of his choice is inputted by a researcher engaged in the study of an real chemical reaction and then various techniques of computer science are mobilized for the preparation of a huge number of feasible reaction routes, and high-precision simulations are conducted for the feasible reaction routes. The results achieved this fiscal year are reported. The purpose of this research and its ripple effect on new product industry creation are stated. Then the positioning, mission, and concept of such a chemical reaction simulator are described. Finally, the result of research and survey of knowledge databases and the result of research and survey of computational chemistry are stated. (NEDO)

  1. Leading survey and research report for fiscal 1999. Survey and research on chemical reaction simulator technology; 1999 nendo kagaku hanno simulator gijutsu no chosa kenkyu hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Although various chemical reactions are made use of at scenes of chemical industry for the acquisition of desired chemicals, the control of reaction process governing factors, such as temperature, pressure, catalysts, solutions, etc., is found to be carried out only on the empirical basis. At the present time, rational or optimum reaction designs are not to be prepared in a short period of time in the presence of the widespread shortage of knowledge about chemical reactions and of the shortage of understanding of chemical reactions at the micro level. Leading survey and research are conducted for the development of a 'chemical reaction simulator' technology to enable the acquisition of optimum reaction designing guidelines in a short period of time. Using the simulator, a chemical of his choice is inputted by a researcher engaged in the study of an real chemical reaction and then various techniques of computer science are mobilized for the preparation of a huge number of feasible reaction routes, and high-precision simulations are conducted for the feasible reaction routes. The results achieved this fiscal year are reported. The purpose of this research and its ripple effect on new product industry creation are stated. Then the positioning, mission, and concept of such a chemical reaction simulator are described. Finally, the result of research and survey of knowledge databases and the result of research and survey of computational chemistry are stated. (NEDO)

  2. Influence of heat and chemical reactions on the Sisko fluid model for ...

    African Journals Online (AJOL)

    The present article studies the effects of heat and chemical reactions on the blood flow through tapered artery with a stenosis. The model incorporates Sisko fluid representation for the blood flow through an axially non-symmetrical but radially symmetric stenosis. Symmetry of the distribution of the wall shearing stress and ...

  3. Optimal allocation of SVC and TCSC using quasi-oppositional chemical reaction optimization for solving multi-objective ORPD problem

    Directory of Open Access Journals (Sweden)

    Susanta Dutta

    2018-05-01

    Full Text Available This paper presents an efficient quasi-oppositional chemical reaction optimization (QOCRO technique to find the feasible optimal solution of the multi objective optimal reactive power dispatch (RPD problem with flexible AC transmission system (FACTS device. The quasi-oppositional based learning (QOBL is incorporated in conventional chemical reaction optimization (CRO, to improve the solution quality and the convergence speed. To check the superiority of the proposed method, it is applied on IEEE 14-bus and 30-bus systems and the simulation results of the proposed approach are compared to those reported in the literature. The computational results reveal that the proposed algorithm has excellent convergence characteristics and is superior to other multi objective optimization algorithms. Keywords: Quasi-oppositional chemical reaction optimization (QOCRO, Reactive power dispatch (RPD, TCSC, SVC, Multi-objective optimization

  4. Kinetic modelling of hydro-treatment reactions by study of different chemical groups; Modelisation cinetique des reactions d`hydrotraitement par regroupement en familles chimiques

    Energy Technology Data Exchange (ETDEWEB)

    Bonnardot, J

    1998-11-19

    Hydro-treatment of petroleum shortcuts permits elimination of unwanted components in order to increase combustion in engine and to decrease atmospheric pollution. Hydro-desulfurization (HDS), Hydro-denitrogenation (HDN) and Hydrogenation of aromatics (HDA) of a LCO (Light Cycle Oil)-Type gas oil have been studied using a new pilot at a fixed temperature with a NiMo/Al{sub 2}O{sub 3} catalyst. A hydrodynamic study showed that reactions occurring in the up-flow fixed bed reactor that has been used during the experiments, were governed exclusively by chemical reaction rates and not by diffusion. Through detailed chemical analysis, height chemical groups have been considered: three aromatics groups, one sulfided group, one nitrogenized and NH{sub 3}, H{sub 2}S, H{sub 2}. Two Langmuir-Hinshelwood-type kinetic models with either one or two types of sites have been established. The model with two types of site - one site of hydrogenation and one site of hydrogenolysis - showed a better fit in the modeling of the experimental results. This model enables to forecast the influence of partial pressure of H{sub 2}S and partial pressure of H{sub 2} on hydro-treatment reactions of a LCO-type gas oil. (author) 119 refs.

  5. Rotating Reverse-Osmosis for Water Purification

    Science.gov (United States)

    Lueptow, RIchard M.

    2004-01-01

    A new design for a water-filtering device combines rotating filtration with reverse osmosis to create a rotating reverse- osmosis system. Rotating filtration has been used for separating plasma from whole blood, while reverse osmosis has been used in purification of water and in some chemical processes. Reverse- osmosis membranes are vulnerable to concentration polarization a type of fouling in which the chemicals meant not to pass through the reverse-osmosis membranes accumulate very near the surfaces of the membranes. The combination of rotating filtration and reverse osmosis is intended to prevent concentration polarization and thereby increase the desired flux of filtered water while decreasing the likelihood of passage of undesired chemical species through the filter. Devices based on this concept could be useful in a variety of commercial applications, including purification and desalination of drinking water, purification of pharmaceutical process water, treatment of household and industrial wastewater, and treatment of industrial process water. A rotating filter consists of a cylindrical porous microfilter rotating within a stationary concentric cylindrical outer shell (see figure). The aqueous suspension enters one end of the annulus between the inner and outer cylinders. Filtrate passes through the rotating cylindrical microfilter and is removed via a hollow shaft. The concentrated suspension is removed at the end of the annulus opposite the end where the suspension entered.

