Olefin copolymerization via reversible addition-fragmentation chain transfer
Venkatesh, R.; Staal, B.B.P.; Klumperman, B.
2004-01-01
Successful statistical copolymn. of an a-olefin (1-octene) with an acrylate (Bu acrylate, BA) and with a methacrylate (Me methacrylate, MMA), employing reversible addn.-fragmentation chain transfer (RAFT) mediated polymn. has been accomplished
Carvalho Esteves, de A.C.; Hodge, P.; Trindade, T.; Barros-Timmons, A.M.M.V.
2009-01-01
Herein, we report the synthesis of quantum dots (QDs)/polymer nanocomposites by reversible addition-fragmentation chain transfer (RAFT) polymerization in miniemulsions using a grafting from approach. First, the surfaces of CdS and CdSe QDs were functionalized using a chain transfer agent, a
Reversible addition-fragmentation chain transfer polymerization of 2-chloro-1,3-butadiene
Pullan, Nikki; Liu, Max; Topham, Paul D.
2013-01-01
Controlled polymerization of 2-chloro-1,3-butadiene using reversible addition–fragmentation chain transfer (RAFT) polymerization has been demonstrated for the first time. 2-Chloro-1,3-butadiene, more commonly known as chloroprene, has significant industrial relevance as a crosslinked rubber, with uses ranging from adhesives to integral automotive components. However, problems surrounding the inherent toxicity of the lifecycle of the thiourea-vulcanized rubber have led to the need for control ...
Monteiro, M.J.; Sjöberg, M.; Göttgens, C.M.; Vlist, van der J.
2000-01-01
The synthesis of block copolymers in an environmentally friendly medium was carried out in emulsion polymerizations through the reversible addition-fragmentation chain transfer process, using a transfer active xanthate (MADIX) agent, under batch and starved-feed conditions. First, ab initio
Energy Technology Data Exchange (ETDEWEB)
Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G. [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia)
2012-01-15
Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated 'grafting-from' process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.
International Nuclear Information System (INIS)
Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G.; Ellis, Amanda V.
2012-01-01
Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated “grafting-from” process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.
Ban, Lu; Han, Xu; Wang, Xian-Hua; Huang, Yan-Ping; Liu, Zhao-Sheng
2013-10-01
To obtain fast separation, ionic liquids were used as porogens first in combination with reversible addition-fragmentation chain transfer (RAFT) polymerization to prepare a new type of molecularly imprinted polymer (MIP) monolith. The imprinted monolithic column was synthesized using a mixture of carprofen (template), 4-vinylpyridine, ethylene glycol dimethacrylate, [BMIM]BF4, and chain transfer agent (CTA). Some polymerization factors, such as template-monomer molar ratio, the degree of crosslinking, the composition of the porogen, and the content of CTA, on the column efficiency and imprinting effect of the resulting MIP monolith were systematically investigated. Affinity screening of structurally similar compounds with the template can be achieved in 200 s on the MIP monolith due to high column efficiency (up to 12,070 plates/m) and good column permeability. Recognition mechanism of the imprinted monolith was also investigated.
Directory of Open Access Journals (Sweden)
Hossein Roghani-Mamaqani
2017-09-01
Full Text Available Edge-functionalized graphene nanolayers with polystyrene chains were prepared by a “grafting through” reversible addition-fragmentation chain transfer (RAFT polymerization. For this purpose, double-bond containing modifier (MD was prepared. After edge-functionalization of graphene oxide (GO by two different amounts of MD and preparation of modified graphenes (LFG and HFG, RAFT polymerization of styrene was applied for preparation of functionalized GO with different densities of polystyrene chains. Fourier transform infrared spectroscopy showed that MD and polystyrene chains were grafted at the edge of GO. Gas chromatography showed that conversion decreased by the addition of modified GO content and also grafting density of MD. Number-average molecular weight and polydispersity index of polystyrene chains were derived from gel permeation chromatography. Increase of modified graphene content results in a decrease in molecular weight of attached polystyrene chains and also an increase in their PDI value. Increase of grafting density of MD results in decrease of molecular weight of polystyrene chains with no considerable variation in PDI value. Thermogravimetric analysis results showed that char residue is about 45.1 and 46.8% for LFG and HFG, respectively. The content of degradation ascribed to polystyrene increased with increase of grafting density of MD and decreased with increase of modified graphene content. X-ray diffraction results were used for evaluation of interlayer spacing of graphene layers after functionalization process and also study of nanocomposites structure. The results of scanning electron microscopy and transmission electron microscopy show that graphene layers with high clarity turned to opaque layers with lots of creases by oxidation and attachment of polystyrene chains.
Keddie, Daniel J
2014-01-21
The discovery of reversible-deactivation radical polymerization (RDRP) has provided an avenue for the synthesis of a vast array of polymers with a rich variety of functionality and architecture. The preparation of block copolymers has received significant focus in this burgeoning research field, due to their diverse properties and potential in a wide range of research environments. This tutorial review will address the important concepts behind the design and synthesis of block copolymers using reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerization is arguably the most versatile of the RDRP methods due to its compatibility with a wide range of functional monomers and reaction media along with its relative ease of use. With an ever increasing array of researchers that possess a variety of backgrounds now turning to RDRP, and RAFT in particular, to prepare their required polymeric materials, it is pertinent to discuss the important points which enable the preparation of high purity functional block copolymers with targeted molar mass and narrow molar mass distribution using RAFT polymerization. The key principles of appropriate RAFT agent selection, the order of monomer addition in block synthesis and potential issues with maintaining high end-group fidelity are addressed. Additionally, techniques which allow block copolymers to be accessed using a combination of RAFT polymerization and complementary techniques are touched upon.
Directory of Open Access Journals (Sweden)
Nenad Micic
2014-01-01
Full Text Available A controlled radical polymerization process using the Reversible Addition-Fragmentation Chain Transfer (RAFT approach was scaled up by a factor of 100 from a small laboratory scale of 5 mL to a preparative scale of 500 mL, using batch and continuous flow processing. The batch polymerizations were carried out in a series of different glass vessels, using either magnetic or overhead stirring, and different modes of heating: Microwave irradiation or conductive heating in an oil bath. The continuous process was conducted in a prototype tubular flow reactor, consisting of 6 mm ID stainless steel tubing, fitted with static mixers. Both reactor types were tested for polymerizations of the acid functional monomers acrylic acid and 2-acrylamido-2-methylpropane-1-sulfonic acid in water at 80 °C with reaction times of 30 to 40 min. By monitoring the temperature during the exothermic polymerization process, it was observed that the type and size of reactor had a significant influence on the temperature profile of the reaction.
Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin
2010-07-22
Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.
Energy Technology Data Exchange (ETDEWEB)
Ye, Piaoran [Case Western Reserve Univ., Cleveland, OH (United States); Cao, Peng -Fei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Su, Zhe [Case Western Reserve Univ., Cleveland, OH (United States); Advincula, Rigoberto [Case Western Reserve Univ., Cleveland, OH (United States)
2017-03-23
Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR), and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L–1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.
Brouwer, de J.A.M.; Schellekens, M.A.J.; Klumperman, B.; Monteiro, M.J.; German, A.L.
2000-01-01
Reversible addn.-fragmentation chain transfer (RAFT) was applied to the copolymn. of styrene and maleic anhydride. The product had a low polydispersity and a predetd. molar mass. Novel, well-defined polyolefin-based block copolymers were prepd. with a macromol. RAFT agent prepd. from a com.
Ghosh, Arjun; Yusa, Shin-ichi; Matsuoka, Hideki; Saruwatari, Yoshiyuki
2011-08-02
Cationic amphiphilic diblock copolymers of poly(n-butylacrylate)-b-poly(3-(methacryloylamino)propyl)trimethylammonium chloride) (PBA-b-PMAPTAC) with various hydrophobic and hydrophilic chain lengths were synthesized by a reversible addition-fragmentation chain transfer (RAFT) process. Their molecular characteristics such as surface activity/nonactivity were investigated by surface tension measurements and foam formation observation. Their micelle formation behavior and micelle structure were investigated by fluorescence probe technique, static and dynamic light scattering (SLS and DLS), etc., as a function of hydrophilic and hydrophobic chain lengths. The block copolymers were found to be non-surface active because the surface tension of the aqueous solutions did not change with increasing polymer concentration. Critical micelle concentration (cmc) of the polymers could be determined by fluorescence and SLS measurements, which means that these polymers form micelles in bulk solution, although they were non-surface active. Above the cmc, the large blue shift of the emission maximum of N-phenyl-1-naphthylamine (NPN) probe and the low micropolarity value of the pyrene probe in polymer solution indicate the core of the micelle is nonpolar in nature. Also, the high value of the relative intensity of the NPN probe and the fluorescence anisotropy of the 1,6-diphenyl-1,3,5-hexatriene (DPH) probe indicated that the core of the micelle is highly viscous in nature. DLS was used to measure the average hydrodynamic radii and size distribution of the copolymer micelles. The copolymer with the longest PBA block had the poorest water solubility and consequently formed micelles with larger size while having a lower cmc. The "non-surface activity" was confirmed for cationic amphiphilic diblock copolymers in addition to anionic ones studied previously, indicating the universality of non-surface activity nature.
Wang, Di; Cao, Zhihan; Pang, Xinzhu; Deng, Yulin; Li, Bo; Dai, Rongji
2018-01-01
Reversible phosphorylation of proteins is one of the most crucial types of post-translational modifications (PTMs). And it shows significant work in diversified biological processes. However, the separation technology of phosphorylated peptides is still an analytical challenge in phosphoproteomics, because phosphopeptides are alway in low stoichiometry. Thus, enrichment of phosphopeptides before detection is indispensable. In this study, a novel temperature regulated separation protocol was developed. Silica@p (NIPAAm-co-IPPA)-Ti4+, a new Ti(IV)-IMAC (Immobilized Metal Affinity chromatography) materials was synthesized by reversible addition fragmentation chain transfer polymerization (RAFT). By the unique thermally responsive properties of poly(N-isopropylacrylamide) (PNIPAAm), the captured phosphorylated peptides could be released by changing temperature only without applying any other eluant which could damage the phosphopeptides. We employed isopropanol phosphonic acid (IPPA) as an IMAC ligand for the immobilization of Ti(IV) which could increase the specific adsorption of phosphopeptides. The enrichment and release properties were examined by treatment with pyridoxal 5’-phosphate (PLP) and casein phosphopeptides (CPP). Two phosphorylated compounds above have temperature-stimulated binding to Ti4+. Finally, silica@p (NIPAAm-co-IPPA)-Ti4+ was successfully employed in pretreatment of phosphopeptides in a tryptic digest of a-casein and human serum albumin (HSA). The results indicated a great potential of this new temperature-responsive material in phosphoproteomics study.
International Nuclear Information System (INIS)
Huang, Xingyi; Wang, Shen; Zhu, Ming; Yang, Ke; Jiang, Pingkai; Bando, Yoshio; Golberg, Dmitri; Zhi, Chunyi
2015-01-01
Thermally conductive and electrically insulating polymer/boron nitride (BN) nanocomposites are highly attractive for various applications in many thermal management fields. However, so far most of the preparation methods for polymer/BN nanocomposites have usually caused difficulties in the material post processing. Here, an in situ grafting approach is designed to fabricate thermally conductive, electrically insulating and post-melt processable polystyrene (PS)/BN nanosphere (BNNS) nanocomposites by initiating styrene (St) on the surface functionalized BNNSs via reversible addition fragmentation chain transfer polymerization. The nanocomposites exhibit significantly enhanced thermal conductivity. For example, at a St/BN feeding ratio of 5:1, an enhancement ratio of 1375% is achieved in comparison with pure PS. Moreover, the dielectric properties of the nanocomposites show a desirable weak dependence on frequency, and the dielectric loss tangent of the nanocomposites remains at a very low level. More importantly, the nanocomposites can be subjected to multiple melt processing to form different shapes. Our method can become a universal approach to prepare thermally conductive, electrically insulating and melt-processable polymer nanocomposites with diverse monomers and nanofillers. (paper)
Energy Technology Data Exchange (ETDEWEB)
Heinen, Jennifer M. (O' Donnell) [Iowa State Univ., Ames, IA (United States)
2014-12-31
This research has shown that the microstructure of self-assembled copolymers can be decoupled from the polymer chemistry. The simplest polymer architecture, linear block copolymers, is valuable for a broad range of applications, including adhesives and coatings, medical devices, electronics and energy storage, because these block copolymers reproducibly self-assemble into microphase separated nanoscale domains. Unfortunately, the self-assembled microstructure is tuned by polymer composition, thus limiting the potential to simultaneously optimize chemical, mechanical, and transport properties for desired applications. To this end, much work was been put into manipulating block copolymer self-assembly independently of polymer composition. These efforts have included the use of additives or solvents to alter polymer chain conformation, the addition of a third monomer to produce ABC triblock terpolymers, architectures with mixed blocks, such as tapered/gradient polymers, and the synthesis of other nonlinear molecular architectures. This work has shown that the microstructures formed by linear ABC terpolymers can be altered by controlling the architecture of the polymer molecules at a constant monomer composition, so that the microstructure is tuned independently from the chemical properties.
Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin
2011-01-01
In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic
Designing the Reverse Supply Chain
DEFF Research Database (Denmark)
Gobbi, Chiara
2011-01-01
Purpose – The purpose of this paper is to explore the impact of the product residual value (PRV) and the loss of value over time of returned products in the reverse supply chain configuration. It also examines whether or not the distinction of Fisher's functional and innovative products holds...... that allows for recapturing most of the PRV. These notions have then been tested by analyzing two reverse supply chains with a case study research methodology. Findings – The findings show that low PRV is associated with second-class recovery options (recycling and energy recovery) and that high PRV...... is associated with first-class recovery options (reconditioning and remarketing). When the recovery option is recycling, time is not relevant, the primary objective is cost reduction (efficiency), the chain is centralized, and actors and phases of the reverse chain are determined by the specificity...
Automated main-chain model building by template matching and iterative fragment extension
International Nuclear Information System (INIS)
Terwilliger, Thomas C.
2003-01-01
A method for automated macromolecular main-chain model building is described. An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and β-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and β-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C α positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 Å. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition
Automated main-chain model building by template matching and iterative fragment extension.
Terwilliger, Thomas C
2003-01-01
An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and beta-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and beta-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C(alpha) positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 A. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition.
Chain-end modification of living anionic polybutadiene with diphenylethylenes and styrenes
Donkers, E.H.D.; Willemse, R.X.E.; Klumperman, B.
2005-01-01
The first step in the transformation of poly(butadienyl)lithium into a macromolecular atom transfer radical polymerization initiator or reversible addition-fragmentation chain transfer agent is the modification of the anionic chain end into a suitable leaving/reinitiating group. We have investigated
Hybrid Algorithms for Fuzzy Reverse Supply Chain Network Design
Che, Z. H.; Chiang, Tzu-An; Kuo, Y. C.
2014-01-01
In consideration of capacity constraints, fuzzy defect ratio, and fuzzy transport loss ratio, this paper attempted to establish an optimized decision model for production planning and distribution of a multiphase, multiproduct reverse supply chain, which addresses defects returned to original manufacturers, and in addition, develops hybrid algorithms such as Particle Swarm Optimization-Genetic Algorithm (PSO-GA), Genetic Algorithm-Simulated Annealing (GA-SA), and Particle Swarm Optimization-Simulated Annealing (PSO-SA) for solving the optimized model. During a case study of a multi-phase, multi-product reverse supply chain network, this paper explained the suitability of the optimized decision model and the applicability of the algorithms. Finally, the hybrid algorithms showed excellent solving capability when compared with original GA and PSO methods. PMID:24892057
How manufacturers can use their reverse supply chain: a typology of reverse supply chain roles
DEFF Research Database (Denmark)
Larsen, Samuel; Jacobsen, Peter
2014-01-01
While traditional forward supply chains end with customer markets, the reverse supply chain (RSC) both begins and ends with the firm’s markets. The study applies the prevalent conceptual RSC‐description in the theoretical field by Guide and Van Wassenhove (2009). In the description, the RSC begins...... is not explicitly part of the description, this study does include them as disposition strategies. Although some RSC topics have been fairly well‐addressed in extant literature (e.g. product acquisition, inventory models and product disassembly), the RSC‐topic remains under‐explored (Pohkarel and Mutha, 2009...... the reverse logistical processes required for supporting a liberal return policy, etc. Based on extant literature from the supply chain management and OM fields, this study develops a conceptual typology of what roles the RSC can play in the firm’s efforts of achieving higher overall economic profits. Each...
Production of a phage-displayed single chain variable fragment ...
African Journals Online (AJOL)
Abstract. Purpose: To develop specific single chain variable fragments (scFv) against ... libraries. The binding ability of the selected scFv antibody fragments against the IBDV particles was ..... Hermelink H, Koscielniak E. A human recombinant.
Production of a phage-displayed single chain variable fragment ...
African Journals Online (AJOL)
Purpose: To develop specific single chain variable fragments (scFv) against infectious bursal disease virus (IBDV) via phage display technology. Methods: Purified viruses were initially applied for iterative panning rounds of scFv phage display libraries. The binding ability of the selected scFv antibody fragments against the ...
Reverse logistics and closed-loop supply chain
DEFF Research Database (Denmark)
Govindan, Kannan; Soleimani, Hamed; Kannan, Devika
2015-01-01
Based on environmental, legal, social, and economic factors, reverse logistics and closed-loop supply chain issues have attracted attention among both academia and practitioners. This attention is evident by the vast number of publications in scientific journals which have been published in recent...... years. Hence, a comprehensive literature review of recent and state-of-the-art papers is vital to draw a framework of the past, and to shed light on future directions. The aim of this paper is to review recently published papers in reverse logistic and closed-loop supply chain in scientific journals...
The Reverse Supply Chain: Configuration, Integration and Profitability
DEFF Research Database (Denmark)
Gobbi, Chiara
2008-01-01
This thesis presents the results of a qualitative investigation that has been conducted in order to enhance knowledge of the reverse supply chain management field. Two aspects of the reverse flow need to be taken into consideration: the importance of introducing mechanisms that promote the circui......This thesis presents the results of a qualitative investigation that has been conducted in order to enhance knowledge of the reverse supply chain management field. Two aspects of the reverse flow need to be taken into consideration: the importance of introducing mechanisms that promote...... the circuitry of resources in order to protect the environment, and the increasing awareness that if strategically managed, the reverse chain represents an opportunity for profit generation and for improving the competitive position of a firm. In the first case, the main stakeholders are represented...... within the 27 Member States, reaching approximately 14-24 Kg. per inhabitant in Western Europe and the 6-12 Kg. per inhabitant in the New Member States. In the second case, the main stakeholder is the firm, the producer that has the possibility of exploring new opportunities to achieve a competitive...
The Impact of Carbon Emissions Policies on Reverse Supply Chain Network Design
Directory of Open Access Journals (Sweden)
Bandar A. ALKHAYYAL
2018-01-01
Full Text Available Reverse Supply Chain is described as an initiative that plays an important role in the global supply chain for those who seek environmentally responsible solutions for their end-of-life products. The relative economic and environmental benefits of reverse supply chain are influenced by costs and emissions during collection, transportation, recovery facilities, disassembly, recycling, remanufacturing, and disposal of unrecoverable components. The design of reverse supply chain network takes into account social, economic and environmental objectives. This paper addresses the design of reverse supply chain under the three common regulatory policies, strict carbon caps, carbon tax, and carbon cap-and-trade.
