WorldWideScience

Sample records for reversible addition-fragmentation chain

  1. Olefin copolymerization via reversible addition-fragmentation chain transfer

    NARCIS (Netherlands)

    Venkatesh, R.; Staal, B.B.P.; Klumperman, B.

    2004-01-01

    Successful statistical copolymn. of an a-olefin (1-octene) with an acrylate (Bu acrylate, BA) and with a methacrylate (Me methacrylate, MMA), employing reversible addn.-fragmentation chain transfer (RAFT) mediated polymn. has been accomplished

  2. Preparation of nanocomposites by reversible addition-fragmentation chain transfer polymerization from the surface of quantum dots in miniemulsion

    NARCIS (Netherlands)

    Carvalho Esteves, de A.C.; Hodge, P.; Trindade, T.; Barros-Timmons, A.M.M.V.

    2009-01-01

    Herein, we report the synthesis of quantum dots (QDs)/polymer nanocomposites by reversible addition-fragmentation chain transfer (RAFT) polymerization in miniemulsions using a grafting from approach. First, the surfaces of CdS and CdSe QDs were functionalized using a chain transfer agent, a

  3. Reversible addition-fragmentation chain transfer polymerization of 2-chloro-1,3-butadiene

    OpenAIRE

    Pullan, Nikki; Liu, Max; Topham, Paul D.

    2013-01-01

    Controlled polymerization of 2-chloro-1,3-butadiene using reversible addition–fragmentation chain transfer (RAFT) polymerization has been demonstrated for the first time. 2-Chloro-1,3-butadiene, more commonly known as chloroprene, has significant industrial relevance as a crosslinked rubber, with uses ranging from adhesives to integral automotive components. However, problems surrounding the inherent toxicity of the lifecycle of the thiourea-vulcanized rubber have led to the need for control ...

  4. Carprofen-imprinted monolith prepared by reversible addition-fragmentation chain transfer polymerization in room temperature ionic liquids.

    Science.gov (United States)

    Ban, Lu; Han, Xu; Wang, Xian-Hua; Huang, Yan-Ping; Liu, Zhao-Sheng

    2013-10-01

    To obtain fast separation, ionic liquids were used as porogens first in combination with reversible addition-fragmentation chain transfer (RAFT) polymerization to prepare a new type of molecularly imprinted polymer (MIP) monolith. The imprinted monolithic column was synthesized using a mixture of carprofen (template), 4-vinylpyridine, ethylene glycol dimethacrylate, [BMIM]BF4, and chain transfer agent (CTA). Some polymerization factors, such as template-monomer molar ratio, the degree of crosslinking, the composition of the porogen, and the content of CTA, on the column efficiency and imprinting effect of the resulting MIP monolith were systematically investigated. Affinity screening of structurally similar compounds with the template can be achieved in 200 s on the MIP monolith due to high column efficiency (up to 12,070 plates/m) and good column permeability. Recognition mechanism of the imprinted monolith was also investigated.

  5. Functionalization of vertically aligned carbon nanotubes with polystyrene via surface initiated reversible addition fragmentation chain transfer polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G. [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia)

    2012-01-15

    Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated 'grafting-from' process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.

  6. Functionalization of vertically aligned carbon nanotubes with polystyrene via surface initiated reversible addition fragmentation chain transfer polymerization

    International Nuclear Information System (INIS)

    Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G.; Ellis, Amanda V.

    2012-01-01

    Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated “grafting-from” process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.

  7. Early career: Templating of liquid crystal microstructures by reversible addition-fragmentation chain transfer polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Heinen, Jennifer M. (O' Donnell) [Iowa State Univ., Ames, IA (United States)

    2014-12-31

    This research has shown that the microstructure of self-assembled copolymers can be decoupled from the polymer chemistry. The simplest polymer architecture, linear block copolymers, is valuable for a broad range of applications, including adhesives and coatings, medical devices, electronics and energy storage, because these block copolymers reproducibly self-assemble into microphase separated nanoscale domains. Unfortunately, the self-assembled microstructure is tuned by polymer composition, thus limiting the potential to simultaneously optimize chemical, mechanical, and transport properties for desired applications. To this end, much work was been put into manipulating block copolymer self-assembly independently of polymer composition. These efforts have included the use of additives or solvents to alter polymer chain conformation, the addition of a third monomer to produce ABC triblock terpolymers, architectures with mixed blocks, such as tapered/gradient polymers, and the synthesis of other nonlinear molecular architectures. This work has shown that the microstructures formed by linear ABC terpolymers can be altered by controlling the architecture of the polymer molecules at a constant monomer composition, so that the microstructure is tuned independently from the chemical properties.

  8. A guide to the synthesis of block copolymers using reversible-addition fragmentation chain transfer (RAFT) polymerization.

    Science.gov (United States)

    Keddie, Daniel J

    2014-01-21

    The discovery of reversible-deactivation radical polymerization (RDRP) has provided an avenue for the synthesis of a vast array of polymers with a rich variety of functionality and architecture. The preparation of block copolymers has received significant focus in this burgeoning research field, due to their diverse properties and potential in a wide range of research environments. This tutorial review will address the important concepts behind the design and synthesis of block copolymers using reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerization is arguably the most versatile of the RDRP methods due to its compatibility with a wide range of functional monomers and reaction media along with its relative ease of use. With an ever increasing array of researchers that possess a variety of backgrounds now turning to RDRP, and RAFT in particular, to prepare their required polymeric materials, it is pertinent to discuss the important points which enable the preparation of high purity functional block copolymers with targeted molar mass and narrow molar mass distribution using RAFT polymerization. The key principles of appropriate RAFT agent selection, the order of monomer addition in block synthesis and potential issues with maintaining high end-group fidelity are addressed. Additionally, techniques which allow block copolymers to be accessed using a combination of RAFT polymerization and complementary techniques are touched upon.

  9. Self-assembly of block copolymer micelles: synthesis via reversible addition-fragmentation chain transfer polymerization and aqueous solution properties.

    Science.gov (United States)

    Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin

    2010-07-22

    Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.

  10. Scale-up of the Reversible Addition-Fragmentation Chain Transfer (RAFT Polymerization Using Continuous Flow Processing

    Directory of Open Access Journals (Sweden)

    Nenad Micic

    2014-01-01

    Full Text Available A controlled radical polymerization process using the Reversible Addition-Fragmentation Chain Transfer (RAFT approach was scaled up by a factor of 100 from a small laboratory scale of 5 mL to a preparative scale of 500 mL, using batch and continuous flow processing. The batch polymerizations were carried out in a series of different glass vessels, using either magnetic or overhead stirring, and different modes of heating: Microwave irradiation or conductive heating in an oil bath. The continuous process was conducted in a prototype tubular flow reactor, consisting of 6 mm ID stainless steel tubing, fitted with static mixers. Both reactor types were tested for polymerizations of the acid functional monomers acrylic acid and 2-acrylamido-2-methylpropane-1-sulfonic acid in water at 80 °C with reaction times of 30 to 40 min. By monitoring the temperature during the exothermic polymerization process, it was observed that the type and size of reactor had a significant influence on the temperature profile of the reaction.

  11. Synthesis of butyl acrylate-styrene block copolymers in emulsion by reversible addition-fragmentation chain transfer : effect of surfactant migration upon film formation

    NARCIS (Netherlands)

    Monteiro, M.J.; Sjöberg, M.; Göttgens, C.M.; Vlist, van der J.

    2000-01-01

    The synthesis of block copolymers in an environmentally friendly medium was carried out in emulsion polymerizations through the reversible addition-fragmentation chain transfer process, using a transfer active xanthate (MADIX) agent, under batch and starved-feed conditions. First, ab initio

  12. Grafting of Polystyrene Chains at the Edge of Graphene Nanolayers by "Grafting Through" Approach Using Reversible Addition-Fragmentation Chain Transfer Polymerization

    Directory of Open Access Journals (Sweden)

    Hossein Roghani-Mamaqani

    2017-09-01

    Full Text Available Edge-functionalized graphene nanolayers with polystyrene chains were prepared by a “grafting through” reversible addition-fragmentation chain transfer (RAFT polymerization. For this purpose, double-bond containing modifier (MD was prepared. After edge-functionalization of graphene oxide (GO by two different amounts of MD and preparation of modified graphenes (LFG and HFG, RAFT polymerization of styrene was applied for preparation of functionalized GO with different densities of polystyrene chains. Fourier transform infrared spectroscopy showed that MD and polystyrene chains were grafted at the edge of GO. Gas chromatography showed that conversion decreased by the addition of modified GO content and also grafting density of MD. Number-average molecular weight and polydispersity index of polystyrene chains were derived from gel permeation chromatography. Increase of modified graphene content results in a decrease in molecular weight of attached polystyrene chains and also an increase in their PDI value. Increase of grafting density of MD results in decrease of molecular weight of polystyrene chains with no considerable variation in PDI value. Thermogravimetric analysis results showed that char residue is about 45.1 and 46.8% for LFG and HFG, respectively. The content of degradation ascribed to polystyrene increased with increase of grafting density of MD and decreased with increase of modified graphene content. X-ray diffraction results were used for evaluation of interlayer spacing of graphene layers after functionalization process and also study of nanocomposites structure. The results of scanning electron microscopy and transmission electron microscopy show that graphene layers with high clarity turned to opaque layers with lots of creases by oxidation and attachment of polystyrene chains.

  13. Highly efficient reversible addition-fragmentation chain-transfer polymerization in ethanol/water via flow chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Ye, Piaoran [Case Western Reserve Univ., Cleveland, OH (United States); Cao, Peng -Fei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Su, Zhe [Case Western Reserve Univ., Cleveland, OH (United States); Advincula, Rigoberto [Case Western Reserve Univ., Cleveland, OH (United States)

    2017-03-23

    Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR), and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L–1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.

  14. Synthesis of Thermally Switchable Chromatographic Materials with Immobilized Ti4+ for Enrichment of Phosphopeptides by Reversible Addition Fragmentation Chain Transfer Polymerization

    Science.gov (United States)

    Wang, Di; Cao, Zhihan; Pang, Xinzhu; Deng, Yulin; Li, Bo; Dai, Rongji

    2018-01-01

    Reversible phosphorylation of proteins is one of the most crucial types of post-translational modifications (PTMs). And it shows significant work in diversified biological processes. However, the separation technology of phosphorylated peptides is still an analytical challenge in phosphoproteomics, because phosphopeptides are alway in low stoichiometry. Thus, enrichment of phosphopeptides before detection is indispensable. In this study, a novel temperature regulated separation protocol was developed. Silica@p (NIPAAm-co-IPPA)-Ti4+, a new Ti(IV)-IMAC (Immobilized Metal Affinity chromatography) materials was synthesized by reversible addition fragmentation chain transfer polymerization (RAFT). By the unique thermally responsive properties of poly(N-isopropylacrylamide) (PNIPAAm), the captured phosphorylated peptides could be released by changing temperature only without applying any other eluant which could damage the phosphopeptides. We employed isopropanol phosphonic acid (IPPA) as an IMAC ligand for the immobilization of Ti(IV) which could increase the specific adsorption of phosphopeptides. The enrichment and release properties were examined by treatment with pyridoxal 5’-phosphate (PLP) and casein phosphopeptides (CPP). Two phosphorylated compounds above have temperature-stimulated binding to Ti4+. Finally, silica@p (NIPAAm-co-IPPA)-Ti4+ was successfully employed in pretreatment of phosphopeptides in a tryptic digest of a-casein and human serum albumin (HSA). The results indicated a great potential of this new temperature-responsive material in phosphoproteomics study.

  15. Thermally conductive, electrically insulating and melt-processable polystyrene/boron nitride nanocomposites prepared by in situ reversible addition fragmentation chain transfer polymerization

    International Nuclear Information System (INIS)

    Huang, Xingyi; Wang, Shen; Zhu, Ming; Yang, Ke; Jiang, Pingkai; Bando, Yoshio; Golberg, Dmitri; Zhi, Chunyi

    2015-01-01

    Thermally conductive and electrically insulating polymer/boron nitride (BN) nanocomposites are highly attractive for various applications in many thermal management fields. However, so far most of the preparation methods for polymer/BN nanocomposites have usually caused difficulties in the material post processing. Here, an in situ grafting approach is designed to fabricate thermally conductive, electrically insulating and post-melt processable polystyrene (PS)/BN nanosphere (BNNS) nanocomposites by initiating styrene (St) on the surface functionalized BNNSs via reversible addition fragmentation chain transfer polymerization. The nanocomposites exhibit significantly enhanced thermal conductivity. For example, at a St/BN feeding ratio of 5:1, an enhancement ratio of 1375% is achieved in comparison with pure PS. Moreover, the dielectric properties of the nanocomposites show a desirable weak dependence on frequency, and the dielectric loss tangent of the nanocomposites remains at a very low level. More importantly, the nanocomposites can be subjected to multiple melt processing to form different shapes. Our method can become a universal approach to prepare thermally conductive, electrically insulating and melt-processable polymer nanocomposites with diverse monomers and nanofillers. (paper)

  16. Non-surface activity and micellization behavior of cationic amphiphilic block copolymer synthesized by reversible addition-fragmentation chain transfer process.

    Science.gov (United States)

    Ghosh, Arjun; Yusa, Shin-ichi; Matsuoka, Hideki; Saruwatari, Yoshiyuki

    2011-08-02

    Cationic amphiphilic diblock copolymers of poly(n-butylacrylate)-b-poly(3-(methacryloylamino)propyl)trimethylammonium chloride) (PBA-b-PMAPTAC) with various hydrophobic and hydrophilic chain lengths were synthesized by a reversible addition-fragmentation chain transfer (RAFT) process. Their molecular characteristics such as surface activity/nonactivity were investigated by surface tension measurements and foam formation observation. Their micelle formation behavior and micelle structure were investigated by fluorescence probe technique, static and dynamic light scattering (SLS and DLS), etc., as a function of hydrophilic and hydrophobic chain lengths. The block copolymers were found to be non-surface active because the surface tension of the aqueous solutions did not change with increasing polymer concentration. Critical micelle concentration (cmc) of the polymers could be determined by fluorescence and SLS measurements, which means that these polymers form micelles in bulk solution, although they were non-surface active. Above the cmc, the large blue shift of the emission maximum of N-phenyl-1-naphthylamine (NPN) probe and the low micropolarity value of the pyrene probe in polymer solution indicate the core of the micelle is nonpolar in nature. Also, the high value of the relative intensity of the NPN probe and the fluorescence anisotropy of the 1,6-diphenyl-1,3,5-hexatriene (DPH) probe indicated that the core of the micelle is highly viscous in nature. DLS was used to measure the average hydrodynamic radii and size distribution of the copolymer micelles. The copolymer with the longest PBA block had the poorest water solubility and consequently formed micelles with larger size while having a lower cmc. The "non-surface activity" was confirmed for cationic amphiphilic diblock copolymers in addition to anionic ones studied previously, indicating the universality of non-surface activity nature.

  17. Controlled radical copolymerization of styrene and maleic anhydride and the synthesis of novel polyolefin-based block copolymers by reversible addition-fragmentation chain-transfer (RAFT) polymerization

    NARCIS (Netherlands)

    Brouwer, de J.A.M.; Schellekens, M.A.J.; Klumperman, B.; Monteiro, M.J.; German, A.L.

    2000-01-01

    Reversible addn.-fragmentation chain transfer (RAFT) was applied to the copolymn. of styrene and maleic anhydride. The product had a low polydispersity and a predetd. molar mass. Novel, well-defined polyolefin-based block copolymers were prepd. with a macromol. RAFT agent prepd. from a com.

  18. Surface molecular imprinting onto fluorescein-coated magnetic nanoparticlesvia reversible addition fragmentation chain transfer polymerization: A facile three-in-one system for recognition and separation of endocrine disrupting chemicals

    Science.gov (United States)

    Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin

    2011-01-01

    In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic

  19. Surface-Confined Aqueous Reversible Addition-Fragmentation Chain Transfer (SCARAFT) Polymerization Method for Preparation of Coated Capillary Leads to over 10 000 Peptides Identified from 25 ng HeLa Digest by Using Capillary Zone Electrophoresis-Tandem Mass Spectrometry.

    Science.gov (United States)

    Zhang, Zhenbin; Peuchen, Elizabeth H; Dovichi, Norman J

    2017-06-20

    A surface-confined aqueous reversible addition-fragmentation chain transfer (SCARAFT) polymerization method was developed to coat capillaries for use in capillary zone electrophoresis (CZE). SCARAFT polymerization primarily takes place on the inner surface of the capillary instead of in solution, which greatly improves the homogeneity of the coating. Capillaries treated with this coating produced an electroosmotic mobility of 2.8 ± 0.2 × 10 -6 cm 2 ·V -1 ·s -1 (N = 3), which is roughly an order of magnitude lower than that of commercial linear polyacrylamide (LPA)-coated capillaries. Coated capillaries were evaluated for bottom-up proteomic analysis using CZE. The very low electroosmotic mobility results in a 200 min separation and improved single-shot analysis. An average of 977 protein groups and 5605 unique peptides were identified from 50 ng of an E. coli digest, and 2158 protein groups and 10 005 peptides were identified from 25 ng of a HeLa digest using single-shot analysis with a SCARAFT-acrylamide capillary coupled to a Q Exactive HF mass spectrometer. The coating is stable. A single capillary was used for over 200 h (8.4 days) of continuous operation. RSD in migration time was between 2 and 3% for selected ion electropherograms (SIEs) generated for six ions; median theoretical plate counts ranged from 240 000 to 600 000 for these SIEs. Various types of coatings could be prepared by simply changing the functional vinyl monomers in the polymerization mixture. Positively charged coatings using direct attachment and formation of a block copolymer were prepared and demonstrated for the separation of mixtures of intact proteins.

  20. Biomedical applications of polymers derived by reversible addition - fragmentation chain-transfer (RAFT).

    Science.gov (United States)

    Fairbanks, Benjamin D; Gunatillake, Pathiraja A; Meagher, Laurence

    2015-08-30

    RAFT- mediated polymerization, providing control over polymer length and architecture as well as facilitating post polymerization modification of end groups, has been applied to virtually every facet of biomedical materials research. RAFT polymers have seen particularly extensive use in drug delivery research. Facile generation of functional and telechelic polymers permits straightforward conjugation to many therapeutic compounds while synthesis of amphiphilic block copolymers via RAFT allows for the generation of self-assembled structures capable of carrying therapeutic payloads. With the large and growing body of literature employing RAFT polymers as drug delivery aids and vehicles, concern over the potential toxicity of RAFT derived polymers has been raised. While literature exploring this complication is relatively limited, the emerging consensus may be summed up in three parts: toxicity of polymers generated with dithiobenzoate RAFT agents is observed at high concentrations but not with polymers generated with trithiocarbonate RAFT agents; even for polymers generated with dithiobenzoate RAFT agents, most reported applications call for concentrations well below the toxicity threshold; and RAFT end-groups may be easily removed via any of a variety of techniques that leave the polymer with no intrinsic toxicity attributable to the mechanism of polymerization. The low toxicity of RAFT-derived polymers and the ability to remove end groups via straightforward and scalable processes make RAFT technology a valuable tool for practically any application in which a polymer of defined molecular weight and architecture is desired. Copyright © 2015. Published by Elsevier B.V.

  1. The Effect of Allylic Sulfide-Mediated IrreversibleAddition-Fragment Chain Transfer on the EmulsionPolymerization Kinetics of Styrene

    Directory of Open Access Journals (Sweden)

    Li An

    2015-09-01

    Full Text Available The effect of the irreversible addition-fragment chain transfer agent, butyl(2-phenylallylsulfane (BPAS, on the course of the emulsion polymerization of styrene and on the product molecular weight was investigated. The emulsion polymerizations were performed using various amounts of sodium dodecyl sulfate (SDS as the surfactant and potassium peroxodisulfate (KPS as the initiator. The relationships between the rates of polymerization (\\(R_{p} \\ and the number of particles per volume (\\(N_{c} \\ with respect to the concentrations of KPS, SDS, and BPAS were found to be \\(R_{p} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.29} \\, \\(N_{c} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.26} \\,\\(R_{p} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.68} \\, \\(N_{c} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.72} \\, and \\(R_{p} \\propto \\left\\lbrack BPAS \\right\\rbrack^{- 0.73} \\ . The obtained relationships can be attributed to the exit of the leaving group radicals on BPAS from the polymer particles. The experimental values of the average number of radicals per particle (\\(\\overset{\\_}{n} \\ were strongly dependent on the BPAS concentration and were in good agreement with the theoretical values (\\({\\overset{\\_}{n}}_{theo} \\ from model calculations. The number-average molecular weight (\\(\\overset{\\_}{M_{n}} \\ can be controlled by BPAS over nearly the entire conversion range, which is also in agreement with the mathematical model. In addition, the transfer rate coefficient (\\(k_{tr} \\ of BPAS can be estimated as 326 L/mol/s at 70 \\(^\\circ\\C. Moreover, similar good results were found for the tested redox reactions at 30 \\(^\\circ\\C.

  2. Designing the Reverse Supply Chain

    DEFF Research Database (Denmark)

    Gobbi, Chiara

    2011-01-01

    Purpose – The purpose of this paper is to explore the impact of the product residual value (PRV) and the loss of value over time of returned products in the reverse supply chain configuration. It also examines whether or not the distinction of Fisher's functional and innovative products holds...... that allows for recapturing most of the PRV. These notions have then been tested by analyzing two reverse supply chains with a case study research methodology. Findings – The findings show that low PRV is associated with second-class recovery options (recycling and energy recovery) and that high PRV...... is associated with first-class recovery options (reconditioning and remarketing). When the recovery option is recycling, time is not relevant, the primary objective is cost reduction (efficiency), the chain is centralized, and actors and phases of the reverse chain are determined by the specificity...

  3. Evaluating Reverse Supply Chain Efficiency: Manufacturer's Perspective

    DEFF Research Database (Denmark)

    Kumar, M.; Tiwari, M. K.; Wong, K. Y.

    2014-01-01

    The paper aims to illustrate the use of fuzzy data envelopment analysis (DEA) in analyzing reverse supply chain (RSC) performance from the manufacturer's perspective. By using an alternative alpha-cut approach, the fuzzy DEA model was converted into a crisp linear programming problem, thereby...... usually ensures an environmentally friendly supply chain network, companies which have implemented RSC techniques since a longer duration do not necessarily have a more efficient supply chain in general....

  4. Bayesian analysis for reversible Markov chains

    NARCIS (Netherlands)

    Diaconis, P.; Rolles, S.W.W.

    2006-01-01

    We introduce a natural conjugate prior for the transition matrix of a reversible Markov chain. This allows estimation and testing. The prior arises from random walk with reinforcement in the same way the Dirichlet prior arises from Pólya’s urn. We give closed form normalizing constants, a simple

  5. An interlacing theorem for reversible Markov chains

    International Nuclear Information System (INIS)

    Grone, Robert; Salamon, Peter; Hoffmann, Karl Heinz

    2008-01-01

    Reversible Markov chains are an indispensable tool in the modeling of a vast class of physical, chemical, biological and statistical problems. Examples include the master equation descriptions of relaxing physical systems, stochastic optimization algorithms such as simulated annealing, chemical dynamics of protein folding and Markov chain Monte Carlo statistical estimation. Very often the large size of the state spaces requires the coarse graining or lumping of microstates into fewer mesoscopic states, and a question of utmost importance for the validity of the physical model is how the eigenvalues of the corresponding stochastic matrix change under this operation. In this paper we prove an interlacing theorem which gives explicit bounds on the eigenvalues of the lumped stochastic matrix. (fast track communication)

  6. An interlacing theorem for reversible Markov chains

    Energy Technology Data Exchange (ETDEWEB)

    Grone, Robert; Salamon, Peter [Department of Mathematics and Statistics, San Diego State University, San Diego, CA 92182-7720 (United States); Hoffmann, Karl Heinz [Institut fuer Physik, Technische Universitaet Chemnitz, D-09107 Chemnitz (Germany)

    2008-05-30

    Reversible Markov chains are an indispensable tool in the modeling of a vast class of physical, chemical, biological and statistical problems. Examples include the master equation descriptions of relaxing physical systems, stochastic optimization algorithms such as simulated annealing, chemical dynamics of protein folding and Markov chain Monte Carlo statistical estimation. Very often the large size of the state spaces requires the coarse graining or lumping of microstates into fewer mesoscopic states, and a question of utmost importance for the validity of the physical model is how the eigenvalues of the corresponding stochastic matrix change under this operation. In this paper we prove an interlacing theorem which gives explicit bounds on the eigenvalues of the lumped stochastic matrix. (fast track communication)

  7. How manufacturers can use their reverse supply chain: a typology of reverse supply chain roles

    DEFF Research Database (Denmark)

    Larsen, Samuel; Jacobsen, Peter

    2014-01-01

    While traditional forward supply chains end with customer markets, the reverse supply chain (RSC) both begins and ends with the firm’s markets. The study applies the prevalent conceptual RSC‐description in the theoretical field by Guide and Van Wassenhove (2009). In the description, the RSC begins...... is not explicitly part of the description, this study does include them as disposition strategies. Although some RSC topics have been fairly well‐addressed in extant literature (e.g. product acquisition, inventory models and product disassembly), the RSC‐topic remains under‐explored (Pohkarel and Mutha, 2009...... the reverse logistical processes required for supporting a liberal return policy, etc. Based on extant literature from the supply chain management and OM fields, this study develops a conceptual typology of what roles the RSC can play in the firm’s efforts of achieving higher overall economic profits. Each...

  8. Observation uncertainty in reversible Markov chains.

    Science.gov (United States)

    Metzner, Philipp; Weber, Marcus; Schütte, Christof

    2010-09-01

    In many applications one is interested in finding a simplified model which captures the essential dynamical behavior of a real life process. If the essential dynamics can be assumed to be (approximately) memoryless then a reasonable choice for a model is a Markov model whose parameters are estimated by means of Bayesian inference from an observed time series. We propose an efficient Monte Carlo Markov chain framework to assess the uncertainty of the Markov model and related observables. The derived Gibbs sampler allows for sampling distributions of transition matrices subject to reversibility and/or sparsity constraints. The performance of the suggested sampling scheme is demonstrated and discussed for a variety of model examples. The uncertainty analysis of functions of the Markov model under investigation is discussed in application to the identification of conformations of the trialanine molecule via Robust Perron Cluster Analysis (PCCA+) .

  9. Second-life retailing: a reverse supply chain perspective

    OpenAIRE

    Beh, LS; Ghobadian, A; He, Q; Gallear, D; O Regan, N

    2016-01-01

    The authors examine the role of entrepreneurial business models in the reverse supply chain of apparel/fashion retailers. The purpose of this paper is to offer an alternative approach to the “return to the point of origin” prevalent in the reverse chain of manufacturers but less technically and economically feasible in the case of apparel/fashion retailers. This approach, second-life retailing, not only reduces waste but also democratises consumption. Design/methodology/approach – The paper i...

  10. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  11. Reverse Logistics in Food Supply Chains

    NARCIS (Netherlands)

    Zeimpekis, V.; Bloemhof, J.M.; Bourlakis, M.

    2014-01-01

    Reverse logistics can be defined as the process of planning, implementing, and controlling the flow of raw materials, in-process inventory, and finished goods from the point of consumption to the point of origin for the purpose of recapturing value or proper disposal. In environmental and economic

  12. Reverse logistics and closed-loop supply chain

    DEFF Research Database (Denmark)

    Govindan, Kannan; Soleimani, Hamed; Kannan, Devika

    2015-01-01

    Based on environmental, legal, social, and economic factors, reverse logistics and closed-loop supply chain issues have attracted attention among both academia and practitioners. This attention is evident by the vast number of publications in scientific journals which have been published in recent...... years. Hence, a comprehensive literature review of recent and state-of-the-art papers is vital to draw a framework of the past, and to shed light on future directions. The aim of this paper is to review recently published papers in reverse logistic and closed-loop supply chain in scientific journals...

  13. The Reverse Supply Chain: Configuration, Integration and Profitability

    DEFF Research Database (Denmark)

    Gobbi, Chiara

    2008-01-01

    This thesis presents the results of a qualitative investigation that has been conducted in order to enhance knowledge of the reverse supply chain management field. Two aspects of the reverse flow need to be taken into consideration: the importance of introducing mechanisms that promote the circui......This thesis presents the results of a qualitative investigation that has been conducted in order to enhance knowledge of the reverse supply chain management field. Two aspects of the reverse flow need to be taken into consideration: the importance of introducing mechanisms that promote...... the circuitry of resources in order to protect the environment, and the increasing awareness that if strategically managed, the reverse chain represents an opportunity for profit generation and for improving the competitive position of a firm. In the first case, the main stakeholders are represented...... within the 27 Member States, reaching approximately 14-24 Kg. per inhabitant in Western Europe and the 6-12 Kg. per inhabitant in the New Member States. In the second case, the main stakeholder is the firm, the producer that has the possibility of exploring new opportunities to achieve a competitive...

  14. Reverse supply chain coordination by revenue sharing contract

    DEFF Research Database (Denmark)

    Govindan, Kannan; Popiuc, M.N.

    2014-01-01

    implementation of revenue sharing contract. We define customer willingness to return obsolete units as a function of the discount offered by the retailer in exchange for recycling devices with a remanufacturing value. The results show that performance measures and total supply chain profits improve through......Products that are not recycled at the end of their life increasingly damage the environment. In a collection - remanufacturing scheme, these end-of-life products can generate new profits. Designed on the personal computers industry, this study defines an analytical model used to explore...... the implications of recycling on the reverse supply chain from an efficiency perspective for all participants in the process. The cases considered for analysis are the two- and three-echelon supply chains, where we first look at the decentralized reverse setting followed by the coordinated setting through...

  15. Overview of coordination contracts within forward and reverse supply chains

    DEFF Research Database (Denmark)

    Govindan, Kannan; Popiuc, M.N.; Diabat, A.

    2013-01-01

    Contracts are comprehensive coordination mechanisms used in both theory and practice to coordinate various supply chain structures. By focusing on the coordination by contracts of the forward and reverse supply chains, the intention of this paper is to (1) present an overview of contracting...... literature and (2) suggest a classification of coordination contracts and contracting literature in the form of classification schemes. The criteria used for contract classification are transfer payment contractual incentives and inventory risk sharing. The classification schemes are based on the level...

  16. Hybrid Algorithms for Fuzzy Reverse Supply Chain Network Design

    Science.gov (United States)

    Che, Z. H.; Chiang, Tzu-An; Kuo, Y. C.

    2014-01-01

    In consideration of capacity constraints, fuzzy defect ratio, and fuzzy transport loss ratio, this paper attempted to establish an optimized decision model for production planning and distribution of a multiphase, multiproduct reverse supply chain, which addresses defects returned to original manufacturers, and in addition, develops hybrid algorithms such as Particle Swarm Optimization-Genetic Algorithm (PSO-GA), Genetic Algorithm-Simulated Annealing (GA-SA), and Particle Swarm Optimization-Simulated Annealing (PSO-SA) for solving the optimized model. During a case study of a multi-phase, multi-product reverse supply chain network, this paper explained the suitability of the optimized decision model and the applicability of the algorithms. Finally, the hybrid algorithms showed excellent solving capability when compared with original GA and PSO methods. PMID:24892057

  17. Maximum Entropy Estimation of Transition Probabilities of Reversible Markov Chains

    Directory of Open Access Journals (Sweden)

    Erik Van der Straeten

    2009-11-01

    Full Text Available In this paper, we develop a general theory for the estimation of the transition probabilities of reversible Markov chains using the maximum entropy principle. A broad range of physical models can be studied within this approach. We use one-dimensional classical spin systems to illustrate the theoretical ideas. The examples studied in this paper are: the Ising model, the Potts model and the Blume-Emery-Griffiths model.

  18. Revenue in reverse? An examination of reverse supply chain enabled revenue streams

    DEFF Research Database (Denmark)

    Larsen, Samuel; Jacobsen, Peter

    2016-01-01

    When original equipment manufacturers (OEMs) examine whether to implement a reverse supply chain (RSC) for their products, oftentimes the motive is cost savings or regulatory compliance. However, a frequently overlooked but equally important benefit is the possibility for creating new revenue...

  19. Profits in reverse? An examination of the decisive factors for reverse supply chain profitability

    DEFF Research Database (Denmark)

    Larsen, Samuel; Jacobsen, Peter

    2015-01-01

    Although the concept of the reverse supply chain (RSC) is not unknown in industry, an inhibitor for its successful use is low (or no) profitability. A research challenge is investigating ways to establish the RSC as a profit-creating center in the organization. This paper contributes...

  20. Integrated forward and reverse supply chain: A tire case study.

    Science.gov (United States)

    Pedram, Ali; Yusoff, Nukman Bin; Udoncy, Olugu Ezutah; Mahat, Abu Bakar; Pedram, Payam; Babalola, Ayo

    2017-02-01

    This paper attempts to integrate both a forward and reverse supply chain to design a closed-loop supply chain network (CLSC). The problem in the design of a CLSC network is uncertainty in demand, return products and the quality of return products. Scenario analyses are generated to overcome this uncertainty. In contrast to the existing supply chain network design models, a new application of a CLSC network was studied in this paper to reduce waste. A multi-product, multi-tier mixed integer linear model is developed for a CLSC network design. The main objective is to maximize profit and provide waste management decision support in order to minimize pollution. The result shows applicability of the model in the tire industry. The model determines the number and the locations of facilities and the material flows between these facilities. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. The Impact of Carbon Emissions Policies on Reverse Supply Chain Network Design

    OpenAIRE

    Bandar A. ALKHAYYAL; Surendra M. GUPTA

    2018-01-01

    Reverse Supply Chain is described as an initiative that plays an important role in the global supply chain for those who seek environmentally responsible solutions for their end-of-life products. The relative economic and environmental benefits of reverse supply chain are influenced by costs and emissions during collection, transportation, recovery facilities, disassembly, recycling, remanufacturing, and disposal of unrecoverable components. The design of reverse supply chain network takes in...

  2. Performance measurement for supply chain management and evaluation criteria determination for reverse supply chain management

    Science.gov (United States)

    Kongar, N. Elif

    2004-12-01

    Today, since customers are able to obtain similar-quality products for similar prices, the lead time has become the only preference criterion for most of the consumers. Therefore, it is crucial that the lead time, i.e., the time spent from the raw material phase till the manufactured good reaches the customer, is minimized. This issue can be investigated under the title of Supply Chain Management (SCM). An efficiently managed supply chain can lead to reduced response time for customers. To achieve this, continuous observation of supply chain efficiency, i.e., a constant performance evaluation of the current SCM is required. Widely used conventional performance measurement methods lack the ability to evaluate a SCM since the supply chain is a dynamic system that requires a more thorough and flexible performance measurement technique. Balanced Scorecard (BS) is an efficient tool for measuring the performance of dynamic systems and has a proven capability of providing the decision makers with the appropriate feedback data. In addition to SCM, a relatively new management field, namely reverse supply chain management (RSCM), also necessitates an appropriate evaluation approach. RSCM differs from SCM in many aspects, i.e., the criteria used for evaluation, the high level of uncertainty involved etc., not allowing the usage of identical evaluation techniques used for SCM. This study proposes a generic Balanced Scorecard to measure the performance of supply chain management while defining the appropriate performance measures for SCM. A scorecard prototype, ESCAPE, is presented to demonstrate the evaluation process.

  3. The Impact of Carbon Emissions Policies on Reverse Supply Chain Network Design

    Directory of Open Access Journals (Sweden)

    Bandar A. ALKHAYYAL

    2018-01-01

    Full Text Available Reverse Supply Chain is described as an initiative that plays an important role in the global supply chain for those who seek environmentally responsible solutions for their end-of-life products. The relative economic and environmental benefits of reverse supply chain are influenced by costs and emissions during collection, transportation, recovery facilities, disassembly, recycling, remanufacturing, and disposal of unrecoverable components. The design of reverse supply chain network takes into account social, economic and environmental objectives. This paper addresses the design of reverse supply chain under the three common regulatory policies, strict carbon caps, carbon tax, and carbon cap-and-trade.

  4. Closing the Loop : Reverse supply chain management andproduct return processes in electronics retailing

    OpenAIRE

    Gorskova, Julija; Ortega, Edrion

    2012-01-01

    Abstract Problem There is a gap in the knowledge concerning reverse product flows due to a lack of research and empirical data in the field of reverse supply chain management in general. Furthermore, more research is needed to investigate the factors influencing the decision making process regarding the right reverse supply chain recovery option choice for companies in order to close the supply chain loop. Processing product returns has become a critical activity for organisations as the volu...

  5. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  6. Chain-end modification of living anionic polybutadiene with diphenylethylenes and styrenes

    NARCIS (Netherlands)

    Donkers, E.H.D.; Willemse, R.X.E.; Klumperman, B.

    2005-01-01

    The first step in the transformation of poly(butadienyl)lithium into a macromolecular atom transfer radical polymerization initiator or reversible addition-fragmentation chain transfer agent is the modification of the anionic chain end into a suitable leaving/reinitiating group. We have investigated

  7. Impact of RFID Information-Sharing Coordination over a Supply Chain with Reverse Logistics

    Science.gov (United States)

    Nativi Nicolau, Juan Jose

    2016-01-01

    Companies have adopted environmental practices such as reverse logistics over the past few decades. However, studies show that aligning partners inside the green supply chain can be a substantial problem. This lack of coordination can increase overall supply chain cost. Information technology such as Radio Frequency Identification (RFID) has the…

  8. A Food Chain Algorithm for Capacitated Vehicle Routing Problem with Recycling in Reverse Logistics

    Science.gov (United States)

    Song, Qiang; Gao, Xuexia; Santos, Emmanuel T.

    2015-12-01

    This paper introduces the capacitated vehicle routing problem with recycling in reverse logistics, and designs a food chain algorithm for it. Some illustrative examples are selected to conduct simulation and comparison. Numerical results show that the performance of the food chain algorithm is better than the genetic algorithm, particle swarm optimization as well as quantum evolutionary algorithm.

  9. It's hard to be green: Reverse green value chain.

    Science.gov (United States)

    Couto, João; Tiago, Teresa; Gil, Artur; Tiago, Flávio; Faria, Sandra

    2016-08-01

    Firms have recently discovered that it is not enough to optimize internal processes and relationships with partners along the value chain to create a sustainable competitive market position. A clear customer orientation, which acknowledges that consumer buying behavior is complex and includes many elements implied in the value chain, is required. As companies offering green products are no exception to this rule, this study analyzes consumer behavior in Europe from a reserve green supply chain management perspective, using descriptive analyses and a structural equation model, with data collected by Flash Barometer comprising 26,573 responses from 28 European countries. The results suggest that European consumers are conscious of the green concept, but are not willing to buy or pay more for these products since the value is unclear. Companies offering green products must therefore rethink their strategies, especially in terms of value proposition, communication strategies, and eco-labeling. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Reverse Logistics – Capturing Value in the Extended Supply Chain

    NARCIS (Netherlands)

    M. Fleischmann (Moritz); J.A.E.E. van Nunen (Jo); B. Graeve; R. Gapp

    2004-01-01

    textabstractProduct flows in today’s supply chains do not end once they have reached the customer. Many products lead a second and even third or fourth life after having accomplished their original task at their first customer. Consequently, a product may generate revenues multiple times, rather

  11. Applying Revenue Management to the Reverse Supply Chain

    NARCIS (Netherlands)

    M. Ferguson (Mark); M. Fleischmann (Moritz); G.C. Souza (Gilvan)

    2008-01-01

    textabstractWe study the disposition decision for product returns in a closed-loop supply chain. Motivated by the asset recovery process at IBM, we consider two disposition alternatives. Returns may be either refurbished for reselling or dismantled for spare parts. Reselling a refurbished unit

  12. A review of reverse logistics and closed-loop supply chains

    DEFF Research Database (Denmark)

    Govindan, Kannan; Soleimani, Hamed

    2016-01-01

    Today, the task of developing reverse logistics and closed-loop supply chains in both developed and developing industries is accepted as a vital need in our societies. The growing interest in reverse issues can be clearly seen in the large number of publications, especially the ones that consider...... case studies in various industries. Based on its missions, Journal of Cleaner Production (JCP) is one of the most active journals in this field. Therefore, a comprehensive review is undertaken of the publications in the field of reverse logistics and closed-loop supply chains; the selection process...... December 2014 have been selected and reviewed. The selected papers are then analyzed based on their content and the appropriate developed categories. The results clarify the main trends in reverse logistics and closed-loop supply chain subjects for the Journal of Cleaner Production and the evaluations...