  6. Features of E-Z-photoisomerization reversible reaction of 4-styrylpyridine crown-containing complexes with different cations

    International Nuclear Information System (INIS)

    Fedorov, Yu.V.; Shepel', N.Eh.; Chernikova, E.Yu.; Fedorova, O.A.; Gulakova, E.N.; Avakyan, V.G.; Jonushauskas, G.

    2008-01-01

    E-Z-Photoisomerization reversible reaction of crown-containing 4-styrylpyridine in the presence of alkali metal perchlorates (Ca 2+ , Mg 2+ , Ba 2+ ) gifted in the formation of complexes with crown-ether fragments, as well as heavy metal perchlorates (Hg 2+ , Cd 2+ ) gifted in the coordination with nitrogen atom of heterocyclic residuum has been studied. Effect of complexing on the photoisomerization is determined by electron spectroscopy and NMR 1 H, structures of the formed Z-isomers are established. The possibility of the E-Z-isomerization control with the use of supramolecular complexing is confirmed by the investigations [ru

  7. Micro flow reactor chips with integrated luminescent chemosensors for spatially resolved on-line chemical reaction monitoring.

    Science.gov (United States)

    Gitlin, Leonid; Hoera, Christian; Meier, Robert J; Nagl, Stefan; Belder, Detlev

    2013-10-21

    Real-time chemical reaction monitoring in microfluidic environments is demonstrated using luminescent chemical sensors integrated in PDMS/glass-based microscale reactors. A fabrication procedure is presented that allows for straightforward integration of thin polymer layers with optical sensing functionality in microchannels of glass-PDMS chips of only 150 μm width and of 10 to 35 μm height. Sensor layers consisting of polystyrene and an oxygen-sensitive platinum porphyrin probe with film thicknesses of about 0.5 to 4 μm were generated by combining spin coating and abrasion techniques. Optimal coating procedures were developed and evaluated. The chip-integrated sensor layers were calibrated and investigated with respect to stability, reproducibility and response times. These microchips allowed observation of dissolved oxygen concentration in the range of 0 to over 40 mg L(-1) with a detection limit of 368 μg L(-1). The sensor layers were then used for observation of a model reaction, the oxidation of sulphite to sulphate in a microfluidic chemical reactor and could observe sulphite concentrations of less than 200 μM. Real-time on-line monitoring of this chemical reaction was realized at a fluorescence microscope setup with 405 nm LED excitation and CCD camera detection.

  8. Modeling of uncertainties in biochemical reactions.

    Science.gov (United States)

    Mišković, Ljubiša; Hatzimanikatis, Vassily

    2011-02-01

    Mathematical modeling is an indispensable tool for research and development in biotechnology and bioengineering. The formulation of kinetic models of biochemical networks depends on knowledge of the kinetic properties of the enzymes of the individual reactions. However, kinetic data acquired from experimental observations bring along uncertainties due to various experimental conditions and measurement methods. In this contribution, we propose a novel way to model the uncertainty in the enzyme kinetics and to predict quantitatively the responses of metabolic reactions to the changes in enzyme activities under uncertainty. The proposed methodology accounts explicitly for mechanistic properties of enzymes and physico-chemical and thermodynamic constraints, and is based on formalism from systems theory and metabolic control analysis. We achieve this by observing that kinetic responses of metabolic reactions depend: (i) on the distribution of the enzymes among their free form and all reactive states; (ii) on the equilibrium displacements of the overall reaction and that of the individual enzymatic steps; and (iii) on the net fluxes through the enzyme. Relying on this observation, we develop a novel, efficient Monte Carlo sampling procedure to generate all states within a metabolic reaction that satisfy imposed constrains. Thus, we derive the statistics of the expected responses of the metabolic reactions to changes in enzyme levels and activities, in the levels of metabolites, and in the values of the kinetic parameters. We present aspects of the proposed framework through an example of the fundamental three-step reversible enzymatic reaction mechanism. We demonstrate that the equilibrium displacements of the individual enzymatic steps have an important influence on kinetic responses of the enzyme. Furthermore, we derive the conditions that must be satisfied by a reversible three-step enzymatic reaction operating far away from the equilibrium in order to respond to

  9. Role of graphene on the surface chemical reactions of BiPO4-rGO with low OH-related defects.

    Science.gov (United States)

    Gao, Erping; Wang, Wenzhong

    2013-11-21

    Graphene has been widely introduced into photocatalysis to enhance photocatalytic performance due to its unique physical and chemical properties. However, the effect of graphene on the surface chemical reactions of photocatalysis has not been clearly researched, which is important for photocatalysis because photocatalytic reactions ultimately occur on the catalyst surface. Herein, a two-step solution-phase reaction has been designed to synthesize quasi-core-shell structured BiPO4-rGO cuboids and the role of graphene on the surface chemical reactions was investigated in detail. It was found that the introduced graphene modified the process and the mechanism of the surface chemical reactions. The change mainly originates from the interaction between graphene and the adsorbed O2 molecule. Due to the electron transfer from graphene to adsorbed O2, graphene could tune the interfacial charge transport and efficiently activate molecular oxygen to form O2˙(-) anions as the major oxidation species instead of ˙OH. In addition, the two-step synthesis approach could efficiently suppress the formation of OH-related defects in the lattice. As a result, the BiPO4-rGO composite exhibited superior photocatalytic activity to BiPO4 and P25, about 4.3 times that of BiPO4 and 6.9 times that of P25.