RAFT Miniemulsion Polymerization of MMA with Cumyl Dithiobenzoate as Chain Transfer Agent
Institute of Scientific and Technical Information of China (English)
Tian Ying GUO; Dong Lin TANG; Jing Wei ZHU; Mou Dao SONG; Bang Hua ZHANG
2006-01-01
Reversible addition-fragmentation transfer (RAFT) miniemulsion polymerizations for PMMA with cumyl dithiobenzoate (CDB) as a chain transfer agent (CTA) has been carried out.Higher temperature made the polymerization much faster and the PDI remained below 1.20, when the temperature was upon 70 ℃.
Second-life retailing: a reverse supply chain perspective
Beh, LS; Ghobadian, A; He, Q; Gallear, D; O Regan, N
2016-01-01
The authors examine the role of entrepreneurial business models in the reverse supply chain of apparel/fashion retailers. The purpose of this paper is to offer an alternative approach to the “return to the point of origin” prevalent in the reverse chain of manufacturers but less technically and economically feasible in the case of apparel/fashion retailers. This approach, second-life retailing, not only reduces waste but also democratises consumption. Design/methodology/approach – The paper i...
Directory of Open Access Journals (Sweden)
Zhao Jianjun
2011-02-01
Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.
The Impact of Carbon Emissions Policies on Reverse Supply Chain Network Design
Bandar A. ALKHAYYAL; Surendra M. GUPTA
2018-01-01
Reverse Supply Chain is described as an initiative that plays an important role in the global supply chain for those who seek environmentally responsible solutions for their end-of-life products. The relative economic and environmental benefits of reverse supply chain are influenced by costs and emissions during collection, transportation, recovery facilities, disassembly, recycling, remanufacturing, and disposal of unrecoverable components. The design of reverse supply chain network takes in...
Evaluating Reverse Supply Chain Efficiency: Manufacturer's Perspective
DEFF Research Database (Denmark)
Kumar, M.; Tiwari, M. K.; Wong, K. Y.
2014-01-01
The paper aims to illustrate the use of fuzzy data envelopment analysis (DEA) in analyzing reverse supply chain (RSC) performance from the manufacturer's perspective. By using an alternative alpha-cut approach, the fuzzy DEA model was converted into a crisp linear programming problem, thereby...... usually ensures an environmentally friendly supply chain network, companies which have implemented RSC techniques since a longer duration do not necessarily have a more efficient supply chain in general....
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Supramolecular Nanoparticles via Single-Chain Folding Driven by Ferrous Ions.
Wang, Fei; Pu, Hongting; Jin, Ming; Wan, Decheng
2016-02-01
Single-chain nanoparticles can be obtained via single-chain folding assisted by intramolecular crosslinking reversibly or irreversibly. Single-chain folding is also an efficient route to simulate biomacromolecules. In present study, poly(N-hydroxyethylacrylamide-co-4'-(propoxy urethane ethyl acrylate)-2,2':6',2''-terpyridine) (P(HEAm-co-EMA-Tpy)) is synthesized via reversible addition fragmentation chain transfer polymerization. Single-chain folding and intramolecular crosslinking of P(HEAm-co-EMA-Tpy) are achieved via metal coordination chemistry. The intramolecular interaction is characterized on ultraviolet/visible spectrophotometer (UV-vis spectroscopy), proton nuclear magnetic resonance ((1)H NMR), and differential scanning calorimetry (DSC). The supramolecular crosslinking mediated by Fe(2+) plays an important role in the intramolecular collapsing of the single-chain and the formation of the nanoparticles. The size and morphology of the nanoparticles can be controlled reversibly via metal coordination chemistry, which can be characterized by dynamic light scattering (DLS), transmission electron microscope (TEM), and atomic force microscope (AFM). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A review of reverse logistics and closed-loop supply chains
DEFF Research Database (Denmark)
Govindan, Kannan; Soleimani, Hamed
2016-01-01
Today, the task of developing reverse logistics and closed-loop supply chains in both developed and developing industries is accepted as a vital need in our societies. The growing interest in reverse issues can be clearly seen in the large number of publications, especially the ones that consider...... case studies in various industries. Based on its missions, Journal of Cleaner Production (JCP) is one of the most active journals in this field. Therefore, a comprehensive review is undertaken of the publications in the field of reverse logistics and closed-loop supply chains; the selection process...... December 2014 have been selected and reviewed. The selected papers are then analyzed based on their content and the appropriate developed categories. The results clarify the main trends in reverse logistics and closed-loop supply chain subjects for the Journal of Cleaner Production and the evaluations...
DEFF Research Database (Denmark)
Olsen, K E; Sletten, K; Westermark, Per
1998-01-01
Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin l...... light chain are a constituent of the AL-amyloid proteins of kappa type. A specific antiserum has identified these fragments in gel filtration fractions where the absorbance approached the base line after the main retarded peak. The fragments are small and have been overlooked previously......Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin...... in the purification process. The significance of the constant part in AL-proteins is unclear, but adds new aspects to the discussion of pre- or post-fibrillogenic cleavage of the immunoglobulin light chains....
Xu, Xiaohui; Li, Daoyuan; Chi, Lequan; Du, Xuzhao; Bai, Xue; Chi, Lianli
2015-04-30
Low molecular weight heparins (LMWHs) are linear and highly charged carbohydrate polymers prepared by chemical or enzymatic depolymerization of heparin. Compared to unfractionated heparin (UFH), LMWHs are prevalently used as clinical anticoagulant drugs due to their lower side effects and better bioavailability. The work presented herein provides a rapid and powerful fragment mapping method for structural characterization of LMWHs. The chain fragments of two types of LMWHs, enoxaparin and nadroparin, were generated by controlled enzymatic digestion with each of heparinase I (Hep I, Enzyme Commission (EC) # 4.2.2.7), heparinase II (Hep II, no EC # assigned) and heparinase III (Hep III, EC # 4.2.2.8). Reversed phase ion pair high performance liquid chromatography (RPIP-HPLC) coupled with electrospray ion trap time-of-flight mass spectrometry (ESI-IT-TOF-MS) was used to profile the oligosaccharide chains ranging from disaccharides to decasaccharides. A database containing all theoretical structural compositions was established to assist the mass spectra interpretation. The six digests derived by three enzymes from two types of LMWHs exhibited distinguishable fingerprinting patterns. And a total of 94 enoxaparin fragments and 109 nadroparin fragments were detected and identified. Besides the common LMWH oligosaccharides, many components containing characteristic LMWH structures such as saturated L-idopyranosuronic acid, 2,5-anhydro-D-mannitol, 1,6-anhydro-D-aminopyranose, as well as odd number oligosaccharides were also revealed. Quantitative comparison of major components derived from innovator and generic nadroparin products was presented. This approach to profile LMWHs' fragments offers a highly reproducible, high resolution and information-rich tool for evaluating the quality of this category of anticoagulant drugs or comparing structural similarities among samples from various sources. Copyright © 2015 Elsevier Ltd. All rights reserved.
Reverse supply chain coordination by revenue sharing contract
DEFF Research Database (Denmark)
Govindan, Kannan; Popiuc, M.N.
2014-01-01
implementation of revenue sharing contract. We define customer willingness to return obsolete units as a function of the discount offered by the retailer in exchange for recycling devices with a remanufacturing value. The results show that performance measures and total supply chain profits improve through......Products that are not recycled at the end of their life increasingly damage the environment. In a collection - remanufacturing scheme, these end-of-life products can generate new profits. Designed on the personal computers industry, this study defines an analytical model used to explore...... the implications of recycling on the reverse supply chain from an efficiency perspective for all participants in the process. The cases considered for analysis are the two- and three-echelon supply chains, where we first look at the decentralized reverse setting followed by the coordinated setting through...
Zhang, Zhenbin; Peuchen, Elizabeth H; Dovichi, Norman J
2017-06-20
A surface-confined aqueous reversible addition-fragmentation chain transfer (SCARAFT) polymerization method was developed to coat capillaries for use in capillary zone electrophoresis (CZE). SCARAFT polymerization primarily takes place on the inner surface of the capillary instead of in solution, which greatly improves the homogeneity of the coating. Capillaries treated with this coating produced an electroosmotic mobility of 2.8 ± 0.2 × 10 -6 cm 2 ·V -1 ·s -1 (N = 3), which is roughly an order of magnitude lower than that of commercial linear polyacrylamide (LPA)-coated capillaries. Coated capillaries were evaluated for bottom-up proteomic analysis using CZE. The very low electroosmotic mobility results in a 200 min separation and improved single-shot analysis. An average of 977 protein groups and 5605 unique peptides were identified from 50 ng of an E. coli digest, and 2158 protein groups and 10 005 peptides were identified from 25 ng of a HeLa digest using single-shot analysis with a SCARAFT-acrylamide capillary coupled to a Q Exactive HF mass spectrometer. The coating is stable. A single capillary was used for over 200 h (8.4 days) of continuous operation. RSD in migration time was between 2 and 3% for selected ion electropherograms (SIEs) generated for six ions; median theoretical plate counts ranged from 240 000 to 600 000 for these SIEs. Various types of coatings could be prepared by simply changing the functional vinyl monomers in the polymerization mixture. Positively charged coatings using direct attachment and formation of a block copolymer were prepared and demonstrated for the separation of mixtures of intact proteins.
Bayesian analysis for reversible Markov chains
Diaconis, P.; Rolles, S.W.W.
2006-01-01
We introduce a natural conjugate prior for the transition matrix of a reversible Markov chain. This allows estimation and testing. The prior arises from random walk with reinforcement in the same way the Dirichlet prior arises from Pólya’s urn. We give closed form normalizing constants, a simple
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Revealing the Supramolecular Nature of Side-Chain Terpyridine-Functionalized Polymer Networks
Directory of Open Access Journals (Sweden)
Jérémy Brassinne
2015-01-01
Full Text Available Nowadays, finely controlling the mechanical properties of polymeric materials is possible by incorporating supramolecular motifs into their architecture. In this context, the synthesis of a side-chain terpyridine-functionalized poly(2-(dimethylaminoethyl methacrylate is reported via reversible addition-fragmentation chain transfer polymerization. By addition of transition metal ions, concentrated aqueous solutions of this polymer turn into metallo-supramolecular hydrogels whose dynamic mechanical properties are investigated by rotational rheometry. Hence, the possibility for the material to relax mechanical constrains via dissociation of transient cross-links is brought into light. In addition, the complex phenomena occurring under large oscillatory shear are interpreted in the context of transient networks.
Joosten, V.; Gouka, R.J.; Hondel, C.A.M.J.J. van den; Verrips, C.T.; Lokman, B.C.
2005-01-01
We report the expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori. Fragments encoding VHHs were cloned in a suitable Aspergillus expression vector and transformants secreting VHH fragments were analysed for integrated gene copy-numbers, mRNA
Gorskova, Julija; Ortega, Edrion
2012-01-01
Abstract Problem There is a gap in the knowledge concerning reverse product flows due to a lack of research and empirical data in the field of reverse supply chain management in general. Furthermore, more research is needed to investigate the factors influencing the decision making process regarding the right reverse supply chain recovery option choice for companies in order to close the supply chain loop. Processing product returns has become a critical activity for organisations as the volu...
Revenue in reverse? An examination of reverse supply chain enabled revenue streams
DEFF Research Database (Denmark)
Larsen, Samuel; Jacobsen, Peter
2016-01-01
When original equipment manufacturers (OEMs) examine whether to implement a reverse supply chain (RSC) for their products, oftentimes the motive is cost savings or regulatory compliance. However, a frequently overlooked but equally important benefit is the possibility for creating new revenue...
Time reversal odd fragmentation functions in semi-inclusive deep inelastic lepton-hadron scattering
Energy Technology Data Exchange (ETDEWEB)
Mulders, P.J. [National Inst. for Nuclear Physics and High Energy Physics, Amsterdam (Netherlands); Levelt, J. [Univ. of Erlangen-Nuernberg (Germany)
1994-04-01
In semi-inclusive scattering of polarized leptons from unpolarized hadrons, one can measure a time reversal odd structure function. It shows up as a sin({phi}) asymmetry of the produced hadrons. This asymmetry can be expressed as the product of a twist-three {open_quotes}hadron {r_arrow} quark{close_quotes} profile function and a time reversal odd twist-two {open_quotes}quark {r_arrow} hadron{close_quotes} fragmentation function. This fragmentation function can only be measured for nonzero transverse momenta of the produced hadron. Its appearance is a consequence of final state interactions between the produced hadron and the rest of the final state.
Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio
2012-01-01
A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.
Directory of Open Access Journals (Sweden)
Li An
2015-09-01
Full Text Available The effect of the irreversible addition-fragment chain transfer agent, butyl(2-phenylallylsulfane (BPAS, on the course of the emulsion polymerization of styrene and on the product molecular weight was investigated. The emulsion polymerizations were performed using various amounts of sodium dodecyl sulfate (SDS as the surfactant and potassium peroxodisulfate (KPS as the initiator. The relationships between the rates of polymerization (\\(R_{p} \\ and the number of particles per volume (\\(N_{c} \\ with respect to the concentrations of KPS, SDS, and BPAS were found to be \\(R_{p} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.29} \\, \\(N_{c} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.26} \\,\\(R_{p} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.68} \\, \\(N_{c} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.72} \\, and \\(R_{p} \\propto \\left\\lbrack BPAS \\right\\rbrack^{- 0.73} \\ . The obtained relationships can be attributed to the exit of the leaving group radicals on BPAS from the polymer particles. The experimental values of the average number of radicals per particle (\\(\\overset{\\_}{n} \\ were strongly dependent on the BPAS concentration and were in good agreement with the theoretical values (\\({\\overset{\\_}{n}}_{theo} \\ from model calculations. The number-average molecular weight (\\(\\overset{\\_}{M_{n}} \\ can be controlled by BPAS over nearly the entire conversion range, which is also in agreement with the mathematical model. In addition, the transfer rate coefficient (\\(k_{tr} \\ of BPAS can be estimated as 326 L/mol/s at 70 \\(^\\circ\\C. Moreover, similar good results were found for the tested redox reactions at 30 \\(^\\circ\\C.
Improved production and function of llama heavy chain antibody fragments by molecular evolution
Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.
2000-01-01
The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In
Bozovic, J.S.; Tello Manon, H.M; Meuldijk, J.; Koning, C.E.; Klumperman, B.
2007-01-01
Reversible addition fragmentation chain transfer (RAFT)-mediated polymerization was successfully applied for the synthesis of poly(4-vinylpyridine) (P4VP) polymers of predetermined molar mass and of low polydispersity index. These RAFT end-functionalized polymers were then used as macro-RAFT agents
Optimization of the crystallizability of a single-chain antibody fragment
Czech Academy of Sciences Publication Activity Database
Škerlová, Jana; Král, Vlastimil; Fábry, Milan; Sedláček, Juraj; Veverka, Václav; Řezáčová, Pavlína
2014-01-01
Roč. 70, č. 12 (2014), s. 1701-1706 ISSN 1744-3091 R&D Projects: GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 ; RVO:68378050 Keywords : single-chain antibody fragment * Thermofluor assay * differential scanning fluorimetry * crystallizability optimization * oligomerization * crystallization Subject RIV: CE - Biochemistry Impact factor: 0.527, year: 2014
Implementing Coordinative Contracts between Manufacturer and Retailer in a Reverse Supply Chain
Directory of Open Access Journals (Sweden)
Sung Wook Yoon
2016-09-01
Full Text Available There is an increasing need for company awareness of environmental problems and sustainable business practices. As a post-consumption activity, the reverse supply chain aims to extract value from products at the end of their lifecycle; it offers a means of pursuing sustainability through recycling, remanufacturing, refurbishing, and reusing. This study develops a series of procedures for implementing contracts between manufacturers and retailers to maximize individual profits and total profits through the reverse supply chain. To analyze the effects of the decision strategies made by parties acting on non-coordinative (decentralized and coordinative contracts, we model a two-echelon reverse supply chain environment using a system dynamics approach. In this study, we examine three cooperative contracts with differing shares of cost and profit between the two parties. Each contract is analyzed according to the following three contract processes. First, the manufacturer proposes a set of contracts that can be considered by the retailer. Second, the retailer evaluates the proposed contracts and chooses the one that is expected to maximize profits. Finally, the retailer and manufacturer adjust the parameters of the best contract to achieve the mutual goal of the supply chain. Using the experimental results, we discuss the best coordinative strategy between manufacturer and retailer for maximizing profits in the reverse supply chain.
Kongar, N. Elif
2004-12-01
Today, since customers are able to obtain similar-quality products for similar prices, the lead time has become the only preference criterion for most of the consumers. Therefore, it is crucial that the lead time, i.e., the time spent from the raw material phase till the manufactured good reaches the customer, is minimized. This issue can be investigated under the title of Supply Chain Management (SCM). An efficiently managed supply chain can lead to reduced response time for customers. To achieve this, continuous observation of supply chain efficiency, i.e., a constant performance evaluation of the current SCM is required. Widely used conventional performance measurement methods lack the ability to evaluate a SCM since the supply chain is a dynamic system that requires a more thorough and flexible performance measurement technique. Balanced Scorecard (BS) is an efficient tool for measuring the performance of dynamic systems and has a proven capability of providing the decision makers with the appropriate feedback data. In addition to SCM, a relatively new management field, namely reverse supply chain management (RSCM), also necessitates an appropriate evaluation approach. RSCM differs from SCM in many aspects, i.e., the criteria used for evaluation, the high level of uncertainty involved etc., not allowing the usage of identical evaluation techniques used for SCM. This study proposes a generic Balanced Scorecard to measure the performance of supply chain management while defining the appropriate performance measures for SCM. A scorecard prototype, ESCAPE, is presented to demonstrate the evaluation process.
Profits in reverse? An examination of the decisive factors for reverse supply chain profitability
DEFF Research Database (Denmark)
Larsen, Samuel; Jacobsen, Peter
2015-01-01
Although the concept of the reverse supply chain (RSC) is not unknown in industry, an inhibitor for its successful use is low (or no) profitability. A research challenge is investigating ways to establish the RSC as a profit-creating center in the organization. This paper contributes...
Fairbanks, Benjamin D; Gunatillake, Pathiraja A; Meagher, Laurence
2015-08-30
RAFT- mediated polymerization, providing control over polymer length and architecture as well as facilitating post polymerization modification of end groups, has been applied to virtually every facet of biomedical materials research. RAFT polymers have seen particularly extensive use in drug delivery research. Facile generation of functional and telechelic polymers permits straightforward conjugation to many therapeutic compounds while synthesis of amphiphilic block copolymers via RAFT allows for the generation of self-assembled structures capable of carrying therapeutic payloads. With the large and growing body of literature employing RAFT polymers as drug delivery aids and vehicles, concern over the potential toxicity of RAFT derived polymers has been raised. While literature exploring this complication is relatively limited, the emerging consensus may be summed up in three parts: toxicity of polymers generated with dithiobenzoate RAFT agents is observed at high concentrations but not with polymers generated with trithiocarbonate RAFT agents; even for polymers generated with dithiobenzoate RAFT agents, most reported applications call for concentrations well below the toxicity threshold; and RAFT end-groups may be easily removed via any of a variety of techniques that leave the polymer with no intrinsic toxicity attributable to the mechanism of polymerization. The low toxicity of RAFT-derived polymers and the ability to remove end groups via straightforward and scalable processes make RAFT technology a valuable tool for practically any application in which a polymer of defined molecular weight and architecture is desired. Copyright © 2015. Published by Elsevier B.V.