  13. Finding metastabilities in reversible Markov chains based on incomplete sampling

    Directory of Open Access Journals (Sweden)

    Fackeldey Konstantin

    2017-01-01

    Full Text Available In order to fully characterize the state-transition behaviour of finite Markov chains one needs to provide the corresponding transition matrix P. In many applications such as molecular simulation and drug design, the entries of the transition matrix P are estimated by generating realizations of the Markov chain and determining the one-step conditional probability Pij for a transition from one state i to state j. This sampling can be computational very demanding. Therefore, it is a good idea to reduce the sampling effort. The main purpose of this paper is to design a sampling strategy, which provides a partial sampling of only a subset of the rows of such a matrix P. Our proposed approach fits very well to stochastic processes stemming from simulation of molecular systems or random walks on graphs and it is different from the matrix completion approaches which try to approximate the transition matrix by using a low-rank-assumption. It will be shown how Markov chains can be analyzed on the basis of a partial sampling. More precisely. First, we will estimate the stationary distribution from a partially given matrix P. Second, we will estimate the infinitesimal generator Q of P on the basis of this stationary distribution. Third, from the generator we will compute the leading invariant subspace, which should be identical to the leading invariant subspace of P. Forth, we will apply Robust Perron Cluster Analysis (PCCA+ in order to identify metastabilities using this subspace.

  14. Implementing Coordinative Contracts between Manufacturer and Retailer in a Reverse Supply Chain

    Directory of Open Access Journals (Sweden)

    Sung Wook Yoon

    2016-09-01

    Full Text Available There is an increasing need for company awareness of environmental problems and sustainable business practices. As a post-consumption activity, the reverse supply chain aims to extract value from products at the end of their lifecycle; it offers a means of pursuing sustainability through recycling, remanufacturing, refurbishing, and reusing. This study develops a series of procedures for implementing contracts between manufacturers and retailers to maximize individual profits and total profits through the reverse supply chain. To analyze the effects of the decision strategies made by parties acting on non-coordinative (decentralized and coordinative contracts, we model a two-echelon reverse supply chain environment using a system dynamics approach. In this study, we examine three cooperative contracts with differing shares of cost and profit between the two parties. Each contract is analyzed according to the following three contract processes. First, the manufacturer proposes a set of contracts that can be considered by the retailer. Second, the retailer evaluates the proposed contracts and chooses the one that is expected to maximize profits. Finally, the retailer and manufacturer adjust the parameters of the best contract to achieve the mutual goal of the supply chain. Using the experimental results, we discuss the best coordinative strategy between manufacturer and retailer for maximizing profits in the reverse supply chain.

  15. Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

    National Research Council Canada - National Science Library

    McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

    2005-01-01

    ...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

  16. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  17. Global Reverse Supply Chain Redesign for Household Plastic Waste under the Emission Trading Scheme

    NARCIS (Netherlands)

    Bing, X.; Bloemhof-Ruwaard, J.M.; Chabaane, A.; Vorst, van der J.G.A.J.

    2015-01-01

    With increasing global resource scarcity, waste becomes a resource that can be managed globally. A reverse supply chain network for waste recycling needs to process all the waste with minimum costs and environmental impact. As re-processing of waste is one of the major sources of pollution in the

  18. Collection effort and reverse channel choices in a closed-loop supply chain

    DEFF Research Database (Denmark)

    Govindan, Kannan; Liu, Liwen; Wang, Zongjun

    2017-01-01

    We investigate the pricing and reverse channel choice decision issues in a closed-loop supply chain, within which the original equipment manufacturer (OEM) sells the new and remanufactured products through a retailer, while collects used products (cores) via dual recycling channels. We consider...

  19. First-order reversal curves of single domain particles: diluted random assemblages and chains

    Science.gov (United States)

    Egli, R.

    2009-04-01

    Exact magnetic models can be used to calculate first-order reversal curves (FORC) of single domain (SD) particle assemblages, as shown by Newell [2005] for the case of isolated Stoner-Wohlfarth particles. After overcoming experimental difficulties, a FORC diagram sharing many similarities to Newell's model has been measured on a lake sediment sample (see A.P. Chen et al., "Quantification of magnetofossils using first-order reversal curves", EGU General Assembly 2009, Abstracts Vol. 11, EGU2009-10719). This sample contains abundant magnetofossils, as shown by coercivity analysis and electron microscopy, therefore suggesting that well dispersed, intact magnetosome chains are the main SD carriers. Subtle differences between the reversible and the irreversible contributions of the measured FORC distribution suggest that magnetosome chains might not be correctly described by the Stoner-Wohlfarth model. To better understand the hysteresis properties of such chains, a simple magnetic model has been implemented, taking dipole-dipole interactions between particles within the same chain into account. The model results depend on the magnetosome elongation, the number of magnetosomes in a chain, and the gap between them. If the chain axis is subparallel to the applied field, the magnetic moment reverses by a pseudo-fanning mode, which is replaced by a pseudo-coherent rotation mode at greater angles. These reversal modes are intrinsically different from coherent rotation assumed Stoner-Wohlfarth model, resulting in FORC diagrams with a smaller reversible component. On the other hand, isolated authigenic SD particles can precipitate in the sediment matrix, as it might occur for pedogenic magnetite. In this case, an assembly of randomly located particles provides a possible model for the resulting FORC diagram. If the concentration of the particles is small, each particle is affected by a random interaction field whose statistical distribution can be calculated from first

  20. Proton-Fueled, Reversible DNA Hybridization Chain Assembly for pH Sensing and Imaging.

    Science.gov (United States)

    Liu, Lan; Liu, Jin-Wen; Huang, Zhi-Mei; Wu, Han; Li, Na; Tang, Li-Juan; Jiang, Jian-Hui

    2017-07-05

    Design of DNA self-assembly with reversible responsiveness to external stimuli is of great interest for diverse applications. We for the first time develop a pH-responsive, fully reversible hybridization chain reaction (HCR) assembly that allows sensitive sensing and imaging of pH in living cells. Our design relies on the triplex forming sequences that form DNA triplex with toehold regions under acidic conditions and then induce a cascade of strand displacement and DNA assembly. The HCR assembly has shown dynamic responses in physiological pH ranges with excellent reversibility and demonstrated the potential for in vitro detection and live-cell imaging of pH. Moreover, this method affords HCR assemblies with highly localized fluorescence responses, offering advantages of improving sensitivity and better selectivity. The proton-fueled, reversible HCR assembly may provide a useful approach for pH-related cell biology study and disease diagnostics.

  1. RAFT Miniemulsion Polymerization of MMA with Cumyl Dithiobenzoate as Chain Transfer Agent

    Institute of Scientific and Technical Information of China (English)

    Tian Ying GUO; Dong Lin TANG; Jing Wei ZHU; Mou Dao SONG; Bang Hua ZHANG

    2006-01-01

    Reversible addition-fragmentation transfer (RAFT) miniemulsion polymerizations for PMMA with cumyl dithiobenzoate (CDB) as a chain transfer agent (CTA) has been carried out.Higher temperature made the polymerization much faster and the PDI remained below 1.20, when the temperature was upon 70 ℃.

  2. Proposition of a modeling and an analysis methodology of integrated reverse logistics chain in the direct chain

    Energy Technology Data Exchange (ETDEWEB)

    Mimouni, F.; Abouabdellah, A.

    2016-07-01

    Propose a modeling and analysis methodology based on the combination of Bayesian networks and Petri networks of the reverse logistics integrated the direct supply chain. Network modeling by combining Petri and Bayesian network. Modeling with Bayesian network complimented with Petri network to break the cycle problem in the Bayesian network. Demands are independent from returns. Model can only be used on nonperishable products. Legislation aspects: Recycling laws; Protection of environment; Client satisfaction via after sale service. Bayesian network with a cycle combined with the Petri Network. (Author)

  3. Proposition of a modeling and an analysis methodology of integrated reverse logistics chain in the direct chain

    Directory of Open Access Journals (Sweden)

    Faycal Mimouni

    2016-04-01

    Full Text Available Purpose: Propose a modeling and analysis methodology based on the combination of Bayesian networks and Petri networks of the reverse logistics integrated the direct supply chain. Design/methodology/approach: Network modeling by combining Petri and Bayesian network. Findings: Modeling with Bayesian network complimented with Petri network to break the cycle problem in the Bayesian network. Research limitations/implications: Demands are independent from returns. Practical implications: Model can only be used on nonperishable products. Social implications: Legislation aspects: Recycling laws; Protection of environment; Client satisfaction via after sale service. Originality/value: Bayesian network with a cycle combined with the Petri Network.

  4. Multi-criteria approach for strategic planning of reverse supply chain

    Directory of Open Access Journals (Sweden)

    Abdelkader Benzohra

    2017-04-01

    Full Text Available A reverse supply chain is viewed as a process from consumption point to recovery point and the management of domestic waste is considered as a specific and complex reverse supply chain. This important sector represents a high challenging problem for our cities, constrained by financial, social, health and environmental considerations. This paper proposes multicriteria decision aid to help choose an efficient domestic waste management strategy. In fact, Multicriteria decision making techniques are considered as a key option to solve this type of problems, giving a solution that represents a good compromise between different preferences. The adopted approach consists in outranking a set of candidate management plans using a method based on partial aggregation criteria. This model is applied on a real case study of an Algerian city and to validate the obtained results, a deep sensitivity analysis is carried out, giving the most appropriate plans.

  5. Reversal of local spins in transport of electrons through a one-dimensional chain

    International Nuclear Information System (INIS)

    Hu, D.-S.; Xiong, S.-J.

    2003-01-01

    We investigate the spin reversal of two coupled magnetic impurities in the transport processes of electrons in a one-dimensional chain. The impurities are side coupled to the chain and the electrons are injected and tunneling through it. The transmission coefficient of electrons and the polarization of impurities are calculated by the use of the equivalent single-particle network method for the correlated system. It is found that both the transmission coefficient and the polarization of impurities depend on the initial state of impurities and the impurity spins can be converted into the direction of electron spin if the injected electrons are polarized and the number of electrons is large enough. The evolution of the spin-reversal processes is studied in details

  6. Influences of reverse outsourcing on green technological progress from the perspective of a global supply chain.

    Science.gov (United States)

    Wang, Shuhong; Song, Malin

    2017-10-01

    As a newly appeared trade mode in recent years, reverse outsourcing has made a great impact on traditional trade modes. This paper researched the influences of reverse outsourcing on green technological progress from the perspective of a global supply chain by using micro-data of enterprises. It worked out the rate of green technological progress from two innovative concepts: potential production technology and practical production technology. The empirical analysis results indicated that reverse outsourcing stimulates, and enterprise size and ownership type potentially affects, green technological progress. State-owned or foreign enterprises with high income levels would pay more attention to environmental protection, energy saving, and emission reduction, while small and micro enterprises with low incomes would choose to ignore environmental protection. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Global reverse supply chain design for solid waste recycling under uncertainties and carbon emission constraint.

    Science.gov (United States)

    Xu, Zhitao; Elomri, Adel; Pokharel, Shaligram; Zhang, Qin; Ming, X G; Liu, Wenjie

    2017-06-01

    The emergence of concerns over environmental protection, resource conservation as well as the development of logistics operations and manufacturing technology has led several countries to implement formal collection and recycling systems of solid waste. Such recycling system has the benefits of reducing environmental pollution, boosting the economy by creating new jobs, and generating income from trading the recyclable materials. This leads to the formation of a global reverse supply chain (GRSC) of solid waste. In this paper, we investigate the design of such a GRSC with a special emphasis on three aspects; (1) uncertainty of waste collection levels, (2) associated carbon emissions, and (3) challenges posed by the supply chain's global aspect, particularly the maritime transportation costs and currency exchange rates. To the best of our knowledge, this paper is the first attempt to integrate the three above-mentioned important aspects in the design of a GRSC. We have used mixed integer-linear programming method along with robust optimization to develop the model which is validated using a sample case study of e-waste management. Our results show that using a robust model by taking the complex interactions characterizing global reverse supply chain networks into account, we can create a better GRSC. The effect of uncertainties and carbon constraints on decisions to reduce costs and emissions are also shown. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Identification of potential recovery facilities for designing a reverse supply chain network using physical programming

    Science.gov (United States)

    Pochampally, Kishore K.; Gupta, Surendra M.; Kamarthi, Sagar V.

    2004-02-01

    Although there are many quantitative models in the literature to design a reverse supply chain, every model assumes that all the recovery facilities that are engaged in the supply chain have enough potential to efficiently re-process the incoming used products. Motivated by the risk of re-processing used products in facilities of insufficient potentiality, this paper proposes a method to identify potential facilities in a set of candidate recovery facilities operating in a region where a reverse supply chain is to be established. In this paper, the problem is solved using a newly developed method called physical programming. The most significant advantage of using physical programming is that it allows a decision maker to express his preferences for values of criteria (for comparing the alternatives), not in the traditional form of weights but in terms of ranges of different degrees of desirability, such as ideal range, desirable range, highly desirable range, undesirable range, and unacceptable range. A numerical example is considered to illustrate the proposed method.

  9. A Comprehensive Mathematical Programming Model for Minimizing Costs in A Multiple-Item Reverse Supply Chain with Sensitivity Analysis

    Directory of Open Access Journals (Sweden)

    Mahmoudi Hoda

    2014-09-01

    Full Text Available These instructions give you guidelines for preparing papers for IFAC conferences. A reverse supply chain is configured by a sequence of elements forming a continuous process to treat return-products until they are properly recovered or disposed. The activities in a reverse supply chain include collection, cleaning, disassembly, test and sorting, storage, transport, and recovery operations. This paper presents a mathematical programming model with the objective of minimizing the total costs of reverse supply chain including transportation, fixed opening, operation, maintenance and remanufacturing costs of centers. The proposed model considers the design of a multi-layer, multi-product reverse supply chain that consists of returning, disassembly, processing, recycling, remanufacturing, materials and distribution centers. This integer linear programming model is solved by using Lingo 9 software and the results are reported. Finally, a sensitivity analysis of the proposed model is also presented.

  10. Analysis on the cost structure of product recall for reverse supply chain

    Science.gov (United States)

    Yanhua, Feng; Xuhui, Xia; Zheng, Yang

    2017-12-01

    The research on the reverse supply chain of product recall mainly focused on the recall network structure, logistics mode and so on. In this paper, when product recall and supply channel are fixed, the specific structure and function expression of cost are analyzed according to the peak season and off-season of recall activities, and whether the assembly manufacturer, supplier and recyclers are cooperated situation, respectively, to build the total cost structure of the function model. Finally, the model is validated correctly through the automotive industry and the electromechanical industry.

  11. Determining the total cost of reverse supply chain operations for original equipment manufacturers

    DEFF Research Database (Denmark)

    Larsen, Samuel Brüning; Jacobsen, Peter

    2014-01-01

    When original equipment manufacturers (OEM) examine whether or not to invest in a reverse supply chain (RSC), managers need insight into not only the cost savings and new revenue streams the RSC enables, but also the total cost of the RSC itself. Using case study research the study examines what...... cost parameters constitute the total cost (TC) of the RSC. The specific RSC that the study seeks the TC for consists of 1) end-product refurbishing, 2) component refurbishing, and 3) sales of used materials back to original suppliers or independent recyclers for materials recycling....

  12. Multi-criteria analysis of potential recovery facilities in a reverse supply chain

    Science.gov (United States)

    Nukala, Satish; Gupta, Surendra M.

    2005-11-01

    Analytic Hierarchy Process (AHP) has been employed by researchers for solving multi-criteria analysis problems. However, AHP is often criticized for its unbalanced scale of judgments and failure to precisely handle the inherent uncertainty and vagueness in carrying out the pair-wise comparisons. With an objective to address these drawbacks, in this paper, we employ a fuzzy approach in selecting potential recovery facilities in the strategic planning of a reverse supply chain network that addresses the decision maker's level of confidence in the fuzzy assessments and his/her attitude towards risk. A numerical example is considered to illustrate the methodology.

  13. The profit potential in reverse supply chain functions for catalyst manufacturers

    DEFF Research Database (Denmark)

    Larsen, Samuel; Sorth-Olsen, Rasmus; Honoré, Aske Lykke

    The reverse supply chain (RSC) contains inherent uncertainties, e.g. the quality level and return volume of used products. By contrast, the catalyst manufacturing industry is characterized by Certainty (manifested in e.g. well-defined and highly controlled production – processes and widespread...... standardization). This paper’s purpose is to examine whether RSC – processes can be profitably applied in this industry. Using case study research the paper examines which RSC - functions that are generally available to manufacturers are profitable for a selected catalyst manufacturer. Results show three...

  14. SAN-b-P4VP block copolymer synthesis by chain extension from RAFT-functional poly(4-vinylpyridine) in solution and in emulsion

    NARCIS (Netherlands)

    Bozovic, J.S.; Tello Manon, H.M; Meuldijk, J.; Koning, C.E.; Klumperman, B.

    2007-01-01

    Reversible addition fragmentation chain transfer (RAFT)-mediated polymerization was successfully applied for the synthesis of poly(4-vinylpyridine) (P4VP) polymers of predetermined molar mass and of low polydispersity index. These RAFT end-functionalized polymers were then used as macro-RAFT agents

  15. Thermally activated magnetization reversal in monatomic magnetic chains on surfaces studied by classical atomistic spin-dynamics simulations

    International Nuclear Information System (INIS)

    Bauer, David S G; Mavropoulos, Phivos; Bluegel, Stefan; Lounis, Samir

    2011-01-01

    We analyse the spontaneous magnetization reversal of supported monatomic chains of finite length due to thermal fluctuations via atomistic spin-dynamics simulations. Our approach is based on the integration of the Landau-Lifshitz equation of motion of a classical spin Hamiltonian in the presence of stochastic forces. The associated magnetization lifetime is found to obey an Arrhenius law with an activation barrier equal to the domain wall energy in the chain. For chains longer than one domain wall width, the reversal is initiated by nucleation of a reversed magnetization domain primarily at the chain edge followed by a subsequent propagation of the domain wall to the other edge in a random-walk fashion. This results in a linear dependence of the lifetime on the chain length, if the magnetization correlation length is not exceeded. We studied chains of uniaxial and triaxial anisotropy and found that a triaxial anisotropy leads to a reduction of the magnetization lifetime due to a higher reversal attempt rate, even though the activation barrier is not changed.

  16. Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

    Science.gov (United States)

    Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

    2012-07-15

    Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. A fuzzy Bi-linear management model in reverse logistic chains

    Directory of Open Access Journals (Sweden)

    Tadić Danijela

    2016-01-01

    Full Text Available The management of the electrical and electronic waste (WEEE problem in the uncertain environment has a critical effect on the economy and environmental protection of each region. The considered problem can be stated as a fuzzy non-convex optimization problem with linear objective function and a set of linear and non-linear constraints. The original problem is reformulated by using linear relaxation into a fuzzy linear programming problem. The fuzzy rating of collecting point capacities and fix costs of recycling centers are modeled by triangular fuzzy numbers. The optimal solution of the reformulation model is found by using optimality concept. The proposed model is verified through an illustrative example with real-life data. The obtained results represent an input for future research which should include a good benchmark base for tested reverse logistic chains and their continuous improvement. [Projekat Ministarstva nauke Republike Srbije, br. 035033: Sustainable development technology and equipment for the recycling of motor vehicles

  18. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  19. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  20. How the reverse supply chain enables original equipment manufacturers to compete on low price

    DEFF Research Database (Denmark)

    Larsen, Samuel; Jacobsen, Peter

    2015-01-01

    -attached services, the purpose of this paper is to examine the relationship between the firm’s RSC processes and overall operating costs. The paper asks the question of how a firm’s RSC processes enable continuous operating cost reductions. The paper’s research method combines a literature review of known RSC......Low price is perhaps the most widely present competitive parameter forcing firms to continuously reduce their operating costs. While much literature has investigated how firms can use their reverse supply chain (RSC) processes to comply with regulations or offer RSC-enabled product......-enabled cost reduction opportunities with a multiple case study that explores unknown opportunities. The most used cost reduction opportunity among the six firms in the study’s case sample is reducing operating costs by replacing purchasing of virgin materials and internal production with recovery of used...

  1. How the reverse supply chain impacts the financial performance of original equipment manufacturers

    DEFF Research Database (Denmark)

    Larsen, Samuel

    This thesis examines the financial impact of a firm’s reverse supply chain (RSC). Specifically, the thesis examines the two questions of how the RSC can contribute to the financial performance of the firm and which factors are decisive for the RSC’s financial contribution. The thesis focuses...... on original equipment manufacturers. The thesis results show that the RSC can contribute to the financial performance of the firm in more than 20 different ways, which the thesis defines as functions of the RSC. Examples of RSC-functions are 1) resale of recovered end-products to price-focused market segments...... in the firm’s primary markets, 2) resale to customers in new markets (in e.g. emerging economies), and 3) sale of used materials back the firm’s original material suppliers. The firm’ RSC can conduct several RSC-functions simultaneously and the financial benefits from operating these RSC-functions differ...

  2. Quality Management in Reverse Logistics A Broad Look on Quality Issues and Their Interaction with Closed-Loop Supply Chains

    CERN Document Server

    2013-01-01

    The concepts of Quality Management (QM) have been used for a long time by manufacturing companies to ensure customers receive a constant and high quality level of products. But what happens with remanufactured or refurbished products?   Quality Management in Reverse Logistics: A Broad Look on Quality Issues and Their Interaction with Closed-Loop Supply Chains discusses the new, promising area of QM and Reverse Logistics interaction. More specifically, it examines and evaluates a number of QM tools and techniques, which can be applied in practice in order to understand, review and improve any closed-loop supply chain process.   Modeling and quantitative methods that can be used by students, practitioners and academics in the Reverse Logistics industry are described. The readers will broaden their scope of thinking in the area of Reverse Logistics, where Quality Management can be applied.

  3. An efficient interpolation technique for jump proposals in reversible-jump Markov chain Monte Carlo calculations

    Science.gov (United States)

    Farr, W. M.; Mandel, I.; Stevens, D.

    2015-01-01

    Selection among alternative theoretical models given an observed dataset is an important challenge in many areas of physics and astronomy. Reversible-jump Markov chain Monte Carlo (RJMCMC) is an extremely powerful technique for performing Bayesian model selection, but it suffers from a fundamental difficulty and it requires jumps between model parameter spaces, but cannot efficiently explore both parameter spaces at once. Thus, a naive jump between parameter spaces is unlikely to be accepted in the Markov chain Monte Carlo (MCMC) algorithm and convergence is correspondingly slow. Here, we demonstrate an interpolation technique that uses samples from single-model MCMCs to propose intermodel jumps from an approximation to the single-model posterior of the target parameter space. The interpolation technique, based on a kD-tree data structure, is adaptive and efficient in modest dimensionality. We show that our technique leads to improved convergence over naive jumps in an RJMCMC, and compare it to other proposals in the literature to improve the convergence of RJMCMCs. We also demonstrate the use of the same interpolation technique as a way to construct efficient ‘global’ proposal distributions for single-model MCMCs without prior knowledge of the structure of the posterior distribution, and discuss improvements that permit the method to be used in higher dimensional spaces efficiently. PMID:26543580

  4. How the reverse supply chain contributes to a firm’s competitive strategy: a strategic alignment perspective

    DEFF Research Database (Denmark)

    Larsen, Samuel Brüning; Masi, Donato; Jacobsen, Peter

    2017-01-01

    The ongoing transition to a Circular Economy is changing the shape of Supply Chains. They are becoming more ‘Closed-Loop’, combining forward and reverse flows of products and materials. Reverse Supply Chains (RSCs), originally considered as a solution for handling waste or recovering residual value...... seven case studies, focusing on original equipment manufacturers (OEMs), show how the RSC can play a strategic, tactical, or operational role for the firm. The paper applies for the first time the concept of strategic alignment to the RSC and practitioners can use the proposed framework to analyse...

  5. A reversible-jump Markov chain Monte Carlo algorithm for 1D inversion of magnetotelluric data

    Science.gov (United States)

    Mandolesi, Eric; Ogaya, Xenia; Campanyà, Joan; Piana Agostinetti, Nicola

    2018-04-01

    This paper presents a new computer code developed to solve the 1D magnetotelluric (MT) inverse problem using a Bayesian trans-dimensional Markov chain Monte Carlo algorithm. MT data are sensitive to the depth-distribution of rock electric conductivity (or its reciprocal, resistivity). The solution provided is a probability distribution - the so-called posterior probability distribution (PPD) for the conductivity at depth, together with the PPD of the interface depths. The PPD is sampled via a reversible-jump Markov Chain Monte Carlo (rjMcMC) algorithm, using a modified Metropolis-Hastings (MH) rule to accept or discard candidate models along the chains. As the optimal parameterization for the inversion process is generally unknown a trans-dimensional approach is used to allow the dataset itself to indicate the most probable number of parameters needed to sample the PPD. The algorithm is tested against two simulated datasets and a set of MT data acquired in the Clare Basin (County Clare, Ireland). For the simulated datasets the correct number of conductive layers at depth and the associated electrical conductivity values is retrieved, together with reasonable estimates of the uncertainties on the investigated parameters. Results from the inversion of field measurements are compared with results obtained using a deterministic method and with well-log data from a nearby borehole. The PPD is in good agreement with the well-log data, showing as a main structure a high conductive layer associated with the Clare Shale formation. In this study, we demonstrate that our new code go beyond algorithms developend using a linear inversion scheme, as it can be used: (1) to by-pass the subjective choices in the 1D parameterizations, i.e. the number of horizontal layers in the 1D parameterization, and (2) to estimate realistic uncertainties on the retrieved parameters. The algorithm is implemented using a simple MPI approach, where independent chains run on isolated CPU, to take

  6. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  7. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  8. Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

    Science.gov (United States)

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

    2004-03-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  9. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  10. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  11. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  12. Reactive Oxygen Species Production by Forward and Reverse Electron Fluxes in the Mitochondrial Respiratory Chain

    Science.gov (United States)

    Selivanov, Vitaly A.; Votyakova, Tatyana V.; Pivtoraiko, Violetta N.; Zeak, Jennifer; Sukhomlin, Tatiana; Trucco, Massimo; Roca, Josep; Cascante, Marta

    2011-01-01

    Reactive oxygen species (ROS) produced in the mitochondrial respiratory chain (RC) are primary signals that modulate cellular adaptation to environment, and are also destructive factors that damage cells under the conditions of hypoxia/reoxygenation relevant for various systemic diseases or transplantation. The important role of ROS in cell survival requires detailed investigation of mechanism and determinants of ROS production. To perform such an investigation we extended our rule-based model of complex III in order to account for electron transport in the whole RC coupled to proton translocation, transmembrane electrochemical potential generation, TCA cycle reactions, and substrate transport to mitochondria. It fits respiratory electron fluxes measured in rat brain mitochondria fueled by succinate or pyruvate and malate, and the dynamics of NAD+ reduction by reverse electron transport from succinate through complex I. The fitting of measured characteristics gave an insight into the mechanism of underlying processes governing the formation of free radicals that can transfer an unpaired electron to oxygen-producing superoxide and thus can initiate the generation of ROS. Our analysis revealed an association of ROS production with levels of specific radicals of individual electron transporters and their combinations in species of complexes I and III. It was found that the phenomenon of bistability, revealed previously as a property of complex III, remains valid for the whole RC. The conditions for switching to a state with a high content of free radicals in complex III were predicted based on theoretical analysis and were confirmed experimentally. These findings provide a new insight into the mechanisms of ROS production in RC. PMID:21483483

  13. Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

    Science.gov (United States)

    Oyarzún, Bernardo; Mognetti, Bortolo Matteo

    2018-03-01

    We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

  14. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  15. Balancing Technologies for Reverse Supply Chain with Modularity as Strategy for Competitiveness

    DEFF Research Database (Denmark)

    Vettorato, Giovanna; Hsuan, Juliana

    In this paper we review applications, case studies, models and techniques proposed for the design and optimization of reverse logistics systems according to the principle of modularity. Based on these studies we give an overview of scientific literature that describes and discusses cases of reverse...

  16. An analytic network process-based multicriteria decision making model for a reverse supply chain

    DEFF Research Database (Denmark)

    Govindan, Kannan; Sarkis, J.; Palaniappan, M.

    2013-01-01

    Reverse logistics has emerged as an important dimension for organizations to build their strategic advantage. Part of this effort relies on potentially outsourcing these activities. With this competitive issue in mind, this paper presents a multistep process to select a third-party reverse logistic...

  17. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  18. Designing a Multistage Supply Chain in Cross-Stage Reverse Logistics Environments: Application of Particle Swarm Optimization Algorithms

    Directory of Open Access Journals (Sweden)

    Tzu-An Chiang

    2014-01-01

    Full Text Available This study designed a cross-stage reverse logistics course for defective products so that damaged products generated in downstream partners can be directly returned to upstream partners throughout the stages of a supply chain for rework and maintenance. To solve this reverse supply chain design problem, an optimal cross-stage reverse logistics mathematical model was developed. In addition, we developed a genetic algorithm (GA and three particle swarm optimization (PSO algorithms: the inertia weight method (PSOA_IWM, VMax method (PSOA_VMM, and constriction factor method (PSOA_CFM, which we employed to find solutions to support this mathematical model. Finally, a real case and five simulative cases with different scopes were used to compare the execution times, convergence times, and objective function values of the four algorithms used to validate the model proposed in this study. Regarding system execution time, the GA consumed more time than the other three PSOs did. Regarding objective function value, the GA, PSOA_IWM, and PSOA_CFM could obtain a lower convergence value than PSOA_VMM could. Finally, PSOA_IWM demonstrated a faster convergence speed than PSOA_VMM, PSOA_CFM, and the GA did.

  19. Designing a multistage supply chain in cross-stage reverse logistics environments: application of particle swarm optimization algorithms.

    Science.gov (United States)

    Chiang, Tzu-An; Che, Z H; Cui, Zhihua

    2014-01-01

    This study designed a cross-stage reverse logistics course for defective products so that damaged products generated in downstream partners can be directly returned to upstream partners throughout the stages of a supply chain for rework and maintenance. To solve this reverse supply chain design problem, an optimal cross-stage reverse logistics mathematical model was developed. In addition, we developed a genetic algorithm (GA) and three particle swarm optimization (PSO) algorithms: the inertia weight method (PSOA_IWM), V(Max) method (PSOA_VMM), and constriction factor method (PSOA_CFM), which we employed to find solutions to support this mathematical model. Finally, a real case and five simulative cases with different scopes were used to compare the execution times, convergence times, and objective function values of the four algorithms used to validate the model proposed in this study. Regarding system execution time, the GA consumed more time than the other three PSOs did. Regarding objective function value, the GA, PSOA_IWM, and PSOA_CFM could obtain a lower convergence value than PSOA_VMM could. Finally, PSOA_IWM demonstrated a faster convergence speed than PSOA_VMM, PSOA_CFM, and the GA did.

  20. Designing a Multistage Supply Chain in Cross-Stage Reverse Logistics Environments: Application of Particle Swarm Optimization Algorithms

    Science.gov (United States)

    Chiang, Tzu-An; Che, Z. H.

    2014-01-01

    This study designed a cross-stage reverse logistics course for defective products so that damaged products generated in downstream partners can be directly returned to upstream partners throughout the stages of a supply chain for rework and maintenance. To solve this reverse supply chain design problem, an optimal cross-stage reverse logistics mathematical model was developed. In addition, we developed a genetic algorithm (GA) and three particle swarm optimization (PSO) algorithms: the inertia weight method (PSOA_IWM), V Max method (PSOA_VMM), and constriction factor method (PSOA_CFM), which we employed to find solutions to support this mathematical model. Finally, a real case and five simulative cases with different scopes were used to compare the execution times, convergence times, and objective function values of the four algorithms used to validate the model proposed in this study. Regarding system execution time, the GA consumed more time than the other three PSOs did. Regarding objective function value, the GA, PSOA_IWM, and PSOA_CFM could obtain a lower convergence value than PSOA_VMM could. Finally, PSOA_IWM demonstrated a faster convergence speed than PSOA_VMM, PSOA_CFM, and the GA did. PMID:24772026

  1. Reverse Revenue Sharing Contract versus Two-Part Tariff Contract under a Closed-Loop Supply Chain System

    Directory of Open Access Journals (Sweden)

    Zunya Shi

    2016-01-01

    Full Text Available The importance of remanufacturing has been recognized in research and practice. The integrated system, combining the forward and reverse activities of supply chains, is called closed-loop supply chain (CLSC system. By coordination in the CLSC system, players will get economic improvement. This paper studies different coordination performances of two types of contracts, two-part tariff (TTC and reverse revenue sharing contract (RRSC, in a closed-loop system. Through mathematical analysis based on Stackelberg Game Theory, we find that it is easy for manufacturer to improve more profits and retailer’s collection effects by adjusting the ratio of transfer collection price through RRSC, and we also give the function to calculate the best ratio of transfer collection price, which may be a valuable reference for the decision maker in practice. Besides, our results also suggest that although the profits of the coordinated CLSC system are always higher than the contradictory scenario, the RRSC is more favorable to the manufacturer than to the retailer, as results show that the manufacturer will share more profits from the system through RRSC. Therefore, RRSC has attracted the manufacturers more to closing the supply chain for economic consideration.

  2. Forecasting return products in an integrated forward/reverse supply chain utilizing an ANFIS

    DEFF Research Database (Denmark)

    Kumar, D. T.; Soleimani, H.; Kannan, G.

    2014-01-01

    Interests in Closed-Loop Supply Chain (CLSC) issues are growing day by day within the academia, companies, and customers. Many papers discuss profitability or cost reduction impacts of remanufacturing, but a very important point is almost missing. Indeed, there is no guarantee about the amounts o...

  3. Reverse and closed loop supply chain coordination by considering government role

    DEFF Research Database (Denmark)

    Heydari, Jafar; Govindan, Kannan; Jafari, Amin

    2017-01-01

    consumption by increasing customers’ willingness to return used products through offering a discount or a direct fee in exchange for bringing back EOL products. Afterward, the model is extended to consider a closed loop supply chain (CLSC). Quantity discounts and increasing fee contracts are proposed...

  4. Development of reversible jump Markov Chain Monte Carlo algorithm in the Bayesian mixture modeling for microarray data in Indonesia

    Science.gov (United States)

    Astuti, Ani Budi; Iriawan, Nur; Irhamah, Kuswanto, Heri

    2017-12-01

    In the Bayesian mixture modeling requires stages the identification number of the most appropriate mixture components thus obtained mixture models fit the data through data driven concept. Reversible Jump Markov Chain Monte Carlo (RJMCMC) is a combination of the reversible jump (RJ) concept and the Markov Chain Monte Carlo (MCMC) concept used by some researchers to solve the problem of identifying the number of mixture components which are not known with certainty number. In its application, RJMCMC using the concept of the birth/death and the split-merge with six types of movement, that are w updating, θ updating, z updating, hyperparameter β updating, split-merge for components and birth/death from blank components. The development of the RJMCMC algorithm needs to be done according to the observed case. The purpose of this study is to know the performance of RJMCMC algorithm development in identifying the number of mixture components which are not known with certainty number in the Bayesian mixture modeling for microarray data in Indonesia. The results of this study represent that the concept RJMCMC algorithm development able to properly identify the number of mixture components in the Bayesian normal mixture model wherein the component mixture in the case of microarray data in Indonesia is not known for certain number.

  5. Forecasting return products in an integrated forward/reverse supply chain utilizing an ANFIS

    Directory of Open Access Journals (Sweden)

    Kumar D. Thresh

    2014-09-01

    Full Text Available Interests in Closed-Loop Supply Chain (CLSC issues are growing day by day within the academia, companies, and customers. Many papers discuss profitability or cost reduction impacts of remanufacturing, but a very important point is almost missing. Indeed, there is no guarantee about the amounts of return products even if we know a lot about demands of first products. This uncertainty is due to reasons such as companies’ capabilities in collecting End-of-Life (EOL products, customers’ interests in returning (and current incentives, and other independent collectors. The aim of this paper is to deal with the important gap of the uncertainties of return products. Therefore, we discuss the forecasting method of return products which have their own open-loop supply chain. We develop an integrated two-phase methodology to cope with the closed-loop supply chain design and planning problem. In the first phase, an Adaptive Network Based Fuzzy Inference System (ANFIS is presented to handle the uncertainties of the amounts of return product and to determine the forecasted return rates. In the second phase, and based on the results of the first one, the proposed multi-echelon, multi-product, multi-period, closed-loop supply chain network is optimized. The second-phase optimization is undertaken based on using general exact solvers in order to achieve the global optimum. Finally, the performance of the proposed forecasting method is evaluated in 25 periods using a numerical example, which contains a pattern in the returning of products. The results reveal acceptable performance of the proposed two-phase optimization method. Based on them, such forecasting approaches can be applied to real-case CLSC problems in order to achieve more reliable design and planning of the network

  6. Current reversals and metastable states in the infinite Bose-Hubbard chain with local particle loss

    Science.gov (United States)

    Kiefer-Emmanouilidis, M.; Sirker, J.

    2017-12-01

    We present an algorithm which combines the quantum trajectory approach to open quantum systems with a density-matrix renormalization-group scheme for infinite one-dimensional lattice systems. We apply this method to investigate the long-time dynamics in the Bose-Hubbard model with local particle loss starting from a Mott-insulating initial state with one boson per site. While the short-time dynamics can be described even quantitatively by an equation of motion (EOM) approach at the mean-field level, many-body interactions lead to unexpected effects at intermediate and long times: local particle currents far away from the dissipative site start to reverse direction ultimately leading to a metastable state with a total particle current pointing away from the lossy site. An alternative EOM approach based on an effective fermion model shows that the reversal of currents can be understood qualitatively by the creation of holon-doublon pairs at the edge of the region of reduced particle density. The doublons are then able to escape while the holes move towards the dissipative site, a process reminiscent—in a loose sense—of Hawking radiation.

  7. Unified heuristics to solve routing problem of reverse logistics in sustainable supply chain

    Science.gov (United States)

    Anbuudayasankar, S. P.; Ganesh, K.; Lenny Koh, S. C.; Mohandas, K.

    2010-03-01

    A reverse logistics problem, motivated by many real-life applications, is examined where bottles/cans in which products are delivered from a processing depot to customers in one period are available for return to the depot in the following period. The picked-up bottles/cans need to be adjusted in the place of delivery load. This problem is termed as simultaneous delivery and pick-up problem with constrained capacity (SDPC). We develop three unified heuristics based on extended branch and bound heuristic, genetic algorithm and simulated annealing to solve SDPC. These heuristics are also designed to solve standard travelling salesman problem (TSP) and TSP with simultaneous delivery and pick-up (TSDP). We tested the heuristics on standard, derived and randomly generated datasets of TSP, TSDP and SDPC and obtained satisfying results with high convergence in reasonable time.

  8. Repletion of branched chain amino acids reverses mTORC1 signaling but not improved metabolism during dietary protein dilution

    DEFF Research Database (Denmark)

    Maida, Adriano; Chan, Jessica S K; Sjøberg, Kim Anker

    2017-01-01

    OBJECTIVE: Dietary protein dilution (PD) has been associated with metabolic advantages such as improved glucose homeostasis and increased energy expenditure. This phenotype involves liver-induced release of FGF21 in response to amino acid insufficiency; however, it has remained unclear whether...... dietary dilution of specific amino acids (AAs) is also required. Circulating branched chain amino acids (BCAAs) are sensitive to protein intake, elevated in the serum of obese humans and mice and thought to promote insulin resistance. We tested whether replenishment of dietary BCAAs to an AA-diluted (AAD......) diet is sufficient to reverse the glucoregulatory benefits of dietary PD. METHODS: We conducted AA profiling of serum from healthy humans and lean and high fat-fed or New Zealand obese (NZO) mice following dietary PD. We fed wildtype and NZO mice one of three amino acid defined diets: control, total...

  9. How the reverse supply chain impacts the firm’s financial performance: A manufacturer’s perspective

    DEFF Research Database (Denmark)

    Larsen, Samuel Brüning; Masi, Donato; Feibert, Diana Cordes

    2018-01-01

    Purpose – Although manufacturers have traditionally viewed reverse supply chain (RSC) activities as a costly nuisance, more recent research has found that the RSC can contribute to the firm’s financial performance. This paper identifies how the RSC can contribute to the firm’s financial performance...... identified 15 distinct opportunities for RSC-contribution to the firm’s financial performance. The study has identified 56 contingency factors. These are related to market segmentation, customer behavior, product design, and the firm’s distributor network. The study includes an interrelationship network...... between factors and the RSC’s contribution.  Practical implications – For managers, the paper shows how the RSC can increase the firm’s financial performance and which contingency factors determine whether operating a RSC will be financially viable if implemented. Originality/Value – While extant...