  10. Humidity independent mass spectrometry for gas phase chemical analysis via ambient proton transfer reaction.

    Science.gov (United States)

    Zhu, Hongying; Huang, Guangming

    2015-03-31

    In this work, a humidity independent mass spectrometric method was developed for rapid analysis of gas phase chemicals. This method is based upon ambient proton transfer reaction between gas phase chemicals and charged water droplets, in a reaction chamber with nearly saturate humidity under atmospheric pressure. The humidity independent nature enables direct and rapid analysis of raw gas phase samples, avoiding time- and sample-consuming sample pretreatments in conventional mass spectrometry methods to control sample humidity. Acetone, benzene, toluene, ethylbenzene and meta-xylene were used to evaluate the analytical performance of present method. The limits of detection for benzene, toluene, ethylbenzene and meta-xylene are in the range of ∼0.1 to ∼0.3 ppbV; that of benzene is well below the present European Union permissible exposure limit for benzene vapor (5 μg m(-3), ∼1.44 ppbV), with linear ranges of approximately two orders of magnitude. The majority of the homemade device contains a stainless steel tube as reaction chamber and an ultrasonic humidifier as the source of charged water droplets, which makes this cheap device easy to assemble and facile to operate. In addition, potential application of this method was illustrated by the real time identification of raw gas phase chemicals released from plants at different physiological stages. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Evolution of weak perturbations in gas-solid suspension with chemical reaction

    Energy Technology Data Exchange (ETDEWEB)

    Sharypov, O.V. [Russian Academy of Sciences, Novosibirsk (Russian Federation). Inst. of Thermophysics; Novosibirsk State Univ. (Russian Federation); Anufriev, I.S. [Novosibirsk State Univ. (Russian Federation)

    2013-07-01

    Dynamics of weak finite-amplitude perturbations in two-phase homogeneous medium (gas + solid particles) with non-equilibrium chemical reaction in gas is studied theoretically. Non-linear model of plane perturbation evolution is substantiated. The model takes into account wave-kinetic interaction and dissipation effects, including inter-phase heat and momentum transfer. Conditions for uniform state of the system are analyzed. Non-linear equation describing evolution of plane perturbation is derived under weak dispersion and dissipation effects. The obtained results demonstrate self-organization in the homogeneous system: steady-state periodic structure arises, its period, amplitude and velocity depends on the features of the medium. The dependencies of these parameters on dissipation and chemical kinetics are analyzed.

  12. Attainment of chemical equilibrium in effusive beam sources of the heterogeneous reaction type

    International Nuclear Information System (INIS)

    Hildenbrand, D.L.

    1979-01-01

    Effusive beam sources derived from gas-solid reactions provide a very important pathway for widening the scope of high temperature thermodynamic studies, but the attainment of chemical equilibrium within these sources is problematical. Some of the underlying kinetic factors associated with the use of these sources are discussed. As one might expect, it is important to maximize the ratio of reactive surface area to exit orifice area. Equilibrium seems to be achieved more readily among the products of gas-solid reactions than among reactant and products, as suggested by the quasi-equilibrium model. Some experiences with the use of heterogeneous reaction sources are described, and two definitive tests for the establishment of equilibrium are outlined

  13. Online monitoring of N-nitrosodimethylamine rejection as a performance indicator of trace organic chemical removal by reverse osmosis.

    Science.gov (United States)

    Fujioka, Takahiro; Takeuchi, Haruka; Tanaka, Hiroaki; Kodamatani, Hitoshi

    2018-06-01

    The security of recycled water quality in potable reuse can be enhanced by improving the credibility of reverse osmosis (RO) treatment for the removal of trace organic chemicals (TOrCs). This study evaluated the potential of online monitoring of N-nitrosodimethylamine (NDMA) before and after RO treatment as a surrogate indicator for TOrC removal by RO. This pilot-scale study monitored NDMA concentrations in RO feedwater (ultrafiltration-treated wastewater) and RO permeate every 22 min using novel online NDMA analyzers-high-performance liquid chromatography followed by photochemical reaction and chemiluminescence detection. NDMA rejection by RO varied considerably in response to changes in operating conditions (permeate flux and feedwater temperature). A high linear correlation between NDMA rejection and the rejection of six other TOrCs was observed. The linear correlation was also identified for an RO membrane damaged with chlorine. The correlation between another potential surrogate indicator (conductivity rejection) and TOrC rejection was relatively low. NDMA, which is the smallest compound among regulated TOrCs, revealed rejections lower than the other TOrCs, indicating that NDMA rejection can be a conservative surrogate indicator capable of predicting changes in TOrC removal. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Statistical Significance of the Maximum Hardness Principle Applied to Some Selected Chemical Reactions.

    Science.gov (United States)

    Saha, Ranajit; Pan, Sudip; Chattaraj, Pratim K

    2016-11-05

    The validity of the maximum hardness principle (MHP) is tested in the cases of 50 chemical reactions, most of which are organic in nature and exhibit anomeric effect. To explore the effect of the level of theory on the validity of MHP in an exothermic reaction, B3LYP/6-311++G(2df,3pd) and LC-BLYP/6-311++G(2df,3pd) (def2-QZVP for iodine and mercury) levels are employed. Different approximations like the geometric mean of hardness and combined hardness are considered in case there are multiple reactants and/or products. It is observed that, based on the geometric mean of hardness, while 82% of the studied reactions obey the MHP at the B3LYP level, 84% of the reactions follow this rule at the LC-BLYP level. Most of the reactions possess the hardest species on the product side. A 50% null hypothesis is rejected at a 1% level of significance.