An interlacing theorem for reversible Markov chains
International Nuclear Information System (INIS)
Grone, Robert; Salamon, Peter; Hoffmann, Karl Heinz
2008-01-01
Reversible Markov chains are an indispensable tool in the modeling of a vast class of physical, chemical, biological and statistical problems. Examples include the master equation descriptions of relaxing physical systems, stochastic optimization algorithms such as simulated annealing, chemical dynamics of protein folding and Markov chain Monte Carlo statistical estimation. Very often the large size of the state spaces requires the coarse graining or lumping of microstates into fewer mesoscopic states, and a question of utmost importance for the validity of the physical model is how the eigenvalues of the corresponding stochastic matrix change under this operation. In this paper we prove an interlacing theorem which gives explicit bounds on the eigenvalues of the lumped stochastic matrix. (fast track communication)
An interlacing theorem for reversible Markov chains
Energy Technology Data Exchange (ETDEWEB)
Grone, Robert; Salamon, Peter [Department of Mathematics and Statistics, San Diego State University, San Diego, CA 92182-7720 (United States); Hoffmann, Karl Heinz [Institut fuer Physik, Technische Universitaet Chemnitz, D-09107 Chemnitz (Germany)
2008-05-30
Reversible Markov chains are an indispensable tool in the modeling of a vast class of physical, chemical, biological and statistical problems. Examples include the master equation descriptions of relaxing physical systems, stochastic optimization algorithms such as simulated annealing, chemical dynamics of protein folding and Markov chain Monte Carlo statistical estimation. Very often the large size of the state spaces requires the coarse graining or lumping of microstates into fewer mesoscopic states, and a question of utmost importance for the validity of the physical model is how the eigenvalues of the corresponding stochastic matrix change under this operation. In this paper we prove an interlacing theorem which gives explicit bounds on the eigenvalues of the lumped stochastic matrix. (fast track communication)
Direct access to dithiobenzoate RAFT agent fragmentation rate coefficients by ESR spin-trapping.
Ranieri, Kayte; Delaittre, Guillaume; Barner-Kowollik, Christopher; Junkers, Thomas
2014-12-01
The β-scission rate coefficient of tert-butyl radicals fragmenting off the intermediate resulting from their addition to tert-butyl dithiobenzoate-a reversible addition-fragmentation chain transfer (RAFT) agent-is estimated via the recently introduced electron spin resonance (ESR)-trapping methodology as a function of temperature. The newly introduced ESR-trapping methodology is critically evaluated and found to be reliable. At 20 °C, a fragmentation rate coefficient of close to 0.042 s(-1) is observed, whereas the activation parameters for the fragmentation reaction-determined for the first time-read EA = 82 ± 13.3 kJ mol(-1) and A = (1.4 ± 0.25) × 10(13) s(-1) . The ESR spin-trapping methodology thus efficiently probes the stability of the RAFT adduct radical under conditions relevant for the pre-equilibrium of the RAFT process. It particularly indicates that stable RAFT adduct radicals are indeed formed in early stages of the RAFT poly-merization, at least when dithiobenzoates are employed as controlling agents as stipulated by the so-called slow fragmentation theory. By design of the methodology, the obtained fragmentation rate coefficients represent an upper limit. The ESR spin-trapping methodology is thus seen as a suitable tool for evaluating the fragmentation rate coefficients of a wide range of RAFT adduct radicals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
First-order reversal curves of single domain particles: diluted random assemblages and chains
Egli, R.
2009-04-01
Exact magnetic models can be used to calculate first-order reversal curves (FORC) of single domain (SD) particle assemblages, as shown by Newell [2005] for the case of isolated Stoner-Wohlfarth particles. After overcoming experimental difficulties, a FORC diagram sharing many similarities to Newell's model has been measured on a lake sediment sample (see A.P. Chen et al., "Quantification of magnetofossils using first-order reversal curves", EGU General Assembly 2009, Abstracts Vol. 11, EGU2009-10719). This sample contains abundant magnetofossils, as shown by coercivity analysis and electron microscopy, therefore suggesting that well dispersed, intact magnetosome chains are the main SD carriers. Subtle differences between the reversible and the irreversible contributions of the measured FORC distribution suggest that magnetosome chains might not be correctly described by the Stoner-Wohlfarth model. To better understand the hysteresis properties of such chains, a simple magnetic model has been implemented, taking dipole-dipole interactions between particles within the same chain into account. The model results depend on the magnetosome elongation, the number of magnetosomes in a chain, and the gap between them. If the chain axis is subparallel to the applied field, the magnetic moment reverses by a pseudo-fanning mode, which is replaced by a pseudo-coherent rotation mode at greater angles. These reversal modes are intrinsically different from coherent rotation assumed Stoner-Wohlfarth model, resulting in FORC diagrams with a smaller reversible component. On the other hand, isolated authigenic SD particles can precipitate in the sediment matrix, as it might occur for pedogenic magnetite. In this case, an assembly of randomly located particles provides a possible model for the resulting FORC diagram. If the concentration of the particles is small, each particle is affected by a random interaction field whose statistical distribution can be calculated from first
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
International Nuclear Information System (INIS)
Liu, Yang; Zhou, Huihao; Zhu, Juanjuan; Gao, Yongxiang; Niu, Liwen; Liu, Jing; Teng, Maikun
2009-01-01
An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P2 1 2 1 2 1
International Nuclear Information System (INIS)
Bauer, David S G; Mavropoulos, Phivos; Bluegel, Stefan; Lounis, Samir
2011-01-01
We analyse the spontaneous magnetization reversal of supported monatomic chains of finite length due to thermal fluctuations via atomistic spin-dynamics simulations. Our approach is based on the integration of the Landau-Lifshitz equation of motion of a classical spin Hamiltonian in the presence of stochastic forces. The associated magnetization lifetime is found to obey an Arrhenius law with an activation barrier equal to the domain wall energy in the chain. For chains longer than one domain wall width, the reversal is initiated by nucleation of a reversed magnetization domain primarily at the chain edge followed by a subsequent propagation of the domain wall to the other edge in a random-walk fashion. This results in a linear dependence of the lifetime on the chain length, if the magnetization correlation length is not exceeded. We studied chains of uniaxial and triaxial anisotropy and found that a triaxial anisotropy leads to a reduction of the magnetization lifetime due to a higher reversal attempt rate, even though the activation barrier is not changed.
Multi-criteria approach for strategic planning of reverse supply chain
Directory of Open Access Journals (Sweden)
Abdelkader Benzohra
2017-04-01
Full Text Available A reverse supply chain is viewed as a process from consumption point to recovery point and the management of domestic waste is considered as a specific and complex reverse supply chain. This important sector represents a high challenging problem for our cities, constrained by financial, social, health and environmental considerations. This paper proposes multicriteria decision aid to help choose an efficient domestic waste management strategy. In fact, Multicriteria decision making techniques are considered as a key option to solve this type of problems, giving a solution that represents a good compromise between different preferences. The adopted approach consists in outranking a set of candidate management plans using a method based on partial aggregation criteria. This model is applied on a real case study of an Algerian city and to validate the obtained results, a deep sensitivity analysis is carried out, giving the most appropriate plans.
Musi, Valeria; Spolaore, Barbara; Picotti, Paola; Zambonin, Marcello; De Filippis, Vincenzo; Fontana, Angelo
2004-05-25
Limited proteolysis of the 153-residue chain of horse apomyoglobin (apoMb) by thermolysin results in the selective cleavage of the peptide bond Pro88-Leu89. The N-terminal (residues 1-88) and C-terminal (residues 89-153) fragments of apoMb were isolated to homogeneity and their conformational and association properties investigated in detail. Far-UV circular dichroism (CD) measurements revealed that both fragments in isolation acquire a high content of helical secondary structure, while near-UV CD indicated the absence of tertiary structure. A 1:1 mixture of the fragments leads to a tight noncovalent protein complex (1-88/89-153, nicked apoMb), characterized by secondary and tertiary structures similar to those of intact apoMb. The apoMb complex binds heme in a nativelike manner, as given by CD measurements in the Soret region. Second-derivative absorption spectra in the 250-300 nm region provided evidence that the degree of exposure of Tyr residues in the nicked species is similar to that of the intact protein at neutral pH. Also, the microenvironment of Trp residues, located in positions 7 and 14 of the 153-residue chain of the protein, is similar in both protein species, as given by fluorescence emission data. Moreover, in analogy to intact apoMb, the nicked protein binds the hydrophobic dye 1-anilinonaphthalene-8-sulfonate (ANS). Taken together, our results indicate that the two proteolytic fragments 1-88 and 89-153 of apoMb adopt partly folded states characterized by sufficiently nativelike conformational features that promote their specific association and mutual stabilization into a nicked protein species much resembling in its structural features intact apoMb. It is suggested that the formation of a noncovalent complex upon fragment complementation can mimic the protein folding process of the entire protein chain, with the difference that the folding of the complementary fragments is an intermolecular process. In particular, this study emphasizes the
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
An implementation framework for additive manufacturing in supply chains
Directory of Open Access Journals (Sweden)
Raed Handal
2017-12-01
Full Text Available Additive manufacturing has become one of the most important technologies in the manufacturing field. Full implementation of additive manufacturing will change many well-known management practices in the production sector. However, theoretical development in the field of additive manufacturing with regard to its impact on supply chain management is rare. While additive manufacturing is believed to revolutionize and enhance traditional manufacturing, there is no comprehensive toolset developed in the manufacturing field to assess the impact of additive manufacturing and determine the best production method that suits the applied supply chain strategy. A significant portion of the existing supply chain methods and frameworks were adopted in this study to examine the implementation of additive manufacturing in supply chain management. The aim of this study is to develop a framework to explain when additive manufacturing impacts supply chain management efficiently.
Overview of coordination contracts within forward and reverse supply chains
DEFF Research Database (Denmark)
Govindan, Kannan; Popiuc, M.N.; Diabat, A.
2013-01-01
Contracts are comprehensive coordination mechanisms used in both theory and practice to coordinate various supply chain structures. By focusing on the coordination by contracts of the forward and reverse supply chains, the intention of this paper is to (1) present an overview of contracting...... literature and (2) suggest a classification of coordination contracts and contracting literature in the form of classification schemes. The criteria used for contract classification are transfer payment contractual incentives and inventory risk sharing. The classification schemes are based on the level...
Variable fragments of heavy chain antibodies (VHHs: a new magic bullet molecule of medicine?
Directory of Open Access Journals (Sweden)
Dorota Smolarek
2012-06-01
Full Text Available Serum of animals belonging to the Camelidae family (camels and llamas contains fully active antibodies that are naturally devoid of light chains. Variable domains derived from heavy chain antibodies (hcAb called VHHs or nanobodies™ can bind antigens as effectively as full-length antibodies and are easy to clone and express. Because of their potential, VHHs are being intensively studied as potential therapeutic, diagnostic and imaging tools. The paper reviews the molecular background of heavy chain antibodies and describes methods of obtaining recombinant fragments of heavy chain antibodies as well as their therapeutic, diagnostic and other applications.
Directory of Open Access Journals (Sweden)
Cui Shang-jin
2010-05-01
Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.
2010-01-01
A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759
Additive manufacturing technology in spare parts supply chain
DEFF Research Database (Denmark)
Li, Yao; Jia, Guozhu; Yang, Cheng
2017-01-01
Additive Manufacturing (AM) technology has the potential to significantly improve supply chain dynamics. The purpose of this paper is to investigate the impact of AM on spare parts supply chain. Three supply chain scenarios are investigated in this paper, namely conventional supply chain...
Directory of Open Access Journals (Sweden)
Tzu-An Chiang
2014-01-01
Full Text Available This study designed a cross-stage reverse logistics course for defective products so that damaged products generated in downstream partners can be directly returned to upstream partners throughout the stages of a supply chain for rework and maintenance. To solve this reverse supply chain design problem, an optimal cross-stage reverse logistics mathematical model was developed. In addition, we developed a genetic algorithm (GA and three particle swarm optimization (PSO algorithms: the inertia weight method (PSOA_IWM, VMax method (PSOA_VMM, and constriction factor method (PSOA_CFM, which we employed to find solutions to support this mathematical model. Finally, a real case and five simulative cases with different scopes were used to compare the execution times, convergence times, and objective function values of the four algorithms used to validate the model proposed in this study. Regarding system execution time, the GA consumed more time than the other three PSOs did. Regarding objective function value, the GA, PSOA_IWM, and PSOA_CFM could obtain a lower convergence value than PSOA_VMM could. Finally, PSOA_IWM demonstrated a faster convergence speed than PSOA_VMM, PSOA_CFM, and the GA did.
Chiang, Tzu-An; Che, Z H; Cui, Zhihua
2014-01-01
This study designed a cross-stage reverse logistics course for defective products so that damaged products generated in downstream partners can be directly returned to upstream partners throughout the stages of a supply chain for rework and maintenance. To solve this reverse supply chain design problem, an optimal cross-stage reverse logistics mathematical model was developed. In addition, we developed a genetic algorithm (GA) and three particle swarm optimization (PSO) algorithms: the inertia weight method (PSOA_IWM), V(Max) method (PSOA_VMM), and constriction factor method (PSOA_CFM), which we employed to find solutions to support this mathematical model. Finally, a real case and five simulative cases with different scopes were used to compare the execution times, convergence times, and objective function values of the four algorithms used to validate the model proposed in this study. Regarding system execution time, the GA consumed more time than the other three PSOs did. Regarding objective function value, the GA, PSOA_IWM, and PSOA_CFM could obtain a lower convergence value than PSOA_VMM could. Finally, PSOA_IWM demonstrated a faster convergence speed than PSOA_VMM, PSOA_CFM, and the GA did.
Chiang, Tzu-An; Che, Z. H.
2014-01-01
This study designed a cross-stage reverse logistics course for defective products so that damaged products generated in downstream partners can be directly returned to upstream partners throughout the stages of a supply chain for rework and maintenance. To solve this reverse supply chain design problem, an optimal cross-stage reverse logistics mathematical model was developed. In addition, we developed a genetic algorithm (GA) and three particle swarm optimization (PSO) algorithms: the inertia weight method (PSOA_IWM), V Max method (PSOA_VMM), and constriction factor method (PSOA_CFM), which we employed to find solutions to support this mathematical model. Finally, a real case and five simulative cases with different scopes were used to compare the execution times, convergence times, and objective function values of the four algorithms used to validate the model proposed in this study. Regarding system execution time, the GA consumed more time than the other three PSOs did. Regarding objective function value, the GA, PSOA_IWM, and PSOA_CFM could obtain a lower convergence value than PSOA_VMM could. Finally, PSOA_IWM demonstrated a faster convergence speed than PSOA_VMM, PSOA_CFM, and the GA did. PMID:24772026
Impact of RFID Information-Sharing Coordination over a Supply Chain with Reverse Logistics
Nativi Nicolau, Juan Jose
2016-01-01
Companies have adopted environmental practices such as reverse logistics over the past few decades. However, studies show that aligning partners inside the green supply chain can be a substantial problem. This lack of coordination can increase overall supply chain cost. Information technology such as Radio Frequency Identification (RFID) has the…
Effects of RAFT Agent on the Selective Approach of Molecularly Imprinted Polymers
Asman, Saliza; Mohamad, Sharifah; Sarih, Norazilawati
2015-01-01
Two types of reversible addition-fragmentation chain transfer molecularly imprinted polymers (RAFT-MIPs) were synthesized using different monomers, which were methacrylic acid functionalized β-cyclodextrin (MAA-β-CD) and 2-hydroxyethyl methacrylate functionalized β-cyclodextrin (HEMA-β-CD), via reversible addition-fragmentation chain transfer (RAFT) polymerization, and were represented as RAFT-MIP(MAA-β-CD) and RAFT-MIP(HEMA-β-CD), respectively. Both RAFT-MIPs were systematically characterize...
Directory of Open Access Journals (Sweden)
Mahmoudi Hoda
2014-09-01
Full Text Available These instructions give you guidelines for preparing papers for IFAC conferences. A reverse supply chain is configured by a sequence of elements forming a continuous process to treat return-products until they are properly recovered or disposed. The activities in a reverse supply chain include collection, cleaning, disassembly, test and sorting, storage, transport, and recovery operations. This paper presents a mathematical programming model with the objective of minimizing the total costs of reverse supply chain including transportation, fixed opening, operation, maintenance and remanufacturing costs of centers. The proposed model considers the design of a multi-layer, multi-product reverse supply chain that consists of returning, disassembly, processing, recycling, remanufacturing, materials and distribution centers. This integer linear programming model is solved by using Lingo 9 software and the results are reported. Finally, a sensitivity analysis of the proposed model is also presented.
Oyarzún, Bernardo; Mognetti, Bortolo Matteo
2018-03-01
We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.
Diverse responses of species to landscape fragmentation in a simple food chain.
Liao, Jinbao; Bearup, Daniel; Blasius, Bernd
2017-09-01
Habitat destruction, characterized by habitat loss and fragmentation, is a key driver of species extinction in spatial extended communities. Recently, there has been some progress in the theory of spatial food webs, however to date practically little is known about how habitat configurational fragmentation influences multi-trophic food web dynamics. To explore how habitat fragmentation affects species persistence in food webs, we introduce a modelling framework that describes the site occupancy of species in a tri-trophic system. We assume that species dispersal range increases with trophic level, exploiting pair-approximation techniques to describe the effect of habitat clustering. In accordance with the trophic rank hypothesis, both habitat loss and fragmentation generally cause species extinction, with stronger effects occurring at higher trophic levels. However, species display diverse responses (negative, neutral or positive) to habitat loss and fragmentation separately, depending on their dispersal range and trophic position. Counter-intuitively, prey species may benefit from habitat loss due to a release in top-down control. Similarly, habitat fragmentation has almost no influence on the site occupancy of the intermediate consumer in the tri-trophic system, though it decreases those of both basal species and top predator. Consequently, species' responses to habitat destruction vary as other species become extinct. Our results reiterate the importance of the interplay between bottom-up and top-down control in trophically linked communities, and highlight the complex responses occurring in even a simple food chain. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.
Tunable, Quantitative Fenton-RAFT Polymerization via Metered Reagent Addition.
Nothling, Mitchell D; McKenzie, Thomas G; Reyhani, Amin; Qiao, Greg G
2018-05-10
A continuous supply of radical species is a key requirement for activating chain growth and accessing quantitative monomer conversions in reversible addition-fragmentation chain transfer (RAFT) polymerization. In Fenton-RAFT, activation is provided by hydroxyl radicals, whose indiscriminate reactivity and short-lived nature poses a challenge to accessing extended polymerization times and quantitative monomer conversions. Here, an alternative Fenton-RAFT procedure is presented, whereby radical generation can be finely controlled via metered dosing of a component of the Fenton redox reaction (H 2 O 2 ) using an external pumping system. By limiting the instantaneous flux of radicals and ensuring sustained radical generation over tunable time periods, metered reagent addition reduces unwanted radical "wasting" reactions and provides access to consistent quantitative monomer conversions with high chain-end fidelity. Fine tuning of radical concentration during polymerization is achieved simply via adjustment of reagent dose rate, offering significant potential for automation. This modular strategy holds promise for extending traditional RAFT initiation toward more tightly regulated radical concentration profiles and affords excellent prospects for the automation of Fenton-RAFT polymerization. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Reversal of local spins in transport of electrons through a one-dimensional chain
International Nuclear Information System (INIS)
Hu, D.-S.; Xiong, S.-J.