  10. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  11. Novel side-chain liquid crystalline polyester architecture for reversible optical storage

    DEFF Research Database (Denmark)

    Hvilsted, Søren; Andruzzi, Fulvio; Kulinna, Chrisian

    1995-01-01

    New side-chain liquid crystalline polyesters have been prepared by melt transesterification of diphenyl tetradecanedioate and a series of mesogenic 2-[omega-[4-[(4-cyanophenyl)azo]phenoxyl] alkyl]-1,3-propanediols, where the alkyl spacer is hexa-, octa-, and decamethylene in turn. The polyesters...... have molecular masses in the range 5000-89 000. Solution C-13 NMR spectroscopy has been employed to identify carbons of polyester repeat units and of both types of end groups. Polyester phases and phase transitions have been investigated in detail by polarizing optical microscopy and differential...... scanning calorimetry for the hexamethylene spacer architecture with different molecular masses. Using FTIR polarization spectroscopy, the segmental orientation in unoriented polyester films induced by argon ion laser irradiation has been followed and an irradiation-dependent order parameter...

  12. Simplification of reversible Markov chains by removal of states with low equilibrium occupancy.

    Science.gov (United States)

    Ullah, Ghanim; Bruno, William J; Pearson, John E

    2012-10-21

    We present a practical method for simplifying Markov chains on a potentially large state space when detailed balance holds. A simple and transparent technique is introduced to remove states with low equilibrium occupancy. The resulting system has fewer parameters. The resulting effective rates between the remaining nodes give dynamics identical to the original system's except on very fast timescales. This procedure amounts to using separation of timescales to neglect small capacitance nodes in a network of resistors and capacitors. We illustrate the technique by simplifying various reaction networks, including transforming an acyclic four-node network to a three-node cyclic network. For a reaction step in which a ligand binds, the law of mass action implies a forward rate proportional to ligand concentration. The effective rates in the simplified network are found to be rational functions of ligand concentration. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Reversal of an Epigenetic Switch Governing Cell Chaining in Bacillus subtilis by Protein Instability

    Science.gov (United States)

    Chai, Yunrong; Kolter, Roberto; Losick, Richard

    2010-01-01

    Bacillus subtilis forms long chains of cells during growth and biofilm formation. Cell separation is mediated by autolysins, whose genes are under the negative control of a heteromeric complex composed of the proteins SinR and SlrR. Formation of the SinR•SlrR complex is governed by a self-reinforcing, double-negative feedback loop in which SinR represses the gene for SlrR and SlrR, by forming the SinR•SlrR complex, titrates SinR and prevents it from repressing slrR. The loop is a bistable switch and exists in a SlrRLOW state in which autolysin genes are on, and a SlrRHIGH state in which autolysin genes are repressed by SinR•SlrR. Cells in the SlrRLOW state are driven into the SlrRHIGH state by SinI, an antirepressor that binds to and inhibits SinR. However, the mechanism by which cells in the SlrRHIGH state revert back to the SlrRLOW state is unknown. We report that SlrR is proteolytically unstable and present evidence that self-cleavage via a LexA-like autopeptidase and ClpC contribute to its degradation. Cells producing a self-cleavage-resistant mutant of SlrR exhibited more persistent chaining during growth and yielded biofilms with enhanced structural complexity. We propose that degradation of SlrR allows cells to switch from the SlrRHIGH to the SlrRLOW state. PMID:20923420

  14. Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

    Science.gov (United States)

    Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

    2011-12-01

    Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

  15. Pricing Models for Dual-channel Reverse Supply Chain Considering Regional Differences under “Internet Recycling” Mode in China

    Science.gov (United States)

    Wu, Di; Li, Peng; Chen, Juhong

    2018-01-01

    In recent years, the Internet technology has been deeply influencing recycling industry to make it more intelligent and interconnected. However, most existing papers on “Internet Recycling” neglected the problem of pricing strategy under online and offline channels for different levels of recyclers. Moreover, the effect of regional differences has been emphasized a lot in dual-channel forward supply chain, but recycling field has seldom been concerned about it. In this paper, a recycling system consisting of one recycling center and several third-party recyclers (TPR) was investigated based on traditional mode and dual-channel mode. The dual-channel reverse supply chain model is transformed from traditional mode by the introduction of online channel. It involves two recycling modes, as recycling centre for online recovery and “Recycling center+TPR” for offline recovery. By establishing pricing strategies based on Stackelberg game model, the impacts of regional differences were analysed. Finally, numerical analysis was given to illustrate the effectiveness of the pricing mechanisms and strategies.

  16. A multi-objective fuzzy mathematical approach for sustainable reverse supply chain configuration

    Directory of Open Access Journals (Sweden)

    Jyoti D. Darbari

    2017-03-01

    Full Text Available Background: Designing and implementation of reverse logistics (RL network which meets the sustainability targets have been a matter of emerging concern for the electronics companies in India. Objectives: The present study developed a two-phase model for configuration of sustainable RL network design for an Indian manufacturing company to manage its end-of-life and endof-use electronic products. The notable feature of the model was the evaluation of facilities under financial, environmental and social considerations and integration of the facility selection decisions with the network design. Method: In the first phase, an integrated Analytical Hierarchical Process Complex Proportional Assessment methodology was used for the evaluation of the alternative locations in terms of their degree of utility, which in turn was based on the three dimensions of sustainability. In the second phase, the RL network was configured as a bi-objective programming problem, and fuzzy optimisation approach was utilised for obtaining a properly efficient solution to the problem. Results: The compromised solution attained by the proposed fuzzy model demonstrated that the cost differential for choosing recovery facilities with better environmental and social performance was not significant; therefore, Indian manufacturers must not compromise on the sustainability aspects for facility location decisions. Conclusion: The results reaffirmed that the bi-objective fuzzy decision-making model can serve as a decision tool for the Indian manufacturers in designing a sustainable RL network. The multi-objective optimisation model captured a reasonable trade-off between the fuzzy goals of minimising the cost of the RL network and maximising the sustainable performance of the facilities chosen.

  17. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito

    2015-05-01

    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  18. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

    NARCIS (Netherlands)

    Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

    2003-01-01

    An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

  20. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  1. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  2. Estrutura da cadeia reversa: "caminhos" e "descaminhos" da embalagem PET Structure of the reverse chain: "ways" of PET packing

    Directory of Open Access Journals (Sweden)

    Sylmara Lopes Francelino Gonçalves-Dias

    2006-12-01

    Full Text Available O trabalho propõe-se a discutir as possibilidades, limites e desafios da reciclagem de PET - Politereftalato de Etileno. Como fundamentação teórico-conceitual, recorre à discussão sobre a natureza e o alcance da logística reversa, analisando as estratégias para estruturação da cadeia de reciclagem. A pesquisa é de caráter exploratório, com adoção de diferentes estratégias para a coleta de dados, envolvendo fontes secundárias produzidas por órgãos públicos, instituições especializadas e mídia, e ainda entrevistas semi-estruturadas com especialistas na área. Os resultados apontam que múltiplos atores estão envolvidos na estrutura da cadeia reversa do PET e que, apesar do avanço no volume de reciclagem, nenhum dos setores, seja público ou privado, consegue individualmente organizar-se para o alcance da efetividade operacional e ambiental desejável no cenário brasileiro. O alcance de bons resultados depende, sobretudo, do investimento nos dois extremos da cadeia reversa: na coleta seletiva e no mercado para o produto reciclado.The work discuss the possibilities, limits and challenges of the recycling of PET packing in the Brazilian case. The authors analyze the nature and the function of the reverse logistics and its strategies for articulation of the recycling chain. The research is based in the exploratory methodological approach, with adoption of different strategies for the collection of data, involving secondary sources produced by public institutions, specialized organizations and media, and still, interviews semi-structured with specialists in the area. The results point that the Brazilian public and private sectors doesn’t get to organize this activity in the desirable environmental scale. Good performances in the PET packing reverse chain depends on investing in the selective collection and in the market for the recycled products.

  3. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Directory of Open Access Journals (Sweden)

    Laurent Dacheux

    2016-07-01

    Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

  4. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Science.gov (United States)

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  5. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    Science.gov (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  6. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  7. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    Science.gov (United States)

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Bayesian uncertainty quantification for flows in heterogeneous porous media using reversible jump Markov chain Monte Carlo methods

    KAUST Repository

    Mondal, A.

    2010-03-01

    In this paper, we study the uncertainty quantification in inverse problems for flows in heterogeneous porous media. Reversible jump Markov chain Monte Carlo algorithms (MCMC) are used for hierarchical modeling of channelized permeability fields. Within each channel, the permeability is assumed to have a lognormal distribution. Uncertainty quantification in history matching is carried out hierarchically by constructing geologic facies boundaries as well as permeability fields within each facies using dynamic data such as production data. The search with Metropolis-Hastings algorithm results in very low acceptance rate, and consequently, the computations are CPU demanding. To speed-up the computations, we use a two-stage MCMC that utilizes upscaled models to screen the proposals. In our numerical results, we assume that the channels intersect the wells and the intersection locations are known. Our results show that the proposed algorithms are capable of capturing the channel boundaries and describe the permeability variations within the channels using dynamic production history at the wells. © 2009 Elsevier Ltd. All rights reserved.

  9. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    Directory of Open Access Journals (Sweden)

    Ji Yeon Kwon

    2013-09-01

    Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

  10. Game Theoretic Analysis of Pricing and Cooperative Advertising in a Reverse Supply Chain for Unwanted Medications in Households

    Directory of Open Access Journals (Sweden)

    Meina Hua

    2017-10-01

    Full Text Available Improper disposal of household unwanted medications (UMs is an emergency problem around the world that adversely affects the sustainability of the environment and human’s health. However, the current disposal practices, mainly based on advertising and collecting status, are unsatisfactory in most countries and regions. Thus, some scholars proposed an alternative disposal practice that is to provide incentives to customers. This study aims to compare a Single Model (advertising only with a Joint Model (advertising with take-back pricing in a two-echelon reverse supply chain (RSC that is composed of one disposer and one collector. In each model, four games (non-cooperative, collector as the Stackelberg leader, disposer as the Stackelberg leader, and cooperative were established in order to identify the optimal pricing and advertising strategies for both members. The results of the study indicate that there is a Pareto dominant range for Joint Model compared to Single Model, whereas Single Model has no Pareto improvement in any games. Furthermore, in non-cooperative games of Joint Model, it is better to implement the leader-follower structure rather than simultaneous movement structure. Additionally, it is verified that the cooperative game is feasible, which leads to the cooperation between the disposer and the collector, and the extra profit from the cooperation can be shared based on the Nash bargaining game. However, in Single Model, it is better for the disposer to act as a channel leader and the collector figures the follower.

  11. Entanglement entropy of a three-spin-interacting spin chain with a time-reversal-breaking impurity at one boundary

    Science.gov (United States)

    Nag, Tanay; Rajak, Atanu

    2018-04-01

    We investigate the effect of a time-reversal-breaking impurity term (of strength λd) on both the equilibrium and nonequilibrium critical properties of entanglement entropy (EE) in a three-spin-interacting transverse Ising model, which can be mapped to a p -wave superconducting chain with next-nearest-neighbor hopping and interaction. Importantly, we find that the logarithmic scaling of the EE with block size remains unaffected by the application of the impurity term, although, the coefficient (i.e., central charge) varies logarithmically with the impurity strength for a lower range of λd and eventually saturates with an exponential damping factor [˜exp(-λd) ] for the phase boundaries shared with the phase containing two Majorana edge modes. On the other hand, it receives a linear correction in term of λd for an another phase boundary. Finally, we focus to study the effect of the impurity in the time evolution of the EE for the critical quenching case where the impurity term is applied only to the final Hamiltonian. Interestingly, it has been shown that for all the phase boundaries, contrary to the equilibrium case, the saturation value of the EE increases logarithmically with the strength of impurity in a certain regime of λd and finally, for higher values of λd, it increases very slowly dictated by an exponential damping factor. The impurity-induced behavior of EE might bear some deep underlying connection to thermalization.

  12. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription.

    Science.gov (United States)

    Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof

    2012-05-15

    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  13. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam

    2015-01-01

    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  14. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  15. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    Directory of Open Access Journals (Sweden)

    Marcos Lázaro Moreli

    2004-10-01

    Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.

  16. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  17. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  18. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  19. Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

    Science.gov (United States)

    Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

    2015-10-01

    The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

  20. Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

    Directory of Open Access Journals (Sweden)

    Boissière-Michot Florence

    2009-04-01

    Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.

  1. Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

    Science.gov (United States)

    Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

    2012-02-01

    Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

  2. Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Faggioli, F; Pasquini, G; Barba, M

    1998-09-01

    The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

  3. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie

    2013-12-01

    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  4. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  5. Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

    2016-11-22

    Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

  6. Supramolecular Nanoparticles via Single-Chain Folding Driven by Ferrous Ions.

    Science.gov (United States)

    Wang, Fei; Pu, Hongting; Jin, Ming; Wan, Decheng

    2016-02-01

    Single-chain nanoparticles can be obtained via single-chain folding assisted by intramolecular crosslinking reversibly or irreversibly. Single-chain folding is also an efficient route to simulate biomacromolecules. In present study, poly(N-hydroxyethylacrylamide-co-4'-(propoxy urethane ethyl acrylate)-2,2':6',2''-terpyridine) (P(HEAm-co-EMA-Tpy)) is synthesized via reversible addition fragmentation chain transfer polymerization. Single-chain folding and intramolecular crosslinking of P(HEAm-co-EMA-Tpy) are achieved via metal coordination chemistry. The intramolecular interaction is characterized on ultraviolet/visible spectrophotometer (UV-vis spectroscopy), proton nuclear magnetic resonance ((1)H NMR), and differential scanning calorimetry (DSC). The supramolecular crosslinking mediated by Fe(2+) plays an important role in the intramolecular collapsing of the single-chain and the formation of the nanoparticles. The size and morphology of the nanoparticles can be controlled reversibly via metal coordination chemistry, which can be characterized by dynamic light scattering (DLS), transmission electron microscope (TEM), and atomic force microscope (AFM). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  8. Repletion of branched chain amino acids reverses mTORC1 signaling but not improved metabolism during dietary protein dilution

    Directory of Open Access Journals (Sweden)

    Adriano Maida

    2017-08-01

    Conclusions: Repletion of BCAAs in dietary PD is sufficient to oppose changes in somatic mTORC1 signaling but does not reverse the hepatic ISR nor induce insulin resistance in type 2 diabetes during dietary PD.

  9. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  10. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

    2012-01-01

    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

  11. Entropic uncertainty for spin-1/2 XXX chains in the presence of inhomogeneous magnetic fields and its steering via weak measurement reversals

    Science.gov (United States)

    Wang, Dong; Ming, Fei; Huang, Ai-Jun; Sun, Wen-Yang; Ye, Liu

    2017-09-01

    The uncertainty principle configures a low bound to the measuring precision for a pair of non-commuting observables, and hence is considerably nontrivial to quantum precision measurement in the field of quantum information theory. In this letter, we consider the entropic uncertainty relation (EUR) in the context of quantum memory in a two-qubit isotropic Heisenberg spin chain. Specifically, we explore the dynamics of EUR in a practical scenario, where two associated nodes of a one-dimensional XXX-spin chain, under an inhomogeneous magnetic field, are connected to a thermal entanglement. We show that the temperature and magnetic field effect can lead to the inflation of the measuring uncertainty, stemming from the reduction of systematic quantum correlation. Notably, we reveal that, firstly, the uncertainty is not fully dependent on the observed quantum correlation of the system; secondly, the dynamical behaviors of the measuring uncertainty are relatively distinct with respect to ferromagnetism and antiferromagnetism chains. Meanwhile, we deduce that the measuring uncertainty is dramatically correlated with the mixedness of the system, implying that smaller mixedness tends to reduce the uncertainty. Furthermore, we propose an effective strategy to control the uncertainty of interest by means of quantum weak measurement reversal. Therefore, our work may shed light on the dynamics of the measuring uncertainty in the Heisenberg spin chain, and thus be important to quantum precision measurement in various solid-state systems.

  12. Medium-chain triglycerides promote macrophage reverse cholesterol transport and improve atherosclerosis in ApoE-deficient mice fed a high-fat diet.

    Science.gov (United States)

    Zhang, Xinsheng; Zhang, Yong; Liu, Yinghua; Wang, Jin; Xu, Qing; Yu, Xiaoming; Yang, Xueyan; Liu, Zhao; Xue, Changyong

    2016-09-01

    We previously observed that medium-chain triglycerides (MCTs) could reduce body fat mass and improve the metabolism of cholesterol. We hypothesized that MCTs can improve atherosclerosis by promoting the reverse cholesterol transport (RCT) process. Therefore, the objective of this study was to investigate the roles of MCTs in macrophage RCT and the progression of atherosclerosis. To test this hypothesis, 30 4-week-old ApoE-deficient (ApoE(-/-)) mice were randomly divided into 2 groups and fed a diet of 2% MCTs or long-chain triglycerides (LCTs) for 16 weeks. Ten age- and sex-matched C57BL/6J mice were fed a diet of 2% LCTs as the control. Macrophage-to-feces RCT was assessed in vivo by intraperitoneal injection of RAW 264.7 macrophages containing (3)H-labeled cholesterol, and atherosclerotic plaques were measured. The mRNA and protein expressions were determined by reverse transcriptase polymerase chain reaction and Western blot analyses, respectively. There was a greater decrease in body fat mass, atherosclerotic plaques, and an improvement in serum lipid profiles. In addition, the MCT mice group showed an increase in (3)H-tracer in the feces and a decrease in the liver. Significantly higher levels of mRNA and protein expression of hepatic ATP-binding cassette transporter A1, ATP-binding cassette transporter G5, cholesterol 7α-hydroxylase, and intestinal ATP-binding cassette transporter G8, as well as lower levels of expression of intestinal Niemann-Pick C1-like 1, were found in the MCT group. These results suggest that MCTs could obviously promote macrophage RCT and improve atherosclerosis in ApoE(-/-) mice, indicating that MCTs have the potential to prevent cardiovascular disease. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Managing Reverse Logistics or Reversing Logistics Management?

    NARCIS (Netherlands)

    M.P. de Brito (Marisa)

    2004-01-01

    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse

  14. Revealing the Supramolecular Nature of Side-Chain Terpyridine-Functionalized Polymer Networks

    Directory of Open Access Journals (Sweden)

    Jérémy Brassinne

    2015-01-01

    Full Text Available Nowadays, finely controlling the mechanical properties of polymeric materials is possible by incorporating supramolecular motifs into their architecture. In this context, the synthesis of a side-chain terpyridine-functionalized poly(2-(dimethylaminoethyl methacrylate is reported via reversible addition-fragmentation chain transfer polymerization. By addition of transition metal ions, concentrated aqueous solutions of this polymer turn into metallo-supramolecular hydrogels whose dynamic mechanical properties are investigated by rotational rheometry. Hence, the possibility for the material to relax mechanical constrains via dissociation of transient cross-links is brought into light. In addition, the complex phenomena occurring under large oscillatory shear are interpreted in the context of transient networks.

  15. Reverse line blot probe design and polymerase chain reaction optimization for bloodmeal analysis of ticks from the eastern United States.

    Science.gov (United States)

    Scott, M C; Harmon, J R; Tsao, J I; Jones, C J; Hickling, G J

    2012-05-01

    Determining the host preference of vector ticks is vital to elucidating the eco-epidemiology of the diseases they spread. Detachment of ticks from captured hosts can provide evidence of feeding on those host species, but only for those species that are feasible to capture. Recently developed, highly sensitive molecular assays show great promise in allowing host selection to be determined from minute traces of host DNA that persist in recently molted ticks. Using methods developed in Europe as a starting-point, we designed 12S rDNA mitochondrial gene probes suitable for use in a reverse line blot (RLB) assay of ticks feeding on common host species in the eastern United States. This is the first study to use the 12S mitochondrial gene in a RLB bloodmeal assay in North America. The assay combines conventional PCR with a biotin-labeled primer and reverse line blots that can be stripped and rehybridized up to 20 times, making the method less expensive and more straightforward to interpret than previous methods of tick bloodmeal identification. Probes were designed that target the species, genus, genus group, family, order, or class of eight reptile, 13 birds, and 32 mammal hosts. After optimization, the RLB assay correctly identified the current hostspecies for 99% of ticks [Amblyomma americanum (L.) and eight other ixodid tick species] collected directly from known hosts. The method identified previous-host DNA for approximately half of all questing ticks assayed. Multiple bloodmeal determinations were obtained in some instances from feeding and questing ticks; this pattern is consistent with previous RLB studies but requires further investigation. Development of this probe library, suitable for eastern U.S. ecosystems, opens new avenues for eco-epidemiological investigations of this region's tick-host systems.

  16. Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

    Directory of Open Access Journals (Sweden)

    C Coelho

    2003-06-01

    Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

  17. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    Science.gov (United States)

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

  18. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    Science.gov (United States)

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  19. Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

    Directory of Open Access Journals (Sweden)

    W. Ali

    2017-06-01

    Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

  20. Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

    1999-01-01

    A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...

  1. Trinuclear ruthenium dioxolene complexes based on the bridging ligand hexahydroxytriphenylene: electrochemistry, spectroscopy, and near-infrared electrochromic behaviour associated with a reversible seven-membered redox chain.

    Science.gov (United States)

    Grange, Christopher S; Meijer, Anthony J H M; Ward, Michael D

    2010-01-07

    The trinuclear complexes [{(R2bipy)2Ru}3(mu3-HHTP)](PF6)3 [1(PF6)3, R = H; 2(PF6)3, R = 4-tBu] contain three {Ru(R2bipy)2}2+ fragments connected to the triangular tris-chelating ligand hexahydroxytriphenylene (H6HHTP). This bridging ligand contains three dioxolene-type binding sites, each of which can reversibly convert between dianionic catecholate (cat), monoanionic semiquinone (sq) or neutral quinone (q) redox states. The bridging ligand as a whole can therefore exist in seven different redox states from fully reduced [cat,cat,cat]6- through to fully oxidised, neutral [q,q,q]. Cyclic voltammetry of 1(PF6)3 in MeCN reveals six redox processes of which the three at more positive potentials (the sq/q couples) are reversible but the three at more negative potentials (the sq/cat couples) are irreversible with distorted wave shapes due to the insolubility of the reduced forms of the complex. In contrast, the more soluble complex 2(PF6)3 displays six reversible one-electron redox processes making all components of a seven-membered redox chain accessible. UV/Vis/NIR spectro-electrochemical studies reveal rich spectroscopic behaviour, with--in particular--very intense transitions in the near-IR region in many of the oxidation states associated with Ru(II)-->(dioxolene) MLCT and bridging ligand centred pi-pi* transitions. TDDFT calculations were used to analyse the electronic spectra in all seven oxidation states; the calculated spectra generally show very good agreement with experiment, which has allowed a fairly complete assignment of the low-energy transitions. The strong electrochromism of the complexes in the near-IR region has formed the basis of an optical window in which a thin film of 1(PF6)3 or 2(PF6)3 on a conductive glass surface can be reversibly and rapidly switched between redox states that alternate between strongly absorbing or near-transparent at 1100 nm, with--for 2(PF6)3--the switching being stable and reversible in water over thousands of cycles.

  2. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  3. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Science.gov (United States)

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  4. Managing Reverse Logistics or Reversing Logistics Management?

    OpenAIRE

    Brito, Marisa

    2004-01-01

    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...

  5. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    Science.gov (United States)

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  6. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

    Science.gov (United States)

    Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

    2012-01-01

    A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

  7. Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

    Science.gov (United States)

    Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

    2011-07-01

    Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

  8. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  9. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  10. Factors Influencing Consumers’ Intention to Return the End of Life Electronic Products through Reverse Supply Chain Management for Reuse, Repair and Recycling

    Directory of Open Access Journals (Sweden)

    Kamyar Kianpour

    2017-09-01

    Full Text Available Resource depletion, population growth and environmental problems force companies to collect their end of life (EOL products for reuse, recycle and refurbishment through reverse supply chain management (RSCM. Success in collecting the EOL products through RSCM depends on the customers’ participation intention. The objectives of this study are: (1 To examine the important factors influencing customers’ attitude to participate in RSCM; (2 To examine the important factors influencing customers’ subjective norm to participate in RSCM; (3 To examine the main factors influencing customers’ perceived behavioral control to participate in RSCM; (4 To examine the influence of attitude, subjective norms and perceived behavioral control on customers’ participation intention in RSCM. The Decomposed Theory of Planned Behaviour (DTPB has been chosen as the underpinning theory for this research. The research conducted employed the quantitative approach. Non-probability (convenience sampling method was used to determine the sample and data was collected using questionnaires. Partial Least Squares-Structural Equation Modeling (PLS-SEM technique was employed. A total of 800 questionnaires were distributed among customers of electronic products in Malaysia. Finally, the questionnaire was distributed among the customers in electronic retailer companies based on convenience sampling method. The empirical results confirm that consumers perception about the risk associated with EOL electronic products, consumers’ ecological knowledge and relative advantages associated with reuse, repair and recycling can influence the attitude of consumers to return the EOL products for reuse, repair and recycling to producer.

  11. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

    2006-01-01

    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  12. Evaluating viral interference between Influenza virus and Newcastle disease virus using real-time reverse transcription–polymerase chain reaction in chicken eggs

    Directory of Open Access Journals (Sweden)

    Ge Shengqiang

    2012-07-01

    Full Text Available Abstract Background Simultaneous and sequential allantoic cavity inoculations of Specific-pathogen-free (SPF chicken eggs with Influenza virus (AIV and Newcastle disease virus (NDV demonstrated that the interaction of AIV and NDV during co-infection was variable. Our research revisited the replication interference potential of AIV and NDV using real-time reverse transcription–polymerase chain reaction (real-time RT-PCR for AIV and NDV to specifically detect the viral genomes in mixed infections. Results Data from this survey showed that when different doses of NDV (Lasota or F48E8 and AIV (F98 or H5N1 were simultaneously inoculated into embryonating chicken eggs (ECE, interference with the growth of NDV occurred, while interference with the growth of AIV did not occur. When equal amount of the two viruses were sequentially employed, the degree of interference was dependent upon the time of superinfection and the virulence of virus. Conclusion AIV have a negative impact on NDV growth if they are inoculated simultaneously or sequentially and that the degree of interference depended upon the quantity and relative virulence of the virus strains used; however, interference with AIV was not observed. Only if NDV were inoculated at an earlier time will NDV able to interfere with the growth of AIV.

  13. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    Science.gov (United States)

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  14. Simultaneous detection of viruses and Toxoplasma gondii in cerebrospinal fluid specimens by multiplex polymerase chain reaction-based reverse hybridization assay.

    Science.gov (United States)

    Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe

    2009-04-01

    The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.

  15. Highly conductive side chain block copolymer anion exchange membranes.

    Science.gov (United States)

    Wang, Lizhu; Hickner, Michael A

    2016-06-28

    Block copolymers based on poly(styrene) having pendent trimethyl styrenylbutyl ammonium (with four carbon ring-ionic group alkyl linkers) or benzyltrimethyl ammonium groups with a methylene bridge between the ring and ionic group were synthesized by reversible addition-fragmentation radical (RAFT) polymerization as anion exchange membranes (AEMs). The C4 side chain polymer showed a 17% increase in Cl(-) conductivity of 33.7 mS cm(-1) compared to the benzyltrimethyl ammonium sample (28.9 mS cm(-1)) under the same conditions (IEC = 3.20 meq. g(-1), hydration number, λ = ∼7.0, cast from DMF/1-propanol (v/v = 3 : 1), relative humidity = 95%). As confirmed by small angle X-ray scattering (SAXS), the side chain block copolymers with tethered ammonium cations showed well-defined lamellar morphologies and a significant reduction in interdomain spacing compared to benzyltrimethyl ammonium containing block copolymers. The chemical stabilities of the block copolymers were evaluated under severe, accelerated conditions, and degradation was observed by (1)H NMR. The block copolymer with C4 side chain trimethyl styrenylbutyl ammonium motifs displayed slightly improved stability compared to that of a benzyltrimethyl ammonium-based AEM at 80 °C in 1 M NaOD aqueous solution for 30 days.

  16. Synthesis and Self-Assembly of Block Copolymers Containing Temperature Sensitive and Degradable Chain Segments.

    Science.gov (United States)

    Gong, Hong-Liang; Lei, Lei; Shi, Shu-Xian; Xia, Yu-Zheng; Chen, Xiao-Nong

    2018-05-01

    In this work, polylactide-b-poly(N-isopropylacrylamide) were synthesized by the combination of controlled ring-opening polymerization and reversible addition fragmentation chain transfer polymerization. These block copolymers with molecular weight range from 7,900 to 12,000 g/mol and narrow polydispersity (≤1.19) can self-assemble into micelles (polylactide core, poly(N-isopropylacrylamide) shell) in water at certain temperature range, which have been evidenced by laser particle size analyzer proton nuclear magnetic resonance and transmission electron microscopy. Such micelles exhibit obvious thermo-responsive properties: (1) Poly(N-isopropylacrylamide) blocks collapse on the polylactide core as system temperature increase, leading to reduce of micelle size. (2) Micelles with short poly(N-isopropylacrylamide) blocks tend to aggregate together when temperature increased, which is resulted from the reduction of the system hydrophilicity and the decreased repulsive force between micelles.

  17. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    Science.gov (United States)

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  18. Development of real-time reverse transcription polymerase chain reaction assays to quantify insulin-like growth factor receptor and insulin receptor expression in equine tissue

    Directory of Open Access Journals (Sweden)

    Stephen B. Hughes

    2013-08-01

    Full Text Available The insulin-like growth factor system (insulin-like growth factor 1, insulin-like growth factor 2, insulin-like growth factor 1 receptor, insulin-like growth factor 2 receptor and six insulin-like growth factor-binding proteins and insulin are essential to muscle metabolism and most aspects of male and female reproduction. Insulin-like growth factor and insulin play important roles in the regulation of cell growth, differentiation and the maintenance of cell differentiation in mammals. In order to better understand the local factors that regulate equine physiology, such as muscle metabolism and reproduction (e.g., germ cell development and fertilisation, real-time reverse transcription polymerase chain reaction assays for quantification of equine insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were developed. The assays were sensitive: 192 copies/µLand 891 copies/µL for insulin-like growth factor 1 receptor, messenger ribonucleic acid and insulin receptor respectively (95%limit of detection, and efficient: 1.01 for the insulin-like growth factor 1 receptor assay and 0.95 for the insulin receptor assay. The assays had a broad linear range of detection (seven logs for insulin-like growth factor 1 receptor and six logs for insulin receptor. This allowed for analysis of very small amounts of messenger ribonucleic acid. Low concentrations of both insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were detected in endometrium, lung and spleen samples, whilst high concentrations were detected in heart, muscle and kidney samples, this was most likely due to the high level of glucose metabolism and glucose utilisation by these tissues. The assays developed for insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid expression have been shown to work on equine tissue and will contribute to the understanding of insulin and insulin-like growth factor 1

  19. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

    Science.gov (United States)

    Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

    2000-12-01

    ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

  20. Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

    International Nuclear Information System (INIS)

    Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

    1999-01-01

    We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  1. Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform.

    Science.gov (United States)

    Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K

    2016-10-15

     The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV).  The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus.  The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%.  The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  2. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

    Science.gov (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  3. Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

    Science.gov (United States)

    Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

    2014-07-01

    A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines.

  4. Comparison of the Diagnostic Value Between Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Histopathologic Examination in Sentinel Lymph Nodes for Patients With Gastric Carcinoma.

    Science.gov (United States)

    Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung

    2016-05-01

    Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

    Directory of Open Access Journals (Sweden)

    Marilia Farignoli Romeiro

    2016-06-01

    Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  6. Detection of feline coronavirus in cheetah (Acinonyx jubatus) feces by reverse transcription-nested polymerase chain reaction in cheetahs with variable frequency of viral shedding.

    Science.gov (United States)

    Gaffney, Patricia M; Kennedy, Melissa; Terio, Karen; Gardner, Ian; Lothamer, Chad; Coleman, Kathleen; Munson, Linda

    2012-12-01

    Cheetahs (Acinonyx jubatus) are a highly threatened species because of habitat loss, human conflict, and high prevalence of disease in captivity. An epidemic of feline infectious peritonitis and concern for spread of infectious disease resulted in decreased movement of cheetahs between U.S. zoological facilities for managed captive breeding. Identifying the true feline coronavirus (FCoV) infection status of cheetahs is challenging because of inconsistent correlation between seropositivity and fecal viral shedding. Because the pattern of fecal shedding of FCoV is unknown in cheetahs, this study aimed to assess the frequency of detectable fecal viral shedding in a 30-day period and to determine the most efficient fecal sampling strategy to identify cheetahs shedding FCoV. Fecal samples were collected from 16 cheetahs housed at seven zoological facilities for 30 to 46 consecutive days; the samples were evaluated for the presence of FCoV by reverse transcription-nested polymerase chain reaction (RT-nPCR). Forty-four percent (7/16) of cheetahs had detectable FCoV in feces, and the proportion of positive samples for individual animals ranged from 13 to 93%. Cheetahs shed virus persistently, intermittently, or rarely over 30-46 days. Fecal RT-nPCR results were used to calculate the probability of correctly identifying a cheetah known to shed virus given multiple hypothetical fecal collection schedules. The most efficient hypothetical fecal sample collection schedule was evaluation of five individual consecutive fecal samples, resulting in a 90% probability of identifying a known shedder. Demographic and management risk factors were not significantly associated (P cheetahs shed virus intermittently to rarely, fecal sampling schedules meant to identify all known shedders would be impractical with current tests and eradication of virus from the population unreasonable. Managing the captive population as endemically infected with FCoV may be a more feasible approach.

  7. Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior

    Science.gov (United States)

    Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

    2011-01-01

    Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

  8. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    Science.gov (United States)

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

    Science.gov (United States)

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

    2003-01-01

    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

  10. Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

    Science.gov (United States)

    Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

    2008-05-20

    Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

  11. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill.

    Science.gov (United States)

    de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G

    2010-09-20

    Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression

  12. Utility of a multiplex reverse transcriptasepolymerase chain reaction assay (HemaVision in the evaluation of genetic abnormalities in Korean children with acute leukemia: a single institution study

    Directory of Open Access Journals (Sweden)

    Hye-Jin kim

    2013-06-01

    Full Text Available &lt;b&gt;Purpose:&lt;/b&gt; In children with acute leukemia, bone marrow genetic abnormalities (GA have prognostic significance, and may be the basis for minimal residual disease monitoring. Since April 2007, we have used a multiplex reverse transcriptase-polymerase chain reaction tool (HemaVision to detect of GA. &lt;b&gt;Methods:&lt;/b&gt; In this study, we reviewed the results of HemaVision screening in 270 children with acute leukemia, newly diagnosed at The Catholic University of Korea from April 2007 to December 2011, and compared the results with those of fluorescence in situ hybridization (FISH, and G-band karyotyping. &lt;b&gt;Results:&lt;/b&gt; Among the 270 children (153 males, 117 females, 187 acute lymphoblastic leukemia and 74 acute myeloid leukemia patients were identified. Overall, GA was detected in 230 patients (85.2%. HemaVision, FISH, and G-band karyotyping identified GA in 125 (46.3%, 126 (46.7%, and 215 patients (79.6%, respectively. TEL-AML1 (20.9%, 39/187 and AML1-ETO (27%, 20/74 were the most common GA in ALL and AML, respectively. Overall sensitivity of HemaVision was 98.4%, with false-negative results in 2 instances: 1 each for TEL-AML1 and MLL-AF4 . An aggregate of diseasesspecific FISH showed 100% sensitivity in detection of GA covered by HemaVision for actual probes utilized. G-band karyotype revealed GA other than those covered by HemaVison screening in 133 patients (49.3%. Except for hyperdiplody and hypodiploidy, recurrent GA as defined by the World Health Organizationthat were not screened by HemaVision, were absent in the karyotype. &lt;b&gt;Conclusion:&lt;/b&gt; HemaVision, supported by an aggregate of FISH tests for important translocations, may allow for accurate diagnosis of GA in Korean children with acute leukemia.

  13. Reverse transcription quantitative real-time polymerase chain reaction reference genes in the spared nerve injury model of neuropathic pain: validation and literature search.

    Science.gov (United States)

    Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R

    2013-07-10

    The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process

  14. Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

    DEFF Research Database (Denmark)

    Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo

    2011-01-01

    and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without modifications......The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT...

  15. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

    Science.gov (United States)

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

  16. Fluorinated polyimides grafted with poly(ethylene glycol) side chains by the RAFT-mediated process and their membranes

    International Nuclear Information System (INIS)

    Chen Yiwang; Chen Lie; Nie Huarong; Kang, E.T.; Vora, R.H.

    2005-01-01

    Graft polymerization of poly(ethylene glycol) methyl ether methacrylate (PEGMA) from fluorinated polyimide (FPI) was carried out by the reversible addition-fragmentation chain transfer (RAFT)-mediated process. The peroxides generated by the ozone treatment on FPI facilitated the thermally-initiated graft copolymerization from FPI backbone. The 'living' character of the graft chain growing was ascertained in the subsequent chain extension of PEGMA. Nuclear magnetic resonance (NMR) and molecular weight measurements were used to characterize the chemical composition and structure of the copolymers. Microfiltration (MF) membranes were fabricated from the FPI-g-PEGMA comb copolymers by phase inversion in aqueous media. Surface composition analysis of the membranes scanned by X-ray photoelectron spectroscopy (XPS) revealed a substantial surface enrichment of the hydrophilic components. The pore size distribution of the resulting membranes was found to be much more uniform than that of the corresponding membranes cast from FPI-g-PEGMA prepared by the conventional radical polymerization process in the absence of the chain transfer agent. The morphology of the membranes was characterized by scanning electron microscopy (SEM)

  17. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    Science.gov (United States)

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  18. Long-term reversibility of renal dysfunction associated to light chain deposition disease with bortezomib and dexamethasone and high dose therapy and autologous stem cell transplantation

    Directory of Open Access Journals (Sweden)

    Tomás J. González-López

    2011-11-01

    Full Text Available A 63-year-old woman presented with progressive renal insufficiency, until a glomerular filtration rate (GFR of 12 mL/min. A renal biopsy demonstrated glomerular deposition of immunoglobulin k light chain. The presence of a small population of monoclonal plasmacytes producing an only light k monoclonal component was demonstrated and Bortezomib and Dexamethasone (BD was provided as initial therapy. After seven courses of therapy, renal function improved without dialysis requirements up to a GFR 31 mL/min. Under hematological complete response (HCR the patient underwent high dose of melphalan (HDM and autologous peripheral blood stem cell transplant. Fifty-four months later the patient remains in HCR and the GFR has progressively improved up to 48 mL/min. This report describes a notably renal function improvement in a patient with Light Chain Deposition Disease after therapy with BD followed by HDM, which can support this treatment as a future option for these patients.

  19. Detection of infectious bursal disease virus in various lymphoid tissues of experimentally infected specific pathogen free chickens by different reverse transcription polymerase chain reaction assays

    DEFF Research Database (Denmark)

    Kabell, Susanne; Handberg, Kurt; Kusk, Mette

    2005-01-01

    Infectious bursal disease (IBD) is a worldwide distributed immunosuppressive viral disease in young chickens, controlled by vaccination. Emergence of several strains of IBD virus (IBDV) has created a demand for strain-specific diagnostic tools. In the present experiment, five different reverse...... included vaccine strain D78, classical strain Faragher 52/70, and the very virulent Danish strain DK01 The presence of the virus infection was confirmed by histopathologic evaluation of bursa lesions. The largest number of positive samples was obtained with a strain-specific two-step multiplex (MPX) RT...

  20. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  1. Reverse Algols

    Science.gov (United States)

    Leung, K. C.

    1989-01-01

    Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.

  2. Reverse Logistics

    OpenAIRE

    Kulikova, Olga

    2016-01-01

    This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...

  3. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium.

    Science.gov (United States)

    Die, Jose V; Baldwin, Ransom L; Rowland, Lisa J; Li, Robert; Oh, Sunghee; Li, Congjun; Connor, Erin E; Ranilla, Maria-Jose

    2017-01-01

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.

  4. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR analysis in the rumen epithelium.

    Directory of Open Access Journals (Sweden)

    Jose V Die

    Full Text Available The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.

  5. A Framework for Reverse Logistics

    NARCIS (Netherlands)

    M.P. de Brito (Marisa); R. Dekker (Rommert)

    2003-01-01

    textabstractReverse Logistics has been stretching out worldwide, involving all the layers of supply chains in various industry sectors. While some actors in the chain have been forced to take products back, others have pro-actively done so, attracted by the value in used products One way or the

  6. Reverse Osmosis

    Indian Academy of Sciences (India)

    many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...