  15. The removal of dinitrochlorobenzene from industrial residuals by liquid-liquid extraction with chemical reaction

    Directory of Open Access Journals (Sweden)

    G. C. M. Ferreira

    2007-09-01

    Full Text Available Nitrochlorobenzenes (NCBs are very important in the chemical industry since they have been used as raw material for the manufacture of crop protection products, as active ingredients in the pharmaceutical industry, as pigments and as antioxidants as well as for other uses. In industrial processes, NCBs are produced by monochlorobenzene (MCB nitration reactions and one of the main residuals formed is dinitrochlorobenzene (DNCB, which is mainly composed of the isomer 2,4DNCB. This subproduct, although of commercial interest when in its pure state, is generally incinerated due to the high costs of recovery treatment and purification. The objective of this study is to present an alternative to the treatment of industrial residuals containing DNCB. The technique consists of converting DNCB into sodium dinitrophenolate, which is very soluble in water and is also easy to reuse. For this purpose, liquid-liquid extraction with chemical reaction (alkaline hydrolysis with a rotating disc contactor (RDC is used. Experimental data on MCB nitration reactions as well as alkaline hydrolysis using a rotating disc contactor are presented.

  16. Two Experiments to Approach the Boltzmann Factor: Chemical Reaction and Viscous Flow

    Science.gov (United States)

    Fazio, Claudio; Battaglia, Onofrio R.; Guastella, Ivan

    2012-01-01

    In this paper we discuss a pedagogical approach aimed at pointing out the role played by the Boltzmann factor in describing phenomena usually perceived as regulated by different mechanisms of functioning. Experimental results regarding some aspects of a chemical reaction and of the viscous flow of some liquids are analysed and described in terms…

  17. Using Drawing Technology to Assess Students' Visualizations of Chemical Reaction Processes

    Science.gov (United States)

    Chang, Hsin-Yi; Quintana, Chris; Krajcik, Joseph

    2014-01-01

    In this study, we investigated how students used a drawing tool to visualize their ideas of chemical reaction processes. We interviewed 30 students using thinking-aloud and retrospective methods and provided them with a drawing tool. We identified four types of connections the students made as they used the tool: drawing on existing knowledge,…

  18. The study of thermodynamic properties and transport properties of multicomponent systems with chemical reactions

    Directory of Open Access Journals (Sweden)

    Samujlov E.

    2013-04-01

    Full Text Available In case of system with chemical reaction the most important properties are heat conductivity and heat capacity. In this work we have considered the equation for estimate the component of these properties caused by chemical reaction and ionization processes. We have evaluated the contribution of this part in heat conductivity and heat capacity too. At the high temperatures contribution in heat conductivity from ionization begins to play an important role. We have created a model, which describe partial and full ionization of gases and gas mixtures. In addition, in this work we present the comparison of our result with experimental data and data from numerical simulation. We was used the data about transport properties of middle composition of Russian coals and the data of thermophysical properties of natural gas for comparison.

  19. Ultrasound-mediated drug delivery by gas bubbles generated from a chemical reaction.

    Science.gov (United States)

    Lee, Sungmun; Al-Kaabi, Leena; Mawart, Aurélie; Khandoker, Ahsan; Alsafar, Habiba; Jelinek, Herbert F; Khalaf, Kinda; Park, Ji-Ho; Kim, Yeu-Chun

    2018-02-01

    Highly echogenic and ultrasound-responsive microbubbles such as nitrogen and perfluorocarbons have been exploited as ultrasound-mediated drug carriers. Here, we propose an innovative method for drug delivery using microbubbles generated from a chemical reaction. In a novel drug delivery system, luminol encapsulated in folate-conjugated bovine serum albumin nanoparticles (Fol-BSAN) can generate nitrogen gas (N 2 ) by chemical reaction when it reacts with hydrogen peroxide (H 2 O 2 ), one of reactive oxygen species (ROS). ROS plays an important role in the initiation and progression of cancer and elevated ROS have been observed in cancer cells both in vitro and in vivo. High-intensity focussed ultrasound (HIFU) is used to burst the N 2 microbubbles, causing site-specific delivery of anticancer drugs such as methotrexate. In this research, the drug delivery system was optimised by using water-soluble luminol and Mobil Composition of Matter-41 (MCM-41), a mesoporous material, so that the delivery system was sensitive to micromolar concentrations of H 2 O 2 . HIFU increased the drug release from Fol-BSAN by 52.9 ± 2.9% in 10 minutes. The cytotoxicity of methotrexate was enhanced when methotrexate is delivered to MDA-MB-231, a metastatic human breast cancer cell line, using Fol-BSAN with HIFU. We anticipate numerous applications of chemically generated microbubbles for ultrasound-mediated drug delivery.

  20. Impact of chemical reaction in fully developed radiated mixed convective flow between two rotating disk

    Science.gov (United States)

    Hayat, T.; Khan, M. Waleed Ahmed; Khan, M. Ijaz; Waqas, M.; Alsaedi, A.