2003-01-01
We investigate the spin reversal of two coupled magnetic impurities in the transport processes of electrons in a one-dimensional chain. The impurities are side coupled to the chain and the electrons are injected and tunneling through it. The transmission coefficient of electrons and the polarization of impurities are calculated by the use of the equivalent single-particle network method for the correlated system. It is found that both the transmission coefficient and the polarization of impurities depend on the initial state of impurities and the impurity spins can be converted into the direction of electron spin if the injected electrons are polarized and the number of electrons is large enough. The evolution of the spin-reversal processes is studied in details
Integrated forward and reverse supply chain: A tire case study.
Pedram, Ali; Yusoff, Nukman Bin; Udoncy, Olugu Ezutah; Mahat, Abu Bakar; Pedram, Payam; Babalola, Ayo
2017-02-01
This paper attempts to integrate both a forward and reverse supply chain to design a closed-loop supply chain network (CLSC). The problem in the design of a CLSC network is uncertainty in demand, return products and the quality of return products. Scenario analyses are generated to overcome this uncertainty. In contrast to the existing supply chain network design models, a new application of a CLSC network was studied in this paper to reduce waste. A multi-product, multi-tier mixed integer linear model is developed for a CLSC network design. The main objective is to maximize profit and provide waste management decision support in order to minimize pollution. The result shows applicability of the model in the tire industry. The model determines the number and the locations of facilities and the material flows between these facilities. Copyright © 2016 Elsevier Ltd. All rights reserved.
Observation uncertainty in reversible Markov chains.
Metzner, Philipp; Weber, Marcus; Schütte, Christof
2010-09-01
In many applications one is interested in finding a simplified model which captures the essential dynamical behavior of a real life process. If the essential dynamics can be assumed to be (approximately) memoryless then a reasonable choice for a model is a Markov model whose parameters are estimated by means of Bayesian inference from an observed time series. We propose an efficient Monte Carlo Markov chain framework to assess the uncertainty of the Markov model and related observables. The derived Gibbs sampler allows for sampling distributions of transition matrices subject to reversibility and/or sparsity constraints. The performance of the suggested sampling scheme is demonstrated and discussed for a variety of model examples. The uncertainty analysis of functions of the Markov model under investigation is discussed in application to the identification of conformations of the trialanine molecule via Robust Perron Cluster Analysis (PCCA+) .
Collection effort and reverse channel choices in a closed-loop supply chain
DEFF Research Database (Denmark)
Govindan, Kannan; Liu, Liwen; Wang, Zongjun
2017-01-01
We investigate the pricing and reverse channel choice decision issues in a closed-loop supply chain, within which the original equipment manufacturer (OEM) sells the new and remanufactured products through a retailer, while collects used products (cores) via dual recycling channels. We consider...
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
A Food Chain Algorithm for Capacitated Vehicle Routing Problem with Recycling in Reverse Logistics
Song, Qiang; Gao, Xuexia; Santos, Emmanuel T.
2015-12-01
This paper introduces the capacitated vehicle routing problem with recycling in reverse logistics, and designs a food chain algorithm for it. Some illustrative examples are selected to conduct simulation and comparison. Numerical results show that the performance of the food chain algorithm is better than the genetic algorithm, particle swarm optimization as well as quantum evolutionary algorithm.
Maximum Entropy Estimation of Transition Probabilities of Reversible Markov Chains
Directory of Open Access Journals (Sweden)
Erik Van der Straeten
2009-11-01
Full Text Available In this paper, we develop a general theory for the estimation of the transition probabilities of reversible Markov chains using the maximum entropy principle. A broad range of physical models can be studied within this approach. We use one-dimensional classical spin systems to illustrate the theoretical ideas. The examples studied in this paper are: the Ising model, the Potts model and the Blume-Emery-Griffiths model.
Dalton, George D; Smith, Forrest L; Smith, Paul A; Dewey, William L
2005-04-01
Two peptide fragments of native Protein Kinase A inhibitor (PKI), PKI-(6-22)-amide and PKI-(Myr-14-22)-amide, significantly reversed low-level morphine antinociceptive tolerance in mice. The inhibition of Protein Kinase A (PKA) activity by both peptide fragments was then measured in specific brain regions (thalamus, periaqueductal gray (PAG), and medulla) and in lumbar spinal cord (LSC), which in previous studies have been shown to play a role in morphine-induced analgesia. In drug naive animals, cytosolic PKA activity was greater than particulate PKA activity in each region, while cytosolic and particulate PKA activities were greater in thalamus and PAG compared to medulla and LSC. The addition of both peptides to homogenates from each region completely abolished cytosolic and particulate PKA activities in vitro. Following injection into the lateral ventricle of the brain of drug naive mice and morphine-tolerant mice, both peptides inhibited PKA activity in the cytosolic, but not the particulate fraction of LSC. In addition, cytosolic and particulate PKA activities were inhibited by both peptides in thalamus. These results demonstrate that the inhibition of PKA reverses morphine tolerance. Moreover, the inhibition of PKA activity in specific brain regions and LSC from morphine-tolerant mice by PKI analogs administered i.c.v. is evidence that PKA plays a role in morphine tolerance.
Directory of Open Access Journals (Sweden)
Barth Stefan
2005-01-01
Full Text Available Abstract Background Common oral diseases and dental caries can be prevented effectively by passive immunization. In humans, passive immunotherapy may require the use of humanized or human antibodies to prevent adverse immune responses against murine epitopes. Therefore we generated human single chain and diabody antibody derivatives based on the binding characteristics of the murine monoclonal antibody Guy's 13. The murine form of this antibody has been used successfully to prevent Streptococcus mutans colonization and the development of dental caries in non-human primates, and to prevent bacterial colonization in human clinical trials. Results The antibody derivatives were generated using a chain-shuffling approach based on human antibody variable gene phage-display libraries. Like the parent antibody, these derivatives bound specifically to SAI/II, the surface adhesin of the oral pathogen S. mutans. Conclusions Humanization of murine antibodies can be easily achieved using phage display libraries. The human antibody fragments bind the antigen as well as the causative agent of dental caries. In addition the human diabody derivative is capable of aggregating S. mutans in vitro, making it a useful candidate passive immunotherapeutic agent for oral diseases.
DEFF Research Database (Denmark)
Larsen, Samuel Brüning; Masi, Donato; Jacobsen, Peter
2017-01-01
The ongoing transition to a Circular Economy is changing the shape of Supply Chains. They are becoming more ‘Closed-Loop’, combining forward and reverse flows of products and materials. Reverse Supply Chains (RSCs), originally considered as a solution for handling waste or recovering residual value...... seven case studies, focusing on original equipment manufacturers (OEMs), show how the RSC can play a strategic, tactical, or operational role for the firm. The paper applies for the first time the concept of strategic alignment to the RSC and practitioners can use the proposed framework to analyse...
Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min
2012-07-15
Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.
Process chain modeling and selection in an additive manufacturing context
DEFF Research Database (Denmark)
Thompson, Mary Kathryn; Stolfi, Alessandro; Mischkot, Michael
2016-01-01
This paper introduces a new two-dimensional approach to modeling manufacturing process chains. This approach is used to consider the role of additive manufacturing technologies in process chains for a part with micro scale features and no internal geometry. It is shown that additive manufacturing...... evolving fields like additive manufacturing....
Reverse logistics in the construction industry.
Hosseini, M Reza; Rameezdeen, Raufdeen; Chileshe, Nicholas; Lehmann, Steffen
2015-06-01
Reverse logistics in construction refers to the movement of products and materials from salvaged buildings to a new construction site. While there is a plethora of studies looking at various aspects of the reverse logistics chain, there is no systematic review of literature on this important subject as applied to the construction industry. Therefore, the objective of this study is to integrate the fragmented body of knowledge on reverse logistics in construction, with the aim of promoting the concept among industry stakeholders and the wider construction community. Through a qualitative meta-analysis, the study synthesises the findings of previous studies and presents some actions needed by industry stakeholders to promote this concept within the real-life context. First, the trend of research and terminology related with reverse logistics is introduced. Second, it unearths the main advantages and barriers of reverse logistics in construction while providing some suggestions to harness the advantages and mitigate these barriers. Finally, it provides a future research direction based on the review. © The Author(s) 2015.
National Research Council Canada - National Science Library
McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L
2005-01-01
...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...
Managing Reverse Logistics or Reversing Logistics Management?
Brito, Marisa
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...
Pochampally, Kishore K.; Gupta, Surendra M.; Kamarthi, Sagar V.
2004-02-01
Although there are many quantitative models in the literature to design a reverse supply chain, every model assumes that all the recovery facilities that are engaged in the supply chain have enough potential to efficiently re-process the incoming used products. Motivated by the risk of re-processing used products in facilities of insufficient potentiality, this paper proposes a method to identify potential facilities in a set of candidate recovery facilities operating in a region where a reverse supply chain is to be established. In this paper, the problem is solved using a newly developed method called physical programming. The most significant advantage of using physical programming is that it allows a decision maker to express his preferences for values of criteria (for comparing the alternatives), not in the traditional form of weights but in terms of ranges of different degrees of desirability, such as ideal range, desirable range, highly desirable range, undesirable range, and unacceptable range. A numerical example is considered to illustrate the proposed method.
Directory of Open Access Journals (Sweden)
Raden Wasito
2015-05-01
Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.
Impact of additive manufacturing on aircraft supply chain performance
DEFF Research Database (Denmark)
Ghadge, Abhijeet; Karantoni, Georgia; Chaudhuri, Atanu
2018-01-01
Purpose – The purpose of this paper is to assess the impact of additive manufacturing (AM) implementation on aircraft supply chain (SC) networks. Additive and conventional manufacturing spare part inventory control systems are studied and compared, revealing insights into SC performance. Design....... Originality/value – The study provides robust evidence for making critical managerial decisions on SC re-design driven by a new and disruptive technology. Next-generation SC and logistics will replace the current demand for fulfilling material products by AM machines. Keywords Performance measurement......, Simulation, Additive manufacturing, Supply chains, Aerospace industry...
Reversed double PCL sign: unusual location of a meniscal fragment of the knee observed by MR imaging
Energy Technology Data Exchange (ETDEWEB)
Niitsu, M.; Itai, Y. [Dept. of Radiology, Inst. of Clinical Medicine, Univ. of Tsukuba, Ibaraki (Japan); Ikeda, K. [Inst. of Clinical Medicine, Univ. of Tsukuba, Ibaraki (Japan)
2003-12-01
A 36-year-old woman with tears of the anterior cruciate ligament and medial meniscus received a meniscectomy. The MR images obtained prior to the partial meniscectomy showed a bucket-handle meniscal tear with centrally displaced fragment lying anterior to the posterior cruciate ligament (PCL), representing a ''double PCL sign''; however, after the meniscectomy, MR images demonstrated a fragment in the space posterior to the PCL where no structure is generally recognized except for the ligament of wrisberg. This article reports a ''reversed'' double PCL sign, caused by inadequate surgical clearance of a bucket-handle tear of the medial meniscus. (orig.)
Proton-Fueled, Reversible DNA Hybridization Chain Assembly for pH Sensing and Imaging.
Liu, Lan; Liu, Jin-Wen; Huang, Zhi-Mei; Wu, Han; Li, Na; Tang, Li-Juan; Jiang, Jian-Hui
2017-07-05
Design of DNA self-assembly with reversible responsiveness to external stimuli is of great interest for diverse applications. We for the first time develop a pH-responsive, fully reversible hybridization chain reaction (HCR) assembly that allows sensitive sensing and imaging of pH in living cells. Our design relies on the triplex forming sequences that form DNA triplex with toehold regions under acidic conditions and then induce a cascade of strand displacement and DNA assembly. The HCR assembly has shown dynamic responses in physiological pH ranges with excellent reversibility and demonstrated the potential for in vitro detection and live-cell imaging of pH. Moreover, this method affords HCR assemblies with highly localized fluorescence responses, offering advantages of improving sensitivity and better selectivity. The proton-fueled, reversible HCR assembly may provide a useful approach for pH-related cell biology study and disease diagnostics.
Sridevi, N. V.; Shukra, A. M.; Neelakantam, B.; Anilkumar, J.; Madhanmohan, M.; Rajan, S.; Dev Chandran
2014-01-01
Recombinant antibody fragments like single chain variable fragments (scFvs) represent an attractive yet powerful alternative to immunoglobulins and hold great potential in the development of clinical diagnostic/therapeutic reagents. Structurally, scFvs are the smallest antibody fragments capable of retaining the antigen-binding capacity of whole antibodies and are composed of an immunoglobulin (Ig) variable light (VL) and variable heavy (VH) chain joined by a flexible polypeptide linker. In the present study, we constructed a scFv against bovine IgA from a hybridoma cell line IL-A71 that secretes a monoclonal antibody against bovine IgA using recombinant DNA technology. The scFv was expressed in Escherichia coli and purified using immobilized metal affinity chromatography (IMAC). The binding activity and specificity of the scFv was established by its non-reactivity toward other classes of immunoglobulins as determined by enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis. Kinetic measurement of the scFv indicated that the recombinant antibody fragment had an affinity in picomolar range toward purified IgA. Furthermore, the scFv was used to develop a sensitive ELISA for the detection of foot and mouth disease virus (FMDV) carrier animals. PMID:24678404
Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda
2016-01-01
Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.
Managing Reverse Logistics or Reversing Logistics Management?
M.P. de Brito (Marisa)
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse
Promoting chain elongation in mixed culture acidification reactors by addition of ethanol
International Nuclear Information System (INIS)
Grootscholten, T.I.M.; Kinsky dal Borgo, F.; Hamelers, H.V.M.; Buisman, C.J.N.
2013-01-01
In this research we investigate a microbial production process to produce medium chain fatty acids (MCFAs) based on the organic fraction of municipal solid waste (OFMSW). In this microbial production process, called chain elongation, bacteria produce medium chain fatty acids (MCFAs) from ethanol and volatile fatty acids (VFAs). MCFAs could be used as new biomass based building blocks for the chemical and fuel industry. The objective of this article is to investigate whether chain elongation can be promoted during acidification of OFMSW by addition of ethanol. The results show that chain elongation can be promoted during acidification of OFMSW by addition of ethanol. However, the hydrolysis rate and the carboxylic acid yield of the OFMSW in reactors with ethanol additions were lower than the hydrolysis rate and the carboxylic acid yield than in reactors without ethanol additions. Further research is required to determine whether a combined chain elongation and acidification reactor or a separated reactor system is more advantageous for MCFA production from OFMSW. -- Highlights: ► Production of medium chain fatty acids from municipal solid waste and ethanol. ► Insight in production of caproate and consumption of in-situ produced ethanol. ► Ethanol additions reduced propionate, butyrate and valerate concentrations. ► Ethanol additions hardly reduced acetate concentrations. ► Hydrolysis rate was lower in experiments with ethanol additions
Kubota, Kei; Kobayashi, Naoki; Yabuta, Masayuki; Ohara, Motomu; Naito, Toyohiro; Kubo, Takuya; Otsuka, Koji
2017-06-05
This report describes a novel, comprehensive approach to identifying a fragment peak of monoclonal antibody-A (mAb-A), detected by sodium dodecyl sulfate-capillary gel electrophoresis (SDS-cGE). The fragment migrated close to the internal standard (10kDa marker) of SDS-cGE and increased about 0.5% under a 25°C condition for 6 months. Generally, identification of fragments observed in SDS-cGE is challenging to carry out due to the difficulty of collecting analytical amounts of fractionations from the capillary. In this study, in-gel digestion peptide mapping and reversed phase liquid chromatography-mass spectrometry (RPLC-MS) were employed to elucidate the structure of the fragment. In addition, a Gelfree 8100 fractionation system was newly introduced to collect the fragment and the fraction was applied to the structural analysis of a mAb for the first time. These three analytical methods showed comparable results, proving that the fragment was a fraction of heavy chain HC1-104. The fragment contained complementarity determining regions (CDRs), which are significant to antigen binding, and thus would affect the efficacy of mAb-A. In addition, SDS-cGE without the 10kDa marker was demonstrated to clarify the increased amount of the fragment, and the experiment revealed that the fragment increases 0.2% per year in storage at 5°C. The combination of the three analytical methodologies successfully identified the impurity peak detected by SDS-cGE, providing information critical to assuring the quality and stability of the biotherapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.
Core Stability in Chain-Component Additive Games
van Velzen, S.; Hamers, H.J.M.; Solymosi, T.
2004-01-01
Chain-component additive games are graph-restricted superadditive games, where an exogenously given line-graph determines the cooperative possibilities of the players.These games can model various multi-agent decision situations, such as strictly hierarchical organisations or sequencing / scheduling
Directory of Open Access Journals (Sweden)
Oliinyk O. S.
2014-02-01
Full Text Available Diphtheria toxin is an exoantigen of Corynebacterium diphtheriae that inhibits protein synthesis and kills sensitive cells. The aim of this study was to obtain human recombinant single-chain variable fragment (scFv antibodies against receptor-binding B subunit of diphtheria toxin. 12 specific clones were selected after three rounds of a phage display naїve (unimmunized human antibody library against recombinant B-subunit. scFv DNA inserts from these 12 clones were digested with MvaI, and 6 unique restriction patterns were found. Single-chain antibodies were expressed in Escherichia coli XL1-blue. The recombinant proteins were characterized by immunoblotting of bacterial extracts and detection with an anti-E-tag antibody. The toxin B-subunit-binding function of the single-chain antibody was shown by ELISA. The affinity constants for different clones were found to be from 106 to 108 М–1. Due to the fact, that these antibody fragments recognized epitopes in the receptor-binding Bsubunit of diphtheria toxin, further studies are interesting to evaluate their toxin neutralization properties and potential for therapeutic applications. Obtained scFv-antibodies can also be used for detection and investigation of biological properties of diphtheria toxin.
2013-01-01
The concepts of Quality Management (QM) have been used for a long time by manufacturing companies to ensure customers receive a constant and high quality level of products. But what happens with remanufactured or refurbished products? Quality Management in Reverse Logistics: A Broad Look on Quality Issues and Their Interaction with Closed-Loop Supply Chains discusses the new, promising area of QM and Reverse Logistics interaction. More specifically, it examines and evaluates a number of QM tools and techniques, which can be applied in practice in order to understand, review and improve any closed-loop supply chain process. Modeling and quantitative methods that can be used by students, practitioners and academics in the Reverse Logistics industry are described. The readers will broaden their scope of thinking in the area of Reverse Logistics, where Quality Management can be applied.
Paonessa, Jessica E; Williams, James C; Lingeman, James E
2018-04-01
We hypothesized that adding sodium bicarbonate (bicarb) to normal saline (NS) irrigation during ureteroscopy in patients with uric acid (UA) nephrolithiasis may assist in dissolving small stone fragments produced during laser lithotripsy. In vitro testing was performed to determine whether dissolution of UA fragments could be accomplished within 1 hour. In total 100% UA renal calculi were fragmented, filtered, and separated by size. Fragment sizes were <0.5 mm and 0.5 to 1 mm. Similar amounts of stone material were agitated in solution at room temperature. Four solutions were tested (NS, NS +1 ampule bicarb/L, NS +2, NS +3). Both groups were filtered to remove solutions after fixed periods. Filtered specimens were dried and weighed. Fragment dissolution rates were calculated as percent removed per hour. Additional testing was performed to determine whether increasing the temperature of solution affected dissolution rates. For fragments <0.5 mm, adding 2 or 3 bicarb ampules/L NS produced a dissolution rate averaging 91% ± 29% per hour. This rate averaged 226% faster than NS alone. With fragments 0.5 to 1 mm, addition of 2 or 3 bicarb ampules/L NS yielded a dissolution rate averaging 22% ± 7% per hour, which was nearly five times higher than NS alone. There was a trend for an increase in mean dissolution rate with higher temperature but this increase was not significant (p = 0.30). The addition of bicarbonate to NS more than doubles the dissolution rate of UA stone fragments and fragments less than 0.5 mm can be completely dissolved within 1 hour. Addition of bicarb to NS irrigation is a simple and inexpensive approach that may assist in the dissolution of UA fragments produced during ureteroscopic laser lithotripsy. Further studies are needed to determine whether a clinical benefit exists.