  7. Significance of detecting circulating hepatocellular carcinoma cells in peripheral blood of hepatocellular carcinoma patients by nested reverse transcription-polymerase chain reaction and its clinical value: a retrospective study.

    Science.gov (United States)

    Liu, Yang; Wang, Yue-ru; Wang, Long; Song, Rui-mei; Zhou, Bo; Song, Zhen-shun

    2014-01-01

    Circulating hepatocellular carcinoma cells may be detected by reverse transcription-polymerase chain reaction. We investigated the relationship between circulating hepatocellular carcinoma cells and hepatoma patient survival after different managements and survival periods. Peripheral vein blood (5 ml) samples were obtained from 113 patients with hepatocellular carcinoma and from 33 control subjects (9 with liver cirrhosis after hepatitis B, 14 with chronic hepatitis B, 10 healthy individuals) between January 1, 2009, and December 31, 2013. To detect circulating hepatocellular carcinoma cells in peripheral blood, alpha-fetoprotein messenger RNA was amplified from total RNA extracted from whole blood by reverse transcription-polymerase chain reaction. Alpha-fetoprotein messenger RNA was detected in 59 blood samples from the hepatocellular carcinoma patients (59/113, 52.2%). In contrast, there were no clinical control subjects whose samples showed detectable alpha-fetoprotein messenger RNA. The presence of alpha-fetoprotein messenger RNA in blood seemed to be correlated with the stage (by TNM classification) of hepatocellular carcinoma, serum alpha-fetoprotein value, and the presence of intrahepatic metastasis, portal vein thrombosis, tumor diameter and/or distant metastasis. In addition, alpha-fetoprotein messenger RNA was detected in the blood of 25 patients showing distant metastasis at extrahepatic organs (100%), in contrast to 32 of 88 cases without metastasis (36.4%). All the patients with hepatocellular carcinoma were followed. Seventeen patients with resection of a T 2 stage hepatocellular carcinoma had a survival of 3.2 years after surgical management, 38 cases with resection of a T3 stage hepatocellular carcinoma had a 1.3-year survival, and only 37 cases with T4 stage disease after different treatments except surgery survived for 0.6 years (P <0.01). The presence of alpha-fetoprotein messenger RNA in peripheral blood may be an indicator of circulating

  8. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    Science.gov (United States)

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  9. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  10. Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

    Science.gov (United States)

    Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

    2000-05-01

    We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

  11. Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

    2011-11-01

    Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

  12. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India

    Directory of Open Access Journals (Sweden)

    K. Nithin Prabhu

    2018-02-01

    Full Text Available Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT, as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR, have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat and wild (leopard, wolf and jackal animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  13. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  14. Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

    Science.gov (United States)

    Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

    2016-01-01

    Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

  15. Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Nishiura, T; Abe, K

    1999-01-01

    The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

  16. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

    Science.gov (United States)

    Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

    2018-02-28

    Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  17. Impact of supply chain management practices on sustainability

    DEFF Research Database (Denmark)

    Govindan, Kannan; Azevedo, Susana G.; Carvalho, Helena

    2014-01-01

    elimination," "supply chain risk management" and "cleaner production." The following lean, resilient and green supply chain management practices do not have a significant impact on supply chain sustainability: "flexible transportation," "flexible sourcing," "ISO 14001 certification," and "reverse logistics...

  18. PMMA-g-OEtOx Graft Copolymers: Influence of Grafting Degree and Side Chain Length on the Conformation in Aqueous Solution

    Directory of Open Access Journals (Sweden)

    Irina Muljajew

    2018-03-01

    Full Text Available Depending on the degree of grafting (DG and the side chain degree of polymerization (DP, graft copolymers may feature properties similar to statistical copolymers or to block copolymers. This issue is approached by studying aqueous solutions of PMMA-g-OEtOx graft copolymers comprising a hydrophobic poly(methyl methacrylate (PMMA backbone and hydrophilic oligo(2-ethyl-2-oxazoline (OEtOx side chains. The graft copolymers were synthesized via reversible addition-fragmentation chain transfer (RAFT copolymerization of methyl methacrylate (MMA and OEtOx-methacrylate macromonomers of varying DP. All aqueous solutions of PMMA-g-OEtOx (9% ≤ DG ≤ 34%; 5 ≤ side chain DP ≤ 24 revealed lower critical solution temperature behavior. The graft copolymer architecture significantly influenced the aggregation behavior, the conformation in aqueous solution and the coil to globule transition, as verified by means of turbidimetry, dynamic light scattering, nuclear magnetic resonance spectroscopy, and analytical ultracentrifugation. The aggregation behavior of graft copolymers with a side chain DP of 5 was significantly affected by small variations of the DG, occasionally forming mesoglobules above the cloud point temperature (Tcp, which was around human body temperature. On the other hand, PMMA-g-OEtOx with elongated side chains assembled into well-defined structures below the Tcp (apparent aggregation number (Nagg = 10 that were able to solubilize Disperse Orange 3. The thermoresponsive behavior of aqueous solutions thus resembled that of micelles comprising a poly(2-ethyl-2-oxazoline (PEtOx shell (Tcp > 60 °C.

  19. Surface functionalization of quantum dots with fine-structured pH-sensitive phospholipid polymer chains.

    Science.gov (United States)

    Liu, Yihua; Inoue, Yuuki; Ishihara, Kazuhiko

    2015-11-01

    To add novel functionality to quantum dots (QDs), we synthesized water-soluble and pH-responsive block-type polymers by reversible addition-fragmentation chain transfer (RAFT) polymerization. The polymers were composed of cytocompatible 2-methacryloyloxyethyl phosphorylcholine (MPC) polymer segments, which contain a small fraction of active ester groups and can be used to conjugate biologically active compounds to the polymer, and pH-responsive poly(2-(N,N-diethylamino) ethyl methacrylate (DEAEMA)) segments. One terminal of the polymer chain had a hydrophobic alkyl group that originated from the RAFT initiator. This hydrophobic group can bind to the hydrophobic layer on the QD surface. A fluorescent dye was conjugated to the polymer chains via the active ester group. The block-type polymers have an amphiphilic nature in aqueous medium. The polymers were thus easily bound to the QD surface upon evaporation of the solvent from a solution containing the block-type polymer and QDs, yielding QD/fluorescence dye-conjugated polymer hybrid nanoparticles. Fluorescence resonance energy transfer (FRET) between the QDs (donors) and the fluorescent dye molecules (acceptors) was used to obtain information on the conformational dynamics of the immobilized polymers. Higher FRET efficiency of the QD/fluorescent dye-conjugated polymer hybrid nanoparticles was observed at pH 7.4 as compared to pH 5.0 due to a stretching-shrinking conformational motion of the poly(DEAEMA) segments in response to changes in pH. We concluded that the block-type MPC polymer-modified nanoparticles could be used to evaluate the pH of cells via FRET fluorescence based on the cytocompatibility of the MPC polymer. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression.

    Science.gov (United States)

    Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong

    2013-01-01

    In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

  1. Evaluation of the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction assay and the INFINITI® Respiratory Viral Panel Plus assay for the detection of human metapneumovirus in Kuwait.

    Science.gov (United States)

    Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad

    2012-04-01

    Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

    2012-04-01

    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  3. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

    Science.gov (United States)

    Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

    2015-03-01

    African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. © 2015 The Author(s).

  4. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

    Science.gov (United States)

    Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

    2017-08-02

    Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

  5. Sensitivity and specificity of real-time reverse transcription polymerase chain reaction, histopathology, and immunohistochemical labeling for the detection of Rift Valley fever virus in naturally infected cattle and sheep.

    Science.gov (United States)

    Odendaal, Lieza; Fosgate, Geoffrey T; Romito, Marco; Coetzer, Jacobus A W; Clift, Sarah J

    2014-01-01

    Real-time reverse transcription polymerase chain reaction (real-time RT-PCR), histopathology, and immunohistochemical labeling (IHC) were performed on liver specimens from 380 naturally infected cattle and sheep necropsied during the 2010 Rift Valley fever (RVF) epidemic in South Africa. Sensitivity (Se) and specificity (Sp) of real-time RT-PCR, histopathology, and IHC were estimated in a latent-class model using a Bayesian framework. The Se and Sp of real-time RT-PCR were estimated as 97.4% (95% confidence interval [CI] = 95.2-98.8%) and 71.7% (95% CI = 65-77.9%) respectively. The Se and Sp of histopathology were estimated as 94.6% (95% CI = 91-97.2%) and 92.3% (95% CI = 87.6-95.8%), respectively. The Se and Sp of IHC were estimated as 97.6% (95% CI = 93.9-99.8%) and 99.4% (95% CI = 96.9-100%), respectively. Decreased Sp of real-time RT-PCR was ascribed to cross-contamination of samples. Stratified analysis of the data suggested variations in test accuracy with fetuses and severely autolyzed specimens. The Sp of histopathology in fetuses (83%) was 9.3% lower than the sample population (92.3%). The Se of IHC decreased from 97.6% to 81.5% in the presence of severe autolysis. The diagnostic Se and Sp of histopathology was higher than expected, confirming the value of routine postmortem examinations and histopathology of liver specimens. Aborted fetuses, however, should be screened using a variety of tests in areas endemic for RVF, and results from severely autolyzed specimens should be interpreted with caution. The most feasible testing option for countries lacking suitably equipped laboratories seems to be routine histology in combination with IHC.

  6. A Dietary Medium-Chain Fatty Acid, Decanoic Acid, Inhibits Recruitment of Nur77 to the HSD3B2 Promoter In Vitro and Reverses Endocrine and Metabolic Abnormalities in a Rat Model of Polycystic Ovary Syndrome.

    Science.gov (United States)

    Lee, Bao Hui; Indran, Inthrani Raja; Tan, Huey Min; Li, Yu; Zhang, Zhiwei; Li, Jun; Yong, Eu-Leong

    2016-01-01

    Hyperandrogenism is the central feature of polycystic ovary syndrome (PCOS). Due to the intricate relationship between hyperandrogenism and insulin resistance in PCOS, 50%-70% of these patients also present with hyperinsulinemia. Metformin, an insulin sensitizer, has been used to reduce insulin resistance and improve fertility in women with PCOS. In previous work, we have noted that a dietary medium-chain fatty acid, decanoic acid (DA), improves glucose tolerance and lipid profile in a mouse model of diabetes. Here, we report for the first time that DA, like metformin, inhibits androgen biosynthesis in NCI-H295R steroidogenic cells by regulating the enzyme 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase type 2 (HSD3B2). The inhibitory effect on HSD3B2 and androgen production required cAMP stimulation, suggesting a mechanistic action via the cAMP-stimulated pathway. Specifically, both DA and metformin reduced cAMP-enhanced recruitment of the orphan nuclear receptor Nur77 to the HSD3B2 promoter, coupled with decreased transcription and protein expression of HSD3B2. In a letrozole-induced PCOS rat model, treatment with DA or metformin reduced serum-free testosterone, lowered fasting insulin, and restored estrous cyclicity. In addition, DA treatment lowered serum total testosterone and decreased HSD3B2 protein expression in the adrenals and ovaries. We conclude that DA inhibits androgen biosynthesis via mechanisms resulting in the suppression of HSD3B2 expression, an effect consistently observed both in vitro and in vivo. The efficacy of DA in reversing the endocrine and metabolic abnormalities of the letrozole-induced PCOS rat model are promising, raising the possibility that diets including DA could be beneficial for the management of both hyperandrogenism and insulin resistance in PCOS.

  7. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  8. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  9. Side-chain amino-acid-based pH-responsive self-assembled block copolymers for drug delivery and gene transfer.

    Science.gov (United States)

    Kumar, Sonu; Acharya, Rituparna; Chatterji, Urmi; De, Priyadarsi

    2013-12-10

    Developing safe and effective nanocarriers for multitype of delivery system is advantageous for several kinds of successful biomedicinal therapy with the same carrier. In the present study, we have designed amino acid biomolecules derived hybrid block copolymers which can act as a promising vehicle for both drug delivery and gene transfer. Two representative natural chiral amino acid-containing (l-phenylalanine and l-alanine) vinyl monomers were polymerized via reversible addition-fragmentation chain transfer (RAFT) process in the presence of monomethoxy poly(ethylene glycol) based macro-chain transfer agents (mPEGn-CTA) for the synthesis of well-defined side-chain amino-acid-based amphiphilic block copolymers, monomethoxy poly(ethylene glycol)-b-poly(Boc-amino acid methacryloyloxyethyl ester) (mPEGn-b-P(Boc-AA-EMA)). The self-assembled micellar aggregation of these amphiphilic block copolymers were studied by fluorescence spectroscopy, atomic force microscopy (AFM) and scanning electron microscopy (SEM). Potential applications of these hybrid polymers as drug carrier have been demonstrated in vitro by encapsulation of nile red dye or doxorubicin drug into the core of the micellar nanoaggregates. Deprotection of side-chain Boc- groups in the amphiphilic block copolymers subsequently transformed them into double hydrophilic pH-responsive cationic block copolymers having primary amino groups in the side-chain terminal. The DNA binding ability of these cationic block copolymers were further investigated by using agarose gel retardation assay and AFM. The in vitro cytotoxicity assay demonstrated their biocompatible nature and these polymers can serve as "smart" materials for promising bioapplications.

  10. Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

    Science.gov (United States)

    Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

    2010-10-01

    The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT

  11. Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis.

    Science.gov (United States)

    Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin

    2017-04-01

    Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

  12. Reversible dimer formation and stability of the anti-tumour single-chain Fv antibody MFE-23 by neutron scattering, analytical ultracentrifugation, and NMR and FT-IR spectroscopy.

    Science.gov (United States)

    Lee, Yie Chia; Boehm, Mark K; Chester, Kerry A; Begent, Richard H J; Perkins, Stephen J

    2002-06-28

    MFE-23 is a single chain Fv (scFv) antibody molecule used to target colorectal cancer through its high affinity for the tumour marker carcinoembryonic antigen (CEA). ScFv molecules are formed from peptide-linked antibody V(H) and V(L) domains, and many of these form dimers. Our recent crystal structure for MFE-23 showed that this formed an unusual symmetric back-to-back association of two monomers that is consistent with a domain-swapped diabody structure. Neutron scattering and modelling fits showed that MFE-23 existed as compact V(H)-V(L)-linked monomers at therapeutically relevant concentrations below 1 mg/ml. Size-exclusion gel chromatography showed that the monomeric and dimeric forms of MFE-23 could be separated, and that the proportions of these two forms depended on the starting MFE-23 concentration. Sedimentation equilibrium experiments by analytical ultracentrifugation at nine concentrations of MFE-23 indicated a reversible monomer-dimer self-association equilibrium with an association constant of 1.9x10(3)-2.2x10(3) M(-1). Sedimentation velocity experiments using the time derivative g(s(*)) method showed that MFE-23-His has a concentration-dependent weight average sedimentation coefficient that increased from 1.8 S for the monomer to about 3-6 S for the dimer. Both values agreed with those calculated from the MFE-23 crystal structure. In relation to the thermal stability of MFE-23, denaturation experiments by (1)H NMR and FT-IR spectroscopy showed that the molecule is stable up to 47 degrees C, after which denaturation was irreversible. MFE-23 dimerisation is discussed in terms of a new model for diabody structures, in which the V(H) and V(L) domains in the monomer are able to dissociate and reassociate to form a dimer, or diabody, but in which symmetric back-to-back contacts between the two monomers are formed. This dimerisation in solution is attributed to the complementary nature of the C-terminal surface of the MFE-23 monomer. Crystal structures for

  13. Patchy micelles based on coassembly of block copolymer chains and block copolymer brushes on silica particles.

    Science.gov (United States)

    Zhu, Shuzhe; Li, Zhan-Wei; Zhao, Hanying

    2015-04-14

    Patchy particles are a type of colloidal particles with one or more well-defined patches on the surfaces. The patchy particles with multiple compositions and functionalities have found wide applications from the fundamental studies to practical uses. In this research patchy micelles with thiol groups in the patches were prepared based on coassembly of free block copolymer chains and block copolymer brushes on silica particles. Thiol-terminated and cyanoisopropyl-capped polystyrene-block-poly(N-isopropylacrylamide) block copolymers (PS-b-PNIPAM-SH and PS-b-PNIPAM-CIP) were synthesized by reversible addition-fragmentation chain transfer polymerization and chemical modifications. Pyridyl disulfide-functionalized silica particles (SiO2-SS-Py) were prepared by four-step surface chemical reactions. PS-b-PNIPAM brushes on silica particles were prepared by thiol-disulfide exchange reaction between PS-b-PNIPAM-SH and SiO2-SS-Py. Surface micelles on silica particles were prepared by coassembly of PS-b-PNIPAM-CIP and block copolymer brushes. Upon cleavage of the surface micelles from silica particles, patchy micelles with thiol groups in the patches were obtained. Dynamic light scattering, transmission electron microscopy, and zeta-potential measurements demonstrate the preparation of patchy micelles. Gold nanoparticles can be anchored onto the patchy micelles through S-Au bonds, and asymmetric hybrid structures are formed. The thiol groups can be oxidized to disulfides, which results in directional assembly of the patchy micelles. The self-assembly behavior of the patchy micelles was studied experimentally and by computer simulation.

  14. Falling chains

    OpenAIRE

    Wong, Chun Wa; Yasui, Kosuke

    2005-01-01

    The one-dimensional fall of a folded chain with one end suspended from a rigid support and a chain falling from a resting heap on a table is studied. Because their Lagrangians contain no explicit time dependence, the falling chains are conservative systems. Their equations of motion are shown to contain a term that enforces energy conservation when masses are transferred between subchains. We show that Cayley's 1857 energy nonconserving solution for a chain falling from a resting heap is inco...

  15. Reverse transcription and polymerase chain reaction: principles and applications in dentistry Transcrição reversa e reação em cadeia da polimerase: princípios e aplicações em odontologia

    Directory of Open Access Journals (Sweden)

    Carlos Ferreira dos Santos

    2004-03-01

    Full Text Available Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR, which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT reaction in order to produce cDNA from RNA (RT-PCR. RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer. Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.Várias técnicas de biologia molecular têm sido disponibilizadas nos últimos anos. Uma que revolucionou a análise de ácidos nucléicos foi a reação em cadeia da polimerase (PCR, descrita pela primeira vez em 1985. Esta técnica baseia-se na possibilidade de amplificação exponencial de fragmentos específicos de DNA, com a criação de milhões de cópias que servirão como matéria-prima para diferentes tipos de análises. A PCR pode ser precedida por uma reação de transcrição reversa (RT para a obtenção de cDNA a partir de RNA (RT-PCR, representando, por exemplo, uma possibilidade de análise de expressão gênica em células ou tecidos. As técnicas de PCR e RT-PCR têm sido utilizadas em pesquisas odontológicas como

  16. END-OF-USE PRODUCTS IN REVERSE LOGISTICS

    OpenAIRE

    Marta Starostka-Patyk

    2007-01-01

    Reverse logistics is a very useful tool for enterprises which have to deal with end-of-use products. Forward logistics is not able to manage them, because they show up on the beginning of reverse supply chain. That is the reason for growing importance of reverse flows. Reverse logistics is quite new logistics system. This paper presents the idea of reverse logistics and end-of-use products problems.

  17. A Near-Infrared Photothermal Effect-Responsive Drug Delivery System Based on Indocyanine Green and Doxorubicin-Loaded Polymeric Micelles Mediated by Reversible Diels-Alder Reaction.

    Science.gov (United States)

    Li, Hui; Li, Junjie; Ke, Wendong; Ge, Zhishen

    2015-10-01

    Near-infrared light (NIR) possesses great advantages for light-responsive controllable drug release, such as deep tissue penetration and low damage to healthy tissues. Herein, a NIR-responsive drug delivery system is developed based on a NIR dye, indocyanine green (ICG), and anticancer drug, doxorubicin (DOX)-loaded thermoresponsive block copolymer micelles, in which the drug release can be controlled via NIR irradiation. First, block copolymers, poly(oligo(ethylene glycol) methacrylate)-block-poly(furfuryl methacrylate) (POEGMA-b-PFMA), are synthesized by sequential reversible addition-fragmentation chain-transfer (RAFT) polymerization, followed by modification with N-octyl maleimide through Diels-Alder (DA) reaction to produce POEGMA-b-POMFMA. The self-assembly of POEGMA-b-POMFMA by nano-precipitation in aqueous solution affords the polymeric micelles which are used to simultaneously encapsulate ICG and DOX. Upon irradiation by NIR light (805 nm), the loaded DOX is released rapidly from the micelles due to partial retro DA reaction and local temperature increase-induced faster drug diffusion by the photothermal effect. Cytotoxicity evaluation and intracellular distribution observation demonstrate significant synergistic effects of NIR-triggered drug release, photothermal, and chemotherapy toward cancer cells under NIR irradiation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis

    NARCIS (Netherlands)

    Felten, Sandra; Leutenegger, Christian M.; Balzer, Hans Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman|info:eu-repo/dai/nl/089740890; Hartmann, Katrin

    2017-01-01

    Background: Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse

  19. Combining or Separating Forward and Reverse Logistics

    DEFF Research Database (Denmark)

    Herbert-Hansen, Zaza Nadja Lee; Larsen, Samuel; Nielsen, Anders

    2018-01-01

    Purpose – While forward logistics handles and manages the flow of goods downstream in the supply chain from suppliers to customers, reverse logistics (RL) manages the flow of returned goods upstream. A firm can combine reverse logistics with forward logistics, keep the flows separated, or choose......-research addresses intra-RL issues while the relationship between forward and reverse logistics is under-researched. This paper contributes to RL-theory by identifying the contextual factors that determine the most advantageous relationship between forward and reverse logistics, and proposes a novel decision making...

  20. Reversible Statistics

    DEFF Research Database (Denmark)

    Tryggestad, Kjell

    2004-01-01

    The study aims is to describe how the inclusion and exclusion of materials and calculative devices construct the boundaries and distinctions between statistical facts and artifacts in economics. My methodological approach is inspired by John Graunt's (1667) Political arithmetic and more recent work...... within constructivism and the field of Science and Technology Studies (STS). The result of this approach is here termed reversible statistics, reconstructing the findings of a statistical study within economics in three different ways. It is argued that all three accounts are quite normal, albeit...... in different ways. The presence and absence of diverse materials, both natural and political, is what distinguishes them from each other. Arguments are presented for a more symmetric relation between the scientific statistical text and the reader. I will argue that a more symmetric relation can be achieved...

  1. CHAIN 2

    International Nuclear Information System (INIS)

    Bailey, D.

    1998-04-01

    The Second Processing Chain (CHAIN2) consists of a suite of ten programs which together provide a full local analysis of the bulk plasma physics within the JET Tokamak. In discussing these ten computational models this report is intended to fulfil two broad purposes. Firstly it is meant to be used as a reference source for any user of CHAIN2 data, and secondly it provides a basic User Manual sufficient to instruct anyone in running the CHAIN2 suite of codes. In the main report text each module is described in terms of its underlying physics and any associated assumptions or limitations, whilst deliberate emphasis is put on highlighting the physics and mathematics of the calculations required in deriving each individual datatype in the standard module PPF output. In fact each datatype of the CHAIN2 PPF output listed in Appendix D is cross referenced to the point in the main text where its evaluation is discussed. An effort is made not only to give the equation used to derive a particular data profile but also to explicitly define which external data sources are involved in the computational calculation

  2. The ATPG Attack for Reverse Engineering of Combinational Hybrid Custom-Programmable Circuits

    Science.gov (United States)

    2017-03-23

    Introduction The widely practiced horizontal integrated circuit supply chain exposes a design to various types of attacks including the reverse engineering ...STT_CMOS designs for reverse- engineering prevention, DAC 2016. [5] M. E. Massad and et. al. Integrated circuit (IC) decamouflaging: reverse...The ATPG Attack for Reverse Engineering of Combinational Hybrid Custom-Programmable Circuits Raza Shafiq Hamid Mahmoodi Houman Homayoun Hassan

  3. Heavy Chain Diseases

    Science.gov (United States)

    ... of heavy chain produced: Alpha Gamma Mu Alpha Heavy Chain Disease Alpha heavy chain disease (IgA heavy ... the disease or lead to a remission. Gamma Heavy Chain Disease Gamma heavy chain disease (IgG heavy ...

  4. Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

    Science.gov (United States)

    Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

    2018-06-01

    The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  5. Chain Dynamics in Magnetorheological Suspensions

    Science.gov (United States)

    Gast, A. P.; Furst, E. M.

    1999-01-01

    fluctuating chains of dipolar particles. Resolving this issue would contribute greatly to the understanding of these interesting and important materials. We have begun to test the predictions of the HT model by both examining the dynamics of individual chains and by measuring the forces between dipolar chains directly to accurately and quantitatively assess the interactions that they experience. To do so, we employ optical trapping techniques and video-microscopy to manipulate and observe our samples on the microscopic level. With these techniques, it is possible to observe chains that are fluctuating freely in three-dimensions, independent of interfacial effects. More importantly, we are able to controllably observe the interactions of two chains at various separations to measure the force-distance profile. The techniques also allow us to study the mechanical properties of individual chains and chain clusters. Our work to this point has focused on reversibly-formed dipolar chains due to field induced dipoles where the combination of this chaining, the dipolar forces, and the hydrodynamic interactions that dictate the rheology of the suspensions. One can envision, however, many situations where optical, electronic, or rheological behavior may be optimized with magneto-responsive anisotropic particles. Chains of polarizable particles may have the best properties as they can coil and flex in the absence of a field and stiffen and orient when a field is applied. We have recently demonstrated a synthesis of stable, permanent paramagnetic chains by both covalently and physically linking paramagnetic colloidal particles. The method employed allows us to create monodisperse chains of controlled length. We observed the stability, field-alignment, and rigidity of this new class of materials. The chains may exhibit unique rheological properties in an applied magnetic field over isotropic suspensions of paramagnetic particles. They are also useful rheological models as bead

  6. The mediating effect of sustainability control system on reverse ...

    African Journals Online (AJOL)

    This paper analyses part of the viability of green supply chain management practices created for fisheries industry to implement sustainability control system adoption as mediating on reverse logistics innovation and customer environmental collaboration towards sustainability performance. It examines reverse logistics ...

  7. Reversible Thermoset Adhesives

    Science.gov (United States)

    Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)

    2016-01-01

    Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.

  8. Tubal Ligation Reversal

    Science.gov (United States)

    ... seal off the fallopian tubes, such as the Essure or Adiana systems, generally aren't reversible. Why ... electrocautery). Some types of sterilization, such as the Essure or Adiana systems, aren't considered reversible. Risks ...

  9. CONCEPTUAL ISSUES REGARDING REVERSE LOGISTICS

    Directory of Open Access Journals (Sweden)

    Ioana Olariu

    2013-12-01

    Full Text Available As the power of consumers is growing, the product return for customer service and customer retention has become a common practice in the competitive market, which propels the recent practice of reverse logistics in companies. Many firms attracted by the value available in the flow, have proactively participated in handling returned products at the end of their usefulness or from other parts of the product life cycle. Reverse logistics is the flow and management of products, packaging, components and information from the point of consumption to the point of origin. It is a collection of practices similar to those of supply chain management, but in the opposite direction, from downstream to upstream. It involves activities such as reuse, repair, remanufacture, refurbish, reclaim and recycle. For the conventional forward logistics systems, the flow starts upstream as raw materials, later as manufactured parts and components to be assembled and continues downstream to reach customers as final products to be disposed once they reach their economic or useful lives. In reverse logistics, the disposed products are pushed upstream to be repaired, remanufactured, refurbished, and disassembled into components to be reused or as raw material to be recycled for later use.

  10. Reverse logistics - a framework

    NARCIS (Netherlands)

    M.P. de Brito (Marisa); R. Dekker (Rommert)

    2002-01-01

    textabstractIn this paper we define and compare Reverse Logistics definitions. We start by giving an understanding framework of Reverse Logistics: the why-what-how. By this means, we put in context the driving forces for Reverse Logistics, a typology of return reasons, a classification of

  11. Sympathetic block by metal clips may be a reversible operation

    DEFF Research Database (Denmark)

    Thomsen, Lars L; Mikkelsen, Rasmus T; Derejko, Miroslawa

    2014-01-01

    , but the question of reversibility remains controversial. Two recent experimental studies found severe histological signs of nerve damage 4-6 weeks after clip removal, but they only used conventional histopathological staining methods. METHODS: Thoracoscopic clipping of the sympathetic trunk was performed in adult...... the sympathetic chain vary tremendously. Most surgeons transect or resect the sympathetic chain, but application of a metal clip that blocks transmission of nerve impulses in the sympathetic chain is used increasingly worldwide. This approach offers potential reversibility if patients regret surgery...... suggests in theory that application of metal clips to the sympathetic chain is a reversible procedure if only the observation period is prolonged. Further studies with longer periods between application and removal as well as investigations of nerve conduction should be encouraged, because we do not know...

  12. Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A.

    Science.gov (United States)

    Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong

    2007-06-30

    Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

  13. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.

    1991-01-01

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  14. Mechanism and kinetics of dithiobenzoate-mediated RAFT polymerization. I. The current situation

    NARCIS (Netherlands)

    Barner-Kowollik, C.; Buback, M.; Charleux, B.; Coote, M.L.; Drache, M.; Fukuda, T.; Goto, A.; Klumperman, B.; Lowe, A.B.; McLeary, J.B.; Moad, G.; Monteiro, M.J.; Sanderson, R.D.; Tonge, M.P.; Vana, P.

    2006-01-01

    Investigations into the kinetics and mechanism of dithiobenzoate-mediated Reversible Addition-Fragmentation Chain Transfer (RAFT) polymerizations, which exhibit nonideal kinetic behavior, such as induction periods and rate retardation, are comprehensively reviewed. The appreciable uncertainty in the

  15. Nanostructured Polysulfone-Based Block Copolymer Membranes

    KAUST Repository

    Xie, Yihui

    2016-01-01

    polycondensation and reversible addition-fragmentation chain-transfer polymerization. The obtained membrane has a highly porous interconnected skin layer composed of elongated micelles with a flower-like arrangement, on top of the graded finger-like macrovoids

  16. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  17. A reactive polystyrene-block-polyisoprene star copolymer as a toughening agent in an epoxy thermoset

    KAUST Repository

    Francis, Raju; Baby, Deepa K.

    2015-01-01

    © 2015 Springer-Verlag Berlin Heidelberg A polystyrene-block-polyisoprene ((PS-b-PI)3) star polymer was synthesized by photochemical reversible addition fragmentation chain transfer (RAFT) polymerization. The obtained star polymer was epoxidized

  18. Reversible flowchart languages and the structured reversible program theorem

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2008-01-01

    Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...

  19. Effects of RAFT Agent on the Selective Approach of Molecularly Imprinted Polymers

    OpenAIRE

    Asman, Saliza; Mohamad, Sharifah; Sarih, Norazilawati

    2015-01-01

    Two types of reversible addition-fragmentation chain transfer molecularly imprinted polymers (RAFT-MIPs) were synthesized using different monomers, which were methacrylic acid functionalized β-cyclodextrin (MAA-β-CD) and 2-hydroxyethyl methacrylate functionalized β-cyclodextrin (HEMA-β-CD), via reversible addition-fragmentation chain transfer (RAFT) polymerization, and were represented as RAFT-MIP(MAA-β-CD) and RAFT-MIP(HEMA-β-CD), respectively. Both RAFT-MIPs were systematically characterize...

  20. Introduction to reversible computing

    CERN Document Server

    Perumalla, Kalyan S

    2013-01-01

    Few books comprehensively cover the software and programming aspects of reversible computing. Filling this gap, Introduction to Reversible Computing offers an expanded view of the field that includes the traditional energy-motivated hardware viewpoint as well as the emerging application-motivated software approach. Collecting scattered knowledge into one coherent account, the book provides a compendium of both classical and recently developed results on reversible computing. It explores up-and-coming theories, techniques, and tools for the application of rever

  1. Optimization and decision support systems for supply chains

    CERN Document Server

    Corominas, Albert; Miranda, João

    2017-01-01

    This contributed volume presents a collection of materials on supply chain management including industry-based case studies addressing petrochemical, pharmaceutical, manufacturing and reverse logistics topics. Moreover, the book covers sustainability issues, as well as optimization approaches. The target audience comprises academics, industry managers, and practitioners in the field of supply chain management, being the book also beneficial for graduate students.

  2. Reversibility of female sterilization.

    Science.gov (United States)

    Siegler, A M; Hulka, J; Peretz, A

    1985-04-01

    The discussion considers the current status of reversibility of sterilization in the US and describes clinical and experimental efforts for developing techniques designed for reversibility. It focuses on regret following sterilization, reversal potential of current sterilization techniques, patient selection, current reversal techniques, results of sterilization procedures, experimental approaches to reversal of current techniques of sterilization, and sterilization procedures devised for reversibility, in humans and in animals. Request is the 1st stage of reversal, but a request for sterilization reversal (SR) does not always mean regret for a decision made at the time. Frequently it is a wish to restore fertility because life circumstances have changed after a sterilization that was ppropriate at the time it was performed. Schwyhart and Kutner reviewed 22 studies published between 1949-69 in which they found that the percentage of patients regretting the procedure ranged from 1.3-15%. Requests for reversal remain low in most countries, but if sterilization becomes a more popular method of contraception, requests will also increase. The ideal operation considered as a reversaible method of sterilization should include an easy, reliable outpatient method of tubal occlusion with miniml risk or patient discomfort that subsequently could be reversed without the need for a major surgical intervention. Endoscopic methods have progressed toward the 1st objective. A recent search of the literature uncovered few series of SR of more than 50 cases. The 767 operations found were analyzed with regard to pregnancy outcome. The precent of live births varied from 74-78.8%, and the occurance of tubal pregnancies ranged from 1.7-6.5%. All of the confounding variables in patient selection and small numbers of reported procedures preclude any conclusion about the different techniques or the number of operations that give a surgeon a level of expertise. Few authors classify their

  3. Reverse Logistics: RFID the key to optimality

    Directory of Open Access Journals (Sweden)

    Rezwan Asif

    2011-07-01

    Full Text Available Purpose: The purpose of this paper is to find ways to reduce uncertainties in Reverse logistic supply chain (RLSC through the use of Radio-frequency identification (RFID technology.Design/methodology/approach: This paper reviews literature and builds model to relate RFID with uncertainties in order to optimize Reverse Logistics. Findings: RFID is really efficient to determine and detect quantity, variety and cycle times of returns; however it's not as convenient to determine quality of the returns. The collected information from RFID can be used to standardize the RLSC.Research limitations: Though it’s several and unique advantages some limitations of RFID have been identified in quality and processing sequence, collecting points and different standards, and in global usage.Originality/value: Previous studies in the area of Reverse Logistics and RFID don’t cover all impacts of this technology on RLSC. This review paper has investigated these impacts and offers a model for optimizing the Reverse Logistics Supply Chain.

  4. Quantum reverse hypercontractivity

    Energy Technology Data Exchange (ETDEWEB)

    Cubitt, Toby [Department of Computer Science, University College London, London, United Kingdom and Centre for Quantum Information and Foundations, DAMTP, University of Cambridge, Cambridge (United Kingdom); Kastoryano, Michael [NBIA, Niels Bohr Institute, University of Copenhagen, 2100 Copenhagen (Denmark); Montanaro, Ashley [School of Mathematics, University of Bristol, Bristol (United Kingdom); Temme, Kristan [Institute for Quantum Information and Matter, California Institute of Technology, Pasadena, California 91125 (United States)

    2015-10-15

    We develop reverse versions of hypercontractive inequalities for quantum channels. By generalizing classical techniques, we prove a reverse hypercontractive inequality for tensor products of qubit depolarizing channels. We apply this to obtain a rapid mixing result for depolarizing noise applied to large subspaces and to prove bounds on a quantum generalization of non-interactive correlation distillation.

  5. Atrioventricular Pacemaker Lead Reversal

    Directory of Open Access Journals (Sweden)

    Mehmet K Aktas, MD

    2007-01-01

    Full Text Available During cardiac surgery temporary epicardial atrial and ventricular leads are placed in case cardiac pacing is required postoperatively. We present the first reported series of patients with reversal of atrioventricular electrodes in the temporary pacemaker without any consequent deleterious hemodynamic effect. We review the electrocardiographic findings and discuss the findings that lead to the discovery of atrioventricular lead reversal.

  6. Semi-Nested Real-Time Reverse Transcription Polymerase Chain Reaction Methods for the Successful Quantitation of Cytokeratin mRNA Expression Levels for the Subtyping of Non-Small-Cell Lung Carcinoma Using Paraffin-Embedded and Microdissected Lung Biopsy Specimens

    International Nuclear Information System (INIS)

    Nakanishi, Yoko; Shimizu, Tetsuo; Tsujino, Ichiro; Obana, Yukari; Seki, Toshimi; Fuchinoue, Fumi; Ohni, Sumie; Oinuma, Toshinori; Kusumi, Yoshiaki; Yamada, Tsutomu; Takahashi, Noriaki; Hashimoto, Shu; Nemoto, Norimichi

    2013-01-01

    In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC

  7. CHAINS-PC, Decay Chain Atomic Densities

    International Nuclear Information System (INIS)

    1994-01-01

    1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain

  8. Logistic chain modelling

    NARCIS (Netherlands)

    Slats, P.A.; Bhola, B.; Evers, J.J.M.; Dijkhuizen, G.

    1995-01-01

    Logistic chain modelling is very important in improving the overall performance of the total logistic chain. Logistic models provide support for a large range of applications, such as analysing bottlenecks, improving customer service, configuring new logistic chains and adapting existing chains to

  9. Reverse logistics in the construction industry.

    Science.gov (United States)

    Hosseini, M Reza; Rameezdeen, Raufdeen; Chileshe, Nicholas; Lehmann, Steffen

    2015-06-01

    Reverse logistics in construction refers to the movement of products and materials from salvaged buildings to a new construction site. While there is a plethora of studies looking at various aspects of the reverse logistics chain, there is no systematic review of literature on this important subject as applied to the construction industry. Therefore, the objective of this study is to integrate the fragmented body of knowledge on reverse logistics in construction, with the aim of promoting the concept among industry stakeholders and the wider construction community. Through a qualitative meta-analysis, the study synthesises the findings of previous studies and presents some actions needed by industry stakeholders to promote this concept within the real-life context. First, the trend of research and terminology related with reverse logistics is introduced. Second, it unearths the main advantages and barriers of reverse logistics in construction while providing some suggestions to harness the advantages and mitigate these barriers. Finally, it provides a future research direction based on the review. © The Author(s) 2015.

  10. An algebra of reversible computation.

    Science.gov (United States)

    Wang, Yong

    2016-01-01

    We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.

  11. Sex reversal in vertebrates

    OpenAIRE

    2016-01-01

    This special topic issue of Sexual Development gives an overview of sex reversal in vertebrates, from fishes naturally changing their sex, to rodents escaping the mammalian SRY-determining system. It offers eight up-to-date reviews on specific subjects in sex reversal, considering fishes, amphibians, reptiles, birds, marsupials, and placental mammals, including humans. The broad scope of represented animals makes this ideal for students and researchers, especially those interested in the...

  12. Irreversible Local Markov Chains with Rapid Convergence towards Equilibrium

    Science.gov (United States)

    Kapfer, Sebastian C.; Krauth, Werner

    2017-12-01

    We study the continuous one-dimensional hard-sphere model and present irreversible local Markov chains that mix on faster time scales than the reversible heat bath or Metropolis algorithms. The mixing time scales appear to fall into two distinct universality classes, both faster than for reversible local Markov chains. The event-chain algorithm, the infinitesimal limit of one of these Markov chains, belongs to the class presenting the fastest decay. For the lattice-gas limit of the hard-sphere model, reversible local Markov chains correspond to the symmetric simple exclusion process (SEP) with periodic boundary conditions. The two universality classes for irreversible Markov chains are realized by the totally asymmetric SEP (TASEP), and by a faster variant (lifted TASEP) that we propose here. We discuss how our irreversible hard-sphere Markov chains generalize to arbitrary repulsive pair interactions and carry over to higher dimensions through the concept of lifted Markov chains and the recently introduced factorized Metropolis acceptance rule.