    2018-06-01

    Flow of magnetohydrodynamic (MHD) viscous fluid between two rotating disks is modeled. Angular velocities of two disks are different. Flow is investigated for nonlinear mixed convection. Heat transfer is analyzed for nonlinear thermal radiation and heat generation/absorption. Chemical reaction is also implemented. Convective conditions of heat and mass transfer are studied. Transformations used lead to reduction of PDEs into the ODEs. The impacts of important physical variables like Prandtl number, Reynold number, Hartman number, mixed convection parameter, chemical reaction and Schmidt number on velocities, temperature and concentration are elaborated. In addition velocity and temperature gradients are physically interpreted. Our obtained results indicate that radial, axial and tangential velocities decrease for higher estimation of Hartman number.

  1. Effect of temperature on a free energy and equilibrium constants during dry flue gas desulphurisation chemical reactions

    Directory of Open Access Journals (Sweden)

    Kuburović Miloš

    2002-01-01

    Full Text Available During dry flue gas desulphurisation (FGD dry particles of reagents are inserted (injected in the stream of flue gas, where they bond SO2. As reagents, the most often are used compounds of calcium (CaCO3, CaO or Ca(OH2. Knowledge of free energy and equilibrium constants of chemical reactions during dry FGD is necessary for understanding of influence of flue gas temperature to course of these chemical reactions as well as to SO2 bonding from flue gases.

  2. Fast chemical reaction in two-dimensional Navier-Stokes flow: initial regime.

    Science.gov (United States)

    Ait-Chaalal, Farid; Bourqui, Michel S; Bartello, Peter

    2012-04-01

    This paper studies an infinitely fast bimolecular chemical reaction in a two-dimensional biperiodic Navier-Stokes flow. The reactants in stoichiometric quantities are initially segregated by infinite gradients. The focus is placed on the initial stage of the reaction characterized by a well-defined one-dimensional material contact line between the reactants. Particular attention is given to the effect of the diffusion κ of the reactants. This study is an idealized framework for isentropic mixing in the lower stratosphere and is motivated by the need to better understand the effect of resolution on stratospheric chemistry in climate-chemistry models. Adopting a Lagrangian straining theory approach, we relate theoretically the ensemble mean of the length of the contact line, of the gradients along it, and of the modulus of the time derivative of the space-average reactant concentrations (here called the chemical speed) to the joint probability density function of the finite-time Lyapunov exponent λ with two times τ and τ[over ̃]. The time 1/λ measures the stretching time scale of a Lagrangian parcel on a chaotic orbit up to a finite time t, while τ measures it in the recent past before t, and τ[over ̃] in the early part of the trajectory. We show that the chemical speed scales like κ(1/2) and that its time evolution is determined by rare large events in the finite-time Lyapunov exponent distribution. The case of smooth initial gradients is also discussed. The theoretical results are tested with an ensemble of direct numerical simulations (DNSs) using a pseudospectral model.

  3. Coal and biomass-based chemicals via carbonylation, hydroformylation and homologation reactions

    Energy Technology Data Exchange (ETDEWEB)

    Sunavala, P.D.; Raghunath, B.

    The paper emphasizes the importance of carbonylation, hydroformylation and homologation reactions in the manufacture of organic chemicals (such as acetic acid, acetic anhydride, cellulose acetate, vinyl acetate monomer, aliphatic amines, isocyanates, methanol, ethanol, n-butanol, ethylene glycol, acrylic acid, etc.) from coal and biomass feedstocks. Topics covered are: synthesis of acetic acid; manufacture of acetic anhydride; synthesis of vinyl acetate monomer by carbonylation; synthesis of aliphatic amines by hydroformylation; synthesis of organic diisocyanates; ethanol synthesis by homologation of methanol; synthesis of ethylene glycol via hydroformylation of formaldehyde; synthesis of n- butanol and n-butyraldehyde by propylene formylation; synthesis of acrylic acid; homologation reaction of carboxylic acid esters with ruthenium catalysts; and synthesis of phenyl isocyanate from nitrobenzene by reductive carbonylation. 26 refs.

  4. Determination of the energetics of the UDP-glucose pyrophosphorylase reaction by positional isotope exchange inhibition

    International Nuclear Information System (INIS)

    Hester, L.S.; Raushel, F.M.

    1987-01-01

    A method has been developed for obtaining qualitative information about enzyme-catalyzed reactions by measuring the inhibitory effects of added substrates on positional isotope exchange rates. It has been demonstrated for ordered kinetic mechanisms that an increase in the concentration of the second substrate to add to the enzyme will result in a linear increase in the ratio of the chemical and positional isotope exchange rates. The slopes and intercepts from these plots can be used to determine the partitioning ratios of binary and ternary enzyme complexes. The method has been applied to the reaction catalyzed by UDP-glucose pyrophosphorylase. A positional isotope exchange reaction was measured within oxygen-18-labeled UTP as a function of variable glucose 1-phosphate concentration in the forward reaction. In the reverse reaction, a positional isotope exchange reaction was measured within oxygen-18-labeled UDP-glucose as a function of increasing pyrophosphate concentration. The results have been interpreted to indicate that the interconversion of the ternary central complexes is fast relative to product dissociation in either direction. In the forward direction, the release of UDP-glucose is slower than the release of pyrophosphate. The release of glucose 1-phosphate is slower than the release of UTP in the reverse reaction

  5. Real-time studies of chemical reactions in lab-on-a-chip devices

    NARCIS (Netherlands)

    Brivio, M.