Energy Technology Data Exchange (ETDEWEB)
Mimouni, F.; Abouabdellah, A.
2016-07-01
Propose a modeling and analysis methodology based on the combination of Bayesian networks and Petri networks of the reverse logistics integrated the direct supply chain. Network modeling by combining Petri and Bayesian network. Modeling with Bayesian network complimented with Petri network to break the cycle problem in the Bayesian network. Demands are independent from returns. Model can only be used on nonperishable products. Legislation aspects: Recycling laws; Protection of environment; Client satisfaction via after sale service. Bayesian network with a cycle combined with the Petri Network. (Author)
Global Reverse Supply Chain Redesign for Household Plastic Waste under the Emission Trading Scheme
Bing, X.; Bloemhof-Ruwaard, J.M.; Chabaane, A.; Vorst, van der J.G.A.J.
2015-01-01
With increasing global resource scarcity, waste becomes a resource that can be managed globally. A reverse supply chain network for waste recycling needs to process all the waste with minimum costs and environmental impact. As re-processing of waste is one of the major sources of pollution in the
International Nuclear Information System (INIS)
Karlish, S.J.D.; Goldshleger, R.; Stein, W.D.
1990-01-01
Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the α chain, a largely intact β chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the α chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein
Energy Technology Data Exchange (ETDEWEB)
Karlish, S.J.D.; Goldshleger, R. (Weizmann Institute of Science, Rehovot (Israel)); Stein, W.D. (Hebrew Univ. Jerusalem (Israel))
1990-06-01
Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the {alpha} chain, a largely intact {beta} chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the {alpha} chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein.
Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Chen Yiwang; Chen Lie; Nie Huarong; Kang, E.T.; Vora, R.H.
2005-01-01
Graft polymerization of poly(ethylene glycol) methyl ether methacrylate (PEGMA) from fluorinated polyimide (FPI) was carried out by the reversible addition-fragmentation chain transfer (RAFT)-mediated process. The peroxides generated by the ozone treatment on FPI facilitated the thermally-initiated graft copolymerization from FPI backbone. The 'living' character of the graft chain growing was ascertained in the subsequent chain extension of PEGMA. Nuclear magnetic resonance (NMR) and molecular weight measurements were used to characterize the chemical composition and structure of the copolymers. Microfiltration (MF) membranes were fabricated from the FPI-g-PEGMA comb copolymers by phase inversion in aqueous media. Surface composition analysis of the membranes scanned by X-ray photoelectron spectroscopy (XPS) revealed a substantial surface enrichment of the hydrophilic components. The pore size distribution of the resulting membranes was found to be much more uniform than that of the corresponding membranes cast from FPI-g-PEGMA prepared by the conventional radical polymerization process in the absence of the chain transfer agent. The morphology of the membranes was characterized by scanning electron microscopy (SEM)
Wang, Jen-Chieh; Zhou, Yufeng
2017-03-01
Extracorporeal shock wave lithotripsy (ESWL) has been used widely in the noninvasive treatment of kidney calculi. The fine fragments less than 2 mm in size can be discharged by urination, which determines the success of ESWL. Although ultrasonic and fluorescent imaging are used to localize the calculi, it's challenging to monitor the stone comminution progress, especially at the late stage of ESWL when fragments spread out as a cloud. The lack of real-time and quantitative evaluation makes this procedure semi-blind, resulting in either under- or over-treatment after the legal number of pulses required by FDA. The time reversal operator (TRO) method has the ability to detect point-like scatterers, and the number of non-zero eigenvalues of TRO is equal to that of the scatterers. In this study, the validation of TRO method to identify stones was illustrated from both numerical and experimental results for one to two stones with various sizes and locations. Furthermore, the parameters affecting the performance of TRO method has also been investigated. Overall, TRO method is effective in identifying the fragments in a stone cluster in real-time. Further development of a detection system and evaluation of its performance both in vitro and in vivo during ESWL is necessary for application.
Highly conductive side chain block copolymer anion exchange membranes.
Wang, Lizhu; Hickner, Michael A
2016-06-28
Block copolymers based on poly(styrene) having pendent trimethyl styrenylbutyl ammonium (with four carbon ring-ionic group alkyl linkers) or benzyltrimethyl ammonium groups with a methylene bridge between the ring and ionic group were synthesized by reversible addition-fragmentation radical (RAFT) polymerization as anion exchange membranes (AEMs). The C4 side chain polymer showed a 17% increase in Cl(-) conductivity of 33.7 mS cm(-1) compared to the benzyltrimethyl ammonium sample (28.9 mS cm(-1)) under the same conditions (IEC = 3.20 meq. g(-1), hydration number, λ = ∼7.0, cast from DMF/1-propanol (v/v = 3 : 1), relative humidity = 95%). As confirmed by small angle X-ray scattering (SAXS), the side chain block copolymers with tethered ammonium cations showed well-defined lamellar morphologies and a significant reduction in interdomain spacing compared to benzyltrimethyl ammonium containing block copolymers. The chemical stabilities of the block copolymers were evaluated under severe, accelerated conditions, and degradation was observed by (1)H NMR. The block copolymer with C4 side chain trimethyl styrenylbutyl ammonium motifs displayed slightly improved stability compared to that of a benzyltrimethyl ammonium-based AEM at 80 °C in 1 M NaOD aqueous solution for 30 days.
Diseno macromolecular par transferencia de cadena
Heuts, J.P.A.; Munoz Bonilla, A.
2010-01-01
In this overview article, a brief description and discussion is given about the controlled radical techniques which are based on chain transfer, i.e., Catalytic Chain Transfer (CCT) and Reversible Addition-Fragmentation chain Transfer (RAFT). The CCT is an incredibly efficient method for making
The profit potential in reverse supply chain functions for catalyst manufacturers
DEFF Research Database (Denmark)
Larsen, Samuel; Sorth-Olsen, Rasmus; Honoré, Aske Lykke
The reverse supply chain (RSC) contains inherent uncertainties, e.g. the quality level and return volume of used products. By contrast, the catalyst manufacturing industry is characterized by Certainty (manifested in e.g. well-defined and highly controlled production – processes and widespread...... standardization). This paper’s purpose is to examine whether RSC – processes can be profitably applied in this industry. Using case study research the paper examines which RSC - functions that are generally available to manufacturers are profitable for a selected catalyst manufacturer. Results show three...
Directory of Open Access Journals (Sweden)
Faycal Mimouni
2016-04-01
Full Text Available Purpose: Propose a modeling and analysis methodology based on the combination of Bayesian networks and Petri networks of the reverse logistics integrated the direct supply chain. Design/methodology/approach: Network modeling by combining Petri and Bayesian network. Findings: Modeling with Bayesian network complimented with Petri network to break the cycle problem in the Bayesian network. Research limitations/implications: Demands are independent from returns. Practical implications: Model can only be used on nonperishable products. Social implications: Legislation aspects: Recycling laws; Protection of environment; Client satisfaction via after sale service. Originality/value: Bayesian network with a cycle combined with the Petri Network.
Directory of Open Access Journals (Sweden)
Zunya Shi
2016-01-01
Full Text Available The importance of remanufacturing has been recognized in research and practice. The integrated system, combining the forward and reverse activities of supply chains, is called closed-loop supply chain (CLSC system. By coordination in the CLSC system, players will get economic improvement. This paper studies different coordination performances of two types of contracts, two-part tariff (TTC and reverse revenue sharing contract (RRSC, in a closed-loop system. Through mathematical analysis based on Stackelberg Game Theory, we find that it is easy for manufacturer to improve more profits and retailer’s collection effects by adjusting the ratio of transfer collection price through RRSC, and we also give the function to calculate the best ratio of transfer collection price, which may be a valuable reference for the decision maker in practice. Besides, our results also suggest that although the profits of the coordinated CLSC system are always higher than the contradictory scenario, the RRSC is more favorable to the manufacturer than to the retailer, as results show that the manufacturer will share more profits from the system through RRSC. Therefore, RRSC has attracted the manufacturers more to closing the supply chain for economic consideration.
Neutralisation and binding of VHS virus by monovalent antibody fragments
DEFF Research Database (Denmark)
Cupit, P.M.; Lorenzen, Niels; Strachan, G.
2001-01-01
We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Xu, Zhitao; Elomri, Adel; Pokharel, Shaligram; Zhang, Qin; Ming, X G; Liu, Wenjie
2017-06-01
The emergence of concerns over environmental protection, resource conservation as well as the development of logistics operations and manufacturing technology has led several countries to implement formal collection and recycling systems of solid waste. Such recycling system has the benefits of reducing environmental pollution, boosting the economy by creating new jobs, and generating income from trading the recyclable materials. This leads to the formation of a global reverse supply chain (GRSC) of solid waste. In this paper, we investigate the design of such a GRSC with a special emphasis on three aspects; (1) uncertainty of waste collection levels, (2) associated carbon emissions, and (3) challenges posed by the supply chain's global aspect, particularly the maritime transportation costs and currency exchange rates. To the best of our knowledge, this paper is the first attempt to integrate the three above-mentioned important aspects in the design of a GRSC. We have used mixed integer-linear programming method along with robust optimization to develop the model which is validated using a sample case study of e-waste management. Our results show that using a robust model by taking the complex interactions characterizing global reverse supply chain networks into account, we can create a better GRSC. The effect of uncertainties and carbon constraints on decisions to reduce costs and emissions are also shown. Copyright © 2017 Elsevier Ltd. All rights reserved.
Analysis on the cost structure of product recall for reverse supply chain
Yanhua, Feng; Xuhui, Xia; Zheng, Yang
2017-12-01
The research on the reverse supply chain of product recall mainly focused on the recall network structure, logistics mode and so on. In this paper, when product recall and supply channel are fixed, the specific structure and function expression of cost are analyzed according to the peak season and off-season of recall activities, and whether the assembly manufacturer, supplier and recyclers are cooperated situation, respectively, to build the total cost structure of the function model. Finally, the model is validated correctly through the automotive industry and the electromechanical industry.
Okazaki, Fumiyoshi; Aoki, Jun-ichi; Tabuchi, Soichiro; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko
2012-10-01
We have constructed a filamentous fungus Aspergillus oryzae that secretes a llama variable heavy-chain antibody fragment (V(HH)) that binds specifically to epidermal growth factor receptor (EGFR) in a culture medium. A major improvement in yield was achieved by fusing the V(HH) with a Taka-amylase A signal sequence (sTAA) and a segment of 28 amino acids from the N-terminal region of Rhizopus oryzae lipase (N28). The yields of secreted, immunologically active anti-EGFR V(HH) reached 73.8 mg/1 in a Sakaguchi flask. The V(HH) fragments were released from the sTAA or N28 proteins by an indigenous A. oryzae protease during cultivation. The purified recombinant V(HH) fragment was specifically recognized and could bind to the EGFR with a high affinity.
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
Barbara, D J; Morton, A; Spence, N J; Miller, A
1995-09-01
Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.
Hisada, Hiromoto; Tsutsumi, Hiroko; Ishida, Hiroki; Hata, Yoji
2013-01-01
Llama variable heavy-chain antibody fragment (VHH) fused to four different reader proteins was produced and secreted in culture medium by Aspergillus oryzae. These fusion proteins consisted of N-terminal reader proteins, VHH, and a C-terminal his-tag sequence which facilitated purification using one-step his-tag affinity chromatography. SDS-PAGE analysis of the deglycosylated purified fusion proteins confirmed that the molecular weight of each corresponded to the expected sum of VHH and the respective reader proteins. The apparent high molecular weight reader protein glucoamylase (GlaB) was found to be suitable for efficient VHH production. The GlaB-VHH-His protein bound its antigen, human chorionic gonadotropin, and was detectable by a new ELISA-based method using a coupled assay with glucoamylase, glucose oxidase, peroxidase, maltose, and 3,3',5,5'-tetramethylbenzidine as substrates. Addition of potassium phosphate to the culture medium induced secretion of 0.61 mg GlaB-VHH-His protein/ml culture medium in 5 days.
Wang, Shuhong; Song, Malin
2017-10-01
As a newly appeared trade mode in recent years, reverse outsourcing has made a great impact on traditional trade modes. This paper researched the influences of reverse outsourcing on green technological progress from the perspective of a global supply chain by using micro-data of enterprises. It worked out the rate of green technological progress from two innovative concepts: potential production technology and practical production technology. The empirical analysis results indicated that reverse outsourcing stimulates, and enterprise size and ownership type potentially affects, green technological progress. State-owned or foreign enterprises with high income levels would pay more attention to environmental protection, energy saving, and emission reduction, while small and micro enterprises with low incomes would choose to ignore environmental protection. Copyright © 2017 Elsevier B.V. All rights reserved.
Multi-criteria analysis of potential recovery facilities in a reverse supply chain
Nukala, Satish; Gupta, Surendra M.
2005-11-01
Analytic Hierarchy Process (AHP) has been employed by researchers for solving multi-criteria analysis problems. However, AHP is often criticized for its unbalanced scale of judgments and failure to precisely handle the inherent uncertainty and vagueness in carrying out the pair-wise comparisons. With an objective to address these drawbacks, in this paper, we employ a fuzzy approach in selecting potential recovery facilities in the strategic planning of a reverse supply chain network that addresses the decision maker's level of confidence in the fuzzy assessments and his/her attitude towards risk. A numerical example is considered to illustrate the methodology.
Determining the total cost of reverse supply chain operations for original equipment manufacturers
DEFF Research Database (Denmark)
Larsen, Samuel Brüning; Jacobsen, Peter
2014-01-01
When original equipment manufacturers (OEM) examine whether or not to invest in a reverse supply chain (RSC), managers need insight into not only the cost savings and new revenue streams the RSC enables, but also the total cost of the RSC itself. Using case study research the study examines what...... cost parameters constitute the total cost (TC) of the RSC. The specific RSC that the study seeks the TC for consists of 1) end-product refurbishing, 2) component refurbishing, and 3) sales of used materials back to original suppliers or independent recyclers for materials recycling....
Completion of autobuilt protein models using a database of protein fragments
International Nuclear Information System (INIS)
Cowtan, Kevin
2012-01-01
Two developments in the process of automated protein model building in the Buccaneer software are described: the use of a database of protein fragments in improving the model completeness and the assembly of disconnected chain fragments into complete molecules. Two developments in the process of automated protein model building in the Buccaneer software are presented. A general-purpose library for protein fragments of arbitrary size is described, with a highly optimized search method allowing the use of a larger database than in previous work. The problem of assembling an autobuilt model into complete chains is discussed. This involves the assembly of disconnected chain fragments into complete molecules and the use of the database of protein fragments in improving the model completeness. Assembly of fragments into molecules is a standard step in existing model-building software, but the methods have not received detailed discussion in the literature
A reactive polystyrene-block-polyisoprene star copolymer as a toughening agent in an epoxy thermoset
Francis, Raju; Baby, Deepa K.
2015-01-01
© 2015 Springer-Verlag Berlin Heidelberg A polystyrene-block-polyisoprene ((PS-b-PI)3) star polymer was synthesized by photochemical reversible addition fragmentation chain transfer (RAFT) polymerization. The obtained star polymer was epoxidized
International Nuclear Information System (INIS)
Denschlag, H.O.; Braun, H.; Wolfsberg, K.
1979-01-01
The fission product yields of the members of the decay chains 132 to 137, 99, and 102 in 235 U(n/sub th/,f) were measured at various kinetic energies and ionic charge states of the fragments using the mass separator for unslowed fission products LOHENGRIN. The results are discussed with respect to four aspects: A preferential formation of neutron rich chain members found at high kinetic energy of the fragments is predominantly due to decreasing prompt neutron evaporation. A particularly large effect in chain 132 is attributed to the double shell closure in Sn-132. The persistence of an even-odd pairing effect in the yields throughout the range of kinetic energies studied leads to the conclusion that the high internal excitation energy of the fragments is tied up mainly in the form of collective energy (e.g., deformation energy) rather than single particle excitation. Generally, the yield distribution at constant kinetic energy is invariant with respect to the ionic charge state of the isotopes separated. Deviations from this behavior found in chains 99, 102, 133, and 136 are interpreted as being due to Auger events following a converted transition in the decay of ns-isomers taking place in the vacuum of the separator. A pronounced variation of the independent formation ratio of single isomeric states with the kinetic energy of the fragments is providing direct information on the controversial topic of the change of angular momentum of fission fragments as a function of deformation (scission distance). 34 references
McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gong, Hong-Liang; Lei, Lei; Shi, Shu-Xian; Xia, Yu-Zheng; Chen, Xiao-Nong
2018-05-01
In this work, polylactide-b-poly(N-isopropylacrylamide) were synthesized by the combination of controlled ring-opening polymerization and reversible addition fragmentation chain transfer polymerization. These block copolymers with molecular weight range from 7,900 to 12,000 g/mol and narrow polydispersity (≤1.19) can self-assemble into micelles (polylactide core, poly(N-isopropylacrylamide) shell) in water at certain temperature range, which have been evidenced by laser particle size analyzer proton nuclear magnetic resonance and transmission electron microscopy. Such micelles exhibit obvious thermo-responsive properties: (1) Poly(N-isopropylacrylamide) blocks collapse on the polylactide core as system temperature increase, leading to reduce of micelle size. (2) Micelles with short poly(N-isopropylacrylamide) blocks tend to aggregate together when temperature increased, which is resulted from the reduction of the system hydrophilicity and the decreased repulsive force between micelles.
Temperatures of fragment kinetic energy spectra
International Nuclear Information System (INIS)
Bauer, W.
1995-01-01
Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework
Bu, Dawei; Zhou, Yuwei; Tang, Jian; Jing, Fang; Zhang, Wei
2013-12-01
Abnormal brain natriuretic peptide (BNP) secretion is regarded as the dominating mechanism of cerebral salt wasting syndrome (CSW), which results from a renal loss of sodium and water during intracranial disease leading to hyponatremia. Scale preparation of therapeutic single-chain variable fragment (scFv) that can neutralize elevated circulating BNP may have potential value for clinical use. In this report, we used a recently isolated humanized anti-BNP scFv fragment (3C1) as model antibody (Ab) to evaluate the potential of scale production of this therapeutic protein. The truncated gene encoding for scFv fragment cloned in pET22b (+) was mainly overexpressed as inclusion bodies in Escherichia coli (E. coli) Rosetta (DE3) pLysS cells. The insoluble fragment was solubilized and purified by Ni-NTA agarose resin under denaturation conditions, and recovered via an effective refolding buffer containing 50 mM Tris-HCl, pH 8.0, 0.15 M NaCl, 1 mM EDTA, 0.5 M arginine, 2 mM GSH, 1 mM GSSG, and 5% glycerol. The refolded scFv fragment was concentrated by PEG20000, and dialyzed in PBS (containing 5% glycerol, pH 7.4). The final yield was approximately 10.2 mg active scFv fragment per liter of culture (3.4 g wet weight cells). The scFv fragment was more than 95% pure assessed by SDS-PAGE assay. Recombinant scFv fragment with His tag displayed its immunoreactivity with anti-His tag Ab by western blotting. ELISA showed the scFv fragment specifically bound to BNP, and it displayed similar activity as the traditional anti-BNP monoclonal Ab (mAb). Thus, the current strategy allows convenient small-scale production of this therapeutic protein. Copyright © 2013 Elsevier Inc. All rights reserved.