  13. Monotone measures of ergodicity for Markov chains

    Directory of Open Access Journals (Sweden)

    J. Keilson

    1998-01-01

    Full Text Available The following paper, first written in 1974, was never published other than as part of an internal research series. Its lack of publication is unrelated to the merits of the paper and the paper is of current importance by virtue of its relation to the relaxation time. A systematic discussion is provided of the approach of a finite Markov chain to ergodicity by proving the monotonicity of an important set of norms, each measures of egodicity, whether or not time reversibility is present. The paper is of particular interest because the discussion of the relaxation time of a finite Markov chain [2] has only been clean for time reversible chains, a small subset of the chains of interest. This restriction is not present here. Indeed, a new relaxation time quoted quantifies the relaxation time for all finite ergodic chains (cf. the discussion of Q1(t below Equation (1.7]. This relaxation time was developed by Keilson with A. Roy in his thesis [6], yet to be published.

  14. On thermodynamic and microscopic reversibility

    International Nuclear Information System (INIS)

    Crooks, Gavin E

    2011-01-01

    The word 'reversible' has two (apparently) distinct applications in statistical thermodynamics. A thermodynamically reversible process indicates an experimental protocol for which the entropy change is zero, whereas the principle of microscopic reversibility asserts that the probability of any trajectory of a system through phase space equals that of the time reversed trajectory. However, these two terms are actually synonymous: a thermodynamically reversible process is microscopically reversible, and vice versa

  15. Sustainable Supply Chain Design

    DEFF Research Database (Denmark)

    Bals, Lydia; Tate, Wendy

    A significant conceptual and practical challenge is how to integrate triple bottom line (TBL; including economic, social and environmental) sustainability into global supply chains. Although this integration is necessary to slow down global resource depletion, understanding is limited of how...... to implement TBL goals across the supply chain. In supply chain design, the classic economic perspective still dominates, although the idea of the TBL is more widely disseminated. The purpose of this research is to add to the sustainable supply chain management literature (SSCM) research agenda...... by incorporating the physical chain, and the (information and financial) support chains into supply chain design. This manuscript tackles issues of what the chains are designed for and how they are designed structurally. Four sustainable businesses are used as illustrative case examples of innovative supply chain...

  16. Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

    Directory of Open Access Journals (Sweden)

    Gilberto Simeone Henriques

    2005-12-01

    , primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of testis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1 initial cDNA concentration of 2 µg, (2 primer concentration of 200nM, (3 hybridization temperature between 57.5ºC and 60.1ºC and (4 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

  17. Reversible Communicating Processes

    Directory of Open Access Journals (Sweden)

    Geoffrey Brown

    2016-02-01

    Full Text Available Reversible distributed programs have the ability to abort unproductive computation paths and backtrack, while unwinding communication that occurred in the aborted paths. While it is natural to assume that reversibility implies full state recovery (as with traditional roll-back recovery protocols, an interesting alternative is to separate backtracking from local state recovery. For example, such a model could be used to create complex transactions out of nested compensable transactions where a programmer-supplied compensation defines the work required to "unwind" a transaction. Reversible distributed computing has received considerable theoretical attention, but little reduction to practice; the few published implementations of languages supporting reversibility depend upon a high degree of central control. The objective of this paper is to demonstrate that a practical reversible distributed language can be efficiently implemented in a fully distributed manner. We discuss such a language, supporting CSP-style synchronous communication, embedded in Scala. While this language provided the motivation for the work described in this paper, our focus is upon the distributed implementation. In particular, we demonstrate that a "high-level" semantic model can be implemented using a simple point-to-point protocol.

  18. Economic impact of reversion

    International Nuclear Information System (INIS)

    2005-01-01

    Estimations of the Norwegian hydropower production and various reversion models' market value have been made. The value of the Norwegian hydropower production until 01.01.2007 is estimated to about Nok 289 billion after taxes, or about 2,42 Nok/kWh medium production, given an expected future electricity price of around 0,25 Nok/kWh and a discount rate at 6,5 percent in nominal terms after taxes. The estimate is slightly above the level of prices for Norwegian hydropower plants in the last 8-10 years. The value of reversion in private plants which today have a limited licence time is estimated to Nok 5,5 billion. The value of reversion in public-owned Norwegian hydropower plants are about Nok 21 billion with a 60 year licence period from 01.01.2007, and about 12 billion for 75 years (ml)

  19. Reference genes for reverse transcription quantitative PCR in canine brain tissue

    NARCIS (Netherlands)

    Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

    2015-01-01

    BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

  20. The Global Value Chain

    DEFF Research Database (Denmark)

    Sørensen, Olav Jull

    The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool......The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool...

  1. Returns management in the supply chain

    OpenAIRE

    Anna Maria Jeszka

    2014-01-01

    Background:  The aim of this exploratory empirical research was to evaluate the level of cooperation in the area of reverse logistics between selected retail chains and logistics operators and suppliers; to identify and evaluate the influence the procedures of handling returns have on the relationships with customers, cost reduction, value recovery, inventory reduction and increasing profitability; as well as determining to what extent logistics operators are involved in the procedures o...

  2. Reversible deep disposal

    International Nuclear Information System (INIS)

    2009-10-01

    This presentation, given by the national agency of radioactive waste management (ANDRA) at the meeting of October 8, 2009 of the high committee for the nuclear safety transparency and information (HCTISN), describes the concept of deep reversible disposal for high level/long living radioactive wastes, as considered by the ANDRA in the framework of the program law of June 28, 2006 about the sustainable management of radioactive materials and wastes. The document presents the social and political reasons of reversibility, the technical means considered (containers, disposal cavities, monitoring system, test facilities and industrial prototypes), the decisional process (progressive development and blocked off of the facility, public information and debate). (J.S.)

  3. Chain transitivity in hyperspaces

    International Nuclear Information System (INIS)

    Fernández, Leobardo; Good, Chris; Puljiz, Mate; Ramírez, Ártico

    2015-01-01

    Given a non-empty compact metric space X and a continuous function f: X → X, we study the dynamics of the induced maps on the hyperspace of non-empty compact subsets of X and on various other invariant subspaces thereof, in particular symmetric products. We show how some important dynamical properties transfer across induced systems. These amongst others include, chain transitivity, chain (weakly) mixing, chain recurrence, exactness by chains. From our main theorem we derive an ε-chain version of Furstenberg’s celebrated 2 implies n Theorem. We also show the implications our results have for dynamics on continua.

  4. Decisive Markov Chains

    OpenAIRE

    Abdulla, Parosh Aziz; Henda, Noomene Ben; Mayr, Richard

    2007-01-01

    We consider qualitative and quantitative verification problems for infinite-state Markov chains. We call a Markov chain decisive w.r.t. a given set of target states F if it almost certainly eventually reaches either F or a state from which F can no longer be reached. While all finite Markov chains are trivially decisive (for every set F), this also holds for many classes of infinite Markov chains. Infinite Markov chains which contain a finite attractor are decisive w.r.t. every set F. In part...

  5. Thermosensory reversal effect quantified

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2008-01-01

    At room temperature, some materials feel colder than others due to differences in thermal conductivity, heat capacity and geometry. When the ambient temperature is well above skin temperature, the roles of 'cold' and 'warm' materials are reversed. In this paper, this effect is quantified by

  6. Thermosensory reversal effect quantified

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2008-01-01

    At room temperature, some materials feel colder than others due to differences in thermal conductivity, heat capacity and geometry. When the ambient temperature is well above skin temperature, the roles of ‘cold’ and ‘warm’ materials are reversed. In this paper, this effect is quantified by

  7. Time reversal communication system

    Science.gov (United States)

    Candy, James V.; Meyer, Alan W.

    2008-12-02

    A system of transmitting a signal through a channel medium comprises digitizing the signal, time-reversing the digitized signal, and transmitting the signal through the channel medium. The channel medium may be air, earth, water, tissue, metal, and/or non-metal.

  8. Engineering Encounters: Reverse Engineering

    Science.gov (United States)

    McGowan, Veronica Cassone; Ventura, Marcia; Bell, Philip

    2017-01-01

    This column presents ideas and techniques to enhance your science teaching. This month's issue shares information on how students' everyday experiences can support science learning through engineering design. In this article, the authors outline a reverse-engineering model of instruction and describe one example of how it looked in our fifth-grade…

  9. Sex Reversal in Birds.

    Science.gov (United States)

    Major, Andrew T; Smith, Craig A

    2016-01-01

    Sexual differentiation in birds is controlled genetically as in mammals, although the sex chromosomes are different. Males have a ZZ sex chromosome constitution, while females are ZW. Gene(s) on the sex chromosomes must initiate gonadal sex differentiation during embryonic life, inducing paired testes in ZZ individuals and unilateral ovaries in ZW individuals. The traditional view of avian sexual differentiation aligns with that expounded for other vertebrates; upon sexual differentiation, the gonads secrete sex steroid hormones that masculinise or feminise the rest of the body. However, recent studies on naturally occurring or experimentally induced avian sex reversal suggest a significant role for direct genetic factors, in addition to sex hormones, in regulating sexual differentiation of the soma in birds. This review will provide an overview of sex determination in birds and both naturally and experimentally induced sex reversal, with emphasis on the key role of oestrogen. We then consider how recent studies on sex reversal and gynandromorphic birds (half male:half female) are shaping our understanding of sexual differentiation in avians and in vertebrates more broadly. Current evidence shows that sexual differentiation in birds is a mix of direct genetic and hormonal mechanisms. Perturbation of either of these components may lead to sex reversal. © 2016 S. Karger AG, Basel.

  10. Elastomers with Reversible Nanoporosity

    DEFF Research Database (Denmark)

    Szewczykowski, Piotr Przemyslaw; Andersen, K.; Schulte, Lars

    2009-01-01

    nanostructure and displays liquid-filled cavities. Upon several cycles of swelling and drying the cavities open and close in a reversible fashion. When exposed to a nonsolvent, the material remains collapsed. This discriminating behavior of liquid-material interaction holds potential for the use...

  11. Dynein light chain family in Tetrahymena thermophila.

    Science.gov (United States)

    Wilkes, David E; Rajagopalan, Vidyalakshmi; Chan, Clarence W C; Kniazeva, Ekaterina; Wiedeman, Alice E; Asai, David J

    2007-02-01

    Dyneins are large protein complexes that produce directed movement on microtubules. In situ, dyneins comprise combinations of heavy, intermediate, light-intermediate, and light chains. The light chains regulate the locations and activities of dyneins but their functions are not completely understood. We have searched the recently sequenced Tetrahymena thermophila macronuclear genome to describe the entire family of dynein light chains expressed in this organism. We identified fourteen genes encoding putative dynein light chains and seven genes encoding light chain-like proteins. RNA-directed PCR revealed that all 21 genes were expressed. Quantitative real time reverse transcription PCR showed that many of these genes were upregulated after deciliation, indicating that these proteins are present in cilia. Using the nomenclature developed in Chlamydomonas, Tetrahymena expresses two isoforms each of LC2, LC4, LC7, and Tctex1, three isoforms of p28, and six LC8/LC8-like isoforms. Tetrahymena also expresses two LC3-like genes. No Tetrahymena orthologue was found for Chlamydomonas LC5 or LC6. This study provides a complete description of the different genes and isoforms of the dynein light chains that are expressed in Tetrahymena, a model organism in which the targeted manipulation of genes is straightforward. (c) 2006 Wiley-Liss, Inc.

  12. Gushing metal chain

    Science.gov (United States)

    Belyaev, Alexander; Sukhanov, Alexander; Tsvetkov, Alexander

    2016-03-01

    This article addresses the problem in which a chain falls from a glass from some height. This phenomenon demonstrates a paradoxical rise of the chain over the glass. To explain this effect, an initial hypothesis and an appropriate theory are proposed for calculating the steady fall parameters of the chain. For this purpose, the modified Cayley's problem of falling chain given its rise due to the centrifugal force of upward inertia is solved. Results show that the lift caused by an increase in linear density at the part of chain where it is being bent (the upper part) is due to the convergence of the chain balls to one another. The experiments confirm the obtained estimates of the lifting chain.

  13. Third-party Reverse logistics platform and method Based on Bilateral Resource Integration

    Directory of Open Access Journals (Sweden)

    Zheng Hong Zhen

    2016-01-01

    Full Text Available Dispersion of reverse logistics resources makes it difficult to create relationships between demanders and providers, thereby the personalized demand for the construction of enterprise reverse logistics cannot be satisfied and the service quality cannot be guaranteed. Aiming at these problems, this paper presents a platform and method of enterprise reverse logistics based on bilateral resource integration (RLBRI. The method creates a third-party reverse logistics platform to accumulate a mass of reverse logistics demanders and providers together. And the platform integrates bilateral resources and acts as an intermediary to establish relationships between two sides. Through the platform, a complete and high-quality business chain for enterprise reverse logistics will be built efficiently. Finally put forward an effective strategy of non-defective reverse logistics depends on the integrity checking service provided by third-party logistics. By using this strategy it can short the distance of non-defective reverse transportation. Computational tests validate the strategy.

  14. Reversed field pinch diagnostics

    International Nuclear Information System (INIS)

    Weber, P.G.

    1986-01-01

    The Reversed Field Pinch (RFP) is a toroidal, axisymmetric magnetic confinement configuration characterized by a magnetic field configuration in which the toroidal magnetic field is of similar strength to the poloidal field, and is reversed at the edge compared to the center. The RFP routinely operates at high beta, and is a strong candidate for a compact fusion device. Relevant attributes of the configuration will be presented, together with an overview of present and planned experiments and their diagnostics. RFP diagnostics are in many ways similar to those of other magnetic confinement devices (such as tokamaks); these lectures will point out pertinent differences, and will present some diagnostics which provide special insights into unique attributes of the RFP

  15. Posterior Reversible Encephalopathy (PRES)

    International Nuclear Information System (INIS)

    Moron E, Fanny E; Diaz Marchan, Pedro

    2005-01-01

    The Posterior Reversible Encephalopathy Syndrome (PRES) is a clinical Syndrome composed of cephalea, alteration in vision and convulsions, usually observed in patients with sudden elevation of arterial pressure. The imagenologic evidence shows reversible vasogenic brain edema without stroke. Its location is predominantly posterior; it affects the cortex and the subcortical white matter of the occipital, parietal and temporal lobes. The treatment with antihypertensive drugs and the removing of immunosupressor medication are generally associated with complete neurological recovery; this is reflected also in the images which return to their basal condition. The untreated hypertension, on the other side, can result in a progressive defect of the autoregulation system of the central nervous system with cerebral hemorrhage, irreversible brain stroke, coma and death

  16. Forbidden subgraph pairs for traceability of block-chains

    NARCIS (Netherlands)

    Li, Binlong; Li, Binlong; Broersma, Haitze J.; Zhang, Shenggui

    2013-01-01

    A block-chain is a graph whose block graph is a path, i.e. it is either a P1, a P2, or a 2-connected graph, or a graph of connectivity 1 with exactly two end-blocks. A graph is called traceable if it contains a Hamilton path. A traceable graph is clearly a block-chain, but the reverse does not hold

  17. Reversible infantile mitochondrial diseases.

    Science.gov (United States)

    Boczonadi, Veronika; Bansagi, Boglarka; Horvath, Rita

    2015-05-01

    Mitochondrial diseases are usually severe and progressive conditions; however, there are rare forms that show remarkable spontaneous recoveries. Two homoplasmic mitochondrial tRNA mutations (m.14674T>C/G in mt-tRNA(Glu)) have been reported to cause severe infantile mitochondrial myopathy in the first months of life. If these patients survive the first year of life by extensive life-sustaining measures they usually recover and develop normally. Another mitochondrial disease due to deficiency of the 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU) causes severe liver failure in infancy, but similar to the reversible mitochondrial myopathy, within the first year of life these infants may also recover completely. Partial recovery has been noted in some other rare forms of mitochondrial disease due to deficiency of mitochondrial tRNA synthetases and mitochondrial tRNA modifying enzymes. Here we summarize the clinical presentation of these unique reversible mitochondrial diseases and discuss potential molecular mechanisms behind the reversibility. Understanding these mechanisms may provide the key to treatments of potential broader relevance in mitochondrial disease, where for the majority of the patients no effective treatment is currently available.

  18. Positioning paper on reversibility

    International Nuclear Information System (INIS)

    2016-01-01

    After having recalled the legal framework adopted in 2006 for the deep geological storage of radioactive wastes, and briefly introduced the concept of reversibility, this publication presents the principle of geological storage, presents high and medium level and long life wastes, highlights the ethical necessity to deal with these radioactive wastes, outlines that geological storage is the generally admitted and adopted solution at the international level, and presents additional means implemented for radioactive waste management. It presents the Cigeo project as the technical answer to the issue of radioactive waste storage, describes the Cigeo development process, its current status and its development planning, and justifies the choice of this technical solution, notably from an ethical point of view. It addresses the issue of reversibility and proposes an overview of the various tools and means which aim at guaranteeing this reversibility. Appendices propose figures illustrating the Cigeo project and its development process, and a rather detailed Power Point presentation of the project by the ANDRA (history, object, planning, installations, and so on)

  19. Editorial: Supply Chain Management

    Directory of Open Access Journals (Sweden)

    Dimitrios Aidonis

    2017-05-01

    Full Text Available This special issue has followed up the 3rd Olympus International Conference on Supply Chains held on Athens Metropolitan Expo, November 7 & 8 2015, Greece. The Conference was organized by the Department of Logistics Technological Educational Institute of Central Macedonia, in collaboration with the: a Laboratory of Quantitative Analysis, Logistics and Supply Chain Management of the Department of Mechanical Engineering, Aristotle University of Thessaloniki (AUTH, b Greek Association of Supply Chain Management (EEL of Northern Greece and the c Supply Chain & Logistics Journal. During the 2-Days Conference more than 60 research papers were presented covering the following thematic areas: (i Transportation, (ii Best Practices in Logistics, (iii Information and Communication Technologies in Supply Chain Management, (iv Food Logistics, (v New Trends in Business Logistics, and (vi Green Supply Chain Management. Three keynote invited speakers addressed interesting issues for the Operational Research, the Opportunities and Prospects of Greek Ports chaired Round Tables with other Greek and Foreign Scientists and Specialists.

  20. Supply Chain Management og Supply Chain costing

    DEFF Research Database (Denmark)

    Nielsen, Steen; Mortensen, Ole

    2002-01-01

    Formålet med denne artikel er at belyse de muligheder som ligger i at integrere virksomhedens økonomiske styring med begrebet Supply Chain Management (SCM). Dette søges belyst ved først at beskrive den teoretiske ramme, hvori SCM indgår. Herefter analyseres begrebet Supply Chain Costing (SCC) som...... Århus. Et resultat er, at via begrebet Supply Chain Costing skabes der mulighed for at måle logistikkædens aktiviteter i kr./øre. Anvendelsen af denne information har også strategisk betydning for at kunne vælge kunde og leverandør. Ved hjælp af integrationen skabes der også helt nye mulighed...

  1. Supply chain components

    OpenAIRE

    Vieraşu, T.; Bălăşescu, M.

    2011-01-01

    In this article I will go through three main logistics components, which are represented by: transportation, inventory and facilities, and the three secondary logistical components: information, production location, price and how they determine performance of any supply chain. I will discuss then how these components are used in the design, planning and operation of a supply chain. I will also talk about some obstacles a supply chain manager may encounter.

  2. Supply chain components

    Directory of Open Access Journals (Sweden)

    Vieraşu, T.

    2011-01-01

    Full Text Available In this article I will go through three main logistics components, which are represented by: transportation, inventory and facilities, and the three secondary logistical components: information, production location, price and how they determine performance of any supply chain. I will discuss then how these components are used in the design, planning and operation of a supply chain. I will also talk about some obstacles a supply chain manager may encounter.

  3. Markov Tail Chains

    OpenAIRE

    janssen, Anja; Segers, Johan

    2013-01-01

    The extremes of a univariate Markov chain with regularly varying stationary marginal distribution and asymptotically linear behavior are known to exhibit a multiplicative random walk structure called the tail chain. In this paper we extend this fact to Markov chains with multivariate regularly varying marginal distributions in Rd. We analyze both the forward and the backward tail process and show that they mutually determine each other through a kind of adjoint relation. In ...

  4. Economy, market and chain

    OpenAIRE

    Sukkel, W.; Hommes, M.

    2009-01-01

    In their pursuit of growth and professionalisation, the Dutch organic sector focuses primarily on market development. But how do you stimulate the market for organic foods? This is the subject of many research projects concerning market, consumer preferences and the supply chain. These projects focus specifically at consumer purchasing behaviour, product development, supply chain formation and minimising cost price. As a rule, this research takes place in close cooperation with chain actors

  5. Supply chain planning classification

    Science.gov (United States)

    Hvolby, Hans-Henrik; Trienekens, Jacques; Bonde, Hans

    2001-10-01

    Industry experience a need to shift in focus from internal production planning towards planning in the supply network. In this respect customer oriented thinking becomes almost a common good amongst companies in the supply network. An increase in the use of information technology is needed to enable companies to better tune their production planning with customers and suppliers. Information technology opportunities and supply chain planning systems facilitate companies to monitor and control their supplier network. In spite if these developments, most links in today's supply chains make individual plans, because the real demand information is not available throughout the chain. The current systems and processes of the supply chains are not designed to meet the requirements now placed upon them. For long term relationships with suppliers and customers, an integrated decision-making process is needed in order to obtain a satisfactory result for all parties. Especially when customized production and short lead-time is in focus. An effective value chain makes inventory available and visible among the value chain members, minimizes response time and optimizes total inventory value held throughout the chain. In this paper a supply chain planning classification grid is presented based current manufacturing classifications and supply chain planning initiatives.

  6. Equivalence of chain conformations in the surface region of a polymer melt and a single Gaussian chain under critical conditions.

    Science.gov (United States)

    Skvortsov, A M; Leermakers, F A M; Fleer, G J

    2013-08-07

    In the melt polymer conformations are nearly ideal according to Flory's ideality hypothesis. Silberberg generalized this statement for chains in the interfacial region. We check the Silberberg argument by analyzing the conformations of a probe chain end-grafted at a solid surface in a sea of floating free chains of concentration φ by the self-consistent field (SCF) method. Apart from the grafting, probe chain and floating chains are identical. Most of the results were obtained for a standard SCF model with freely jointed chains on a six-choice lattice, where immediate step reversals are allowed. A few data were generated for a five-choice lattice, where such step reversals are forbidden. These coarse-grained models describe the equilibrium properties of flexible atactic polymer chains at the scale of the segment length. The concentration was varied over the whole range from φ = 0 (single grafted chain) to φ = 1 (probe chain in the melt). The number of contacts with the surface, average height of the free end and its dispersion, average loop and train length, tail size distribution, end-point and overall segment distributions were calculated for a grafted probe chain as a function of φ, for several chain lengths and substrate∕polymer interactions, which were varied from strong repulsion to strong adsorption. The computations show that the conformations of the probe chain in the melt do not depend on substrate∕polymer interactions and are very similar to the conformations of a single end-grafted chain under critical conditions, and can thus be described analytically. When the substrate∕polymer interaction is fixed at the value corresponding to critical conditions, all equilibrium properties of a probe chain are independent of φ, over the whole range from a dilute solution to the melt. We believe that the conformations of all flexible chains in the surface region of the melt are close to those of an appropriate single chain in critical conditions, provided

  7. Status of time reversal invariance

    International Nuclear Information System (INIS)

    Henley, E.M.

    1989-01-01

    Time Reversal Invariance is introduced, and theories for its violation are reviewed. The present experimental and theoretical status of Time Reversal Invariance and tests thereof will be presented. Possible future tests will be discussed. 30 refs., 2 figs., 1 tab

  8. Introduction to time reversal theory

    International Nuclear Information System (INIS)

    Henley, E.M.

    1987-01-01

    Theory and reaction mechanisms relevant to time reversal invariance are reviewed. Consequences of time reversal invariance are presented under the headings of CP tests, electromagnetic moments, weak emissions or absorptions, and scattering reactions. 8 refs., 4 figs

  9. Diseno macromolecular par transferencia de cadena

    NARCIS (Netherlands)

    Heuts, J.P.A.; Munoz Bonilla, A.

    2010-01-01

    In this overview article, a brief description and discussion is given about the controlled radical techniques which are based on chain transfer, i.e., Catalytic Chain Transfer (CCT) and Reversible Addition-Fragmentation chain Transfer (RAFT). The CCT is an incredibly efficient method for making

  10. The Causes of Preference Reversal.

    OpenAIRE

    Tversky, Amos; Slovic, Paul; Kahneman, Daniel

    1990-01-01

    Observed preference reversal cannot be adequately explained by violations of independence, the reduction axiom, or transitivity. The primary cause of preference reversal is the failure of procedure invariance, especially the overpricing of low-probability, high-payoff bets. This result violates regret theory and generalized (nonindependent) utility models. Preference reversal and a new reversal involving time preferences are explained by scale compatibility, which implies that payoffs are wei...

  11. Geomagnetic Field During a Reversal

    Science.gov (United States)

    Heirtzler, J. R.

    2003-01-01

    It has frequently been suggested that only the geomagnetic dipole, rather than higher order poles, reverse during a geomagnetic field reversal. Under this assumption the geomagnetic field strength has been calculated for the surface of the Earth for various steps of the reversal process. Even without an eminent a reversal of the field, extrapolation of the present secular change (although problematic) shows that the field strength may become zero in some geographic areas within a few hundred years.

  12. A Study on Reverse Logistics

    OpenAIRE

    Reddy, Dhananjaya

    2011-01-01

    In the competitive world of manufacturing, companies are often searching for new ways to improve their process, customer satisfaction and stay ahead in the game with their competitors. Reverse logistics has been considered a strategy to bring these things to life for the past decade or so. This thesis work tries to shed some light on the basics of reverse logistics and how reverse logistics can be used as a management strategy. This paper points out the fundamentals of reverse logistics and l...

  13. Geomagnetic Reversals during the Phanerozoic.

    Science.gov (United States)

    McElhinny, M W

    1971-04-09

    An antalysis of worldwide paleomagnetic measurements suggests a periodicity of 350 x 10(6) years in the polarity of the geomagnetic field. During the Mesozoic it is predominantly normal, whereas during the Upper Paleozoic it is predominantly reversed. Although geomagnetic reversals occur at different rates throughout the Phanerozoic, there appeaars to be no clear correlation between biological evolutionary rates and reversal frequency.

  14. Supply chain integration in the product return process: A study of consumer electronics retailers

    Directory of Open Access Journals (Sweden)

    Wynand Mostert

    2017-07-01

    Contribution: Academically, this study expands the literature on supply chain integration in an unexplored context. For managers, this study identifies various reverse logistics integration barriers and details what practices and strategies improve the probability of successful integration efforts.

  15. Enantiopure heterobimetallic single-chain magnets from the chiral Ru(III) building block.

    Science.gov (United States)

    Ru, Jing; Gao, Feng; Wu, Tao; Yao, Min-Xia; Li, Yi-Zhi; Zuo, Jing-Lin

    2014-01-21

    A pair of one-dimensional enantiomers based on the versatile chiral dicyanoruthenate(III) building block have been synthesized and they are chiral single-chain magnets with the effective spin-reversal barrier of 28.2 K.

  16. On DNA codes from a family of chain rings

    Directory of Open Access Journals (Sweden)

    Elif Segah Oztas

    2017-01-01

    Full Text Available In this work, we focus on reversible cyclic codes which correspond to reversible DNA codes or reversible-complement DNA codes over a family of finite chain rings, in an effort to extend what was done by Yildiz and Siap in [20]. The ring family that we have considered are of size $2^{2^k}$, $k=1,2, \\cdots$ and we match each ring element with a DNA $2^{k-1}$-mer. We use the so-called $u^2$-adic digit system to solve the reversibility problem and we characterize cyclic codes that correspond to reversible-complement DNA-codes. We then conclude our study with some examples.

  17. Supply Chain Management

    DEFF Research Database (Denmark)

    Wieland, Andreas; Handfield, Robert B.

    Supply chain management has made great strides in becoming a discipline with a standalone body of theories. As part of this evolution, researchers have sought to embed and integrate observed supply chain management phenomena into theoretical statements. In our review, we explore where we have been...

  18. Critical Chain Exercises

    Science.gov (United States)

    Doyle, John Kevin

    2010-01-01

    Critical Chains project management focuses on holding buffers at the project level vs. task level, and managing buffers as a project resource. A number of studies have shown that Critical Chain project management can significantly improve organizational schedule fidelity (i.e., improve the proportion of projects delivered on time) and reduce…

  19. Value Chain Engineering

    DEFF Research Database (Denmark)

    Wæhrens, Brian Vejrum; Slepniov, Dmitrij

    2015-01-01

    This workbook is recommended for the attention of students of and managers in Danish small and medium sized enterprises (SMEs). Danish SMEs are currently facing a number of key challenges related to their position in global value chains. This book provides an insight into value chain management t...

  20. Fields From Markov Chains

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2005-01-01

    A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly.......A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly....

  1. Reversal Strategies for NOACs

    DEFF Research Database (Denmark)

    Husted, Steen; Verheugt, Freek; Comuth, Willemijn

    2015-01-01

    , coagulation factor concentrates or NOAC-specific antidotes could be used. Coagulation factor concentrates can be used in patients with haemophilia and to reverse the effect of VKAs but, in NOAC-treated patients, results are inconsistent and these agents could potentially have pro-thrombotic effects. Specific...... antidotes for NOACs are expected to be on the market soon. Phase III clinical trials with a humanized antibody fragment directed against dabigatran (idarucizumab) and recombinant, modified factor Xa (andexanet alfa) are ongoing. A molecule (aripazine) with broad activity against various anticoagulants...

  2. Reversible brazing process

    Science.gov (United States)

    Pierce, Jim D.; Stephens, John J.; Walker, Charles A.

    1999-01-01

    A method of reversibly brazing surfaces together. An interface is affixed to each surface. The interfaces can be affixed by processes such as mechanical joining, welding, or brazing. The two interfaces are then brazed together using a brazing process that does not defeat the surface to interface joint. Interfaces of materials such as Ni-200 can be affixed to metallic surfaces by welding or by brazing with a first braze alloy. The Ni-200 interfaces can then be brazed together using a second braze alloy. The second braze alloy can be chosen so that it minimally alters the properties of the interfaces to allow multiple braze, heat and disassemble, rebraze cycles.

  3. Forbidden subgraph pairs for traceability of block-chains

    Directory of Open Access Journals (Sweden)

    Binlong Li

    2013-04-01

    Full Text Available A block-chain is a graph whose block graph is a path, i.e. it is either a $P_1$, a $P_2$, or a 2-connected graph, or a graph of connectivity 1 with exactly two end-blocks. A graph is called traceable if it contains a Hamilton path. A traceable graph is clearly a block-chain, but the reverse does not hold in general.In this paper we characterize all pairs of connected graphs $\\{R,S\\}$ such that every $\\{R,S\\}$-free block-chain is traceable.

  4. Integrated supply chain risk management

    OpenAIRE

    Riaan Bredell; Jackie Walters

    2007-01-01

    Integrated supply chain risk management (ISCRM) has become indispensable to the theory and practice of supply chain management. The economic and political realities of the modern world require not only a different approach to supply chain management, but also bold steps to secure supply chain performance and sustainable wealth creation. Integrated supply chain risk management provides supply chain organisations with a level of insight into their supply chains yet to be achieved. If correctly ...

  5. Supply Chain Connectivity: Enhancing Participation in the Global Supply Chain

    OpenAIRE

    Patalinghug, Epictetus E.

    2015-01-01

    Supply chain connectivity is vital for the efficient flow of trade among APEC economies. This paper reviews the literature and supply chain management, describes the barriers to enhancing participation in global supply chain, analyzes the various measures of supply chain performance, and suggests steps for the Philippines to fully reap the benefits of the global value chain.

  6. Reversibly Bistable Flexible Electronics

    KAUST Repository

    Alfaraj, Nasir

    2015-05-01

    Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent. While maintaining large-scale production and prototyping rapidity, this flexible and translucent scheme demonstrates the potential to transform conventionally stiff electronic devices into thin and foldable ones without compromising long-term performance and reliability. In this work, we report on the fabrication and characterization of reversibly bistable flexible electronic switches that utilize flexible n-channel metal-oxide-semiconductor field-effect transistors. The transistors are fabricated initially on rigid (100) silicon substrates before they are peeled off. They can be used to control flexible batches of light-emitting diodes, demonstrating both the relative ease of scaling at minimum cost and maximum reliability and the feasibility of integration. The peeled-off silicon fabric is about 25 µm thick. The fabricated devices are transferred to a reversibly bistable flexible platform through which, for example, a flexible smartphone can be wrapped around a user’s wrist and can also be set back to its original mechanical position. Buckling and cyclic bending of such host platforms brings a completely new dimension to the development of flexible electronics, especially rollable displays.

  7. Fast switching of bistable magnetic nanowires through collective spin reversal

    Science.gov (United States)

    Vindigni, Alessandro; Rettori, Angelo; Bogani, Lapo; Caneschi, Andrea; Gatteschi, Dante; Sessoli, Roberta; Novak, Miguel A.

    2005-08-01

    The use of magnetic nanowires as memory units is made possible by the exponential divergence of the characteristic time for magnetization reversal at low temperature, but the slow relaxation makes the manipulation of the frozen magnetic states difficult. We suggest that finite-size segments can show a fast switching if collective reversal of the spins is taken into account. This mechanism gives rise at low temperatures to a scaling law for the dynamic susceptibility that has been experimentally observed for the dilute molecular chain Co(hfac)2NitPhOMe. These results suggest a possible way of engineering nanowires for fast switching of the magnetization.

  8. Top Management Support Partially Optimized Reverse Logistics in The Manufacturing Sector of Pakistan

    Directory of Open Access Journals (Sweden)

    Ms. Sitara Shafiq

    2013-07-01

    Full Text Available Supply chain management urges reverse logistics to be an effective tool for organizational competitive advantage. Reverse chains demand astute resource deployments and strategic focus by the top management. In Pakistan manufacturing industries employing reverse logistics for cost effectiveness reported heavy reliance on top management support. However, literature is yet not benefited by such empirical facts. This study hypothesized that top management support is key for cost effective reverse logistics. Collecting and analyzing reliable data for various elements of its variables of interests, the study confirmed considerable multi linear regression between top management support and cost effectiveness. Substantiating the hypothesis, it contributes that a significant impact of strategic focus and resource commitment by top management leads reverse logistics based manufacturers to success.

  9. Understanding the supply chain

    Directory of Open Access Journals (Sweden)

    Aćimović Slobodan

    2006-01-01

    Full Text Available Supply chain management represents new business philosophy and includes strategically positioned and much wider scope of activity in comparison with its "older brother" - management of logistics. Philosophy of the concept of supply chain is directed to more coordination of key business functions of every link in distribution chain in the process of organization of the flow of both goods and information, while logistic managing instruments are focused on internal optimum of flows of goods and information within one company. Applying the concept of integrated supply chain among several companies makes the importance of operative logistics activity even greater on the level of one company, thus advancing processes of optimum and coordination within and between different companies and confirms the importance of logistics performances for the company’s profitability. Besides the fact that the borders between companies are being deleted, this concept of supply chain in one distribution channel influences increasing of importance of functional, i.e. traditional business managing approaches but instead it points out the importance of process managing approaches. Although the author is aware that "there is nothing harder, more dangerous and with uncertain success, but to find a way for introducing some novelties (Machiavelli, it would be even his additional stimulation for trying to bring closer the concept and goals of supply chain implementation that are identified in key, relevant, modern, theoretical and consulting approaches in order to achieve better understanding of the subject and faster implementation of the concept of supply chain management by domestic companies.

  10. Reversible posterior leukoencephalopathy syndrome

    International Nuclear Information System (INIS)

    Lee, Eun Ja; Yu, Won Jong; Ahn, Kook Jin; Jung, So Lyung; Lee, Yeon Soo; Kim, Ji Chang; Kang, Si Won; Song, Chang Joon; Song, Soon-Young; Koo, Ja Hong; Kim, Man Deuk

    2001-01-01

    To review reversible posterior leukoencephalopathy syndrome. We reviewed 22 patients (M:F=3:19; age, 17-46 years) with the characteristic clinical and imaging features of reversible posterior leukoencephalopathy syndrome. All underwent brain MRI, and in three cases both CT and MRI were performed. In one, MRA was obtained, and in eleven, follow-up MR images were obtained. We evaluated the causes of this syndrome, its clinical manifestations, and MR findings including the locations of lesions, the presence or absence of contrast enhancement, and the changes seen at follow-up MRI. Of the 22 patients, 13 had eclampsia (six during pregnancy and seven during puerperium). Four were receiving immunosuppressive therapy (three, cyclosporine ; one, FK 506). Four suffered renal failure and one had complicated migraine. The clinical manifestations included headache (n=12), visual disturbance (n=13), seizure (n=15), focal neurologic sign (n=3), and altered mental status (n=2). Fifteen patients had hypertension and the others normotension. MRI revealed that lesions were bilateral (n=20) or unilateral (n=2). In all patients the lesion was found in the cortical and subcortical areas of the parieto-occipital lobes ; other locations were the basal ganglia (n=9), posterior temporal lobe (n=8), frontal lobe (n=5), cerebellum (n=5), pons (n=2), and thalamus (n=1). All lesions were of high signal intensity on T2-weighted images, and of iso to low intensity on T1-weighted images. One was combined with acute hematoma in the left basal ganglia. In eight of 11 patients who underwent postcontrast T1-weighted MRI, there was no definite enhancement ; in one, enhancement was mild, and in tow, patchy. CT studies showed low attenuation, and MRA revealed mild vasospasm. The symptoms of all patients improved. Follow-up MRI in nine of 11 patients depicted complete resolution of the lesions ; in two, small infarctions remained but the extent of the lesions had decreased. Reversible posterior

  11. Reversible posterior leukoencephalopathy syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eun Ja; Yu, Won Jong; Ahn, Kook Jin; Jung, So Lyung; Lee, Yeon Soo; Kim, Ji Chang; Kang, Si Won [The Catholic Univ. of Korea, Taejon (Korea, Republic of); Song, Chang Joon [Chungnam National Univ. School of Medicine, Cheonju (Korea, Republic of); Song, Soon-Young; Koo, Ja Hong [Kwandong Univ. College of Medicine, Myungji Hospital, Seoul (Korea, Republic of); Kim, Man Deuk [College of Medicine Pochon CHA Univ., Seoul (Korea, Republic of)

    2001-10-01

    To review reversible posterior leukoencephalopathy syndrome. We reviewed 22 patients (M:F=3:19; age, 17-46 years) with the characteristic clinical and imaging features of reversible posterior leukoencephalopathy syndrome. All underwent brain MRI, and in three cases both CT and MRI were performed. In one, MRA was obtained, and in eleven, follow-up MR images were obtained. We evaluated the causes of this syndrome, its clinical manifestations, and MR findings including the locations of lesions, the presence or absence of contrast enhancement, and the changes seen at follow-up MRI. Of the 22 patients, 13 had eclampsia (six during pregnancy and seven during puerperium). Four were receiving immunosuppressive therapy (three, cyclosporine ; one, FK 506). Four suffered renal failure and one had complicated migraine. The clinical manifestations included headache (n=12), visual disturbance (n=13), seizure (n=15), focal neurologic sign (n=3), and altered mental status (n=2). Fifteen patients had hypertension and the others normotension. MRI revealed that lesions were bilateral (n=20) or unilateral (n=2). In all patients the lesion was found in the cortical and subcortical areas of the parieto-occipital lobes ; other locations were the basal ganglia (n=9), posterior temporal lobe (n=8), frontal lobe (n=5), cerebellum (n=5), pons (n=2), and thalamus (n=1). All lesions were of high signal intensity on T2-weighted images, and of iso to low intensity on T1-weighted images. One was combined with acute hematoma in the left basal ganglia. In eight of 11 patients who underwent postcontrast T1-weighted MRI, there was no definite enhancement ; in one, enhancement was mild, and in tow, patchy. CT studies showed low attenuation, and MRA revealed mild vasospasm. The symptoms of all patients improved. Follow-up MRI in nine of 11 patients depicted complete resolution of the lesions ; in two, small infarctions remained but the extent of the lesions had decreased. Reversible posterior

  12. Plastic value chains

    DEFF Research Database (Denmark)

    Baxter, John; Wahlstrom, Margareta; Zu Castell-Rüdenhausen, Malin

    2014-01-01

    Optimizing plastic value chains is regarded as an important measure in order to increase recycling of plastics in an efficient way. This can also lead to improved awareness of the hazardous substances contained in plastic waste, and how to avoid that these substances are recycled. As an example......, plastics from WEEE is chosen as a Nordic case study. The project aims to propose a number of improvements for this value chain together with representatives from Nordic stakeholders. Based on the experiences made, a guide for other plastic value chains shall be developed....