    2005-01-01

    The realization of a lab-on-a-chip system in which chemical reactions are carried out in a continuous flow mode and monitored on-line by a suitable analytical technique is the main topic of this thesis. Two types of a lab-on-a-chip were realized, both using mass spectrometry (MS) as the on-line

  6. Flows, scaling, and the control of moment hierarchies for stochastic chemical reaction networks

    Science.gov (United States)

    Smith, Eric; Krishnamurthy, Supriya

    2017-12-01

    Stochastic chemical reaction networks (CRNs) are complex systems that combine the features of concurrent transformation of multiple variables in each elementary reaction event and nonlinear relations between states and their rates of change. Most general results concerning CRNs are limited to restricted cases where a topological characteristic known as deficiency takes a value 0 or 1, implying uniqueness and positivity of steady states and surprising, low-information forms for their associated probability distributions. Here we derive equations of motion for fluctuation moments at all orders for stochastic CRNs at general deficiency. We show, for the standard base case of proportional sampling without replacement (which underlies the mass-action rate law), that the generator of the stochastic process acts on the hierarchy of factorial moments with a finite representation. Whereas simulation of high-order moments for many-particle systems is costly, this representation reduces the solution of moment hierarchies to a complexity comparable to solving a heat equation. At steady states, moment hierarchies for finite CRNs interpolate between low-order and high-order scaling regimes, which may be approximated separately by distributions similar to those for deficiency-zero networks and connected through matched asymptotic expansions. In CRNs with multiple stable or metastable steady states, boundedness of high-order moments provides the starting condition for recursive solution downward to low-order moments, reversing the order usually used to solve moment hierarchies. A basis for a subset of network flows defined by having the same mean-regressing property as the flows in deficiency-zero networks gives the leading contribution to low-order moments in CRNs at general deficiency, in a 1 /n expansion in large particle numbers. Our results give a physical picture of the different informational roles of mean-regressing and non-mean-regressing flows and clarify the dynamical

  7. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  8. Controlling Chemical Reactions in Confined Environments: Water Dissociation in MOF-74

    Directory of Open Access Journals (Sweden)

    Erika M. A. Fuentes-Fernandez

    2018-02-01

    Full Text Available The confined porous environment of metal organic frameworks (MOFs is an attractive system for studying reaction mechanisms. Compared to flat oxide surfaces, MOFs have the key advantage that they exhibit a well-defined structure and present significantly fewer challenges in experimental characterization. As an example of an important reaction, we study here the dissociation of water—which plays a critical role in biology, chemistry, and materials science—in MOFs and show how the knowledge of the structure in this confined environment allows for an unprecedented level of understanding and control. In particular, combining in-situ infrared spectroscopy and first-principles calculations, we show that the water dissociation reaction can be selectively controlled inside Zn-MOF-74 by alcohol, through both chemical and physical interactions. Methanol is observed to speed up water dissociation by 25% to 100%, depending on the alcohol partial pressure. On the other hand, co-adsorption of isopropanol reduces the speed of the water reaction, due mostly to steric interactions. In addition, we also investigate the stability of the product state after the water dissociation has occurred and find that the presence of additional water significantly stabilizes the dissociated state. Our results show that precise control of reactions within nano-porous materials is possible, opening the way for advances in fields ranging from catalysis to electrochemistry and sensors.

  9. A computational approach to extinction events in chemical reaction networks with discrete state spaces.

    Science.gov (United States)

    Johnston, Matthew D

    2017-12-01

    Recent work of Johnston et al. has produced sufficient conditions on the structure of a chemical reaction network which guarantee that the corresponding discrete state space system exhibits an extinction event. The conditions consist of a series of systems of equalities and inequalities on the edges of a modified reaction network called a domination-expanded reaction network. In this paper, we present a computational implementation of these conditions written in Python and apply the program on examples drawn from the biochemical literature. We also run the program on 458 models from the European Bioinformatics Institute's BioModels Database and report our results. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Dynamic Modeling of Reversible Methanolysis of Jatropha curcas Oil to Biodiesel

    Science.gov (United States)

    Syam, Azhari M.; Hamid, Hamidah A.; Yunus, Robiah; Rashid, Umer

    2013-01-01

    Many kinetics studies on methanolysis assumed the reactions to be irreversible. The aim of the present work was to study the dynamic modeling of reversible methanolysis of Jatropha curcas oil (JCO) to biodiesel. The experimental data were collected under the optimal reaction conditions: molar ratio of methanol to JCO at 6 : 1, reaction temperature of 60°C, 60 min of reaction time, and 1% w/w of catalyst concentration. The dynamic modeling involved the derivation of differential equations for rates of three stepwise reactions. The simulation study was then performed on the resulting equations using MATLAB. The newly developed reversible models were fitted with various rate constants and compared with the experimental data for fitting purposes. In addition, analysis of variance was done statistically to evaluate the adequacy and quality of model parameters. The kinetics study revealed that the reverse reactions were significantly slower than forward reactions. The activation energies ranged from 6.5 to 44.4 KJ mol−1. PMID:24363616

  11. Thermodynamic reversibility and irreversibility of the reverse transformation in stabilized Cu-Zn-Al martensite

    International Nuclear Information System (INIS)

    Kustov, S.; Corro, M.; Pons, J.; Cesari, E.; Van Humbeeck, J.