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.
DEFF Research Database (Denmark)
Abbasi, Maisam; Sternberg, Henrik; Nilsson, Fredrik
2014-01-01
that impact the cost and time requirements from customers of logistics services are not yet a reality. Research limitations/implications (if applicable) This paper implies that LSP sustainability cannot be investigated in isolation if a company does not manage proprietary resources. Practical implications (if......Purpose The purpose of this article is to explore the environmental impact of Logistics Service Provider (LSP) activities in the light of increased customer attention and fragmentation of the industry. It also explores to what extent the LSPs can actually monitor the environmental impact...... of logistics activities in the supply chain? Design/methodology/approach The methodology of this paper is a literature review, a qualitative interview survey, and three case studies. A framework on sustainability challenges in supply chains derived from the literature is used to structure and analyze...
Joosten, V.; Roelofs, M.S.; Dries, N. van den; Goosen, T.; Verrips, C.T.; Hondel, C.A.M.J.J. van den; Lokman, B.C.
2005-01-01
The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5′- or 3′-terminal ends of the gene encoding llama variable heavy chain antibody fragment VHH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which
Nanostructured Polysulfone-Based Block Copolymer Membranes
Xie, Yihui
2016-01-01
polycondensation and reversible addition-fragmentation chain-transfer polymerization. The obtained membrane has a highly porous interconnected skin layer composed of elongated micelles with a flower-like arrangement, on top of the graded finger-like macrovoids
Virtual fragment preparation for computational fragment-based drug design.
Ludington, Jennifer L
2015-01-01
Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.
Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli
International Nuclear Information System (INIS)
Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng
1995-06-01
MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)
Energy Technology Data Exchange (ETDEWEB)
Itoh, Keiji, E-mail: itoh@okayama-u.ac.jp [Graduate School of Education, Okayama University, Tsushima-naka, Okayama 700-8530 (Japan); Research Reactor Institute, Kyoto University, Kumatori, Osaka 590-0494 (Japan)
2017-02-15
Pulsed neutron diffraction and synchrotron X-ray diffraction measurements were performed on Se{sub 100-x}Te{sub x} bulk glasses with x=10, 20, 30 and 40. The coordination numbers obtained from the diffraction results demonstrate that Se and Te atoms are twofold coordinated and the glass structure is formed by the chain network. The three-dimensional structure model for Se{sub 60}Te{sub 40} glass obtained by using reverse Monte Carlo modelling shows that the alternating arrangements of Se and Te atoms compose the major part of the chain clusters but several other fragments such as Se{sub n} chains and Te-Te dimers are also present in large numbers. The chain clusters have geometrically disordered forms and the interchain atomic order is different from those in the crystal structures of trigonal Se and trigonal Te. - Graphical abstract: Coordination environment in Se{sub 60}Te{sub 40} glass.
Mechanism and kinetics of dithiobenzoate-mediated RAFT polymerization. I. The current situation
Barner-Kowollik, C.; Buback, M.; Charleux, B.; Coote, M.L.; Drache, M.; Fukuda, T.; Goto, A.; Klumperman, B.; Lowe, A.B.; McLeary, J.B.; Moad, G.; Monteiro, M.J.; Sanderson, R.D.; Tonge, M.P.; Vana, P.
2006-01-01
Investigations into the kinetics and mechanism of dithiobenzoate-mediated Reversible Addition-Fragmentation Chain Transfer (RAFT) polymerizations, which exhibit nonideal kinetic behavior, such as induction periods and rate retardation, are comprehensively reviewed. The appreciable uncertainty in the
Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.
2013-01-01
Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
Zhang, Xinsheng; Zhang, Yong; Liu, Yinghua; Wang, Jin; Xu, Qing; Yu, Xiaoming; Yang, Xueyan; Liu, Zhao; Xue, Changyong
2016-09-01
We previously observed that medium-chain triglycerides (MCTs) could reduce body fat mass and improve the metabolism of cholesterol. We hypothesized that MCTs can improve atherosclerosis by promoting the reverse cholesterol transport (RCT) process. Therefore, the objective of this study was to investigate the roles of MCTs in macrophage RCT and the progression of atherosclerosis. To test this hypothesis, 30 4-week-old ApoE-deficient (ApoE(-/-)) mice were randomly divided into 2 groups and fed a diet of 2% MCTs or long-chain triglycerides (LCTs) for 16 weeks. Ten age- and sex-matched C57BL/6J mice were fed a diet of 2% LCTs as the control. Macrophage-to-feces RCT was assessed in vivo by intraperitoneal injection of RAW 264.7 macrophages containing (3)H-labeled cholesterol, and atherosclerotic plaques were measured. The mRNA and protein expressions were determined by reverse transcriptase polymerase chain reaction and Western blot analyses, respectively. There was a greater decrease in body fat mass, atherosclerotic plaques, and an improvement in serum lipid profiles. In addition, the MCT mice group showed an increase in (3)H-tracer in the feces and a decrease in the liver. Significantly higher levels of mRNA and protein expression of hepatic ATP-binding cassette transporter A1, ATP-binding cassette transporter G5, cholesterol 7α-hydroxylase, and intestinal ATP-binding cassette transporter G8, as well as lower levels of expression of intestinal Niemann-Pick C1-like 1, were found in the MCT group. These results suggest that MCTs could obviously promote macrophage RCT and improve atherosclerosis in ApoE(-/-) mice, indicating that MCTs have the potential to prevent cardiovascular disease. Copyright © 2016 Elsevier Inc. All rights reserved.
Grange, Christopher S; Meijer, Anthony J H M; Ward, Michael D
2010-01-07
The trinuclear complexes [{(R2bipy)2Ru}3(mu3-HHTP)](PF6)3 [1(PF6)3, R = H; 2(PF6)3, R = 4-tBu] contain three {Ru(R2bipy)2}2+ fragments connected to the triangular tris-chelating ligand hexahydroxytriphenylene (H6HHTP). This bridging ligand contains three dioxolene-type binding sites, each of which can reversibly convert between dianionic catecholate (cat), monoanionic semiquinone (sq) or neutral quinone (q) redox states. The bridging ligand as a whole can therefore exist in seven different redox states from fully reduced [cat,cat,cat]6- through to fully oxidised, neutral [q,q,q]. Cyclic voltammetry of 1(PF6)3 in MeCN reveals six redox processes of which the three at more positive potentials (the sq/q couples) are reversible but the three at more negative potentials (the sq/cat couples) are irreversible with distorted wave shapes due to the insolubility of the reduced forms of the complex. In contrast, the more soluble complex 2(PF6)3 displays six reversible one-electron redox processes making all components of a seven-membered redox chain accessible. UV/Vis/NIR spectro-electrochemical studies reveal rich spectroscopic behaviour, with--in particular--very intense transitions in the near-IR region in many of the oxidation states associated with Ru(II)-->(dioxolene) MLCT and bridging ligand centred pi-pi* transitions. TDDFT calculations were used to analyse the electronic spectra in all seven oxidation states; the calculated spectra generally show very good agreement with experiment, which has allowed a fairly complete assignment of the low-energy transitions. The strong electrochromism of the complexes in the near-IR region has formed the basis of an optical window in which a thin film of 1(PF6)3 or 2(PF6)3 on a conductive glass surface can be reversibly and rapidly switched between redox states that alternate between strongly absorbing or near-transparent at 1100 nm, with--for 2(PF6)3--the switching being stable and reversible in water over thousands of cycles.
Random attractors for stochastic lattice reversible Gray-Scott systems with additive noise
Directory of Open Access Journals (Sweden)
Hongyan Li
2015-10-01
Full Text Available In this article, we prove the existence of a random attractor of the stochastic three-component reversible Gray-Scott system on infinite lattice with additive noise. We use a transformation of addition involved with Ornstein-Uhlenbeck process, for proving the pullback absorbing property and the pullback asymptotic compactness of the reaction diffusion system with cubic nonlinearity.
Directory of Open Access Journals (Sweden)
Marilia Farignoli Romeiro
2016-06-01
Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.
A fuzzy Bi-linear management model in reverse logistic chains
Directory of Open Access Journals (Sweden)
Tadić Danijela
2016-01-01
Full Text Available The management of the electrical and electronic waste (WEEE problem in the uncertain environment has a critical effect on the economy and environmental protection of each region. The considered problem can be stated as a fuzzy non-convex optimization problem with linear objective function and a set of linear and non-linear constraints. The original problem is reformulated by using linear relaxation into a fuzzy linear programming problem. The fuzzy rating of collecting point capacities and fix costs of recycling centers are modeled by triangular fuzzy numbers. The optimal solution of the reformulation model is found by using optimality concept. The proposed model is verified through an illustrative example with real-life data. The obtained results represent an input for future research which should include a good benchmark base for tested reverse logistic chains and their continuous improvement. [Projekat Ministarstva nauke Republike Srbije, br. 035033: Sustainable development technology and equipment for the recycling of motor vehicles
International Nuclear Information System (INIS)
Teoule, R.; Duplaa, A.M.
1987-01-01
Electrophoresis on polyacrylamide gels of the fragments resulting from γ-irradiation of single-stranded oligodeoxyribonucleotides labelled at their 5'- or 3'-end proved a potent tool for analysis of the radiation-induced chain breakage of DNA. Owing to the fact that the oligonucleotide may be ruptured at more than one site, counting of the electrophoresis bands must be corrected and it is necessary to assess the influence of the cleavage position on the band intensities. A complicating factor is the inhomogeneity of the system due to the presence of the four bases A, T, C and G. To circumvent this problem, the homooligodeoxyribonucleotides (dA) 15 , (dC) 15 , (dT) 15 were used as experimental probes. They were γ-irradiated in solution, heated in alkali and resulting fragments separated by gel electrophoresis. A computer simulation of band intensities was compiled based on the general assumption that the chain breakage is homogeneous. Experimental results obtained from the homooligodeoxyribonucleotides labelled at either the 5' or the 3'-end are in excellent agreement with theoretical calculations. Abacus giving the gel band intensities (percentage) against the nucleotide positions and the remaining intensity of the original oligonucleotide have been obtained. (author)
Joosten, V.; Roelofs, M.S.; Dries, van den N.; Goosen, T.; Verrips, C.T.; Hondel, van den C.A.M.J.J.; Lokman, B.C.
2005-01-01
The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5'- or 3'-terminal ends of the gene encoding llama variable heavy chain antibody fragment V-HH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
Use of reverse kinematics in the identification of large fragments evaporated by compound nuclei
International Nuclear Information System (INIS)
Sobotka, L.G.; McMahan, M.A.; McDonald, R.J.
1985-01-01
Fragments ranging in charge from Z = 2 to Z = Z/sub symmetry/ have been identified from the compound nucleus decay associated with a variety of heavy ion reactions. The use of reverse kinematics (projectile heavier than the target) was crucial in performing these measurements. The experiments were carried out at the SuperHILAC utilizing beams of 550 MeV 74 Ge, 782 MeV 93 Nb and 1157 MeV 139 La, to bombard targets of 0.54 mg/cm 2 12 C and 1.0 mg/cm 2 9 Be. The detection system consisted of four solid state ΔE-E silicon telescopes (40-70 μm, 3-5 mm) situated at 7.5 0 , 15 0 , 25 0 , and 35 0 from the beam with solid angles of approximately 1.0 msr. For the heavier 139 La beam these detectors were supplemented by two gas ΔE - solid state E telescopes at -7.5 0 and -22.5 0
Towards novel therapeutics for HIV through fragment-based screening and drug design.
Tiefendbrunn, Theresa; Stout, C David
2014-01-01
Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.
Monoclonal antibody fragment removal mediated by mixed mode resins.
O'Connor, Ellen; Aspelund, Matthew; Bartnik, Frank; Berge, Mark; Coughlin, Kelly; Kambarami, Mutsa; Spencer, David; Yan, Huiming; Wang, William
2017-05-26
Efforts to increase monoclonal antibody expression in cell culture can result in the presence of fragmented species requiring removal in downstream processing. Capto adhere, HEA Hypercel, and PPA Hypercel anion exchange/hydrophobic interaction mixed mode resins were evaluated for their fragment removal capabilities and found to separate large hinge IgG1 antibody fragment (LHF) from monomer. Removal of greater than 75% of LHF population occurred at pH 8 and low conductivity. The mechanism of fragment removal was investigated in two series of experiments. The first experimental series consisted of comparison to chromatographic behavior on corresponding single mode resins. Both single mode anion exchange and hydrophobic interaction resins failed to separate LHF. The second experimental series studied the impact of phase modifiers, ethylene glycol, urea, and arginine on the mixed mode mediated removal. The addition of ethylene glycol decreased LHF removal by half. Further decreases in LHF separation were seen upon incubation with urea and arginine. Therefore, it was discovered that the purification is the result of a mixed mode phenomena dominated by hydrophobic interaction and hydrogen bonding effects. The site of interaction between the LHF and mixed mode resin was determined by chemical labeling of lysine residues with sulfo-NHS acetate. The labeling identified the antibody hinge and light chain regions as mediating the fragment separation. Sequence analysis showed that under separation conditions, a hydrophobic proline patch and hydrogen bonding serine and threonine residues mediate the hinge interaction with the Capto adhere ligand. Additionally, a case study is presented detailing the optimization of fragment removal using Capto adhere resin to achieve purity and yield targets in a manufacturing facility. This study demonstrated that mixed mode resins can be readily integrated into commercial antibody platform processes when additional chromatographic abilities
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Baculovirus display of functional antibody Fab fragments.
Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki
2015-08-01
The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.
On the fragmentation of biomolecules: fragmentation of alanine dipeptide along the polypeptide chain
DEFF Research Database (Denmark)
Solov'yov, Ilia; Yakubovich, Alexander; Solov'yov, Andrey
2006-01-01
The interaction potential between amino acids in alanine dipeptide has been studied for the first time taking into account exact molecular geometry. Ab initio calculation has been performed in the framework of density functional theory taking into account all electrons in the system. The fragment...
Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule
2017-06-26
IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
The formation of planets by disc fragmentation
Directory of Open Access Journals (Sweden)
Stamatellos Dimitris
2013-04-01
Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.
Directory of Open Access Journals (Sweden)
Irina Muljajew
2018-03-01
Full Text Available Depending on the degree of grafting (DG and the side chain degree of polymerization (DP, graft copolymers may feature properties similar to statistical copolymers or to block copolymers. This issue is approached by studying aqueous solutions of PMMA-g-OEtOx graft copolymers comprising a hydrophobic poly(methyl methacrylate (PMMA backbone and hydrophilic oligo(2-ethyl-2-oxazoline (OEtOx side chains. The graft copolymers were synthesized via reversible addition-fragmentation chain transfer (RAFT copolymerization of methyl methacrylate (MMA and OEtOx-methacrylate macromonomers of varying DP. All aqueous solutions of PMMA-g-OEtOx (9% ≤ DG ≤ 34%; 5 ≤ side chain DP ≤ 24 revealed lower critical solution temperature behavior. The graft copolymer architecture significantly influenced the aggregation behavior, the conformation in aqueous solution and the coil to globule transition, as verified by means of turbidimetry, dynamic light scattering, nuclear magnetic resonance spectroscopy, and analytical ultracentrifugation. The aggregation behavior of graft copolymers with a side chain DP of 5 was significantly affected by small variations of the DG, occasionally forming mesoglobules above the cloud point temperature (Tcp, which was around human body temperature. On the other hand, PMMA-g-OEtOx with elongated side chains assembled into well-defined structures below the Tcp (apparent aggregation number (Nagg = 10 that were able to solubilize Disperse Orange 3. The thermoresponsive behavior of aqueous solutions thus resembled that of micelles comprising a poly(2-ethyl-2-oxazoline (PEtOx shell (Tcp > 60 °C.
Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes
Denisov, E. T.; Shestakov, A. F.
2018-05-01
Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.
Current fragmentation in deep inelastic scattering
International Nuclear Information System (INIS)
Hamer, C.J.
1975-04-01
It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)
On the record process of time-reversible spectrally-negative Markov additive processes
J. Ivanovs; M.R.H. Mandjes (Michel)
2009-01-01
htmlabstractWe study the record process of a spectrally-negative Markov additive process (MAP). Assuming time-reversibility, a number of key quantities can be given explicitly. It is shown how these key quantities can be used when analyzing the distribution of the all-time maximum attained by MAPs
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
International Nuclear Information System (INIS)
Wang Canjun; Chen Shibo; Mei Dongcheng
2006-01-01
We study the noise-induce transport and current reversal of Brownian particles in a continuously periodic potential driven by cross correlation between a multiplicative white noise and an additive white noise. We find that directed motion of the Brownian particles can be induced by the correlation between the additive noise and the multiplicative noise. The current reversal and the direction of the current is controlled by the values of the intensity (λ) of the correlated noises and a dimensionless parameter R (R=α/D, D is the intensity of multiplicative noise and α is the intensity of additive noise)
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Bose, Ranjita K.; Enke, Marcel; Grande, Antonio M.; Zechel, Stefan; Schacher, Felix H.; Hager, Martin D.; Garcia, Santiago J.; Schubert, Ulrich S.; van der Zwaag, Sybrand
2017-01-01
The main aim of this work is to study the respective contribution of the hard and soft blocks of a metal-ligand containing block copolymer to the self-healing behavior. To this aim, different block copolymers containing terpyridine were synthesized using reversible addition-fragmentation chain
International Nuclear Information System (INIS)
Pacifico, M.D.; Pearl, R.A.; Kupsch, J.M.
2006-01-01
Radio scintigraphy using single chain antibody fragments (scFvs) offers a potenti al means of early detection of melanoma metastases. However, previous studies have shown suboptimal levels of tumour localization and nonspecific background accumulation which may be due to antigen heterogeneity. We aimed to improve tumour localization by using a cocktail of different scFvs targeting different epitopes on melanoma cells. We have previously developed three scFvs against distinct and highly tumour-specific melanoma cell-surface antigens by chain shuffling and antibody phage selection on melanoma cells. Three scFvs, RAFT3, B3 and B4 were labeled with 1 25I odine and tested both individually and as a cocktail in a nude mouse xenograft model far human melanoma. Results demonstrated improved tumour localization in vivo when compared to the individual scFvs. Tumour uptake of the cocktail at l hour was 24.220% ID/g (injected dose/gram) compared with 2.854%, 2.263% and 1.355% far B4, RAFT3 and B3, respectively, when injected individually. In addition, the cocktail exhibited significantly superior tumour to normal tissue ratios far muscle and spleen (p<0.05). A combination or cocktail of scFv clones may have an advantage aver individual scFvs far melanoma targeting in patients because of heterogeneity in the expression of different epitopes of antigens on melanoma cells
Augmentation of chain formation in a magnetic fluid by the addition of halloysite nanotubes
International Nuclear Information System (INIS)
Desai, Rucha; Upadhyay, R V; Mehta, R V
2014-01-01
The study aims to investigate the effect of the addition of nanotubes of halloysite on the augmentation of chains observed in an aqueous magnetic fluid consisting of co-precipitated magnetite particles stabilized with lauric acid. Three samples of the mixture containing 0.5%, 1% and 2% of halloysite nanotubes (HNTs) and a pure magnetic fluid are used for this study. A room temperature magnetization study shows that for 0.5% and 1% of HNT, the magnetization of the mixture significantly increases, while for the higher concentration (2%) it decreases. Such concentration dependent behaviour on the addition of a nonmagnetic system to a magnetic fluid has not previously been observed. The increase in the magnetization is attributed to smaller sized (<5–6 nm) magnetite attached to the HNT, forming a magnetite–HNT composite. Additionally, field-induced chaining is augmented by the addition of HNT in the magnetic fluid. The augmentation of chain formation is confirmed by optical microscopy, field-induced transmission changes and field-dependent diffraction effects. The augmentation will be useful in enhancing other properties of the composite, such as the viscosity and thermal conductivity of nanofluids. (paper)
Fragmentation kinetics of a Morse oscillator chain under tension
International Nuclear Information System (INIS)
Stember, Joseph N.; Ezra, Gregory S.