  13. Project Decision Chain

    DEFF Research Database (Denmark)

    Rolstadås, Asbjørn; Pinto, Jeffrey K.; Falster, Peter

    2015-01-01

    To add value to project performance and help obtain project success, a new framework for decision making in projects is defined. It introduces the project decision chain inspired by the supply chain thinking in the manufacturing sector and uses three types of decisions: authorization, selection......, and plan decision. A primitive decision element is defined where all the three decision types can be accommodated. Each task in the primitive element can in itself contain subtasks that in turn will comprise new primitive elements. The primitive elements are nested together in a project decision chain....

  14. Control Towers in Supply Chain Management - Past and Future

    Directory of Open Access Journals (Sweden)

    Anna Trzuskawska-Grzesińska

    2017-02-01

    Full Text Available The global economy requires global supply chain management which relies on visibility and responsiveness. Determinants such as: information technology tools, process knowledge, sales and operations planning experiences, etc., enable the formation of theory and practice for the supply chain control tower concept. The goal of the research paper is to identify business examples of different approaches to the supply chain control tower in the past and initiate a discussion on their future. This paper synthesizes past control tower practices and identifies possible future trends. The author performed: literature analysis, three selected companies' case studies and comparative analyses. As the control towers evolve, while supply chains are transforming continuous, update from the market is needed. The research findings showed the selected companies, in the future, perceived control tower's activities as a potential source of revenue not just solely a source of cost and time optimization as well as a source of value added to customer. The researched control towers were built and still they are developed. The business frequently changes and requires control towers to be adjusted, reengineered and adaptive. The researched control towers are needed to keep control over supply chain while it is transforming. There is a differentiation between the supply chain control towers, logistic services control towers and reverse supply chain control towers. An integration mechanism between the control towers would be necessary to assure entire supply chain visibility and orchestration. The research also shows the knowledge gap regarding the control towers in supply chain, specially their possible configurations and future.

  15. The Financial Supply Chain Management: a New Solution for Supply Chain Resilience

    Directory of Open Access Journals (Sweden)

    Virgil Popa

    2013-02-01

    Full Text Available In the present article, the author aims to find solutions to optimize the supply chain for the cash flow – a flow of products reversed from the physical one and the two-ways flow of information. In the last 15-20 years, academics and practitioners were oriented towards increasing the speed, cost reduction on supply chain material’s flow, oriented towards 3RP (3 Resource Planning logistics solutions and management solutions such as outsourcing or collaborative management. In terms of information flow, there has been a real revolution with the rise of the Internet and information technology standards introduced by the VICS (Voluntary Interindustry Commerce Standards, CSCMP (Council of Supply Chain Management Professionals, SCC (Supply Chain Council şi ECR Europe (Efficient Consumer Respons. The objective of this paper is to identify new ways of working together on supply chain financial flows. Methods used are the documentation in the literature and the practices of transnational companies under recession. Results refer to the identification of new solutions such as reverse factoring. A comparative analysis regarding the european and national regulations gets us to the conclusion that Romania is still tributary to traditional commercial credit. We propose that the Collaborative management, as a modus vivendi in a globalized and super computerized world, must be included within all Romanian organizations life, within the Supply Chain, but also those which are 3PL (Third Part Logistics and 4PL (Four Part Logistics organizations, where not only information services are included, but also financial services (banks and specialized financial institutions.

  16. Improving the Reverse Logistics Respecting Principles of Sustainable Development in an Industrial Company

    Science.gov (United States)

    Fidlerová, Helena; Mĺkva, Miroslava

    2016-06-01

    Reverse logistics, the movement of materials back up the supply chain, is recognised by many organisations as an opportunity for adding value. The paper considers the theoretical framework and the conception of reverse logistics in literature and practice. The objective of the article is to propose tangible solutions which eliminate the imbalances in reverse logistics and improve the waste management in the company. The case study focuses on the improvement in the process of waste packaging in the context of sustainable development as a part of reverse logistics in the surveyed industrial company in Slovakia.

  17. Influence of magnetostatic interactions on the magnetization reversal of patterned magnetic elements

    International Nuclear Information System (INIS)

    Yin Xioalu; Liou, S. H.; Adeyeye, A. O.; Jain, S.; Han Baoshan

    2011-01-01

    The magnetization reversal in patterned thin-film arrays of elliptical submicron permalloy elements has been investigated by magnetic-force microscopy and micro-magneto-optic Kerr effect. Three different spatial arrangements of chains are considered, namely chains aligned parallel to the long axis of the ellipse, chains aligned parallel to the short axis of the ellipse, and arrays with roughly equal element-to-element spacings in both directions. Comparison of the hysteresis loops in an in-plane field perpendicular to the ellipses' long axes shows that the magnetization reversibility is highest for chains along the long axis. This is due to the nearly coherent magnetization rotation in the applied magnetic field and to the formation of a head-to-tail domain arrangement. Other arrangements, such as chains of ellipses aligned parallel to short axis, yield flux-closure domains as the applied magnetic field is changed.

  18. Reverse osmosis application studies

    International Nuclear Information System (INIS)

    Golomb, A.

    1982-02-01

    To assess the feasibility of applying reverse osmosis (RO) and ultrafiltration (UF) for effective treatment of process and waste streams from operations at Ontario Hydro's thermal and nuclear stations, an extensive literature survey has been carried out. It is concluded that RO is not at present economic for pretreatment of Great Lakes water prior to ion exchange demineralization for boiler makeup. Using both conventional and novel commercial membrane modules, RO pilot studies are recommended for treatment of boiler cleaning wastes, fly ash leachates, and flue gas desulphurization scrubber discharges for removal of heavy metals. Volume reduction and decontamination of nuclear station low-level active liquid waste streams by RO/UF also appear promising. Research programmes are proposed

  19. Reverse photoacoustic standoff spectroscopy

    Science.gov (United States)

    Van Neste, Charles W [Kingston, TN; Senesac, Lawrence R [Knoxville, TN; Thundat, Thomas G [Knoxville, TN

    2011-04-12

    A system and method are disclosed for generating a reversed photoacoustic spectrum at a greater distance. A source may emit a beam to a target and a detector measures signals generated as a result of the beam being emitted on the target. By emitting a chopped/pulsed light beam to the target, it may be possible to determine the target's optical absorbance by monitoring the intensity of light collected at the detector at different wavelengths. As the wavelength of light is changed, the target may absorb or reject each optical frequency. Rejection may increase the intensity at the sensing element and absorption may decrease the intensity. Accordingly, an identifying spectrum of the target may be made with the intensity variation of the detector as a function of illuminating wavelength.

  20. Reverse Osmosis Optimization

    Energy Technology Data Exchange (ETDEWEB)

    McMordie Stoughton, Kate; Duan, Xiaoli; Wendel, Emily M.

    2013-08-26

    This technology evaluation was prepared by Pacific Northwest National Laboratory on behalf of the U.S. Department of Energy’s Federal Energy Management Program (FEMP). ¬The technology evaluation assesses techniques for optimizing reverse osmosis (RO) systems to increase RO system performance and water efficiency. This evaluation provides a general description of RO systems, the influence of RO systems on water use, and key areas where RO systems can be optimized to reduce water and energy consumption. The evaluation is intended to help facility managers at Federal sites understand the basic concepts of the RO process and system optimization options, enabling them to make informed decisions during the system design process for either new projects or recommissioning of existing equipment. This evaluation is focused on commercial-sized RO systems generally treating more than 80 gallons per hour.¬

  1. Reverse Osmosis Optimization

    Energy Technology Data Exchange (ETDEWEB)

    None

    2013-08-01

    This technology evaluation was prepared by Pacific Northwest National Laboratory on behalf of the U.S. Department of Energy’s Federal Energy Management Program (FEMP). The technology evaluation assesses techniques for optimizing reverse osmosis (RO) systems to increase RO system performance and water efficiency. This evaluation provides a general description of RO systems, the influence of RO systems on water use, and key areas where RO systems can be optimized to reduce water and energy consumption. The evaluation is intended to help facility managers at Federal sites understand the basic concepts of the RO process and system optimization options, enabling them to make informed decisions during the system design process for either new projects or recommissioning of existing equipment. This evaluation is focused on commercial-sized RO systems generally treating more than 80 gallons per hour.

  2. Sex Reversal in Amphibians.

    Science.gov (United States)

    Flament, Stéphane

    2016-01-01

    Amphibians have been widely used to study developmental biology due to the fact that embryo development takes place independently of the maternal organism and that observations and experimental approaches are easy. Some amphibians like Xenopus became model organisms in this field. In the first part of this article, the differentiation of the gonads in amphibians and the mechanisms governing this process are reviewed. In the second part, the state of the art about sex reversal, which can be induced by steroid hormones in general and by temperature in some species, is presented. Also information about pollutants found in the environment that could interfere with the development of the amphibian reproductive apparatus or with their reproductive physiology is given. Such compounds could play a part in the amphibian decline, since in the wild, many amphibians are endangered species. © 2016 S. Karger AG, Basel.

  3. The power of nudging ; Using reverse logistics to improve recycling behaviour in household waste management while taking the intention-action gap into account

    OpenAIRE

    Samuelsen, Asta Gjetø; Støyle, Rebecka Våge

    2016-01-01

    Masteroppgave(MSc) in Master of Science in Business, Logistics, operations and supply chain management - Handelshøyskolen BI, 2016 Reverse logistics plays an important role in keeping resources in the supply chain for as long as possible through the creation of a circular waste management system. In household waste management, the success of such a system depends on the end-consumer, which supplies waste to the reverse supply chain. The aim of this thesis is therefore to examin...

  4. Editorial: Supply Chain Management

    Directory of Open Access Journals (Sweden)

    Aidonis, D.

    2012-01-01

    Full Text Available This special issue has followed up the 2nd Olympus International Conference on Supply Chains held on October 5-6, 2012, in Katerini, Greece. The Conference was organized by the Department of Logistics of Alexander Technological Educational Institution (ATEI of Thessaloniki, in collaboration with the Laboratory of Quantitative Analysis, Logistics and Supply Chain Management of the Department of Mechanical Engineering, Aristotle University of Thessaloniki (AUTH. During the 2-Days Conference more than 50 research papers were presented covering the following thematic areas: (i Business Logistics, (ii Transportation, Telematics and Distribution Networks, (iii Green Logistics, (iv Information and Communication Technologies in Supply Chain Management, and (v Services and Quality. Three keynote invited speakers addressed interesting issues for the Humanitarian Logistics, Green Supply Chains of the Agrifood Sector and the Opportunities and Prospects of Greek Ports chaired Round Tables with other Greek and Foreign Scientists and Specialists.

  5. Characterizing Oregon's supply chains.

    Science.gov (United States)

    2013-03-01

    In many regions throughout the world, freight models are used to aid infrastructure investment and : policy decisions. Since freight is such an integral part of efficient supply chains, more realistic : transportation models can be of greater assista...

  6. Moldova - Value Chain Training

    Data.gov (United States)

    Millennium Challenge Corporation — The evaluation of the GHS value chain training subactivity wwas designed to measure the extent, if any, to which the training activities improved the productivity...

  7. Innovation Across the Supply Chain

    DEFF Research Database (Denmark)

    Druehl, Cheryl; Carrillo, Janice; Hsuan, Juliana

    Innovation is an integral part of every firm’s ongoing operations. Beyond product innovation, supply chain innovations offer a unique source of competitive advantage. We synthesize recent research on innovation in the supply chain, specifically, innovative supply chain processes...

  8. Quantitative models for sustainable supply chain management

    DEFF Research Database (Denmark)

    Brandenburg, M.; Govindan, Kannan; Sarkis, J.

    2014-01-01

    and directions of this research area, this paper provides a content analysis of 134 carefully identified papers on quantitative, formal models that address sustainability aspects in the forward SC. It was found that a preponderance of the publications and models appeared in a limited set of six journals......Sustainability, the consideration of environmental factors and social aspects, in supply chain management (SCM) has become a highly relevant topic for researchers and practitioners. The application of operations research methods and related models, i.e. formal modeling, for closed-loop SCM...... and reverse logistics has been effectively reviewed in previously published research. This situation is in contrast to the understanding and review of mathematical models that focus on environmental or social factors in forward supply chains (SC), which has seen less investigation. To evaluate developments...

  9. Supply chain risk management

    OpenAIRE

    Christian Hollstein; Frank Himpel

    2013-01-01

    Background: Supply chain risk management increasingly gains prominence in many international industries. In order to strengthen supply chain structures, processes, and networks, adequate potentials for risk management need to be built (focus on effective logistics) and to be utilized (focus on efficient logistics). Natural-based disasters, such as the case of Fukushima, illustrate how crucial risk management is. Method: By aligning a theoretical-conceptual framework with empirical-induct...

  10. Main-chain supramolecular block copolymers.

    Science.gov (United States)

    Yang, Si Kyung; Ambade, Ashootosh V; Weck, Marcus

    2011-01-01

    Block copolymers are key building blocks for a variety of applications ranging from electronic devices to drug delivery. The material properties of block copolymers can be tuned and potentially improved by introducing noncovalent interactions in place of covalent linkages between polymeric blocks resulting in the formation of supramolecular block copolymers. Such materials combine the microphase separation behavior inherent to block copolymers with the responsiveness of supramolecular materials thereby affording dynamic and reversible materials. This tutorial review covers recent advances in main-chain supramolecular block copolymers and describes the design principles, synthetic approaches, advantages, and potential applications.

  11. MASTERING SUPPLY CHAIN RISKS

    Directory of Open Access Journals (Sweden)

    Borut Jereb

    2012-11-01

    Full Text Available Risks in supply chains represent one of the major business issues today. Since every organizationstrives for success and uninterrupted operations, efficient supply chain risk management is crucial.During supply chain risk research at the Faculty of Logistics in Maribor (Slovenia some keyissues in the field were identified, the major being the lack of instruments which can make riskmanagement in an organization easier and more efficient. Consequently, a model which captures anddescribes risks in an organization and its supply chain was developed. It is in accordance with thegeneral risk management and supply chain security standards, the ISO 31000 and ISO 28000families. It also incorporates recent finding from the risk management field, especially from theviewpoint of segmenting of the public.The model described in this paper focuses on the risks itself by defining them by different keydimensions, so that risk management is simplified and can be undertaken in every supply chain andorganizations within them. Based on our mode and consequent practical research in actualorganizations, a freely accessible risk catalog has been assembled and published online from the risksthat have been identified so far. This catalog can serve as a checklist and a starting point in supplychain risk management in organizations. It also incorporates experts from the field into a community,in order to assemble an ever growing list of possible risks and to provide insight into the model andits value in practice.

  12. Identifying reverse 3PL performance critical success factors

    OpenAIRE

    Sharif, A M

    2009-01-01

    The reverse and third party logistics operational process is now well known and established to be a vital component of modern day supply chain and product / service-based organizations (Marasco, 2007). Apart from being a vital component of such enterprises, many researchers and practitioners have also been noting the importance of this approach and its impact on customer service, satisfaction, profitability and other key performance indicators (Autry et al., 2001). However, studies relating t...

  13. Collisionless magnetic reconnection in a plasmoid chain

    Directory of Open Access Journals (Sweden)

    S. Markidis

    2012-02-01

    Full Text Available The kinetic features of plasmoid chain formation and evolution are investigated by two dimensional Particle-in-Cell simulations. Magnetic reconnection is initiated in multiple X points by the tearing instability. Plasmoids form and grow in size by continuously coalescing. Each chain plasmoid exhibits a strong out-of plane core magnetic field and an out-of-plane electron current that drives the coalescing process. The disappearance of the X points in the coalescence process are due to anti-reconnection, a magnetic reconnection where the plasma inflow and outflow are reversed with respect to the original reconnection flow pattern. Anti-reconnection is characterized by the Hall magnetic field quadrupole signature. Two new kinetic features, not reported by previous studies of plasmoid chain evolution, are here revealed. First, intense electric fields develop in-plane normally to the separatrices and drive the ion dynamics in the plasmoids. Second, several bipolar electric field structures are localized in proximity of the plasmoid chain. The analysis of the electron distribution function and phase space reveals the presence of counter-streaming electron beams, unstable to the two stream instability, and phase space electron holes along the reconnection separatrices.

  14. 49 CFR 230.89 - Reverse gear.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Reverse gear. 230.89 Section 230.89 Transportation... Reversing Gear § 230.89 Reverse gear. (a) General provisions. Reverse gear, reverse levers, and quadrants... quadrant. Proper counterbalance shall be provided for the valve gear. (b) Air-operated power reverse gear...

  15. Surfboards of different materials: a reverse logistics analysis

    Directory of Open Access Journals (Sweden)

    Matheus Moraes Zambon

    2016-04-01

    Full Text Available There are about 35 million surfers in the world and more than 3 million in Brazil. The surfer’s lifestyle is associated with nature, although the materials used to produce a surfboard are usually toxic and difficult to recover its value. This study deals with the reverse logistics of surfboards made of three different materials. The production chain is characterized and the waste generated in the manufacturing process and in the post-use were identified. Waste recovery initiatives in Brazil and other countries were also listed. Data collection was conducted by visits to surfboards manufacturers in Florianopolis and interviews to manufacturers from other localities. The findings show that the three types of surfboards have similar reuse channels, and the polyurethane surfboards waste – the surfboard with the highest market share – are not recovered into the same industry, unlike EPS surfboards waste.  Keywords: Reverse logistics; surfboard; Reverse channels.

  16. Field reversal experiments (FRX)

    International Nuclear Information System (INIS)

    Linford, R.K.; Armstrong, W.T.; Platts, D.A.; Sherwood, E.G.

    1978-01-01

    The equilibrium, confinement, and stability properties of the reversed-field configuration (RFC) are being studied in two theta-pinch facilities. The RFC is an elongated toroidal plasma confined in a purely poloidal field geometry. The open field lines of the linear theta pinch support the closed-field RFC much like the vertical field centers the toroidal plasma in a tokamak. Depending on stability and confinement properties, the RFC might be used to greatly reduce the axial losses in linear fusion devices such as mirrors, theta pinches, and liners. The FRX systems produce RFC's with a major radius R = 2-6 cm, minor radius a approximately 2 cm, and a total length l approximately 35 cm. The observed temperatures are T/sub e/ approximately 100 eV and T/sub i/ = 150-350 eV with a peak density n approximately 2 x 10 15 cm -3 . After the plasma reaches equilibrium, the RFC remains stable for up to 30 μs followed by the rapid growth of the rotational m = 2 instability, which terminates the confinement. During the stable equilibrium, the particle and energy confinement times are more than 10 times longer than in an open-field system. The behavior of the m = 2 mode qualitatively agrees with the theoretically predicted instability for rotational velocities exceeding some critical value

  17. Field reversal experiments (FRX)

    International Nuclear Information System (INIS)

    Linford, R.K.; Armstrong, W.T.; Platts, D.A.; Sherwood, E.G.

    1979-01-01

    The equilibrium, confinement, and stability properties of the reversed-field configuration (RFC) are being studied in two theta-pinch facilities. The RFC is an elongated toroidal plasma confined in a purely poloidal field geometry. The open field lines of the linear theta pinch support the closed-field RFC much like the vertical field centres the toroidal plasma in a tokamak. Depending on stability and confinement properties, the RFC might be used to greatly reduce the axial losses in linear fusion devices such as mirrors, theta pinches, and liners. The FRX systems produce RFCs with a major radius R=2-6cm, a minor radius a approximately 2cm, and a total length l approximately 35cm. The observed temperatures are Tsub(e) approximately 100eV and Tsub(i)=150-350eV with a peak density n approximately 2x10 15 cm -3 . After the plasma has reached equilibrium, the RFC remains stable for up to 30μs, followed by the rapid growth of the rotational m=2 instability, which terminates the confinement. During the stable equilibrium, the particle and energy confinement times are more than 10 times longer than in an open-field system. The behaviour of the m=2 mode agrees qualitatively with the theoretically predicted instability for rotational velocities exceeding some critical value. (author)

  18. Phasic Triplet Markov Chains.

    Science.gov (United States)

    El Yazid Boudaren, Mohamed; Monfrini, Emmanuel; Pieczynski, Wojciech; Aïssani, Amar

    2014-11-01

    Hidden Markov chains have been shown to be inadequate for data modeling under some complex conditions. In this work, we address the problem of statistical modeling of phenomena involving two heterogeneous system states. Such phenomena may arise in biology or communications, among other fields. Namely, we consider that a sequence of meaningful words is to be searched within a whole observation that also contains arbitrary one-by-one symbols. Moreover, a word may be interrupted at some site to be carried on later. Applying plain hidden Markov chains to such data, while ignoring their specificity, yields unsatisfactory results. The Phasic triplet Markov chain, proposed in this paper, overcomes this difficulty by means of an auxiliary underlying process in accordance with the triplet Markov chains theory. Related Bayesian restoration techniques and parameters estimation procedures according to the new model are then described. Finally, to assess the performance of the proposed model against the conventional hidden Markov chain model, experiments are conducted on synthetic and real data.

  19. Nodal-chain metals.

    Science.gov (United States)

    Bzdušek, Tomáš; Wu, QuanSheng; Rüegg, Andreas; Sigrist, Manfred; Soluyanov, Alexey A

    2016-10-06

    The band theory of solids is arguably the most successful theory of condensed-matter physics, providing a description of the electronic energy levels in various materials. Electronic wavefunctions obtained from the band theory enable a topological characterization of metals for which the electronic spectrum may host robust, topologically protected, fermionic quasiparticles. Many of these quasiparticles are analogues of the elementary particles of the Standard Model, but others do not have a counterpart in relativistic high-energy theories. A complete list of possible quasiparticles in solids is lacking, even in the non-interacting case. Here we describe the possible existence of a hitherto unrecognized type of fermionic excitation in metals. This excitation forms a nodal chain-a chain of connected loops in momentum space-along which conduction and valence bands touch. We prove that the nodal chain is topologically distinct from previously reported excitations. We discuss the symmetry requirements for the appearance of this excitation and predict that it is realized in an existing material, iridium tetrafluoride (IrF 4 ), as well as in other compounds of this class of materials. Using IrF 4 as an example, we provide a discussion of the topological surface states associated with the nodal chain. We argue that the presence of the nodal-chain fermions will result in anomalous magnetotransport properties, distinct from those of materials exhibiting previously known excitations.

  20. Reverse logistics: an empirical study for operational framework

    International Nuclear Information System (INIS)

    Yusuf, I.

    2013-01-01

    This paper presents framework of reverse logistics optimizing the stakeholders gain, social gain, economic gain and environmental gain. It identifies the roadblocks that prevail in recycling industry and describes various types of returns and wastes. Framework of the reverse logistics is evolved on the basis of actual happening of the items shown in table 1-4 disposed off from industries shown in table 6. The rejected items require environmental disposal passing through the different phases described in flow of operational framework. An operational framework of reverse logistics is developed studying fifty organizations.. In ad -dition three best practices of reverse logistics are proposed by consolidating the experiential information and rich hands on industrial experience in supply chain and reverse logistics area. The research has proposed the Social, Stakeholder, Economic and Environmental (SSEE) sustained gain model optimizing the benefits of stakeholders and highlights the variety of waste and its operational methodology in Pakistani industry. The proposed framework does not include the hospital waste, radioactive waste, hazardous materials waste, municipal waste, agricultural waste and cold chain waste like meat, milk, etc.The operational framework is existing way of doing that takes the waste materials from point of origin to the point of recycling. A better understanding of this framework may help researchers and front line managers to develop better, more ac -curate models for effective and sustainable utilization of waste materials, benefiting organizations and soci -ety by simultaneously enhancing the cost effectiveness and improving environmental awareness. The paper provides an operational framework of reverse logistics and 2S2E sustained gain model. Specific applications are examined through empirical research. (author)

  1. Towards a reversible functional language

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2012-01-01

    /equality operator also simplifies inverse computation and program inversion. We discuss the advantages of a reversible functional language using example programs, including run-length encoding. Program inversion is seen to be as lightweight as for imperative reversible languages and realized by recursive descent...

  2. Reverse engineering of RFID devices

    NARCIS (Netherlands)

    Bokslag, W.

    2015-01-01

    This paper discusses the relevance and potential impact of both RFID and reverse engineering of RFID technology, followed by a discussion of common protocols and internals of RFID technology. The focus of the paper is on providing an overview of the different approaches to reverse engineering RFID

  3. How decision reversibility affects motivation

    NARCIS (Netherlands)

    Bullens, L.; van Harreveld, F.; Förster, J.; Higgins, T.E.

    2014-01-01

    The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making,

  4. Enzymatic reactions in reversed micelles

    NARCIS (Netherlands)

    Hilhorst, M.H.

    1984-01-01

    It has been recognised that enzymes in reversed micelles have potential for application in chemical synthesis. Before these expectations will be realised many problems must be overcome. This thesis deals with some of them.
    In Chapter 1 the present knowledge about reversed micelles and

  5. Reversible networks in supramolecular polymers

    NARCIS (Netherlands)

    Havermans - van Beek, D.J.M.

    2007-01-01

    Non–covalent interactions between low molecular weight polymers form the basis of supramolecular polymers. The material properties of such polymers are determined by the strength and lifetime of the non–covalent reversible interactions. Due to the reversibility of the interactions between the low

  6. Reverse genetics of avian metapneumoviruses

    Science.gov (United States)

    An overview of avian metapneumovirus (aMPV) infection in turkeys and development of a reverse genetics system for aMPV subgroup C (aMPV-C) virus will be presented. By using reverse genetics technology, we generated recombinant aMPV-C viruses containing a different length of glycoprotein (G) gene or...

  7. Returns management in the supply chain

    Directory of Open Access Journals (Sweden)

    Anna Maria Jeszka

    2014-09-01

    Full Text Available Background:  The aim of this exploratory empirical research was to evaluate the level of cooperation in the area of reverse logistics between selected retail chains and logistics operators and suppliers; to identify and evaluate the influence the procedures of handling returns have on the relationships with customers, cost reduction, value recovery, inventory reduction and increasing profitability; as well as determining to what extent logistics operators are involved in the procedures of handling returns in the analysed chains. Methods: Based on the literature and the experience of researchers from developed countries a questionnaire was constructed which was subsequently used to conduct empirical research in selected retail chains operating in two provinces in Poland. The questionnaire survey involved the sales personnel of selected retail chains in the clothing industry. Overall, 105 questionnaires were collected and analysed. Results: Various aspects of cooperation with suppliers and logistics operators in respect of handling returns were evaluated. Most indicators of cooperation were evaluated favourably, with the exception of joint access to the database, the use of inventory data available online, and access to information from the warehouse, which received low marks from the respondents. In the case of the studied stores, some of the activities in the area of reverse logistics are outsourced; for example, obtaining products from users, logistics, and the transport of returns are typically done by an outside operator. Inspection, sorting, appraisal, repairs, as well as the sales of refurbished products are usually performed within the studied retail corporations. Conclusions: The research has shown that the retail chains developed very good programmes for handling returns in the supply chain, as evidenced by the presented and highly rated indicators of cooperation, with the exception of information exchange where there is still much

  8. Critical success factors for reverse logistics in Indian industries

    DEFF Research Database (Denmark)

    Mangla, Sachin Kumar; Govindan, Kannan; Luthra, Sunil

    2016-01-01

    Industries face significant pressures to enact eco-friendly practices in their supply chain due to the constraints of natural resources and growing ecological awareness among customers. Reverse logistics (RL) has been considered as a systematic approach for industries to improve their environmental...... Economic and Strategic main factors belong to effect group. This model will help business analysts and supply chain managers formulate both short-term and long-term, flexible decision strategies for successfully managing and implementing RL adoption in the supply chain scenarios....... of the CSFs, while the DEMATEL approach categorizes the causal relationships among them. The findings of this work shows that the Global competitiveness main factor is highly prioritized, and thus, needs to be focused greatly in order to increase the effectiveness of RL adoption in business. The relative...

  9. Integrating reverse logistics and eco-design: a proposal for a new framework

    Directory of Open Access Journals (Sweden)

    Felipe Kich Gontijo

    2014-07-01

    Full Text Available The concepts of Reverse Logistics and Eco-design are discussed in this paper, suggesting that these applications are often treated differently, thus not being able to achieve a higher performance in relation to environmental sustainability. The reason is most reverse logistics applications have a repairer action, since their waste generation is not planned along with product design. The proposal shows how the two concepts can work together, describing the time of each application.Unfolding the two concepts into reverse channels concerning logistics and life cycle analysis of the product as per eco-design, an application model has been developed, promoting integration between the two practices, so that the reverse supply chain is planned along with the product.The result is the development of a model for implementing reverse logistics integrating eco-design, thus optimizing the reverse flow of waste.

  10. MODELS OF PROJECT REVERSE ENGINEERING

    Directory of Open Access Journals (Sweden)

    Віктор Володимирович ІВАНОВ

    2017-03-01

    Full Text Available Reverse engineering decided important scientific and technical problems of increasing the cost of the existing technical product by transforming it into a product with other features or design. Search ideas of the new application of existing products on the base of heuristic analysis were created. The concept of reverse engineering and its division into three types: conceptual, aggregate and complete was expanded. The use of heuristic methods for reverse engineering concept was showed. The modification model of Reverse engineering based on the model of РМВОК was developed. Our model includes two new phases: identification and transformation. At the identification phase, technical control is made. At the transformation phase, search heuristic idea of the new applied existing technical product was made. The model of execution phase that included heuristic methods, metrological equipment, and CAD/CAM/CAE program complex was created. The model that connected economic indicators of reverse engineering project was developed.

  11. What do reversible programs compute?

    DEFF Research Database (Denmark)

    Axelsen, Holger Bock; Glück, Robert

    2011-01-01

    Reversible computing is the study of computation models that exhibit both forward and backward determinism. Understanding the fundamental properties of such models is not only relevant for reversible programming, but has also been found important in other fields, e.g., bidirectional model...... transformation, program transformations such as inversion, and general static prediction of program properties. Historically, work on reversible computing has focussed on reversible simulations of irreversible computations. Here, we take the viewpoint that the property of reversibility itself should...... are not strictly classically universal, but that they support another notion of universality; we call this RTM-universality. Thus, even though the RTMs are sub-universal in the classical sense, they are powerful enough as to include a self-interpreter. Lifting this to other computation models, we propose r...

  12. Fundamentals of reversible flowchart languages

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2016-01-01

    Abstract This paper presents the fundamentals of reversible flowcharts. They are intended to naturally represent the structure and control flow of reversible (imperative) programming languages in a simple computation model, in the same way classical flowcharts do for conventional languages......, structured reversible flowcharts are as expressive as unstructured ones, as shown by a reversible version of the classic Structured Program Theorem. We illustrate how reversible flowcharts can be concretized with two example programming languages, complete with syntax and semantics: a low-level unstructured...... language and a high-level structured language. We introduce concrete tools such as program inverters and translators for both languages, which follow the structure suggested by the flowchart model. To further illustrate the different concepts and tools brought together in this paper, we present two major...

  13. Supply chain quality management

    Directory of Open Access Journals (Sweden)

    Hannan Amoozad Mahdiraji

    2012-10-01

    Full Text Available In recent years, there are several methods introduced for the improvement of operational performances. Total quality management and supply chain management are two methods recommended for this purpose. These two approaches have been studied in most researches separately, while they have objectives in common, and this makes them a strategic means, which can be used, simultaneously. Total quality management and supply chain management play significant roles to increase the organizational competitiveness power. Moreover, they have only one purpose that is customer satisfaction, and they are different only on their approaches to reach their objectives. In this research, we aim to study both approaches of quality management and supply chain, their positive increasing effects that may be generated after their integration. For this purpose, the concept and definitions of each approach is studied, independently, their similarities and differences are recognized, and finally, the advantages of their integration are introduced.

  14. Chain inflation revisited

    International Nuclear Information System (INIS)

    Chialva, Diego; Danielsson, Ulf H

    2008-01-01

    This paper represents an in-depth treatment of the chain inflation scenario. We fully determine the evolution of the universe in the model, the conditions necessary in order to have a successful inflationary period, and the matching with the observational results regarding the cosmological perturbations. We study in great detail, and in general, the dynamics of the background, as well as the mechanism of generation of the perturbations. We also find an explicit formula for the spectrum of adiabatic perturbations. Our results prove that chain inflation is a viable model for solving the horizon, entropy and flatness problems of standard cosmology and for generating the right amount of adiabatic cosmological perturbations. The results are radically different from those found in previous works on the subject. Finally, we argue that there is a natural way to embed chain inflation into flux compactified string theory. We discuss the details of the implementation and how to fit observations

  15. Supply-Chain Optimization Template

    Science.gov (United States)

    Quiett, William F.; Sealing, Scott L.

    2009-01-01

    The Supply-Chain Optimization Template (SCOT) is an instructional guide for identifying, evaluating, and optimizing (including re-engineering) aerospace- oriented supply chains. The SCOT was derived from the Supply Chain Council s Supply-Chain Operations Reference (SCC SCOR) Model, which is more generic and more oriented toward achieving a competitive advantage in business.

  16. Essentials of supply chain management

    CERN Document Server

    Hugos, Michael H

    2011-01-01

    The latest thinking, strategies, developments, and technologies to stay current in supply chain management Presenting the core concepts and techniques of supply chain management in a clear, concise and easily readable style, the Third Edition of Essentials of Supply Chain Management outlines the most crucial tenets and concepts of supply chain management.

  17. Integrated supply chain risk management

    Directory of Open Access Journals (Sweden)

    Riaan Bredell

    2007-11-01

    Full Text Available Integrated supply chain risk management (ISCRM has become indispensable to the theory and practice of supply chain management. The economic and political realities of the modern world require not only a different approach to supply chain management, but also bold steps to secure supply chain performance and sustainable wealth creation. Integrated supply chain risk management provides supply chain organisations with a level of insight into their supply chains yet to be achieved. If correctly applied, this process may optimise management decision-making and assist in the protection and enhancement of shareholder value.

  18. Solitons in Granular Chains

    International Nuclear Information System (INIS)

    Manciu, M.; Sen, S.; Hurd, A.J.

    1999-01-01

    The authors consider a chain of elastic (Hertzian) grains that repel upon contact according to the potential V = adelta u , u > 2, where delta is the overlap between the grains. They present numerical and analytical results to show that an impulse initiated at an end of a chain of Hertzian grains in contact eventually propagates as a soliton for all n > 2 and that no solitons are possible for n le 2. Unlike continuous, they find that colliding solitons in discrete media initiative multiple weak solitons at the point of crossing

  19. Nuclear safety chains

    International Nuclear Information System (INIS)

    Robbins, M.C.; Eames, G.F.; Mayell, J.R.

    1981-01-01

    An original scheme has been developed for expressing the complex interrelationships associated with the engineered safeguards provided for a nuclear power station. This management tool, based upon network diagrams called Nuclear Safety Chains, looks at the function required of a particular item of safety plant, defines all of the vital supplies and support features necessary for successful operation, and expresses them in visual form, to facilitate analysis and optimisation for operations and maintenance staff. The safety chains are confined to manual schemes at present, although they are designed to be compatible with modern computer techniques. Their usefulness with any routine maintenance planning application on high technology plant is already being appreciated. (author)

  20. Markov set-chains

    CERN Document Server

    Hartfiel, Darald J

    1998-01-01

    In this study extending classical Markov chain theory to handle fluctuating transition matrices, the author develops a theory of Markov set-chains and provides numerous examples showing how that theory can be applied. Chapters are concluded with a discussion of related research. Readers who can benefit from this monograph are those interested in, or involved with, systems whose data is imprecise or that fluctuate with time. A background equivalent to a course in linear algebra and one in probability theory should be sufficient.

  1. The Geomagnetic Field During a Reversal

    Science.gov (United States)

    Heirtzler, James R.

    2003-01-01

    By modifying the IGRF it is possible to learn what may happen to the geomagnetic field during a geomagnetic reversal. If the entire IGRF reverses then the declination and inclination only reverse when the field strength is zero. If only the dipole component of the IGRF reverses a large geomagnetic field remains when the dipole component is zero and he direction of the field at the end of the reversal is not exactly reversed from the directions at the beginning of the reversal.

  2. Stability of global entanglement in thermal states of spin chains

    International Nuclear Information System (INIS)

    Brennen, Gavin K.; Bullock, Stephen S.

    2004-01-01

    We investigate the entanglement properties of a one-dimensional chain of qubits coupled via nearest-neighbor spin-spin interactions. The entanglement measure used is the n-concurrence, which is distinct from other measures on spin chains such as bipartite entanglement in that it can quantify 'global' entanglement across the spin chain. Specifically, it computes the overlap of a quantum state with its time-reversed state. As such, this measure is well suited to study ground states of spin-chain Hamiltonians that are intrinsically time-reversal-symmetric. We study the robustness of n-concurrence of ground states when the interaction is subject to a time-reversal antisymmetric magnetic field perturbation. The n-concurrence in the ground state of the isotropic XX model is computed and it is shown that there is a critical magnetic field strength at which the entanglement experiences a jump discontinuity from the maximum value to zero. The n-concurrence for thermal mixed states is derived and a threshold temperature is computed below which the system has nonzero entanglement

  3. Robust environmental closed-loop supply chain design under uncertainty

    International Nuclear Information System (INIS)

    MA, Ruimin; YAO, Lifei; JIN, Maozhu; REN, Peiyu; LV, Zhihan

    2016-01-01

    With the fast developments in product remanufacturing to improve economic and environmental performance, an environmental closed-loop supply (ECLSC) chain is important for enterprises' competitiveness. In this paper, a robust ECLSC network is investigated which includes multiple plants, collection centers, demand zones, and products, and consists of both forward and reverse supply chains. First, a robust multi-objective mixed integer nonlinear programming model is proposed to deal with ECLSC considering two conflicting objectives simultaneously, as well as the uncertain nature of the supply chain. Cost parameters of the supply chain and demand fluctuations are subject to uncertainty. The first objective function aims to minimize the economical cost and the second objective function is to minimize the environmental influence. Then, the proposed model is solved as a single-objective mixed integer programming model applying the LP-metrics method. Finally, numerical example has been presented to test the model. The results indicate that the proposed model is applicable in practice.

  4. The design of supply chains

    OpenAIRE

    Bøge Sørensen, Lars

    2004-01-01

    Keywords Supply Chain Management, Supply Chain Design, Literature study Abstract Argues stability is a design objective for supply chain design alongside cost, lead time and responsiveness. Performs an extensive literature study on supply chain design, identifies methods, theories and objectives in the existing literature. Describes the concept external specificity and how it’s used to design supply chains. Using the concept upstream, archetypes of risk minimal and maximal desi...

  5. Standard handbook of chains chains for power transmission and material handling

    CERN Document Server

    2005-01-01

    A BRIEF HISTORY OF THE DEVELOPMENT OF CHAINEarly DevelopmentsCog ChainCast Detachable ChainCast Pintle ChainPrecision Roller ChainEngineering Steel ChainSilent ChainFlat-Top ChainTerminologyA CHAIN OVERVIEW: USES AND ADVANTAGESGeneralTypes of ChainScope of Chains CoveredStyles and Forms of ChainsStraight and Offset Link ChainsChains With and Without RollersUses of ChainStandard Chains and Their UsesThe Advantages of Chains in ApplicationsAdvantages of Roller Chains in DrivesAdvantages of Silent Chain Drives

  6. How decision reversibility affects motivation.

    Science.gov (United States)

    Bullens, Lottie; van Harreveld, Frenk; Förster, Jens; Higgins, Tory E

    2014-04-01

    The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making, strengthening prevention-related motivation relatively more than promotion-related motivation. If so, then decision reversibility should have effects associated with the relative differences between prevention and promotion motivation. In 5 studies, we manipulated the reversibility of a decision and used different indicators of regulatory focus motivation to test these predictions. Specifically, Study 1 tested for differences in participants' preference for approach versus avoidance strategies toward a desired end state. In Study 2, we used speed and accuracy performance as indicators of participants' regulatory motivation, and in Study 3, we measured global versus local reaction time performance. In Study 4, we approached the research question in a different way, making use of the value-from-fit hypothesis (Higgins, 2000, 2002). We tested whether a fit between chronic regulatory focus and focus induced by the reversibility of the decision increased participants' subjective positive feelings about the decision outcome. Finally, in Study 5, we tested whether regulatory motivation, induced by decision reversibility, also influenced participants' preference in specific product features. The results generally support our hypothesis showing that, compared to irreversible decisions, reversible decisions strengthen a prevention focus more than a promotion focus. Implications for research on decision making are discussed.