    2006-01-01

    It has been shown that both pinning- (mechanical) and reordering-induced (chemical) stabilization components contribute to the overall stabilization effect. An algorithm has been developed for quantitative analysis of the chemical and mechanical stabilization components, using routine calorimetry results. The basic idea underlying this algorithm is that chemical and mechanical stabilization components stem, respectively, from the factors, affecting thermodynamically reversible and irreversible factors during the first reverse transformation of the stabilized martensite. On a thermodynamical level, application of the suggested algorithm has been illustrated using experimental calorimetry results for a Cu-Zn-Al alloy. Here we report analysis of pinning and reordering processes on a microscopic scale, using experimental data on non-linear anelasticity in the same Cu-Zn-Al alloy to track different spatial and temporal localization of these processes during martensite ageing

  12. Modeling heat dissipation at the nanoscale: an embedding approach for chemical reaction dynamics on metal surfaces.

    Science.gov (United States)

    Meyer, Jörg; Reuter, Karsten

    2014-04-25

    We present an embedding technique for metallic systems that makes it possible to model energy dissipation into substrate phonons during surface chemical reactions from first principles. The separation of chemical and elastic contributions to the interaction potential provides a quantitative description of both electronic and phononic band structure. Application to the dissociation of O2 at Pd(100) predicts translationally "hot" oxygen adsorbates as a consequence of the released adsorption energy (ca. 2.6 eV). This finding questions the instant thermalization of reaction enthalpies generally assumed in models of heterogeneous catalysis. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Aggregation-induced chemical reactions: acid dissociation in growing water clusters.

    Science.gov (United States)

    Forbert, Harald; Masia, Marco; Kaczmarek-Kedziera, Anna; Nair, Nisanth N; Marx, Dominik

    2011-03-23

    Understanding chemical reactivity at ultracold conditions, thus enabling molecular syntheses via interstellar and atmospheric processes, is a key issue in cryochemistry. In particular, acid dissociation and proton transfer reactions are ubiquitous in aqueous microsolvation environments. Here, the full dissociation of a HCl molecule upon stepwise solvation by a small number of water molecules at low temperatures, as relevant to helium nanodroplet isolation (HENDI) spectroscopy, is analyzed in mechanistic detail. It is found that upon successive aggregation of HCl with H(2)O molecules, a series of cyclic heteromolecular structures, up to and including HCl(H(2)O)(3), are initially obtained before a precursor state for dissociation, HCl(H(2)O)(3)···H(2)O, is observed upon addition of a fourth water molecule. The latter partially aggregated structure can be viewed as an "activated species", which readily leads to dissociation of HCl and to the formation of a solvent-shared ion pair, H(3)O(+)(H(2)O)(3)Cl(-). Overall, the process is mostly downhill in potential energy, and, in addition, small remaining barriers are overcome by using kinetic energy released as a result of forming hydrogen bonds due to aggregation. The associated barrier is not ruled by thermal equilibrium but is generated by athermal non-equilibrium dynamics. These "aggregation-induced chemical reactions" are expected to be of broad relevance to chemistry at ultralow temperature much beyond HENDI spectroscopy.

  14. Artificial Self-Sufficient P450 in Reversed Micelles

    Directory of Open Access Journals (Sweden)

    Teruyuki Nagamune

    2010-04-01

    Full Text Available Cytochrome P450s are heme-containing monooxygenases that require electron transfer proteins for their catalytic activities. They prefer hydrophobic compounds as substrates and it is, therefore, desirable to perform their reactions in non-aqueous media. Reversed micelles can stably encapsulate proteins in nano-scaled water pools in organic solvents. However, in the reversed micellar system, when multiple proteins are involved in a reaction they can be separated into different micelles and it is then difficult to transfer electrons between proteins. We show here that an artificial self-sufficient cytochrome P450, which is an enzymatically crosslinked fusion protein composed of P450 and electron transfer proteins, showed micelle-size dependent catalytic activity in a reversed micellar system. Furthermore, the presence of thermostable alcohol dehydrogenase promoted the P450-catalyzed reaction due to cofactor regeneration.

  15. Enzymes as modular catalysts for redox half-reactions in H2-powered chemical synthesis: from biology to technology.

    Science.gov (United States)

    Reeve, Holly A; Ash, Philip A; Park, HyunSeo; Huang, Ailun; Posidias, Michalis; Tomlinson, Chloe; Lenz, Oliver; Vincent, Kylie A

    2017-01-15

    The present study considers the ways in which redox enzyme modules are coupled in living cells for linking reductive and oxidative half-reactions, and then reviews examples in which this concept can be exploited technologically in applications of coupled enzyme pairs. We discuss many examples in which enzymes are interfaced with electronically conductive particles to build up heterogeneous catalytic systems in an approach which could be termed synthetic biochemistry We focus on reactions involving the H + /H 2 redox couple catalysed by NiFe hydrogenase moieties in conjunction with other biocatalysed reactions to assemble systems directed towards synthesis of specialised chemicals, chemical building blocks or bio-derived fuel molecules. We review our work in which this approach is applied in designing enzyme-modified particles for H 2 -driven recycling of the nicotinamide cofactor NADH to provide a clean cofactor source for applications of NADH-dependent enzymes in chemical synthesis, presenting a combination of published and new work on these systems. We also consider related photobiocatalytic approaches for light-driven production of chemicals or H 2 as a fuel. We emphasise the techniques available for understanding detailed catalytic properties of the enzymes responsible for individual redox half-reactions, and the importance of a fundamental understanding of the enzyme characteristics in enabling effective applications of redox biocatalysis. © 2017 The Author(s).

  16. Grain rotation and lattice deformation during photoinduced chemical reactions revealed by in situ X-ray nanodiffraction.