2007-01-01
The bond dissociation kinetics of tethered atomic (Morse potential) chains under tensile stress is studied. Both RRKM (fully anharmonic, Monte Carlo) and RRK (harmonic appproximation) theory are applied to predict bond dissociation rate constants as a function of energy and tensile force. For chains with N ≥ 3 atoms a hybrid statistical theory is used involving a harmonic approximation for motion in the transition state for bond dissociation. For chains with N = 2-5 atoms, while the RRK approximation significantly overestimates the dissociation rate constant, the fully anharmonic RRKM rate is quite close to simulation results. For the N = 2 chain, a novel approach to the extraction of decay rate constants based on the classical spectral theorem is implemented. Good agreement between the RRKM and dynamical rate constants is obtained for N = 2 despite the fact that the reactant phase space contains a significant fraction of relatively short-lived trajectories
International Nuclear Information System (INIS)
Arnold, Werner
2002-01-01
Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer
Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L
2009-10-01
Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.
Bose, R.K.; Enke, Marcel; Grande, A.M.; Zechel, Stefan; Schacher, Felix H.; Hager, Martin D.; Garcia Espallargas, Santiago J.; Schubert, Ulrich S.; van der Zwaag, S.
2017-01-01
The main aim of this work is to study the respective contribution of the hard and soft blocks of a metal-ligand containing block copolymer to the self-healing behavior. To this aim, different block copolymers containing terpyridine were synthesized using reversible addition-fragmentation chain
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
Fast local fragment chaining using sum-of-pair gap costs
DEFF Research Database (Denmark)
Otto, Christian; Hoffmann, Steve; Gorodkin, Jan
2011-01-01
, and rank the fragments to improve the specificity. Results: Here we present a fast and flexible fragment chainer that for the first time also supports a sum-of-pair gap cost model. This model has proven to achieve a higher accuracy and sensitivity in its own field of application. Due to a highly time...... alignment heuristics alone. By providing both the linear and the sum-of-pair gap cost model, a wider range of application can be covered. The software clasp is available at http://www.bioinf.uni-leipzig.de/Software/clasp/....
Reverse Logistics in Food Supply Chains
Zeimpekis, V.; Bloemhof, J.M.; Bourlakis, M.
2014-01-01
Reverse logistics can be defined as the process of planning, implementing, and controlling the flow of raw materials, in-process inventory, and finished goods from the point of consumption to the point of origin for the purpose of recapturing value or proper disposal. In environmental and economic
Modelling antibody side chain conformations using heuristic database search.
Ritchie, D W; Kemp, G J
1997-01-01
We have developed a knowledge-based system which models the side chain conformations of residues in the variable domains of antibody Fv fragments. The system is written in Prolog and uses an object-oriented database of aligned antibody structures in conjunction with a side chain rotamer library. The antibody database provides 3-dimensional clusters of side chain conformations which can be copied en masse into the model structure. The object-oriented database architecture facilitates a navigational style of database access, necessary to assemble side chains clusters. Around 60% of the model is built using side chain clusters and this eliminates much of the combinatorial complexity associated with many other side chain placement algorithms. Construction and placement of side chain clusters is guided by a heuristic cost function based on a simple model of side chain packing interactions. Even with a simple model, we find that a large proportion of side chain conformations are modelled accurately. We expect our approach could be used with other homologous protein families, in addition to antibodies, both to improve the quality of model structures and to give a "smart start" to the side chain placement problem.
Roy, Sudeshna; Spilling, Christopher D
2010-11-19
A convergent synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization, and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with l-selectride to give the fragments of amphidinolide C and F.
Kumar, Sonu; Acharya, Rituparna; Chatterji, Urmi; De, Priyadarsi
2013-12-10
Developing safe and effective nanocarriers for multitype of delivery system is advantageous for several kinds of successful biomedicinal therapy with the same carrier. In the present study, we have designed amino acid biomolecules derived hybrid block copolymers which can act as a promising vehicle for both drug delivery and gene transfer. Two representative natural chiral amino acid-containing (l-phenylalanine and l-alanine) vinyl monomers were polymerized via reversible addition-fragmentation chain transfer (RAFT) process in the presence of monomethoxy poly(ethylene glycol) based macro-chain transfer agents (mPEGn-CTA) for the synthesis of well-defined side-chain amino-acid-based amphiphilic block copolymers, monomethoxy poly(ethylene glycol)-b-poly(Boc-amino acid methacryloyloxyethyl ester) (mPEGn-b-P(Boc-AA-EMA)). The self-assembled micellar aggregation of these amphiphilic block copolymers were studied by fluorescence spectroscopy, atomic force microscopy (AFM) and scanning electron microscopy (SEM). Potential applications of these hybrid polymers as drug carrier have been demonstrated in vitro by encapsulation of nile red dye or doxorubicin drug into the core of the micellar nanoaggregates. Deprotection of side-chain Boc- groups in the amphiphilic block copolymers subsequently transformed them into double hydrophilic pH-responsive cationic block copolymers having primary amino groups in the side-chain terminal. The DNA binding ability of these cationic block copolymers were further investigated by using agarose gel retardation assay and AFM. The in vitro cytotoxicity assay demonstrated their biocompatible nature and these polymers can serve as "smart" materials for promising bioapplications.
Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.
Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B
2016-11-25
Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Fission fragment angular momentum
International Nuclear Information System (INIS)
Frenne, D. De
1991-01-01
Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs
Liu, Han-Lin; Lin, Wei-Fang; Hu, Wen-Chi; Lee, Yung-An
2015-01-01
Potyviruses are major pathogens that often cause mixed infection in calla lilies. To reduce the time and cost of virus indexing, a detection method for the simultaneous targeting of multiple potyviruses was developed by generating a broad-spectrum monoclonal antibody (MAb) for detecting the greatest possible number of potyviruses. The conserved 121-amino-acid core regions of the capsid proteins of Dasheen mosaic potyvirus (DsMV), Konjak mosaic potyvirus (KoMV), and Zantedeschia mild mosaic potyvirus (ZaMMV) were sequentially concatenated and expressed as a recombinant protein for immunization. After hybridoma cell fusion and selection, one stable cell line that secreted a group-specific antibody, named C4 MAb, was selected. In the reaction spectrum test, the C4 MAb detected at least 14 potyviruses by indirect enzyme-linked immunosorbent assay (I-ELISA) and Western blot analysis. Furthermore, the variable regions of the heavy (VH) and light (VL) chains of the C4 MAb were separately cloned and constructed as single-chain variable fragments (scFvs) for expression in Escherichia coli. Moreover, the pectate lyase E (PelE) signal peptide of Erwinia chrysanthemi S3-1 was added to promote the secretion of C4 scFvs into the medium. According to Western blot analysis and I-ELISA, the soluble C4 scFv (VL-VH) fragment showed a binding specificity similar to that of the C4 MAb. Our results demonstrate that a recombinant protein derived from fusion of the conserved regions of viral proteins has the potential to produce a broad-spectrum MAb against a large group of viruses and that the PelE signal peptide can improve the secretion of scFvs in E. coli. PMID:26209665
NMR spectroscopy in the optimization and evaluation of RAFT agents
Klumperman, B.; McLeary, J.B.; van den Dungen, E.; Pound, G.
2007-01-01
The selection of a suitable mediating agent in Reversible Addition-Fragmentation Chain Transfer (RAFT) mediated polymerization is crucial to the degree of control that can be achieved. An overview of work from the Stellenbosch group is presented in which the use of NMR spectroscopy as a tool for
The Buccaneer software for automated model building. 1. Tracing protein chains.
Cowtan, Kevin
2006-09-01
A new technique for the automated tracing of protein chains in experimental electron-density maps is described. The technique relies on the repeated application of an oriented electron-density likelihood target function to identify likely C(alpha) positions. This function is applied both in the location of a few promising ;seed' positions in the map and to grow those initial C(alpha) positions into extended chain fragments. Techniques for assembling the chain fragments into an initial chain trace are discussed.
Senet, P; Aparicio, F
2007-04-14
By using the exact density functional theory, one demonstrates that the value of the local electronic softness of a molecular fragment is directly related to the polarization charge (Coulomb hole) induced by a test electron removed (or added) from (at) the fragment. Our finding generalizes to a chemical group a formal relation between these molecular descriptors recently obtained for an atom in a molecule using an approximate atomistic model [P. Senet and M. Yang, J. Chem. Sci. 117, 411 (2005)]. In addition, a practical ab initio computational scheme of the Coulomb hole and related local descriptors of reactivity of a molecular family having in common a similar fragment is presented. As a blind test, the method is applied to the lateral chains of the 20 isolated amino acids. One demonstrates that the local softness of the lateral chain is a quantitative measure of the similarity of the amino acids. It predicts the separation of amino acids in different biochemical groups (aliphatic, basic, acidic, sulfur contained, and aromatic). The present approach may find applications in quantitative structure activity relationship methodology.
Nelson, Alfreda D.; Hoffmann, Michele M.; Parks, Christopher A.; Dasari, Surendra; Schrum, Adam G.; Gil, Diana
2012-01-01
Generated by proteolytic cleavage of immunoglobulin, Fab fragments possess great promise as blocking reagents, able to bind receptors or other targets without inducing cross-linking. However, aggregation of Fab preparations is a common occurrence, which generates intrinsic stimulatory capacity and thwarts signal blockade strategies. Using a panel of biochemical approaches, including size exclusion chromatography, SDS-PAGE, mass spectrometry, and cell stimulation followed by flow cytometry, we have measured the oligomerization and acquisition of stimulatory capacity that occurs in four monoclonal IgG Fabs specific for TCR/CD3. Unexpectedly, we observed that all Fabs spontaneously formed complexes that were precisely bivalent, and these bivalent complexes possessed most of the stimulatory activity of each Fab preparation. Fabs composing bivalent complexes were more susceptible to proteolysis than monovalent Fabs, indicating a difference in conformation between the Fabs involved in these two different states of valency. Because osmolytes represent a class of compounds that stabilize protein folding and conformation, we sought to determine the extent to which the amino acid osmolyte l-proline might impact bivalent Fab complexation. We found that l-proline (i) inhibited the adoption of the conformation associated with bivalent complexation, (ii) preserved Fab monovalency, (iii) reversed the conformation of preformed bivalent Fabs to that of monovalent Fabs, and (iv) separated a significant percentage of preformed bivalent complexes into monovalent species. Thus, Fab fragments can adopt a conformation that is compatible with folding or packing of a bivalent complex in a process that can be inhibited by osmolytes. PMID:23109335
Spatial- and Time-Correlated Detection of Fission Fragments
Directory of Open Access Journals (Sweden)
Platkevic M.
2012-02-01
Full Text Available With the goal to measure angular correlations of fission fragments in rare fission decay (e.g. ternary and quaternary fission, a multi-detector coincidence system based on two and up to four position sensitive pixel detectors Timepix has been built. In addition to the high granularity, wide dynamic range and per pixel signal threshold, these devices are equipped with per pixel energy and time sensitivity providing more information (position, energy, time, enhances particle-type identification and selectivity of event-by-event detection. Operation of the device with the integrated USB 2.0 based readout interface FITPix and the control and data acquisition software tool Pixelman enables online visualization and flexible/adjustable operation for a different type of experiments. Spatially correlated fission fragments can be thus registered in coincidence. Similarly triggered measurements are performed using an integrated spectrometric module with analogue signal chain electronics. The current status of development together with demonstration of the technique with a 252Cf source is presented.
'Smart' Diblock Copolymers as Templates for Magnetic-Core Gold-Shell Nanoparticle Synthesis
International Nuclear Information System (INIS)
Nash, Michael A.; Lai, James J.; Hoffman, Allan S.; Yager, Paul; Stayton, Partick S.
2010-01-01
We report a new strategy for synthesizing temperature-responsive γ-Fe 2 O 3 -core/Au-shell nanoparticles (Au-mNPs) from diblock copolymer micelles. The amphiphilic diblock copolymer chains were synthesized using reversible addition-fragmentation chain-transfer (RAFT) with a thermally responsive 'smart' poly(N-isopropylacrylamide) (pNIPAAm) block and an amine-containing poly(N,N-dimethylaminoethylacrylamide) (DMAEAm) block that acted as a reducing agent during gold shell formation. The Au-mNPs reversibly aggregated upon heating the solution above the transition temperature of pNIPAAm, resulting in a red-shifted localized surface plasmon resonance.
Irreversible Local Markov Chains with Rapid Convergence towards Equilibrium
Kapfer, Sebastian C.; Krauth, Werner
2017-12-01
We study the continuous one-dimensional hard-sphere model and present irreversible local Markov chains that mix on faster time scales than the reversible heat bath or Metropolis algorithms. The mixing time scales appear to fall into two distinct universality classes, both faster than for reversible local Markov chains. The event-chain algorithm, the infinitesimal limit of one of these Markov chains, belongs to the class presenting the fastest decay. For the lattice-gas limit of the hard-sphere model, reversible local Markov chains correspond to the symmetric simple exclusion process (SEP) with periodic boundary conditions. The two universality classes for irreversible Markov chains are realized by the totally asymmetric SEP (TASEP), and by a faster variant (lifted TASEP) that we propose here. We discuss how our irreversible hard-sphere Markov chains generalize to arbitrary repulsive pair interactions and carry over to higher dimensions through the concept of lifted Markov chains and the recently introduced factorized Metropolis acceptance rule.
Desmet, Gilles B; De Rybel, Nils; Van Steenberge, Paul H M; D'hooge, Dagmar R; Reyniers, Marie-Françoise; Marin, Guy B
2018-01-01
Ab-initio-calculated rate coefficients for addition and fragmentation in reversible-addition fragmentation chain transfer (RAFT) polymerization of styrene with 2-cyano-2-propyl dodecyl trithiocarbonate initiated by azobisisobutyronitrile allow the reliable simulation of the experimentally observed conversion, number average chain length, and dispersity. The rate coefficient for addition of a macroradical R i to the macroRAFT agent R i X at 333 K (6.8 10 4 L mol -1 s -1 ) is significantly lower than to the initial RAFT agent R 0 X (3.2 10 6 L mol -1 s -1 ), mainly due to a difference in activation energy (15.4 vs 3.0 kJ mol -1 ), which causes the dispersity to spike in the beginning of the polymerization. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Oettmeier, Katrin; Hofmann, Erik
2016-01-01
Purpose The business implications of additive manufacturing (AM) are explored; specific focus thereby lies on the impact of AM technology adoption in customized parts production. Design/methodology/approach Based on two explorative case studies from the hearing aid industry, the impact of AM technology adoption on supply chain business processes and management components is analyzed. General systems theory and a supply chain management framework serve as theoretical underpinning....
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2014-10-01
Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul
2014-10-01
This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Producing carbon-based boundary films from catalytically active lubricant additives
Erdemir, Ali; Mane, Anil U.; Elam, Jeffrey W.; Ramirez, Giovanni; Eryilmaz, Osman
2018-04-24
A lubricant composition includes an oil including a plurality of long-chain hydrocarbon molecules. A quantity of a catalytically active metal-organic additive is mixed with the oil. The metal-organic additive is formulated to fragment the long-chain hydrocarbon molecules of the oil into at least one of dimers and trimers under the influence of at least one of a mechanical loading and a thermal loading. In some embodiments, the metal-organic additive includes a compound of formula II: ##STR00001## where: X is Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Y, Zr, Nb, Mo, Tc, Ru, Rh, Pd, Ag, Cd, Hf, Ta, W, Re, Os, Ir, Pt, Au, Hg, Rf, Db, Sg, Bh, Hs, Mt, Ds, Rg or Cn, and R.sub.1, R.sub.2, R.sub.3 and R.sub.4 are alkyl or alkyl halide.
Astuti, Ani Budi; Iriawan, Nur; Irhamah, Kuswanto, Heri
2017-12-01
In the Bayesian mixture modeling requires stages the identification number of the most appropriate mixture components thus obtained mixture models fit the data through data driven concept. Reversible Jump Markov Chain Monte Carlo (RJMCMC) is a combination of the reversible jump (RJ) concept and the Markov Chain Monte Carlo (MCMC) concept used by some researchers to solve the problem of identifying the number of mixture components which are not known with certainty number. In its application, RJMCMC using the concept of the birth/death and the split-merge with six types of movement, that are w updating, θ updating, z updating, hyperparameter β updating, split-merge for components and birth/death from blank components. The development of the RJMCMC algorithm needs to be done according to the observed case. The purpose of this study is to know the performance of RJMCMC algorithm development in identifying the number of mixture components which are not known with certainty number in the Bayesian mixture modeling for microarray data in Indonesia. The results of this study represent that the concept RJMCMC algorithm development able to properly identify the number of mixture components in the Bayesian normal mixture model wherein the component mixture in the case of microarray data in Indonesia is not known for certain number.
Liang, Yuxue; Neta, Pedatsur; Yang, Xiaoyu; Stein, Stephen E
2018-03-01
High-accuracy MS/MS spectra of deprotonated ions of 390 dipeptides and 137 peptides with three to six residues are studied. Many amino acid residues undergo neutral losses from their side chains. The most abundant is the loss of acetaldehyde from threonine. The abundance of losses from the side chains of other amino acids is estimated relative to that of threonine. While some amino acids lose the whole side chain, others lose only part of it, and some exhibit two or more different losses. Side-chain neutral losses are less abundant in the spectra of protonated peptides, being significant mainly for methionine and arginine. In addition to the neutral losses, many amino acid residues in deprotonated peptides produce specific negative ions after peptide bond cleavage. An expanded list of fragment ions from protonated peptides is also presented and compared with those of deprotonated peptides. Fragment ions are mostly different for these two cases. These lists of fragments are used to annotate peptide mass spectral libraries and to aid in the confirmation of specific amino acids in peptides. Graphical Abstract ᅟ.
Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis
Directory of Open Access Journals (Sweden)
Chi-Hsin Lee
2017-10-01
Full Text Available Russell’s vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs containing 3.4 × 107 and 5.5 × 107 transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.
Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis.
Lee, Chi-Hsin; Lee, Yu-Ching; Lee, Yueh-Lun; Leu, Sy-Jye; Lin, Liang-Tzung; Chen, Chi-Ching; Chiang, Jen-Ron; Mwale, Pharaoh Fellow; Tsai, Bor-Yu; Hung, Ching-Sheng; Yang, Yi-Yuan
2017-10-27
Russell's vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF) venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY) antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs) containing 3.4 × 10⁷ and 5.5 × 10⁷ transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.
van Zalinge, M. E.; Cashman, K. V.; Sparks, R. S. J.