  7. Development Value Chains meet Business Supply Chains : The concept of Global Value Chains unraveled

    NARCIS (Netherlands)

    S. Drost (Sarah); J.C.A.C. van Wijk (Jeroen); S.R. Vellema (Sietze)

    2011-01-01

    textabstractValue chain promotion is considered a key element of private sector development strategies and pro-poor growth. However, (value) chain concepts are rather complex and unclear. This paper unravels the concept of global value chains and studies the diversity of key value chain-related

  8. Supercritical fluid reverse micelle separation

    Science.gov (United States)

    Fulton, J.L.; Smith, R.D.

    1993-11-30

    A method of separating solute material from a polar fluid in a first polar fluid phase is provided. The method comprises combining a polar fluid, a second fluid that is a gas at standard temperature and pressure and has a critical density, and a surfactant. The solute material is dissolved in the polar fluid to define the first polar fluid phase. The combined polar and second fluids, surfactant, and solute material dissolved in the polar fluid is maintained under near critical or supercritical temperature and pressure conditions such that the density of the second fluid exceeds the critical density thereof. In this way, a reverse micelle system defining a reverse micelle solvent is formed which comprises a continuous phase in the second fluid and a plurality of reverse micelles dispersed in the continuous phase. The solute material is dissolved in the polar fluid and is in chemical equilibrium with the reverse micelles. The first polar fluid phase and the continuous phase are immiscible. The reverse micelles each comprise a dynamic aggregate of surfactant molecules surrounding a core of the polar fluid. The reverse micelle solvent has a polar fluid-to-surfactant molar ratio W, which can vary over a range having a maximum ratio W[sub o] that determines the maximum size of the reverse micelles. The maximum ratio W[sub o] of the reverse micelle solvent is then varied, and the solute material from the first polar fluid phase is transported into the reverse micelles in the continuous phase at an extraction efficiency determined by the critical or supercritical conditions. 27 figures.

  9. Innovation in Supply Chains

    DEFF Research Database (Denmark)

    Maier, Maximilian; Korbel, Jakob; Brem, Alexander

    2015-01-01

    . Moreover, along with the fourth industrial revolution – industry 4.0 – new technologies such as cyber physical systems are fast gaining popularity. Hence, based on the analysis of relevant literature, we further develop the supply chain committee model, developed by Kaluza et al. (2003) to demonstrate how...

  10. Markov Chain Monte Carlo

    Indian Academy of Sciences (India)

    be obtained as a limiting value of a sample path of a suitable ... makes a mathematical model of chance and deals with the problem by .... Is the Markov chain aperiodic? It is! Here is how you can see it. Suppose that after you do the cut, you hold the top half in your right hand, and the bottom half in your left. Then there.

  11. Serum Free Light Chains

    Science.gov (United States)

    ... lab's website in order to provide you with background information about the test(s) you had performed. You will need to return ... the free light chains have a much shorter half-life (3-5 hours) than ... cell disorders, the test is also used for assessing response and minimal ...

  12. Galileo Chain Thermometer

    Science.gov (United States)

    Ucke, C.; Schlichting, H. J.

    2017-01-01

    This relatively rare thermometer has a rather unusual display: lower temperatures are located at the top of the scale, higher ones at the bottom. A sphere on a chain floats in a suitable liquid, sinking at high temperatures when the density of the liquid decreases and rising in the increased density at low temperatures. With reasonable effort and…

  13. Supply Chain Costing

    DEFF Research Database (Denmark)

    Asmussen, Jesper Normann; Kristensen, Jesper; Wæhrens, Brian Vejrum

    Based Costing (ABC) på et forsyningskædeniveau – heri benævnt Supply Chain Costing (SCC). Udoverdefordelederfindesved ABCtilføjerSCCogså et økonomisk grundlag til det strategiske rationale, der ofte ligger bag opbygningen af virksomhedens forsyningskæde, og kan dermed medvirke til konkret...

  14. Global Value Chain Configuration

    DEFF Research Database (Denmark)

    Hernandez, Virginia; Pedersen, Torben

    2017-01-01

    modes chosen and the different ways of coordinating them. We also examine the outcomes of a global value chain configuration in terms of performance and upgrading. Our aim is to review the state of the art of these issues, identify research gaps and suggest new lines for future research that would...

  15. Exploration Supply Chain Simulation

    Science.gov (United States)

    2008-01-01

    The Exploration Supply Chain Simulation project was chartered by the NASA Exploration Systems Mission Directorate to develop a software tool, with proper data, to quantitatively analyze supply chains for future program planning. This tool is a discrete-event simulation that uses the basic supply chain concepts of planning, sourcing, making, delivering, and returning. This supply chain perspective is combined with other discrete or continuous simulation factors. Discrete resource events (such as launch or delivery reviews) are represented as organizational functional units. Continuous resources (such as civil service or contractor program functions) are defined as enabling functional units. Concepts of fixed and variable costs are included in the model to allow the discrete events to interact with cost calculations. The definition file is intrinsic to the model, but a blank start can be initiated at any time. The current definition file is an Orion Ares I crew launch vehicle. Parameters stretch from Kennedy Space Center across and into other program entities (Michaud Assembly Facility, Aliant Techsystems, Stennis Space Center, Johnson Space Center, etc.) though these will only gain detail as the file continues to evolve. The Orion Ares I file definition in the tool continues to evolve, and analysis from this tool is expected in 2008. This is the first application of such business-driven modeling to a NASA/government-- aerospace contractor endeavor.

  16. Perturbed Markov chains

    OpenAIRE

    Solan, Eilon; Vieille, Nicolas

    2015-01-01

    We study irreducible time-homogenous Markov chains with finite state space in discrete time. We obtain results on the sensitivity of the stationary distribution and other statistical quantities with respect to perturbations of the transition matrix. We define a new closeness relation between transition matrices, and use graph-theoretic techniques, in contrast with the matrix analysis techniques previously used.

  17. Economy, market and chain

    NARCIS (Netherlands)

    Sukkel, W.; Hommes, M.

    2009-01-01

    In their pursuit of growth and professionalisation, the Dutch organic sector focuses primarily on market development. But how do you stimulate the market for organic foods? This is the subject of many research projects concerning market, consumer preferences and the supply chain. These projects

  18. Heavy chain only antibodies

    DEFF Research Database (Denmark)

    Moghimi, Seyed Moein; Rahbarizadeh, Fatemeh; Ahmadvand, Davoud

    2013-01-01

    Unlike conventional antibodies, heavy chain only antibodies derived from camel contain a single variable domain (VHH) and two constant domains (CH2 and CH3). Cloned and isolated VHHs possess unique properties that enable them to excel conventional therapeutic antibodies and their smaller antigen...

  19. Markov Chain Monte Carlo

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 7; Issue 3. Markov Chain Monte Carlo - Examples. Arnab Chakraborty. General Article Volume 7 Issue 3 March 2002 pp 25-34. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/007/03/0025-0034. Keywords.

  20. Supply chain reliability modelling

    Directory of Open Access Journals (Sweden)

    Eugen Zaitsev

    2012-03-01

    Full Text Available Background: Today it is virtually impossible to operate alone on the international level in the logistics business. This promotes the establishment and development of new integrated business entities - logistic operators. However, such cooperation within a supply chain creates also many problems related to the supply chain reliability as well as the optimization of the supplies planning. The aim of this paper was to develop and formulate the mathematical model and algorithms to find the optimum plan of supplies by using economic criterion and the model for the probability evaluating of non-failure operation of supply chain. Methods: The mathematical model and algorithms to find the optimum plan of supplies were developed and formulated by using economic criterion and the model for the probability evaluating of non-failure operation of supply chain. Results and conclusions: The problem of ensuring failure-free performance of goods supply channel analyzed in the paper is characteristic of distributed network systems that make active use of business process outsourcing technologies. The complex planning problem occurring in such systems that requires taking into account the consumer's requirements for failure-free performance in terms of supply volumes and correctness can be reduced to a relatively simple linear programming problem through logical analysis of the structures. The sequence of the operations, which should be taken into account during the process of the supply planning with the supplier's functional reliability, was presented.

  1. METRODOS: Meteorological preprocessor chain

    DEFF Research Database (Denmark)

    Astrup, P.; Mikkelsen, T.; Deme, S.

    2001-01-01

    The METRODOS meteorological preprocessor chain combines measured tower data and coarse grid numerical weather prediction (NWP) data with local scale flow models and similarity scaling to give high resolution approximations of the meteorological situation. Based on available wind velocity and dire...

  2. Reverse engineering for quality systems

    International Nuclear Information System (INIS)

    Nolan, A.J.

    1995-01-01

    When the age of software engineering began, many companies were faced with a problem of how to support the older, pre-software-engineering, programs. The techniques of reverse engineering and re-engineering were developed to bridge the gap between the past and the present. Although reverse engineering can be used for generating missing documentation, it can also be used as a means to demonstrate quality in these older programs. This paper presents, in the form of a case study, how Rolls-Royce and Associates Limited addressed the quality issues of reverse engineering and re-engineering. (author)

  3. Field reversal in mirror machines

    International Nuclear Information System (INIS)

    Pearlstein, L.D.; Anderson, D.V.; Boozer, A.H.

    1978-01-01

    This report discusses some of the physics issues anticipated in field-reversed mirrors. The effect of current cancellation due to electrons is described. An estimate is made of the required impurity level to maintain a field-reversed configuration. The SUPERLAYER code is used to simulate the high-β 2XIIB results, and favorable comparisons require inclusion of quasilinear RF turbulence. Impact of a quadrupole field on field-line closure and resonant transport is discussed. A simple self-consistent model of ion currents is presented. Conditions for stability of field-reversed configurations to E x B driven rotations are determined

  4. Zero field reversal probability in thermally assisted magnetization reversal

    Science.gov (United States)

    Prasetya, E. B.; Utari; Purnama, B.

    2017-11-01

    This paper discussed about zero field reversal probability in thermally assisted magnetization reversal (TAMR). Appearance of reversal probability in zero field investigated through micromagnetic simulation by solving stochastic Landau-Lifshitz-Gibert (LLG). The perpendicularly anisotropy magnetic dot of 50×50×20 nm3 is considered as single cell magnetic storage of magnetic random acces memory (MRAM). Thermally assisted magnetization reversal was performed by cooling writing process from near/almost Curie point to room temperature on 20 times runs for different randomly magnetized state. The results show that the probability reversal under zero magnetic field decreased with the increase of the energy barrier. The zero-field probability switching of 55% attained for energy barrier of 60 k B T and the reversal probability become zero noted at energy barrier of 2348 k B T. The higest zero-field switching probability of 55% attained for energy barrier of 60 k B T which corespond to magnetif field of 150 Oe for switching.

  5. Performance evaluation of reverse logistics: A case of LPG agency

    Directory of Open Access Journals (Sweden)

    Kottala Sri Yogi

    2015-12-01

    Full Text Available Majority of the manufacturing companies are incorporating the practice of reverse logistics in their value chain. In manufacturing processes, the concept of reverse logistics plays a vital role in enhancing the company’s profit margin for sustainable business growth. For every company, there is a need of performance measurement system to be established as successful business tool. However to predict better results, how smartly the inputs for the transformation or business process are being effectively and efficiently used has to be analyzed. Drawing attention to the growing popularity in adapting the best practices of reverse logistics among different manufacturing industries, this paper aims to build a methodology in order to measure the performance of liquefied petroleum gas (LPG agencies. To do so, it has undertaken the Asian emerging market-India as a case study and improved the understanding of performance measurement in reverse logistics to refilling LPG cylinders. Further, it has suggested a framework affecting the implementation of reverse logistics activities and its network.

  6. Applying Fuzzy Multiobjective Integrated Logistics Model to Green Supply Chain Problems

    Directory of Open Access Journals (Sweden)

    Chui-Yu Chiu

    2014-01-01

    Full Text Available The aim of this paper is attempting to explore the optimal way of supply chain management within the domain of environmental responsibility and concerns. The background of this research involves the issue of green supply chain management (GSCM and the concept of the multiobjective integrated logistics model. More specifically, in this paper, we suggest the fuzzy multiobjective integrated logistics model with the transportation cost and demand fuzziness to solve green supply chain problems in the uncertain environment which is illustrated via the detailed numerical example. Results and the sensitivity analysis of the numerical example indicate that when the governmental subsidy value increased the profits of the reverse chain also increased. The finding shows that the governmental subsidy policy could remain of significant influence for used-product reverse logistics chain.

  7. A Typology of Reverse Innovation

    DEFF Research Database (Denmark)

    von Zedtwitz, Max; Corsi, Simone; Søberg, Peder Veng

    2015-01-01

    secondary market introduction, this study expands the espoused definition of reverse innovation beyond its market-introduction focus with reversals in the flow of innovation in the ideation and product development phases. Recognizing that each phase can take place in different geographical locations...... taking place in an emerging country. This analytical framework allows recasting of current research at the intersection between innovation and international business. Of the 10 reverse innovation flows, six are new and have not been covered in the literature to date. The study addresses questions......’s portfolio of global innovation competence and capability. The implications for management are concerned with internal and external resistance to reverse innovation. Most significantly, while greater recognition and power of innovation in formerly subordinate organizational units is inconvenient to some...

  8. CHAIN EXTENDER AND EMULSIFIER APPLICATION IN IRON ORE FLOTATION

    Directory of Open Access Journals (Sweden)

    José Pedro da Silva

    2013-06-01

    Full Text Available The present study aims to evaluate the reverse flotation performance of iron ore, using collector (amine, in the presence and absence of chain extender (diesel oil and emulsifier (sodium lauryl sulfate.Six tests were realized with duplicate. Tests using amine, diesel oil and sodium lauryl sulphate show the better results, with metallurgical recovery of 91.82% and the concentrate silica equal 1.68%. Thus, it is found that the use of emulsifier and chain extender together with the amine, shows better results in the flotation, in terms of metal recovery and selectivity, when compared to using only amine or amine and diesel oil.

  9. Nitroxide radicals formed in situ as polymer chain growth regulators

    International Nuclear Information System (INIS)

    Kolyakina, Elena V; Grishin, Dmitry F

    2009-01-01

    Published data on controlled synthesis of macromolecules using nitroxide radicals, formed in situ during polymerization, as polymer chain growth regulators are systematized and generalized. The attention is focused on the mechanism of polymer chain growth control during reversibly inhibited radical homopolymerization and the effect of structure of precursors and regulating additives on the polymerization kinetics of monomers of different nature and the molecular-mass characteristics of the polymers thus formed. The key methods for generation of nitroxide radicals directly during polymerization are considered. The prospects for development and practical use of these approaches for the synthesis of new polymeric materials are evaluated.

  10. Spontaneous direct and reverse osmosis

    International Nuclear Information System (INIS)

    Valitov, N.Kh.

    1996-01-01

    It has been ascertained experimentally that in the course of separation of CsCl, KCl, NaCl aqueous solutions by semi-permeable membrane from distilled water the direct and then reverse osmosis are observed. The same sequence is observed in case of separation of CsCl aqueous solutions from NaCl of different concentrations. The reason for the direct and reverse osmosis has been explained. 5 refs.; 3 figs. 1 tab

  11. The design of supply chains

    DEFF Research Database (Denmark)

    Bøge Sørensen, Lars

    2004-01-01

    Keywords Supply Chain Management, Supply Chain Design, Literature studyAbstract Argues stability is a design objective for supply chain design alongside cost, leadtime and responsiveness. Performs an extensive literature study on supply chain design,identifies methods, theories and objectives...... in the existing literature. Describes the conceptexternal specificity and how it's used to design supply chains. Using the concept upstream,archetypes of risk minimal and maximal design are identified. Downstream the conceptdescribes two viable scenarios, one minimizing the impact, the other minimizing...... theprobability of (intended) departure of a supply chain partner. Finally, principles for supplychain design are described and managerial outlined....

  12. Decision-Making for Supply Chain Integration Supply Chain Integration

    CERN Document Server

    Lettice, Fiona; Durowoju, Olatunde

    2012-01-01

    Effective supply chain integration, and the tight co-ordination it creates, is an essential pre-requisite for successful supply chain management.  Decision-Making for Supply Chain Integration is a practical reference on recent research in the area of supply chain integration focusing on distributed decision-making problems. Recent applications of various decision-making tools for integrating supply chains are covered including chapters focusing on: •Supplier selection, pricing strategy and inventory decisions in multi-level supply chains, •RFID-enabled distributed decision-making, •Operational risk issues and time-critical decision-making for sensitive logistics nodes, Modelling end to end processes to improve supply chain integration, and •Integrated systems to improve service delivery and optimize resource use. Decision-Making for Supply Chain Integration provides an insight into the tools and methodologies of this field with support from real-life case studies demonstrating successful application ...

  13. Garbage collection for reversible functional languages

    DEFF Research Database (Denmark)

    Mogensen, Torben Ægidius

    2015-01-01

    Reversible languages are programming languages where all programs can run both forwards and backwards. Reversible functional languages have been proposed that use symmetric pattern matching and data construction. To be reversible, these languages require linearity: Every variable must be used...

  14. Phase separation in short-chain lecithin/gel-state long-chain lecithin aggregates

    International Nuclear Information System (INIS)

    Bian, J.; Roberts, M.F.

    1990-01-01

    Small bilayer particles for spontaneously from gel-state long-chain phospholipids such as dipalmitoylphosphatidylcholine and 0.2 mol fraction short-chain lecithins (e.g., diheptanoylphosphatidylcholine). When the particles are incubed at temperatures greater than the T m of the long-chain phosphatidylcholine (PC), the particles rapidly fuse (from 90-angstrom to ≥ 5,000-angstrom radius); this transition is reversible. A possible explanation for this behavior involves patching or phase separation of the short-chain component within the gel-state particle and randomization of both lipid species above T m . Differential scanning calorimetry, 1 H T 1 values of proteodiheptanoyl-PC in diheptanoyl-PC-d 26 /dipalmitoyl-PC-d 62 matrices of varying deuterium content, solid-state 2 H NMR spectroscopy as a function of temperature, and fluorescence pyrene excimer-to-monomer ratios as a function of mole fraction diheptanoyl-PC provide evidence that such phase separation must occur. These results are used to construct a phase diagram for the diheptanoyl-PC/dipalmitoyl-PC system, to propose detailed geometric models for the different lipid particles involved, and to understand phospholipase kinetics toward the different aggregates

  15. The IASI detection chain

    Science.gov (United States)

    Nicol, Patrick; Fleury, Joel; Le Naour, Claire; Bernard, Frédéric

    2017-11-01

    IASI (Infrared Atmospheric Sounding Interferometer) is an infrared atmospheric sounder. It will provide meteorologist and scientific community with atmospheric spectra. The instrument is composed of a Fourier transform spectrometer and an associated infrared imager. The presentation will describe the spectrometer detection chain architecture, composed by three different detectors cooled in a passive cryo-cooler (so called CBS : Cold Box Subsystem) and associated analog electronics up to digital conversion. It will mainly focus on design choices with regards to environment constraints, implemented technologies, and associated performances. CNES is leading the IASI program in collaboration with EUMETSAT. The instrument Prime is ALCATEL SPACE responsible, notably, of the detection chain architecture. SAGEM SA provides the detector package (so called CAU : Cold Acquisition Unit).

  16. Sympathetic chain Schwannoma

    International Nuclear Information System (INIS)

    Al-Mashat, Faisal M.

    2009-01-01

    Schwannomas are rare, benign, slowly growing tumors arising from Schwann cells that line nerve sheaths. Schwannomas arising from the cervical sympathetic chain are extremely rare. Here, we report a case of a 70-year-old man who presented with only an asymptomatic neck mass. Physical examination revealed a left sided Horner syndrome and a neck mass with transmitted pulsation and anterior displacement of the carotid artery. Computed tomography (CT) showed a well-defined non-enhancing mass with vascular displacement. The nerve of origin of this encapsulated tumor was the sympathetic chain. The tumor was excised completely intact. The pathologic diagnosis was Schwannoma (Antoni type A and Antoni type B). The patient has been well and free of tumor recurrence for 14 months with persistence of asymptomatic left sided Horner syndrome. The clinical, radiological and pathological evaluations, therapy and postoperative complications of this tumor are discussed. (author)

  17. Extended linear chain compounds

    CERN Document Server

    Linear chain substances span a large cross section of contemporary chemistry ranging from covalent polymers, to organic charge transfer com­ plexes to nonstoichiometric transition metal coordination complexes. Their commonality, which coalesced intense interest in the theoretical and exper­ imental solid state physics/chemistry communities, was based on the obser­ vation that these inorganic and organic polymeric substrates exhibit striking metal-like electrical and optical properties. Exploitation and extension of these systems has led to the systematic study of both the chemistry and physics of highly and poorly conducting linear chain substances. To gain a salient understanding of these complex materials rich in anomalous aniso­ tropic electrical, optical, magnetic, and mechanical properties, the conver­ gence of diverse skills and talents was required. The constructive blending of traditionally segregated disciplines such as synthetic and physical organic, inorganic, and polymer chemistry, crystallog...

  18. Environmental Retail Supply Chains

    DEFF Research Database (Denmark)

    Kotzab, Herbert; Munch, Hilde; de Faultrier, Birgitte

    2011-01-01

    which were grouped into eight categories; they refer to “fundamental environmental attitude”, “use of energy”, “use of input material”, “product”, “packaging”, “transport”, “consumption” and “waste”. The level of environmental supply chain management can be characterised as very operational and very...... short-term oriented (green operations). Long-term oriented green design initiatives were hardly observed. Furthermore, the specific environmental activities of three retailers from Denmark, France and the UK were compared. Research limitations/implications – The empirical study investigates supply chain...... operations of retailers and excludes other areas of retail management. The results are based on material that is published by the respective companies and thus do not include internal reports. Originality/value – The main contribution of this paper is to test the proposition that global retailers follow...

  19. Towards Intelligent Supply Chains

    DEFF Research Database (Denmark)

    Siurdyban, Artur; Møller, Charles

    2012-01-01

    applied to the context of organizational processes can increase the success rate of business operations. The framework is created using a set of theoretical based constructs grounded in a discussion across several streams of research including psychology, pedagogy, artificial intelligence, learning...... of deploying inapt operations leading to deterioration of profits. To address this problem, we propose a unified business process design framework based on the paradigm of intelligence. Intelligence allows humans and human-designed systems cope with environmental volatility, and we argue that its principles......, business process management and supply chain management. It outlines a number of system tasks combined in four integrated management perspectives: build, execute, grow and innovate, put forward as business process design propositions for Intelligent Supply Chains....

  20. Port supply chain integration : analyzing biofuel supply chains

    NARCIS (Netherlands)

    Stevens, Leonie C. E.; Vis, Iris F. A.

    2016-01-01

    This paper focuses on port supply chain integration to strengthen operational and business performance. We provide a structured and comprehensive method to enable port supply chain integration and demonstrate its applicability to the biofuel supply chain. We define the value proposition, role,

  1. The innovation value chain.

    Science.gov (United States)

    Hansen, Morten T; Birkinshaw, Julian

    2007-06-01

    The challenges of coming up with fresh ideas and realizing profits from them are different for every company. One firm may excel at finding good ideas but may have weak systems for bringing them to market. Another organization may have a terrific process for funding and rolling out new products and services but a shortage of concepts to develop. In this article, Hansen and Birkinshaw caution executives against using the latest and greatest innovation approaches and tools without understanding the unique deficiencies in their companies' innovation systems. They offer a framework for evaluating innovation performance: the innovation value chain. It comprises the three main phases of innovation (idea generation, conversion, and diffusion) as well as the critical activities performed during those phases (looking for ideas inside your unit; looking for them in other units; looking for them externally; selecting ideas; funding them; and promoting and spreading ideas companywide). Using this framework, managers get an end-to-end view of their innovation efforts. They can pinpoint their weakest links and tailor innovation best practices appropriately to strengthen those links. Companies typically succumb to one of three broad "weakest-link" scenarios. They are idea poor, conversion poor, or diffusion poor. The article looks at the ways smart companies - including Intuit, P&G, Sara Lee, Shell, and Siemens- modify the best innovation practices and apply them to address those organizations' individual needs and flaws. The authors warn that adopting the chain-based view of innovation requires new measures of what can be delivered by each link in the chain. The approach also entails new roles for employees "external scouts" and "internal evangelists," for example. Indeed, in their search for new hires, companies should seek out those candidates who can help address particular weaknesses in the innovation value chain.

  2. Supply Chain Initiatives Database

    Energy Technology Data Exchange (ETDEWEB)

    None

    2012-11-01

    The Supply Chain Initiatives Database (SCID) presents innovative approaches to engaging industrial suppliers in efforts to save energy, increase productivity and improve environmental performance. This comprehensive and freely-accessible database was developed by the Institute for Industrial Productivity (IIP). IIP acknowledges Ecofys for their valuable contributions. The database contains case studies searchable according to the types of activities buyers are undertaking to motivate suppliers, target sector, organization leading the initiative, and program or partnership linkages.

  3. Supply chain finance

    Directory of Open Access Journals (Sweden)

    Kasavica Petar

    2014-01-01

    Full Text Available The concept of supply chain finance is a response to global illiquidity, intensified through the global economic crisis and globalization of commercial and financial flows. The growing illiquidity undermines credit ratings of economic entities, thereby reducing the potential for achieving the projected goals (profitability and portfolio quality. In order to overcome this, banks have introduced certain products flexible to the requirements of specific transactions. The concerned products redirect the focus from a client's credit rating and risk to the credit rating and risk of a business partner (buyer, resulting in benefits for all transaction participants ('win-win-win'. Moreover, the activities are targeted at transaction analysis, i.e. the isolation and protection of the cash flow as the source of financial instrument's repayment. On the other hand, there has been an increasing number of transactions based on the risk of the commercial bank of the client's business partner, or on the risk of collateral (inventory. The focus is actually placed on the financing of adequate supply chain stages, given that counterparty relationship management has been proven to be crucial for efficient management of one's own business. The tensions existing in the relations between partners (increasingly long payment deadlines are in the basis of the supply chain finance concept. Decisions made by banks are based on the entire supply chain (wide information basis, thereby shifting the focus from the product (as was the case before the crisis to the client's needs. Thus, decisions become increasingly comprehensive, quicker, and more precise, and portfolios less risky. Through the individual portfolio of banks, the market of national economies also becomes safer and more liquid. These are rather profitable transactions, because, due to the risk transfer, financing is enabled to companies to whom classic crediting in most cases is not available.

  4. Pairwise Choice Markov Chains

    OpenAIRE

    Ragain, Stephen; Ugander, Johan

    2016-01-01

    As datasets capturing human choices grow in richness and scale---particularly in online domains---there is an increasing need for choice models that escape traditional choice-theoretic axioms such as regularity, stochastic transitivity, and Luce's choice axiom. In this work we introduce the Pairwise Choice Markov Chain (PCMC) model of discrete choice, an inferentially tractable model that does not assume any of the above axioms while still satisfying the foundational axiom of uniform expansio...

  5. Distinguishing Hidden Markov Chains

    OpenAIRE

    Kiefer, Stefan; Sistla, A. Prasad

    2015-01-01

    Hidden Markov Chains (HMCs) are commonly used mathematical models of probabilistic systems. They are employed in various fields such as speech recognition, signal processing, and biological sequence analysis. We consider the problem of distinguishing two given HMCs based on an observation sequence that one of the HMCs generates. More precisely, given two HMCs and an observation sequence, a distinguishing algorithm is expected to identify the HMC that generates the observation sequence. Two HM...

  6. Approximate quantum Markov chains

    CERN Document Server

    Sutter, David

    2018-01-01

    This book is an introduction to quantum Markov chains and explains how this concept is connected to the question of how well a lost quantum mechanical system can be recovered from a correlated subsystem. To achieve this goal, we strengthen the data-processing inequality such that it reveals a statement about the reconstruction of lost information. The main difficulty in order to understand the behavior of quantum Markov chains arises from the fact that quantum mechanical operators do not commute in general. As a result we start by explaining two techniques of how to deal with non-commuting matrices: the spectral pinching method and complex interpolation theory. Once the reader is familiar with these techniques a novel inequality is presented that extends the celebrated Golden-Thompson inequality to arbitrarily many matrices. This inequality is the key ingredient in understanding approximate quantum Markov chains and it answers a question from matrix analysis that was open since 1973, i.e., if Lieb's triple ma...

  7. The coprime quantum chain

    Science.gov (United States)

    Mussardo, G.; Giudici, G.; Viti, J.

    2017-03-01

    In this paper we introduce and study the coprime quantum chain, i.e. a strongly correlated quantum system defined in terms of the integer eigenvalues n i of the occupation number operators at each site of a chain of length M. The n i ’s take value in the interval [2,q] and may be regarded as S z eigenvalues in the spin representation j  =  (q  -  2)/2. The distinctive interaction of the model is based on the coprimality matrix \\boldsymbolΦ : for the ferromagnetic case, this matrix assigns lower energy to configurations where occupation numbers n i and n i+1 of neighbouring sites share a common divisor, while for the anti-ferromagnetic case it assigns a lower energy to configurations where n i and n i+1 are coprime. The coprime chain, both in the ferro and anti-ferromagnetic cases, may present an exponential number of ground states whose values can be exactly computed by means of graph theoretical tools. In the ferromagnetic case there are generally also frustration phenomena. A fine tuning of local operators may lift the exponential ground state degeneracy and, according to which operators are switched on, the system may be driven into different classes of universality, among which the Ising or Potts universality class. The paper also contains an appendix by Don Zagier on the exact eigenvalues and eigenvectors of the coprimality matrix in the limit q\\to ∞ .

  8. Supply chain finance and its accounting treatment : reclassification of trade payables and it's implications for the professional field

    NARCIS (Netherlands)

    Bauke Feenstra; Anne Rikst Engbers; Michiel Steeman

    2017-01-01

    In the modern Supply Chain Finance landscape, Reverse Factoring is one of the most consolidated business model for working capital financing. However, accounting treatment of Reverse Factoring might affect the balance sheet of large corporate, with disruptive consequences for the programme as a

  9. Adjustable chain trees for proteins

    DEFF Research Database (Denmark)

    Winter, Pawel; Fonseca, Rasmus

    2012-01-01

    A chain tree is a data structure for changing protein conformations. It enables very fast detection of clashes and free energy potential calculations. A modified version of chain trees that adjust themselves to the changing conformations of folding proteins is introduced. This results in much...... tighter bounding volume hierarchies and therefore fewer intersection checks. Computational results indicate that the efficiency of the adjustable chain trees is significantly improved compared to the traditional chain trees....

  10. A chain of FPU cells

    NARCIS (Netherlands)

    Verhulst, F.

    2015-01-01

    In contrast to the classical Fermi-Pasta-Ulam (FPU) chain, the inhomogeneous FPU chain shows nearly all the principal resonances. Using this fact, we can construct a periodic FPU chain of low dimension, for instance a FPU cell of four degrees-of-freedom, that can be used as a building block for a

  11. Designing structural supply chain flexibility

    NARCIS (Netherlands)

    Mulinski, Ksawery Jan

    2012-01-01

    In a continuously changing business environment the role of supply chain flexibility is constantly increasing. A flexible supply chain can ensure survival in quickly changing market conditions as well as enable sustainable growth. This thesis explores the topic of supply chain flexibility with focus

  12. Process Algebra and Markov Chains

    NARCIS (Netherlands)

    Brinksma, Hendrik; Hermanns, H.; Brinksma, Hendrik; Hermanns, H.; Katoen, Joost P.

    This paper surveys and relates the basic concepts of process algebra and the modelling of continuous time Markov chains. It provides basic introductions to both fields, where we also study the Markov chains from an algebraic perspective, viz. that of Markov chain algebra. We then proceed to study

  13. Process algebra and Markov chains

    NARCIS (Netherlands)

    Brinksma, E.; Hermanns, H.; Brinksma, E.; Hermanns, H.; Katoen, J.P.

    2001-01-01

    This paper surveys and relates the basic concepts of process algebra and the modelling of continuous time Markov chains. It provides basic introductions to both fields, where we also study the Markov chains from an algebraic perspective, viz. that of Markov chain algebra. We then proceed to study

  14. Risk Management in Logystics Chains

    OpenAIRE

    Butrin, Andrey; Vikulov, Vladimir

    2013-01-01

    Article is devoted to risk management of supply chain. The authors considered indicators of supply chain risks, including risks caused by supplier. Authors formed a method of optimizing the level of supply chain risk in the integration with suppliers and customers.

  15. Academic Education Chain Operation Model

    OpenAIRE

    Ruskov, Petko; Ruskov, Andrey

    2007-01-01

    This paper presents an approach for modelling the educational processes as a value added chain. It is an attempt to use a business approach to interpret and compile existing business and educational processes towards reference models and suggest an Academic Education Chain Operation Model. The model can be used to develop an Academic Chain Operation Reference Model.

  16. Seismic tomography with the reversible jump algorithm

    Science.gov (United States)

    Bodin, Thomas; Sambridge, Malcolm

    2009-09-01

    The reversible jump algorithm is a statistical method for Bayesian inference with a variable number of unknowns. Here, we apply this method to the seismic tomography problem. The approach lets us consider the issue of model parametrization (i.e. the way of discretizing the velocity field) as part of the inversion process. The model is parametrized using Voronoi cells with mobile geometry and number. The size, position and shape of the cells defining the velocity model are directly determined by the data. The inverse problem is tackled within a Bayesian framework and explicit regularization of model parameters is not required. The mobile position and number of cells means that global damping procedures, controlled by an optimal regularization parameter, are avoided. Many velocity models with variable numbers of cells are generated via a transdimensional Markov chain and information is extracted from the ensemble as a whole. As an aid to interpretation we visualize the expected earth model that is obtained via Monte Carlo integration in a straightforward manner. The procedure is particularly adept at imaging rapid changes or discontinuities in wave speed. While each velocity model in the final ensemble consists of many discontinuities at cell boundaries, these are smoothed out in the averaged ensemble solution while those required by the data are reinforced. The ensemble of models can also be used to produce uncertainty estimates and experiments with synthetic data suggest that they represent actual uncertainty surprisingly well. We use the fast marching method in order to iteratively update the ray geometry and account for the non-linearity of the problem. The method is tested here with synthetic data in a 2-D application and compared with a subspace method that is a more standard matrix-based inversion scheme. Preliminary results illustrate the advantages of the reversible jump algorithm. A real data example is also shown where a tomographic image of Rayleigh wave

  17. Vasectomy reversal: a clinical update

    Directory of Open Access Journals (Sweden)

    Abhishek P Patel

    2016-01-01

    Full Text Available Vasectomy is a safe and effective method of contraception used by 42-60 million men worldwide. Approximately 3%-6% of men opt for a vasectomy reversal due to the death of a child or divorce and remarriage, change in financial situation, desire for more children within the same marriage, or to alleviate the dreaded postvasectomy pain syndrome. Unlike vasectomy, vasectomy reversal is a much more technically challenging procedure that is performed only by a minority of urologists and places a larger financial strain on the patient since it is usually not covered by insurance. Interest in this procedure has increased since the operating microscope became available in the 1970s, which consequently led to improved patency and pregnancy rates following the procedure. In this clinical update, we discuss patient evaluation, variables that may influence reversal success rates, factors to consider in choosing to perform vasovasostomy versus vasoepididymostomy, and the usefulness of vasectomy reversal to alleviate postvasectomy pain syndrome. We also review the use of robotics for vasectomy reversal and other novel techniques and instrumentation that have emerged in recent years to aid in the success of this surgery.

  18. Developing weighted criteria to evaluate lean reverse logistics through analytical network process

    Science.gov (United States)

    Zagloel, Teuku Yuri M.; Hakim, Inaki Maulida; Krisnawardhani, Rike Adyartie

    2017-11-01

    Reverse logistics is a part of supply chain that bring materials from consumers back to manufacturer in order to gain added value or do a proper disposal. Nowadays, most companies are still facing several problems on reverse logistics implementation which leads to high waste along reverse logistics processes. In order to overcome this problem, Madsen [Framework for Reverse Lean Logistics to Enable Green Manufacturing, Eco Design 2009: 6th International Symposium on Environmentally Conscious Design and Inverse Manufacturing, Sapporo, 2009] has developed a lean reverse logistics framework as a step to eliminate waste by implementing lean on reverse logistics. However, the resulted framework sets aside criteria used to evaluate its performance. This research aims to determine weighted criteria that can be used as a base on reverse logistics evaluation by considering lean principles. The resulted criteria will ensure reverse logistics are kept off from waste, thus implemented efficiently. Analytical Network Process (ANP) is used in this research to determine the weighted criteria. The result shows that criteria used for evaluation lean reverse logistics are Innovation and Learning (35%), Economic (30%), Process Flow Management (14%), Customer Relationship Management (13%), Environment (6%), and Social (2%).

  19. Reverse Knowledge Transfer in MNEs

    DEFF Research Database (Denmark)

    Mudambi, Ram; Piscitello, Lucia; Rabbiosi, Larissa

    2014-01-01

    a positive correlation with the extent of reverse knowledge transfers to the parent MNE. Relying on the headquarters-subsidiary view of the MNE, we argue that, beyond a point, increasing subsidiary innovativeness will be associated with lower reverse knowledge transfers. Further, we argue......It is now well recognized that multinational enterprises (MNEs) are differentiated networks wherein subsidiaries vary in terms of their ability to create new knowledge and competencies for their parent groups. In much of this theory, it is taken for granted that subsidiary innovativeness has...... that this relationship is sensitive to the subsidiary entry mode. Using data from a sample of 293 Italian subsidiaries, we find strong support for our hypotheses. In particular, our results confirm that the effect of subsidiary innovativeness on reverse knowledge transfers displays an inverted-U shape...

  20. Ice ages and geomagnetic reversals

    Science.gov (United States)

    Wu, Patrick

    1992-01-01

    There have been speculations on the relationship between climatic cooling and polarity reversals of the earth's magnetic field during the Pleistocene. Two of the common criticisms on this relationship have been the reality of these short duration geomagnetic events and the accuracy of their dates. Champion et al. (1988) have reviewed recent progress in this area. They identified a total of 10 short-duration polarity events in the last 1 Ma and 6 of these events have been found in volcanic rocks, which also have K-Ar dates. Supposing that the speculated relationship between climatic cooling and geomagnetic reversals actually exist, two mechanisms that assume climatic cooling causes short period magnetic reversals will be investigated. These two methods are core-mantle boundary topography and transfer of the rotational energy to the core.

  1. Reverse innovation in maternal health.

    Science.gov (United States)

    Firoz, Tabassum; Makanga, Prestige Tatenda; Nathan, Hannah L; Payne, Beth; Magee, Laura A

    2017-09-01

    Reverse innovation, defined as the flow of ideas from low- to high-income settings, is gaining traction in healthcare. With an increasing focus on value, investing in low-cost but effective and innovative solutions can be of mutual benefit to both high- and low-income countries. Reverse innovation has a role in addressing maternal health challenges in high-income countries by harnessing these innovative solutions for vulnerable populations especially in rural and remote regions. In this paper, we present three examples of 'reverse innovation' for maternal health: a low-cost, easy-to-use blood pressure device (CRADLE), a diagnostic algorithm (mini PIERS) and accompanying mobile app (PIERS on the Move), and a novel method for mapping maternal outcomes (MOM).

  2. Reverse Transfection Using Gold Nanoparticles

    Science.gov (United States)

    Yamada, Shigeru; Fujita, Satoshi; Uchimura, Eiichiro; Miyake, Masato; Miyake, Jun

    Reverse transfection from a solid surface has the potential to deliver genes into various types of cell and tissue more effectively than conventional methods of transfection. We present a method for reverse transfection using a gold colloid (GC) as a nanoscaffold by generating nanoclusters of the DNA/reagentcomplex on a glass surface, which could then be used for the regulation of the particle size of the complex and delivery of DNA into nuclei. With this method, we have found that the conjugation of gold nanoparticles (20 nm in particle size) to the pEGFP-N1/Jet-PEI complex resulted in an increase in the intensity of fluorescence of enhanced green fluorescent protein (EGFP) (based on the efficiency of transfection) from human mesenchymal stem cells (hMSCs), as compared with the control without GC. In this manner, we constructed a method for reverse transfection using GC to deliver genes into the cells effectively.