    Science.gov (United States)

    Huang, Zhifeng; Bartels, Matthias; Xu, Rui; Osterhoff, Markus; Kalbfleisch, Sebastian; Sprung, Michael; Suzuki, Akihiro; Takahashi, Yukio; Blanton, Thomas N; Salditt, Tim; Miao, Jianwei

    2015-07-01

    In situ X-ray diffraction (XRD) and transmission electron microscopy (TEM) have been used to investigate many physical science phenomena, ranging from phase transitions, chemical reactions and crystal growth to grain boundary dynamics. A major limitation of in situ XRD and TEM is a compromise that has to be made between spatial and temporal resolution. Here, we report the development of in situ X-ray nanodiffraction to measure high-resolution diffraction patterns from single grains with up to 5 ms temporal resolution. We observed, for the first time, grain rotation and lattice deformation in chemical reactions induced by X-ray photons: Br(-) + hv → Br + e(-) and e(-) + Ag(+) → Ag(0). The grain rotation and lattice deformation associated with the chemical reactions were quantified to be as fast as 3.25 rad s(-1) and as large as 0.5 Å, respectively. The ability to measure high-resolution diffraction patterns from individual grains with a temporal resolution of several milliseconds is expected to find broad applications in materials science, physics, chemistry and nanoscience.

  17. Computational organic chemistry: bridging theory and experiment in establishing the mechanisms of chemical reactions.

    Science.gov (United States)

    Cheng, Gui-Juan; Zhang, Xinhao; Chung, Lung Wa; Xu, Liping; Wu, Yun-Dong

    2015-02-11

    Understanding the mechanisms of chemical reactions, especially catalysis, has been an important and active area of computational organic chemistry, and close collaborations between experimentalists and theorists represent a growing trend. This Perspective provides examples of such productive collaborations. The understanding of various reaction mechanisms and the insight gained from these studies are emphasized. The applications of various experimental techniques in elucidation of reaction details as well as the development of various computational techniques to meet the demand of emerging synthetic methods, e.g., C-H activation, organocatalysis, and single electron transfer, are presented along with some conventional developments of mechanistic aspects. Examples of applications are selected to demonstrate the advantages and limitations of these techniques. Some challenges in the mechanistic studies and predictions of reactions are also analyzed.

  18. Methyl salicylate: a reactive chemical warfare agent surrogate to detect reaction with hypochlorite.

    Science.gov (United States)

    Salter, W Bruce; Owens, Jeffery R; Wander, Joseph D

    2011-11-01

    Methyl salicylate (MeS) has a rich history as an inert physical simulant for the chemical warfare agents sulfur mustard and soman, where it is used extensively for liquid- and vapor-permeation testing. Here we demonstrate possible utility of MeS as a reactivity simulant for chlorine-based decontaminants. In these experiments MeS was reacted with sodium hypochlorite varying stoichiometry, temperature, reaction time, and pH. No colored oxidation products were observed; however, chlorination of the aromatic ring occurred ortho (methyl 3-chlorosalicylate) and para (methyl 5-chlorosalicylate) to the position bearing the -OH group in both the mono- and disubstituted forms. The monosubstituted para product accumulated initially, and the ortho and 3,5-dichloro products formed over the next several hours. Yields from reactions conducted below pH 11 declined rapidly with decreasing pH. Reactions run at 40 °C produced predominantly para substitution, while those run at 0 °C produced lower yields of ortho- and para-substituted products. Reactions were also carried out on textile substrates of cotton, 50/50 nylon-cotton, and a meta aramid. The textile data broadly reproduced reaction times and stoichiometry observed in the liquid phase, but are complicated by physical and possibly chemical interactions with the fabric. These data indicate that, for hypochlorite-containing neutralizing agents operating at strongly alkaline pH, one can expect MeS to react stoichiometrically with the hypochlorite it encounters. This suggests utility of MeS in lieu of such highly hazardous surrogates as monochloroalkyl sulfides as a simulant for threat scenarios involving the stoichiometric decomposition of sulfur mustard. Specifically, the extent of coverage of the simulant on a fabric by the neutralizing agent can be directly measured. Similar reactivity toward other halogen oxidizing agents is likely but remains to be demonstrated.

  19. A proposal for study of ion-beam induced chemical reactions using JAERI tandem accelerator

    International Nuclear Information System (INIS)

    1985-11-01

    Problems in ion-beam induced chemical reactions using JAERI Tandem Accelerator were discussed. Research philosophy, some proposed experiments which are based on measurements during ion-beam bombardment, and main features of the experimental apparatus are briefly described in this report. (author)

  20. Chemical reactions of fission products with ethylene using the gas jet technique

    International Nuclear Information System (INIS)

    Contis, E.T.; Rengan, Krish; Griffin, Henry C.

    1994-01-01

    An understanding of the nature of the chemical reactions taking place between fission products and their carrier gases, and the designing of a fast separation procedure were the purposes of this investigation. Chemical reactions of short-lived (less than one minute half-life) fission products with carrier gases lead to various chemical species which can be separated in the gas phase. The Gas Jet Facility at the Ford Nuclear Reactor was used to study the yields of volatile selenium and bromine fission products of 235 U using a semi-automatic batch solvent extraction technique. Heptane and water were used as organic and inorganic solvents. A carrier gas mixture of ethylene to pre-purified nitrogen (1 : 3) was used to sweep the fission products from the target to the chemistry area for analysis. The results indicated that the volatile selenium products generated by the interaction of selenium fission fragments with ethylene were predominantly organic in nature (84%), possibly organoselenides. The selenium values were used to resolve the fractions of the bromine nuclides, which come from two major sources, viz., directly from fission and from the beta-decay of selenium. The data showed that the fractions of independent bromine fission products in the organic phase were much lower compared to selenium; the bromine values range from 10 to 22% and varied with mass number. Results indicated that the bromine products were inorganic in nature, as possibly hydrogen chloride. ((orig.))