  3. Radiology's value chain.

    Science.gov (United States)

    Enzmann, Dieter R

    2012-04-01

    A diagnostic radiology value chain is constructed to define its main components, all of which are vulnerable to change, because digitization has caused disaggregation of the chain. Some components afford opportunities to improve productivity, some add value, while some face outsourcing to lower labor cost and to information technology substitutes, raising commoditization risks. Digital image information, because it can be competitive at smaller economies of scale, allows faster, differential rates of technological innovation of components, initiating a centralization-to-decentralization technology trend. Digitization, having triggered disaggregation of radiology's professional service model, may soon usher in an information business model. This means moving from a mind-set of "reading images" to an orientation of creating and organizing information for greater accuracy, faster speed, and lower cost in medical decision making. Information businesses view value chain investments differently than do small professional services. In the former model, producing a better business product will extend image interpretation beyond a radiologist's personal fund of knowledge to encompass expanding external imaging databases. A follow-on expansion with integration of image and molecular information into a report will offer new value in medical decision making. Improved interpretation plus new integration will enrich and diversify radiology's key service products, the report and consultation. A more robust, information-rich report derived from a "systems" and "computational" radiology approach will be facilitated by a transition from a professional service to an information business. Under health care reform, radiology will transition its emphasis from volume to greater value. Radiology's future brightens with the adoption of a philosophy of offering information rather than "reads" for decision making. Staunchly defending the status quo via turf wars is unlikely to constitute a

  4. Musical Markov Chains

    Science.gov (United States)

    Volchenkov, Dima; Dawin, Jean René

    A system for using dice to compose music randomly is known as the musical dice game. The discrete time MIDI models of 804 pieces of classical music written by 29 composers have been encoded into the transition matrices and studied by Markov chains. Contrary to human languages, entropy dominates over redundancy, in the musical dice games based on the compositions of classical music. The maximum complexity is achieved on the blocks consisting of just a few notes (8 notes, for the musical dice games generated over Bach's compositions). First passage times to notes can be used to resolve tonality and feature a composer.

  5. Chains of securitization

    Directory of Open Access Journals (Sweden)

    Marieke de Goede

    2017-12-01

    Full Text Available Securitization has a dual rationality that twins a financial sense to one of modern statecraft and national security. This forum contribution advocates a focus on material practices as a means of further exploring the entanglement of finance and security. In particular, it advances a notion of ‘chains of securitization’, arguing that such a concept provides researchers with a concrete way to analyze how ‘financial’ objects, such as derivatives, are assembled to generate (insecurities, as well as how ‘security’ objects, such as suspicious transactions, are assembled across public/private domains.

  6. Detox fashion supply chain

    CERN Document Server

    2017-01-01

    This first volume on detox fashion discusses various interesting topics including a Toxic-Free Supply Chain for Textiles and Clothing; Environmental Issues in Textiles; Global Regulations, Restrictions & Research; Making the Change: Consumer Adoption of Sustainable Fashion; and Strategies for Detoxing Your Wardrobe. It provides an overview of the chemical-related issues confronting the fashion sector, summarizes global regulations, and discusses how to make the change by changing consumers’ attitude towards adopting sustainable fashion, as well as the best strategies for detoxing our wardrobes.

  7. 6d string chains

    Science.gov (United States)

    Gadde, Abhijit; Haghighat, Babak; Kim, Joonho; Kim, Seok; Lockhart, Guglielmo; Vafa, Cumrun

    2018-02-01

    We consider bound states of strings which arise in 6d (1,0) SCFTs that are realized in F-theory in terms of linear chains of spheres with negative self-intersections 1,2, and 4. These include the strings associated to N small E 8 instantons, as well as the ones associated to M5 branes probing A and D type singularities in M-theory or D5 branes probing ADE singularities in Type IIB string theory. We find that these bound states of strings admit (0,4) supersymmetric quiver descriptions and show how one can compute their elliptic genera.

  8. Shared Value Chain Design

    DEFF Research Database (Denmark)

    Bals, Lydia; Tate, Wendy L.

    In Sustainable Supply Chain Management (SSCM) research still the classic economic perspective is the dominating perspective, although the triple bottom line (including economic, social and ecological) is well accepted. The theoretical foundation for the paper is Stakeholder Theory. Case studies...... of social businesses funded by the Germany-based company Yunus Social Business (YSB; http://www.yunussb.com) are presented, extracting the basic model types and how they involve and affect the stakeholders. These models reveal innovative approaches to enable positive economic, social and ecological impacts...

  9. Reverse genetics with animal viruses. NSV reverse genetics

    International Nuclear Information System (INIS)

    Mebatsion, T.

    2005-01-01

    New strategies to genetically manipulate the genomes of several important animal pathogens have been established in recent years. This article focuses on the reverse genetics techniques, which enables genetic manipulation of the genomes of non-segmented negative-sense RNA viruses. Recovery of a negative-sense RNA virus entirely from cDNA was first achieved for rabies virus in 1994. Since then, reverse genetic systems have been established for several pathogens of medical and veterinary importance. Based on the reverse genetics technique, it is now possible to design safe and more effective live attenuated vaccines against important viral agents. In addition, genetically tagged recombinant viruses can be designed to facilitate serological differentiation of vaccinated animals from infected animals. The approach of delivering protective immunogens of different pathogens using a single vector was made possible with the introduction of the reverse genetics system, and these novel broad-spectrum vaccine vectors have potential applications in improving animal health in developing countries. (author)

  10. Marburg Virus Reverse Genetics Systems

    Directory of Open Access Journals (Sweden)

    Kristina Maria Schmidt

    2016-06-01

    Full Text Available The highly pathogenic Marburg virus (MARV is a member of the Filoviridae family and belongs to the group of nonsegmented negative-strand RNA viruses. Reverse genetics systems established for MARV have been used to study various aspects of the viral replication cycle, analyze host responses, image viral infection, and screen for antivirals. This article provides an overview of the currently established MARV reverse genetic systems based on minigenomes, infectious virus-like particles and full-length clones, and the research that has been conducted using these systems.

  11. Reverse Zymography: Overview and Pitfalls.

    Science.gov (United States)

    Sharma, Kanika; Bhattacharyya, Debasish

    2017-01-01

    Reverse zymography is a technique by which protease inhibitor(s) in a sample could be electrophoretically separated in a substrate-impregnated acrylamide gel and their relative abundance could be semi-quantified. The gel after electrophoresis is incubated with a protease when the impregnated substrate and all other proteins of the sample are degraded into small peptides except the inhibitor(s) that show clear bands against a white background. Since reverse zymography cannot distinguish between a protease inhibitor and a protein that is resistant against proteolysis, the results should be confirmed from inhibition of protease activity by solution state assay.

  12. Reverse hybrid total hip arthroplasty

    DEFF Research Database (Denmark)

    Wangen, Helge; Havelin, Leif I.; Fenstad, Anne M

    2017-01-01

    Background and purpose - The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty....... Patients and methods - From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk...

  13. Reference counting for reversible languages

    DEFF Research Database (Denmark)

    Mogensen, Torben Ægidius

    2014-01-01

    inverses: Freeing a block of memory is done by running the allocation procedure backwards. Axelsen and Glück use this heap manager to sketch implementation of a simple reversible functional language where pattern matching a constructor is the inverse of construction, so pattern-matching implies......Modern programming languages and operating systems use heap memory that allows allocation and deallocation of memory to be decoupled, so they don't follow a stack discipline. Axelsen and Glück have presented a reversible heap manager where allocation and deallocation are each other's logical...

  14. Concurrent Product & Supply Chain Creation

    DEFF Research Database (Denmark)

    Gubi, Ebbe

    it is a structural premise. We also know that logistics costs generally are estimated 15-20% of total product costs. Accordingly, it stands to reason that a company can reduce costs, and thereby gain an edge on its competitors, by tailoring the supply chain in question to an individual product or product family; i.......e. by creating Focused Supply Chains. At the same time, customer satisfaction can be increased. As a second means to achieving a better fit between product and supply chain, the firm can deploy Design for Logistics, the discipline of considering the supply chain during product creation. The thesis sets out...... and supply chains should be created concurrently and integrated. The concept of Concurrent Product & Supply Chain Creation is introduced, and the two main components Focused Supply Chains and Design For Logistics are explained and exemplified by use of Bang & Olufsen....

  15. Self-lacing atom chains

    International Nuclear Information System (INIS)

    Zandvliet, Harold J W; Van Houselt, Arie; Poelsema, Bene

    2009-01-01

    The structural and electronic properties of self-lacing atomic chains on Pt modified Ge(001) surfaces have been studied using low-temperature scanning tunnelling microscopy and spectroscopy. The self-lacing chains have a cross section of only one atom, are perfectly straight, thousands of atoms long and virtually defect free. The atomic chains are composed of dimers that have their bonds aligned in a direction parallel to the chain direction. At low temperatures the atomic chains undergo a Peierls transition: the periodicity of the chains doubles from a 2 x to a 4 x periodicity and an energy gap opens up. Furthermore, at low temperatures (T<80 K) novel quasi-one-dimensional electronic states are found. These quasi-one-dimensional electronic states originate from an electronic state of the underlying terrace that is confined between the atomic chains.

  16. Magnetization reversal through soliton flip in biquadratic ferromagnet with varying exchange interactions

    CERN Document Server

    Daniel, M

    2002-01-01

    We study the phenomenon of magnetization reversal in the form of a soliton flip in a biquadratic ferromagnetic spin chain induced by varying bilinear and biquadratic exchange interactions. This is carried out by analysing the evolution of the velocity and amplitude of the soliton using a perturbation analysis.

  17. The response of dense dry granular material to the shear reversal

    Science.gov (United States)

    Zhang, Jie; Ren, Jie; Farhadi, Somayeh; Behringer, Robert

    2008-11-01

    We have performed two dimensional granular experiments under pure shear using bidisperse photo-elastic disks. Starting from a stress free state, a square box filled with granular particles is subject to shear. The forward shears involved various number of steps, leading to maximum strains between 0.1 and 0.3. The area is kept constant during the shear. The network of force chains gradually built up as the strain increased, leading to increased pressure and shear stress. Reverse shear was then applied to the system. Depending on the initial packing fraction and the strain at which the shear is reversed, the force chain network built prior to the shear reversal may be destroyed completely or partially destroyed. Following the force chain weakening, when the reserve shear is continuously applied to the system, there is a force chain strengthening. Following each change of the system, contact forces of individual disks were measured by applying an inverse algorithm. We also kept track of the displacement and angle of rotation of every particle from frame to frame. We present the results for the structure failure and reconstruction during shear reversals. We also present data for stresses, contact force distributions and other statistical measures.

  18. An optimization model for sustainable solutions towards implementation of reverse logistics under collaborative framework

    DEFF Research Database (Denmark)

    Agarwal, Vernika; Govindan, Kannan; Darbari, Jyoti Dhingra

    2016-01-01

    Enforced Legislations, social image, corporate citizenship and market competence are forcing manufacturing enterprises (MEs) to incorporate reverse logistics (RL) into their supply chains. RL can be used as a strategic tool to gain customer loyalty and reduce operational costs by maximizing...

  19. Exact goodness-of-fit tests for Markov chains.

    Science.gov (United States)

    Besag, J; Mondal, D

    2013-06-01

    Goodness-of-fit tests are useful in assessing whether a statistical model is consistent with available data. However, the usual χ² asymptotics often fail, either because of the paucity of the data or because a nonstandard test statistic is of interest. In this article, we describe exact goodness-of-fit tests for first- and higher order Markov chains, with particular attention given to time-reversible ones. The tests are obtained by conditioning on the sufficient statistics for the transition probabilities and are implemented by simple Monte Carlo sampling or by Markov chain Monte Carlo. They apply both to single and to multiple sequences and allow a free choice of test statistic. Three examples are given. The first concerns multiple sequences of dry and wet January days for the years 1948-1983 at Snoqualmie Falls, Washington State, and suggests that standard analysis may be misleading. The second one is for a four-state DNA sequence and lends support to the original conclusion that a second-order Markov chain provides an adequate fit to the data. The last one is six-state atomistic data arising in molecular conformational dynamics simulation of solvated alanine dipeptide and points to strong evidence against a first-order reversible Markov chain at 6 picosecond time steps. © 2013, The International Biometric Society.

  20. Adiabatic condition and the quantum hitting time of Markov chains

    International Nuclear Information System (INIS)

    Krovi, Hari; Ozols, Maris; Roland, Jeremie

    2010-01-01

    We present an adiabatic quantum algorithm for the abstract problem of searching marked vertices in a graph, or spatial search. Given a random walk (or Markov chain) P on a graph with a set of unknown marked vertices, one can define a related absorbing walk P ' where outgoing transitions from marked vertices are replaced by self-loops. We build a Hamiltonian H(s) from the interpolated Markov chain P(s)=(1-s)P+sP ' and use it in an adiabatic quantum algorithm to drive an initial superposition over all vertices to a superposition over marked vertices. The adiabatic condition implies that, for any reversible Markov chain and any set of marked vertices, the running time of the adiabatic algorithm is given by the square root of the classical hitting time. This algorithm therefore demonstrates a novel connection between the adiabatic condition and the classical notion of hitting time of a random walk. It also significantly extends the scope of previous quantum algorithms for this problem, which could only obtain a full quadratic speedup for state-transitive reversible Markov chains with a unique marked vertex.

  1. Closed loop supply chain in printing operation

    Directory of Open Access Journals (Sweden)

    Marcius Fabius Henriques Carvalho

    2011-12-01

    Full Text Available There is a clear change in focus in large companies, previously dedicated primarily to the production of physical goods, toward offering complimentary services and changing their focus toward more service-oriented businesses, in order to increase their competitiveness. At the same time, companies are facing increasing product returns due to various reasons leading to reverse logistics practices and toward the introduction of a Closed Loop Supply Chain management perspective. The purpose of this work is to identify, using a case study in the printing industry,  specific characteristics, regarding product returns, both in a product-oriented and a service-oriented operation. Furthermore, the current work performs a diagnosis of current practices applications of CLSC models in the two operating models. The paper concludes that indeed there are relevant differences in managing the CLSC for each case and identify the main gaps for each operation.

  2. A functional language for describing reversible logic

    DEFF Research Database (Denmark)

    Thomsen, Michael Kirkedal

    2012-01-01

    Reversible logic is a computational model where all gates are logically reversible and combined in circuits such that no values are lost or duplicated. This paper presents a novel functional language that is designed to describe only reversible logic circuits. The language includes high....... Reversibility of descriptions is guaranteed with a type system based on linear types. The language is applied to three examples of reversible computations (ALU, linear cosine transformation, and binary adder). The paper also outlines a design flow that ensures garbage- free translation to reversible logic...... circuits. The flow relies on a reversible combinator language as an intermediate language....

  3. Thermally reversible cross-linked poly(ether-urethanes

    Directory of Open Access Journals (Sweden)

    V. Gaina

    2013-07-01

    Full Text Available Cross-linked poly(ether-urethanes were prepared by Diels-Alder (DA reaction of the furan-containing poly(ether-urethane to bismaleimides and showed thermal reversibility evidenced by differential scanning calorimetry and attenuated total reflectance in conjunction with Fourier transform infrared spectroscopy (ATR-FTIR. The furan-containing poly(ether-urethanes were synthesized by the polyaddition reaction of 1,6-hexamethylene diisocyanate (HMDI or 4,4'- dibenzyl diisocyanate (DBDI to poly(tetramethylene ether glycol (PTMEG having Mn = 250, 650, 1000, 1500 and 2000 and 2-[N,N-bis(2-methyl-2-hydroxyethylamino]furfuryl as chain extender by the solution prepolymer method. The molar ratio of isocyanate: PTMEG:chain extender varied from 2:1:1 to 4:1:3, which produces a molar concentration of furyl group ranging between 3.65•10–4 and 1.25•10–3 mol/g.

  4. A chain of microphones

    International Nuclear Information System (INIS)

    1994-07-01

    In order to discover a more accurate and selective measuring method for the identification of individual flow-noise pollution sources on wind turbines blades, measuring equipment based on a chain of microphones was developed. The principle underlying the design of this equipment is that signals from a number of microphones can be interpreted. Thus the microphones can register noise from sections of the rotary blade and unwished-for noise is eliminated. The gating technique ensures that noises from individual blades can be separated and that clarity is improved. In addition to this, noise can be determined close to the source. The chain consists of 8 microphones placed in a row at adjustable distances. Measurements are registered on tapes as are the trigger signals for the blade passage. The computer processes the measurement results and unnecessary noise is depressed. The listening angles can also be changed electronically so that the doppler effect can be corrected. Results confirmed that the equipment operated satisfactorily and could also be used in relation to noise pollution in power plants as it is especially effective in depressing excess, and cutting out outside, noise and registers accurately individual sources of noise helped by its ability to ''listen '' at varying angles to the source. (AB)

  5. Maintenance of a multi-cell field reversed mirror reactor

    International Nuclear Information System (INIS)

    Neef, W.S. Jr.

    1978-01-01

    The Field Reversed Mirror Reactor is composed of a horizontal linear chain of cells, each of which requires neutral beam injection. Blanket replacement is achieved by lifting one complete cell module from the reactor and replacing it with a preassembled and tested identical module. Ioffe bar connectors eliminate redundant bus bars. Asymmetric cell design simplifies magnet construction and reduces replacement time. A tapered cylindrical coolant distributor simplifies blanket removal. An evacuated housing surrounds the reactor reducing cell-to-cell sealing problems related to maintenance. Remote couplings are used for coolant and accessories. Hot-cell location and design permits immediate reconditioning or storage of replacement cells

  6. Creative industries value chain: The value chain logic in supply chain relationships

    OpenAIRE

    Emilia Madudová

    2017-01-01

    The purpose of this paper is to provide a deeper look into value chain logic in supply chain relationships in a creative industries value chains. In recent years, value has been recognized as a key factor in better understanding of consumer behavior and gaining a competitive advantage. In a value chain, added value should be defined at every step of the chain. There should be defined activity which adds value as well as the activity that subtracts any value. The total value can be then calcul...

  7. CAPSULE REPORT: REVERSE OSMOSIS PROCESS

    Science.gov (United States)

    A failure analysis has been completed for the reverse osmosis (RO) process. The focus was on process failures that result in releases of liquids and vapors to the environment. The report includes the following: 1) A description of RO and coverage of the principles behind the proc...

  8. Time reversal and parity tests

    International Nuclear Information System (INIS)

    Terwilliger, K.

    1975-01-01

    A recent review by Henley discusses the present status of Time Reversal and Parity symmetry violations, and comments on the implications for high energy hadron scattering. This note will briefly summarize the situation with particular attention to the sizes of possible effects, relating them to experimental accuracy available or reasonably possible at the ZGS

  9. Reverse ventilation--perfusion mismatch

    International Nuclear Information System (INIS)

    Palmaz, J.C.; Barnett, C.A.; Reich, S.B.; Krumpe, P.E.; Farrer, P.A.

    1984-01-01

    Patients having lobar airway obstruction or consolidation usually have decreases of both ventilation and perfusion on lung scans. We report three patients in whom hypoxic vasoconstriction was apparently incomplete, resulting in a ''reversed'' ventilation-perfusion mismatch. Perfusion of the hypoxic lobe on the radionuclide scan was associated with metabolic alkalosis, pulmonary venous and pulmonary arterial hypertension in these patients

  10. Barriers and Prospects for Reverse Logistics as Regards oil Lube and its Packaging

    Directory of Open Access Journals (Sweden)

    Luis Alfredo Sencovici

    2015-08-01

    Full Text Available This article aims to discuss the main challenges and prospects for the implementation of reverse logistics to lube oil and its packaging. The methodology focuses on conducting in-depth interviews with representatives of these products’ chains, and the results show that technological advances now allow for the generation of re-refined oil with better economic and environmental features than crude oil, and there have been noticeable advances as to packaging too. However, issues such as conflicts in the reverse chain as to the distribution costs of collection, lack of regional solutions to recycling activities, poor supervision, lack of tax incentives and manufacturers’ low interest in modify their products and processes emphasis on prevention challenge the expansion of large-scale reverse logistics activity in the country.

  11. An Experimental Research on Closed Loop Supply Chain Management with Internet of Things

    OpenAIRE

    PAKSOY, Turan; KARAOĞLAN, İsmail; GÖKÇEN, Hadi; PARDALOS, Panos M.; TORĞUL, Belkıs

    2016-01-01

    Abstract. Closed loop supply chain (CLSC) optimization is integration of forward and reverse logistics activities. The importance of CLSC management is increasing by legal regulations, limited energy resources and environmental- financial problems that growing in recent years. However, reverse logistics part of the CLSC is a flow type which is more difficult to made predictions, planning and controls by reason contained uncertainties. This stage, Internet of Things system reduces related unce...

  12. Reverse amblyopia with atropine treatment.

    Science.gov (United States)

    Hainline, Bryan C; Sprunger, Derek C; Plager, David A; Neely, Daniel E; Guess, Matthew G

    2009-01-01

    Occlusion, pharmacologic pernalization and combined therapy have been documented in controlled studies to effectively treat amblyopia with few complications. However, there remain concerns about the effectiveness and complications when, as in this case, there are not standardized treatment protocols. A retrospective chart review of 133 consecutive patients in one community based ophthalmology practice treated for amblyopia was performed. Treatments evaluated were occlusion only, atropine penalization, and combination of occlusion and atropine. Reverse amblyopia was defined as having occured when the visual acuity of the sound eye was 3 LogMar units worse than visual acuity of the amblyopia eye after treatment. Improvement in vision after 6 months and 1 year of amblyopia therapy was similar among all three groups: 0.26 LogMar lines and 0.30 in the atropine group, 0.32 and 0.34 in the occlusion group, and 0.24 and 0.32 in the combined group. Eight (6%) patients demonstrated reverse amblyopia. The mean age of those who developed reverse amblyopia was 3.5 years, 1.5 years younger than the mean age of the study population, 7/8 had strabismic amblyopia, 6/8 were on daily atropine and had a mean refractive error of +4.77 diopters in the amblyopic eye and +5.06 diopters in the sound eye. Reverse amblyopia did not occur with occlusion only therapy. In this community based ophthalmology practice, atropine, patching, and combination therapy appear to be equally effective modalities to treat ambyopia. Highly hyperopic patients under 4 years of age with dense, strabismic amblyopia and on daily atropine appeared to be most at risk for development of reverse amblyopia.

  13. Polyneutron Chain Reactions

    International Nuclear Information System (INIS)

    John C. Fisher

    2000-01-01

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a

  14. One long chain among shorter chains : the Flory approach revisited

    OpenAIRE

    Raphaël , E.; Fredrickson , G.; Pincus , P.

    1992-01-01

    We consider the mean square end-to-end distance of a long chain immersed in a monodisperse, concentrated solution of shorter, chemically identical chains. In contrast with the earlier work of Flory, no simplifying assumption on the wave vector dependence of the effective potential between segments is made. In order to obtain a closed form expression for the dimension of the long chain, we first derive a general expression for the mean square end-to-end distance of a flexible chain with arbitr...

  15. Relaxation Dynamics of Nanoparticle-Tethered Polymer Chains

    KAUST Repository

    Kim, Sung A

    2015-09-08

    © 2015 American Chemical Society. Relaxation dynamics of nanoparticle-tethered cis-1,4-polyisoprene (PI) are investigated using dielectric spectroscopy and rheometry. A model system composed of polymer chains densely grafted to spherical SiO2 nanoparticles to form self-suspended suspensions facilitates detailed studies of slow global chain and fast segmental mode dynamics under surface and geometrical confinement-from experiments performed in bulk materials. We report that unentangled polymer molecules tethered to nanoparticles relax far more slowly than their tethered entangled counterparts. Specifically, at fixed grafting density we find, counterintuitively, that increasing the tethered polymer molecular weight up to values close to the entanglement molecular weight speeds up chain relaxation dynamics. Decreasing the polymer grafting density for a fixed molecular weight has the opposite effect: it dramatically slows down chain relaxation, increases interchain coupling, and leads to a transition in rheological response from simple fluid behavior to viscoelastic fluid behavior for tethered PI chains that are unentangled by conventional measures. Increasing the measurement temperature produces an even stronger elastic response and speeds up molecular relaxation at a rate that decreases with grafting density and molecular weight. These observations are discussed in terms of chain confinement driven by crowding between particles and by the existence of an entropic attractive force produced by the space-filling constraint on individual chains in a self-suspended material. Our results indicate that the entropic force between densely grafted polymer molecules couples motions of individual chains in an analogous manner to reversible cross-links in associating polymers.

  16. Supply Chain Management and E-Commerce Technology Adoption among Logistics Service Providers in Malaysia

    OpenAIRE

    Mohd Iskandar bin Illyas Tan; Iziati Saadah bt Ibrahim

    2010-01-01

    Logistics is part of the supply chain processes that plans, implements, and controls the efficient and effective forward and reverse flow and storage of goods, services, and related information between the point of origin and the point of consumption in order to meet customer requirements. This research aims to investigate the current status and future direction of the use of Information Technology (IT) for logistics, focusing on Supply Chain Management (SCM) and E-Commer...

  17. Green Supply Chain Management in Chinese Electronic Manufacturing Organisations: An Analysis of Senior Managements' Perceptions

    OpenAIRE

    Eoin Plant; Yusen Xu; Gareth R.T. White

    2015-01-01

    Green supply chain management and reverse logistics has emerged as a key area of research interest. Recent environmental regulations have also stimulated interest in this field. However, information sharing is a prerequisite to efficient and effective logistics utilisation. Manufacturing organisations in China were argued to be 10-20 years behind their Western counterparts in relation to information sharing in their supply chains (). This barrier needs to be addressed if China is going to mai...

  18. Baby Skyrmion chains

    International Nuclear Information System (INIS)

    Foster, David

    2010-01-01

    The Baby Skyrmion model is a two-dimensional analogue of the full three-dimensional Skyrme model. It is not just useful for guiding investigations in the Skyrme model, it also has applications in condensed matter physics. Previous results on multi-charged Baby Skyrmion solutions have pointed to a modular structure, comprised of charge two rings and single charge one Skyrmions, which combine to form higher charged structures. In this paper we present alternative numerical solutions that correspond to new finite Baby Skyrmion chains, which have lower energy than those found previously, and are also good candidates for the global minimum energy solutions. We then proceed from the infinite plane, to Baby Skyrmions on a cylinder and then a torus, to obtain the solutions of periodic Baby Skyrmions, of which periodic segments will correspond to sections of large charge Baby Skyrmions in the plane

  19. Supply chain reaction

    International Nuclear Information System (INIS)

    Snieckus, Darius

    2000-01-01

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  20. Y-junction of superconducting Josephson chains

    International Nuclear Information System (INIS)

    Giuliano, Domenico; Sodano, Pasquale

    2009-01-01

    We show that, for pertinent values of the fabrication and control parameters, an attractive finite coupling fixed point emerges in the phase diagram of a Y-junction of superconducting Josephson chains. The new fixed point arises only when the dimensionless flux f piercing the central loop of the network equals π and, thus, does not break time-reversal invariance; for f≠π, only the strongly coupled fixed point survives as a stable attractive fixed point. Phase slips (instantons) have a crucial role in establishing this transition: we show indeed that, at f=π, a new set of instantons-the W-instantons-comes into play to destabilize the strongly coupled fixed point. Finally, we provide a detailed account of the Josephson current-phase relationship along the arms of the network, near each one of the allowed fixed points. Our results evidence remarkable similarities between the phase diagram accessible to a Y-junction of superconducting Josephson chains and the one found in the analysis of quantum Brownian motion on frustrated planar lattices

  1. Market adoption of reverse factoring

    NARCIS (Netherlands)

    Iacono, Umberto Dello; Reindorp, Matthew; Dellaert, Nico

    2015-01-01

    Purpose - The purpose of this paper is to show that market dynamics can significantly influence th lifecycle and value of a supply chain finance (SCF) arrangement. Design/methodology/approach - Based on a review of scientific and trade literature, the author construct a model of market dynamics for

  2. Flux through a Markov chain

    International Nuclear Information System (INIS)

    Floriani, Elena; Lima, Ricardo; Ourrad, Ouerdia; Spinelli, Lionel

    2016-01-01

    Highlights: • The flux through a Markov chain of a conserved quantity (mass) is studied. • Mass is supplied by an external source and ends in the absorbing states of the chain. • Meaningful for modeling open systems whose dynamics has a Markov property. • The analytical expression of mass distribution is given for a constant source. • The expression of mass distribution is given for periodic or random sources. - Abstract: In this paper we study the flux through a finite Markov chain of a quantity, that we will call mass, which moves through the states of the chain according to the Markov transition probabilities. Mass is supplied by an external source and accumulates in the absorbing states of the chain. We believe that studying how this conserved quantity evolves through the transient (non-absorbing) states of the chain could be useful for the modelization of open systems whose dynamics has a Markov property.

  3. Advances in single chain technology.

    Science.gov (United States)

    Gonzalez-Burgos, Marina; Latorre-Sanchez, Alejandro; Pomposo, José A

    2015-10-07

    The recent ability to manipulate and visualize single atoms at atomic level has given rise to modern bottom-up nanotechnology. Similar exquisite degree of control at the individual polymeric chain level for producing functional soft nanoentities is expected to become a reality in the next few years through the full development of so-called "single chain technology". Ultra-small unimolecular soft nano-objects endowed with useful, autonomous and smart functions are the expected, long-term valuable output of single chain technology. This review covers the recent advances in single chain technology for the construction of soft nano-objects via chain compaction, with an emphasis in dynamic, letter-shaped and compositionally unsymmetrical single rings, complex multi-ring systems, single chain nanoparticles, tadpoles, dumbbells and hairpins, as well as the potential end-use applications of individual soft nano-objects endowed with useful functions in catalysis, sensing, drug delivery and other uses.

  4. A remark on Dickey's stabilizing chain

    International Nuclear Information System (INIS)

    Svinin, Andrei K.

    2011-01-01

    We observe that Dickey's stabilizing chain can be naturally included into two-dimensional chain of infinitely many copies of equations of KP hierarchy. -- Highlights: → In this study we consider Dickey's stabilizing chain. → We construct two-dimensional chain of dressing truncated operators. → We show that Dickey's stabilizing chain can be included into two-dimensional chain of KP hierarchies.

  5. Chain formation of metal atoms

    DEFF Research Database (Denmark)

    Bahn, Sune Rastad; Jacobsen, Karsten Wedel

    2001-01-01

    The possibility of formation of single-atomic chains by manipulation of nanocontacts is studied for a selection of metals (Ni, Pd, Pt, Cu, Ag, Au). Molecular dynamics simulations show that the tendency for chain formation is strongest for Au and Pt. Density functional theory calculations indicate...... that the metals which form chains exhibit pronounced many-atom interactions with strong bonding in low coordinated systems....

  6. Non-stationary Markov chains

    OpenAIRE

    Mallak, Saed

    1996-01-01

    Ankara : Department of Mathematics and Institute of Engineering and Sciences of Bilkent University, 1996. Thesis (Master's) -- Bilkent University, 1996. Includes bibliographical references leaves leaf 29 In thi.s work, we studierl the Ergodicilv of Non-Stationary .Markov chains. We gave several e.xainples with different cases. We proved that given a sec[uence of Markov chains such that the limit of this sec|uence is an Ergodic Markov chain, then the limit of the combination ...

  7. DOS cones along atomic chains

    Science.gov (United States)

    Kwapiński, Tomasz

    2017-03-01

    The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin-orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears.

  8. DOS cones along atomic chains

    International Nuclear Information System (INIS)

    Kwapiński, Tomasz

    2017-01-01

    The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin–orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears. (paper)

  9. Markov Chain Monte Carlo Methods

    Indian Academy of Sciences (India)

    Keywords. Markov chain; state space; stationary transition probability; stationary distribution; irreducibility; aperiodicity; stationarity; M-H algorithm; proposal distribution; acceptance probability; image processing; Gibbs sampler.

  10. Risikobasiertes Supply-Chain-Management

    DEFF Research Database (Denmark)

    Wieland, Andreas; Schinz, Philipp

    2015-01-01

    Das Management erlebt seit einigen Jahren dahingehend einen Paradigmenwechsel, dass nicht mehr Unternehmen als einzelne autonome Einheiten im Wettbewerb zueinander stehen, sondern die Supply Chains, in denen diese Unternehmen eingebunden sind. Ursachen hierfür sind beispielsweise die Auslagerung...... von Nicht-Kernprozessen auf vorgelagerte Stufen der Supply Chain oder auf Supply-Chain-Dienstleister sowie die Internationalisierung der Beschaffung. Dieser Paradigmenwechsel hat traditionelles Denken in den Schranken des Systems „Unternehmen“ abgelöst und zum Supply- Chain-Denken geführt, das vor......- und nachgelagerte Stufen des Systems „End-to-End-Supply-Chain“ einbezieht, etwa auch die Lieferanten von Lieferanten....

  11. Reverse logistics system and recycling potential at a landfill: A case study from Kampala City

    International Nuclear Information System (INIS)

    Kinobe, J.R.; Gebresenbet, G.; Niwagaba, C.B.; Vinnerås, B.

    2015-01-01

    Highlights: • Quantifies the different waste streams delivered at the landfill. • Evaluates the amount of potential waste products that enters into the reverse cycle. • Drawing out the reverse logistics activities from Kampala City to Kiteezi landfill. • Identify the storage, collection and transportation mechanisms of products to the various destinations; and finally. • The study suggests efficient measures to improve reverse logistics system. - Abstract: The rapid growing population and high urbanisation rates in Sub-Saharan Africa has caused enormous pressure on collection services of the generated waste in the urban areas. This has put a burden on landfilling, which is the major waste disposal method. Waste reduction, re-use and recycling opportunities exist but are not fully utilized. The common items that are re-used and re-cycled are plastics, paper, aluminum, glass, steel, cardboard, and yard waste. This paper develops an overview of reverse logistics at Kiteezi landfill, the only officially recognised waste disposal facility for Kampala City. The paper analyses, in details the collection, re-processing, re-distribution and final markets of these products into a reversed supply chain network. Only 14% of the products at Kiteezi landfill are channeled into the reverse chain while 63% could be included in the distribution chain but are left out and disposed of while the remaining 23% is buried. This is because of the low processing power available, lack of market value, lack of knowledge and limited value addition activities to the products. This paper proposes possible strategies of efficient and effective reverse logistics development, applicable to Kampala City and other similar cities

  12. Reverse logistics system and recycling potential at a landfill: A case study from Kampala City

    Energy Technology Data Exchange (ETDEWEB)

    Kinobe, J.R., E-mail: joel.kinobe@slu.se [Department of Energy and Technology, Swedish University of Agricultural Sciences, P.O. Box 7032, SE-750 07 Uppsala (Sweden); Department of Civil and Environmental Engineering, Makerere University College of Engineering, Design, Art and Technology (CEDAT), P.O. Box 7062, Kampala (Uganda); Gebresenbet, G. [Department of Energy and Technology, Swedish University of Agricultural Sciences, P.O. Box 7032, SE-750 07 Uppsala (Sweden); Niwagaba, C.B. [Department of Civil and Environmental Engineering, Makerere University College of Engineering, Design, Art and Technology (CEDAT), P.O. Box 7062, Kampala (Uganda); Vinnerås, B. [Department of Energy and Technology, Swedish University of Agricultural Sciences, P.O. Box 7032, SE-750 07 Uppsala (Sweden)

    2015-08-15

    Highlights: • Quantifies the different waste streams delivered at the landfill. • Evaluates the amount of potential waste products that enters into the reverse cycle. • Drawing out the reverse logistics activities from Kampala City to Kiteezi landfill. • Identify the storage, collection and transportation mechanisms of products to the various destinations; and finally. • The study suggests efficient measures to improve reverse logistics system. - Abstract: The rapid growing population and high urbanisation rates in Sub-Saharan Africa has caused enormous pressure on collection services of the generated waste in the urban areas. This has put a burden on landfilling, which is the major waste disposal method. Waste reduction, re-use and recycling opportunities exist but are not fully utilized. The common items that are re-used and re-cycled are plastics, paper, aluminum, glass, steel, cardboard, and yard waste. This paper develops an overview of reverse logistics at Kiteezi landfill, the only officially recognised waste disposal facility for Kampala City. The paper analyses, in details the collection, re-processing, re-distribution and final markets of these products into a reversed supply chain network. Only 14% of the products at Kiteezi landfill are channeled into the reverse chain while 63% could be included in the distribution chain but are left out and disposed of while the remaining 23% is buried. This is because of the low processing power available, lack of market value, lack of knowledge and limited value addition activities to the products. This paper proposes possible strategies of efficient and effective reverse logistics development, applicable to Kampala City and other similar cities.

  13. Requirements of supply chain management in differentiating European pork chains

    NARCIS (Netherlands)

    Trienekens, J.H.; Wognum, P.M.

    2013-01-01

    This paper summarizes results obtained by research into pork chain management in the EU Integrated Project Q-Porkchains. Changing demands for intrinsic and extrinsic quality attributes of pork products impact the way supply chain management should be organized from the farmer down to the consumer.

  14. Reversal agents in anaesthesia and critical care

    Directory of Open Access Journals (Sweden)

    Nibedita Pani

    2015-01-01

    Full Text Available Despite the advent of short and ultra-short acting drugs, an in-depth knowledge of the reversal agents used is a necessity for any anaesthesiologist. Reversal agents are defined as any drug used to reverse the effects of anaesthetics, narcotics or potentially toxic agents. The controversy on the routine reversal of neuromuscular blockade still exists. The advent of newer reversal agents like sugammadex have made the use of steroidal neuromuscular blockers like rocuronium feasible in rapid sequence induction situations. We made a review of the older reversal agents and those still under investigation for drugs that are regularly used in our anaesthesia practice.

  15. Reverse osmosis water purification system

    Science.gov (United States)

    Ahlstrom, H. G.; Hames, P. S.; Menninger, F. J.

    1986-01-01

    A reverse osmosis water purification system, which uses a programmable controller (PC) as the control system, was designed and built to maintain the cleanliness and level of water for various systems of a 64-m antenna. The installation operates with other equipment of the antenna at the Goldstone Deep Space Communication Complex. The reverse osmosis system was designed to be fully automatic; with the PC, many complex sequential and timed logic networks were easily implemented and are modified. The PC monitors water levels, pressures, flows, control panel requests, and set points on analog meters; with this information various processes are initiated, monitored, modified, halted, or eliminated as required by the equipment being supplied pure water.

  16. Trend towards reverse leach process

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    The South African gold mining industry is making notable strides in improving recovery methods for both gold and uranium with significant additions to profits because of higher efficiencies and reductions in costs in the recovery processes. The most notable step on the gold side recently is the adoption of the reverse leach process at Buffelsfontein and Western Deep Levels. This process was pioneered at Hartebeesfontein as far back as 1975 and when introduced there resulted in a two and a half per cent improvement in recovery efficiencies. The essence of reverse leaching under which the uranium is recovered before the gold is the fact that the gold partly coated with iron oxide or locked in uranite, is exposed to be recovered later by cyanidation

  17. Reversible evolution of charged ergoregions

    Energy Technology Data Exchange (ETDEWEB)

    Kokkotas, K.; Spyrou, N.

    1987-07-01

    The reversible evolution of a charged rotating ergoregion, due to the injection into it of particles with mass-energy and angular momentum, is studied systematically. As in the uncharged case, a bulge always forms on the outer boundary of the ergoregion due to the latter's angular momentum. The behavior of the bulge's position, relative to the black hole's rotation axis and equatorial plane, is studied, on the basis of the cosmic censorship hypothesis, during the ergoregion's reversible evolution. The range of the permitted values of the ergoregion's linear dimensions along the rotation axis and perpendicular to it is specified. Finally the differences with the evolution of an uncharged ergoregion are pointed out and discussed.

  18. Malware analysis and reverse engineering

    OpenAIRE

    Šváb, Martin

    2014-01-01

    Focus of this thesis is reverse engineering in information technology closely linked with the malware analysis. It explains fundamentals of IA-32 processors architecture and basics of operating system Microsoft Windows. Main part of this thesis is dedicated to the malware analysis, including description of creating a tool for simplification of static part of the analysis. In Conclusion various approaches to the malware analysis, which were described in previous part of the thesis, are practic...

  19. How to play Reverse Hex

    DEFF Research Database (Denmark)

    Toft, Bjarne; Hayward, Ryan B.; Henderson, Philip

    2012-01-01

    We present new results on how to play Reverse Hex, also known as Rex, or Misère Hex, on n × n boards. We give new proofs – and strengthened versions – of Lagarias and Sleator’s theorem (for n × n boards, each player can prolong the game until the board is full, so the first/second player can alwa...

  20. Theory of field reversed configurations

    International Nuclear Information System (INIS)

    Steinhauer, L.C.

    1990-01-01

    This final report surveys the results of work conducted on the theory of field reversed configurations. This project has spanned ten years, beginning in early 1980. During this period, Spectra Technology was one of the leading contributors to the advances in understanding FRC. The report is organized into technical topic areas, FRC formation, equilibrium, stability, and transport. Included as an appendix are papers published in archival journals that were generated in the course of this report. 33 refs