2018-03-01
Broken crystals have been documented in many large-volume caldera-forming ignimbrites and can help to understand the role of crystal fragmentation in both eruption and compaction processes, the latter generally overlooked in the literature. This study investigates the origin of fragmented crystals in the > 1260 km3, crystal-rich Cardones ignimbrites located in the Central Andes. Observations of fragmented crystals in non-welded pumice clasts indicate that primary fragmentation includes extensive crystal breakage and an associated ca. 5 vol% expansion of individual crystals while preserving their original shapes. These observations are consistent with the hypothesis that crystals fragment in a brittle response to rapid decompression associated with the eruption. Additionally, we observe that the extent of crystal fragmentation increases with increasing stratigraphic depth in the ignimbrite, recording secondary crystal fragmentation during welding and compaction. Secondary crystal fragmentation aids welding and compaction in two ways. First, enhanced crystal fragmentation at crystal-crystal contacts accommodates compaction along the principal axis of stress. Second, rotation and displacement of individual crystal fragments enhances lateral flow in the direction(s) of least principal stress. This process increases crystal aspect ratios and forms textures that resemble mantled porphyroclasts in shear zones, indicating lateral flow adds to processes of compaction and welding alongside bubble collapse. In the Cardones ignimbrite, secondary fragmentation commences at depths of 175-250 m (lithostatic pressures 4-6 MPa), and is modulated by both the overlying crystal load and the time spent above the glass transition temperature. Under these conditions, the existence of force-chains can produce stresses at crystal-crystal contacts of a few times the lithostatic pressure. We suggest that documenting crystal textures, in addition to conventional welding parameters, can
Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko
2011-01-01
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.
Additional chain-branching pathways in the low-temperature oxidation of branched alkanes
Wang, Zhandong
2015-12-31
Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS). Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C8H14O4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C8H16O5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C8H16O5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O2 addition, intramolecular isomerization, and OH release; C8H14O4 species are proposed to result from subsequent reactions of C8H16O5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth\\'s troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. The results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances. © 2015 The Combustion Institute.
Directory of Open Access Journals (Sweden)
Christiane Y Ozaki
Full Text Available Diarrhea is a prevalent pathological condition frequently associated to the colonization of the small intestine by enterotoxigenic Escherichia coli (ETEC strains, known to be endemic in developing countries. These strains can produce two enterotoxins associated with the manifestation of clinical symptoms that can be used to detect these pathogens. Although several detection tests have been developed, minimally equipped laboratories are still in need of simple and cost-effective methods. With the aim to contribute to the development of such diagnostic approaches, we describe here two mouse hybridoma-derived single chain fragment variable (scFv that were produced in E. coli against enterotoxins of ETEC strains.Recombinant scFv were developed against ETEC heat-labile toxin (LT and heat-stable toxin (ST, from previously isolated hybridoma clones. This work reports their design, construction, molecular and functional characterization against LT and ST toxins. Both antibody fragments were able to recognize the cell-interacting toxins by immunofluorescence, the purified toxins by ELISA and also LT-, ST- and LT/ST-producing ETEC strains.The developed recombinant scFvs against LT and ST constitute promising starting point for simple and cost-effective ETEC diagnosis.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Gouge, Michael F.
2011-01-01
Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.
Stability of llama heavy chain antibody fragments under extreme conditions
Dolk, E.
2004-01-01
Camelids have next to their normal antibodies, a unique subset of antibodies lacking light chains. The resulting single binding domain, VHH, of these heavy chain antibodies consequently have unique properties. A high stability is one of these properties, which was investigated in this thesis. The
How the reverse supply chain impacts the financial performance of original equipment manufacturers
DEFF Research Database (Denmark)
Larsen, Samuel
This thesis examines the financial impact of a firm’s reverse supply chain (RSC). Specifically, the thesis examines the two questions of how the RSC can contribute to the financial performance of the firm and which factors are decisive for the RSC’s financial contribution. The thesis focuses...... on original equipment manufacturers. The thesis results show that the RSC can contribute to the financial performance of the firm in more than 20 different ways, which the thesis defines as functions of the RSC. Examples of RSC-functions are 1) resale of recovered end-products to price-focused market segments...... in the firm’s primary markets, 2) resale to customers in new markets (in e.g. emerging economies), and 3) sale of used materials back the firm’s original material suppliers. The firm’ RSC can conduct several RSC-functions simultaneously and the financial benefits from operating these RSC-functions differ...
International Nuclear Information System (INIS)
Robinson, M.A.
1989-01-01
Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations
Ji, Xiaonan; Shen, Yanli; Sun, Hao; Gao, Xiangdong
2016-08-01
Human hepatocellular carcinoma (HCC) has a high rate of tumor recurrence and metastasis, resulting in shortened survival time. The function of alpha-fetoprotein (AFP) as a regulatory factor in the growth of HCC cells has been well defined. The aim of this study was to investigate the use of a novel AFP-specific single-chain variable fragment that blocked AFP and inhibited HCC cell growth. The results indicated that the anti-AFP single-chain variable fragment (scFv) induced growth inhibition of AFP-expressing HCC cell lines in vitro through induction of G1 cell cycle arrest and apoptosis. The mechanism of apoptosis probably involved with blocking AFP internalization and regulation of the PTEN/PI3K/Akt signaling network. Moreover, the anti-AFP-scFv also effectively sensitized the HepG2 cells to paclitaxel (PTX) at a lower concentration. The combination effect of PTX and anti-AFP-scFv displayed a synergistic effect on HepG2 cells both in vitro and in vivo. Our results demonstrated that targeting AFP by specific antibodies has potential immunotherapeutic efficacy in human HCC.
Memory functions and correlations in additive binary Markov chains
Energy Technology Data Exchange (ETDEWEB)
Melnyk, S S [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Usatenko, O V [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Yampol' skii, V A [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Apostolov, S S [V N Karazin Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine); Maiselis, Z A [V N Karazin Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine)
2006-11-17
A theory of additive Markov chains with a long-range memory, proposed earlier in Usatenko et al (2003 Phys. Rev. E 68 061107), is developed and used to describe statistical properties of long-range correlated systems. The convenient characteristics of such systems, memory functions and their relation to the correlation properties of the systems are examined. Various methods for finding the memory function via the correlation function are proposed. The inverse problem (calculation of the correlation function by means of the prescribed memory function) is also solved. This is demonstrated for the analytically solvable model of the system with a step-wise memory function.
Memory functions and correlations in additive binary Markov chains
International Nuclear Information System (INIS)
Melnyk, S S; Usatenko, O V; Yampol'skii, V A; Apostolov, S S; Maiselis, Z A
2006-01-01
A theory of additive Markov chains with a long-range memory, proposed earlier in Usatenko et al (2003 Phys. Rev. E 68 061107), is developed and used to describe statistical properties of long-range correlated systems. The convenient characteristics of such systems, memory functions and their relation to the correlation properties of the systems are examined. Various methods for finding the memory function via the correlation function are proposed. The inverse problem (calculation of the correlation function by means of the prescribed memory function) is also solved. This is demonstrated for the analytically solvable model of the system with a step-wise memory function
Directory of Open Access Journals (Sweden)
Santiago Marfà
Full Text Available Early detection of fibrosis progression is of major relevance for the diagnosis and management of patients with liver disease. This study was designed to find non-invasive biomarkers for fibrosis in a clinical context where this process occurs rapidly, HCV-positive patients who underwent liver transplantation (LT. We analyzed 93 LT patients with HCV recurrence, 41 non-LT patients with liver disease showing a fibrosis stage F≥1 and 9 patients without HCV recurrence who received antiviral treatment before LT, as control group. Blood obtained from 16 healthy subjects was also analyzed. Serum samples were fractionated by ion exchange chromatography and their proteomic profile was analyzed by SELDI-TOF-MS. Characterization of the peptide of interest was performed by ion chromatography and electrophoresis, followed by tandem mass spectrometry identification. Marked differences were observed between the serum proteome profile of LT patients with early fibrosis recurrence and non-recurrent LT patients. A robust peak intensity located at 5905 m/z was the distinguishing feature of non-recurrent LT patients. However, the same peak was barely detected in recurrent LT patients. Similar results were found when comparing samples of healthy subjects with those of non-LT fibrotic patients, indicating that our findings were not related to either LT or HCV infection. Using tandem mass-spectrometry, we identified the protein peak as a C-terminal fragment of the fibrinogen α chain. Cell culture experiments demonstrated that TGF-β reduces α-fibrinogen mRNA expression and 5905 m/z peak intensity in HepG2 cells, suggesting that TGF-β activity regulates the circulating levels of this protein fragment. In conclusion, we identified a 5.9 kDa C-terminal fragment of the fibrinogen α chain as an early serum biomarker of fibrogenic processes in patients with liver disease.
A Framework for Reverse Logistics
M.P. de Brito (Marisa); R. Dekker (Rommert)
2003-01-01
textabstractReverse Logistics has been stretching out worldwide, involving all the layers of supply chains in various industry sectors. While some actors in the chain have been forced to take products back, others have pro-actively done so, attracted by the value in used products One way or the
Cloning and expression of cell wall acid invertase gene fragment ...
African Journals Online (AJOL)
A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...
END-OF-USE PRODUCTS IN REVERSE LOGISTICS
Marta Starostka-Patyk
2007-01-01
Reverse logistics is a very useful tool for enterprises which have to deal with end-of-use products. Forward logistics is not able to manage them, because they show up on the beginning of reverse supply chain. That is the reason for growing importance of reverse flows. Reverse logistics is quite new logistics system. This paper presents the idea of reverse logistics and end-of-use products problems.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Borek, Aleksandra; Sokolowska-Wedzina, Aleksandra; Chodaczek, Grzegorz; Otlewski, Jacek
2018-01-01
Fibroblast growth factor receptors (FGFRs) are promising targets for antibody-based cancer therapies, as their substantial overexpression has been found in various tumor cells. Aberrant activation of FGF receptor 2 (FGFR2) signaling through overexpression of FGFR2 and/or its ligands, mutations, or receptor amplification has been reported in multiple cancer types, including gastric, colorectal, endometrial, ovarian, breast and lung cancer. In this paper, we describe application of the phage display technology to produce a panel of high affinity single chain variable antibody fragments (scFvs) against the extracellular ligand-binding domain of FGFR2 (ECD_FGFR2). The binders were selected from the human single chain variable fragment scFv phage display libraries Tomlinson I + J and showed high specificity and binding affinity towards human FGFR2 with nanomolar KD values. To improve the affinity of the best binder selected, scFvF7, we reformatted it to a bivalent diabody format, or fused it with the Fc region (scFvF7-Fc). The scFvF7-Fc antibody construct presented the highest affinity for FGFR2, with a KD of 0.76 nM, and was selectively internalized into cancer cells overexpressing FGFR2, Snu-16 and NCI-H716. Finally, we prepared a conjugate of scFvF7-Fc with the cytotoxic drug monomethyl-auristatin E (MMAE) and evaluated its cytotoxicity. The conjugate delivered MMAE selectively to FGFR2-positive tumor cells. These results indicate that scFvF7-Fc-vcMMAE is a highly potent molecule for the treatment of cancers with FGFR2 overexpression.
Reverse logistics system and recycling potential at a landfill: A case study from Kampala City.
Kinobe, J R; Gebresenbet, G; Niwagaba, C B; Vinnerås, B
2015-08-01
The rapid growing population and high urbanisation rates in Sub-Saharan Africa has caused enormous pressure on collection services of the generated waste in the urban areas. This has put a burden on landfilling, which is the major waste disposal method. Waste reduction, re-use and recycling opportunities exist but are not fully utilized. The common items that are re-used and re-cycled are plastics, paper, aluminum, glass, steel, cardboard, and yard waste. This paper develops an overview of reverse logistics at Kiteezi landfill, the only officially recognised waste disposal facility for Kampala City. The paper analyses, in details the collection, re-processing, re-distribution and final markets of these products into a reversed supply chain network. Only 14% of the products at Kiteezi landfill are channeled into the reverse chain while 63% could be included in the distribution chain but are left out and disposed of while the remaining 23% is buried. This is because of the low processing power available, lack of market value, lack of knowledge and limited value addition activities to the products. This paper proposes possible strategies of efficient and effective reverse logistics development, applicable to Kampala City and other similar cities. Copyright © 2015 Elsevier Ltd. All rights reserved.
Li, Zhuang; Cheng, Yue; Xi, Hualong; Gu, Tiejun; Yuan, Ruosen; Chen, Xiaoxu; Jiang, Chunlai; Kong, Wei; Wu, Yongge
2015-12-01
Fatal rabies can be prevented effectively by post-exposure prophylactic (PEP) with rabies immunoglobulin (RIG). Single-chain variable fragments (scFv), which are composed of a variable heavy chain (VH) and a variable light chain (VL) connected by a peptide linker, can potentially be used to replace RIG. However, in our previous study, a scFv (scFV57S) specific for the rabies virus (RV) G protein showed a lower neutralizing potency than that of its parent IgG due to lower stability and altered peptide assembly pattern. In monoclonal antibodies, the VH and VL interact non-covalently, while in scFvs the VH is connected covalently with the VL by the artificial linker. In this study, we constructed and expressed two peptides 57VL-JUN-HIS and 57VH-FOS-HA in Escherichia coli. The well-known Fos and Jun leucine zippers were utilized to dimerize VH and VL similarly to the IgG counterpart. The two peptides assembled to form zipFv57S in vitro. Due to the greater similarity in structure with IgG, the zipFv57S protein showed a higher binding ability and affinity resulting in notable improvement of in vitro neutralizing activity over its corresponding scFv. The zipFv57S protein was also found to be more stable and showed similar protective rate as RIG in mice challenged with a lethal dose of RV. Our results not only indicated zipFv57S as an ideal alternative for RIG in PEP but also offered a novel and efficient hetero-dimerization pattern of VH and VL leading to enhanced neutralizing potency. Copyright © 2015. Published by Elsevier Ltd.
Roy, Sudeshna; Spilling, Christopher D.
2010-01-01
A convergent synthesis of the C(18)–C(34) fragment of amphidinolide C and the C(18)–C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with L-selectride to give the fragments of amphidinolide C and F. PMID:21028791
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Network design and operational modelling for construction green supply chain management
Directory of Open Access Journals (Sweden)
Pengfei Zhou Dong Chen
2013-01-01
Full Text Available Based on studying organizational structure of Construction Green Supply Chain Management (CGSCM, a mathematical programming model of CGSCM was proposed. The model aimed to maximize the aggregate profits of normalized construction logistics, the reverse logistics and the environmental performance. Numerical experiments show that the proposed approach can improve the aggregate profit effectively. In addition, return ratio, subsidies from governmental organizations, and environmental performance were analyzed for CGSCM performance. Herein, the proper return, subsidy and control strategy could optimize construction green supply chain.
Directory of Open Access Journals (Sweden)
R Mirnejad
2011-01-01
Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.
Entropy and long-range memory in random symbolic additive Markov chains.
Melnik, S S; Usatenko, O V
2016-06-01
The goal of this paper is to develop an estimate for the entropy of random symbolic sequences with elements belonging to a finite alphabet. As a plausible model, we use the high-order additive stationary ergodic Markov chain with long-range memory. Supposing that the correlations between random elements of the chain are weak, we express the conditional entropy of the sequence by means of the symbolic pair correlation function. We also examine an algorithm for estimating the conditional entropy of finite symbolic sequences. We show that the entropy contains two contributions, i.e., the correlation and the fluctuation. The obtained analytical results are used for numerical evaluation of the entropy of written English texts and DNA nucleotide sequences. The developed theory opens the way for constructing a more consistent and sophisticated approach to describe the systems with strong short-range and weak long-range memory.
Shigemori, Suguru; Ihara, Masaki; Sato, Takashi; Yamamoto, Yoshinari; Nigar, Shireen; Ogita, Tasuku; Shimosato, Takeshi
2017-01-01
Interleukin 6 (IL-6) is an important pathogenic factor in development of various inflammatory and autoimmune diseases and cancer. Blocking antibodies against molecules associated with IL-6/IL-6 receptor signaling are an attractive candidate for the prevention or therapy of these diseases. In this study, we developed a genetically modified strain of Lactococcus lactis secreting a single-chain variable fragment antibody against mouse IL-6 (IL6scFv). An IL6scFv-secretion vector was constructed by cloning an IL6scFv gene fragment into a lactococcal secretion plasmid and was electroporated into L. lactis NZ9000 (NZ-IL6scFv). Secretion of recombinant IL6scFv (rIL6scFv) by nisin-induced NZ-IL6scFv was confirmed by western blotting and was optimized by tuning culture conditions. We found that rIL6scFv could bind to commercial recombinant mouse IL-6. This result clearly demonstrated the immunoreactivity of rIL6scFv. This is the first study to engineer a genetically modified strain of lactic acid bacteria (gmLAB) that produces a functional anti-cytokine scFv. Numerous previous studies suggested that mucosal delivery of biomedical proteins using gmLAB is an effective and low-cost way to treat various disorders. Therefore, NZ-IL6scFv may be an attractive tool for the research and development of new IL-6 targeting agents for various inflammatory and autoimmune diseases as well as for cancer.
Directory of Open Access Journals (Sweden)
Richard Atherton
2013-06-01
Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.
Sympathetic block by metal clips may be a reversible operation
DEFF Research Database (Denmark)
Thomsen, Lars L; Mikkelsen, Rasmus T; Derejko, Miroslawa
2014-01-01
, but the question of reversibility remains controversial. Two recent experimental studies found severe histological signs of nerve damage 4-6 weeks after clip removal, but they only used conventional histopathological staining methods. METHODS: Thoracoscopic clipping of the sympathetic trunk was performed in adult...... the sympathetic chain vary tremendously. Most surgeons transect or resect the sympathetic chain, but application of a metal clip that blocks transmission of nerve impulses in the sympathetic chain is used increasingly worldwide. This approach offers potential reversibility if patients regret surgery...... suggests in theory that application of metal clips to the sympathetic chain is a reversible procedure if only the observation period is prolonged. Further studies with longer periods between application and removal as well as investigations of nerve conduction should be encouraged, because we do not know...
Arlaud, G J; Gagnon, J; Porter, R R
1982-01-01
1. The a- and b-chains of reduced and alkylated human complement subcomponent C1r were separated by high-pressure gel-permeation chromatography and isolated in good yield and in pure form. 2. CNBr cleavage of C1r b-chain yielded eight major peptides, which were purified by gel filtration and high-pressure reversed-phase chromatography. As determined from the sum of their amino acid compositions, these peptides accounted for a minimum molecular weight of 28 000, close to the value 29 100 calculated from the whole b-chain. 3. N-Terminal sequence determinations of C1r b-chain and its CNBr-cleavage peptides allowed the identification of about two-thirds of the amino acids of C1r b-chain. From our results, and on the basis of homology with other serine proteinases, an alignment of the eight CNBr-cleavage peptides from C1r b-chain is proposed. 4. The residues forming the 'charge-relay' system of the active site of serine proteinases (His-57, Asp-102 and Ser-195 in the chymotrypsinogen numbering) are found in the corresponding regions of C1r b-chain, and the amino acid sequence around these residues has been determined. 5. The N-terminal sequence of C1r b-chain has been extended to residue 60 and reveals that C1r b-chain lacks the 'histidine loop', a disulphide bond that is present in all other known serine proteinases.
How the reverse supply chain enables original equipment manufacturers to compete on low price
DEFF Research Database (Denmark)
Larsen, Samuel; Jacobsen, Peter
2015-01-01
-attached services, the purpose of this paper is to examine the relationship between the firm’s RSC processes and overall operating costs. The paper asks the question of how a firm’s RSC processes enable continuous operating cost reductions. The paper’s research method combines a literature review of known RSC......Low price is perhaps the most widely present competitive parameter forcing firms to continuously reduce their operating costs. While much literature has investigated how firms can use their reverse supply chain (RSC) processes to comply with regulations or offer RSC-enabled product......-enabled cost reduction opportunities with a multiple case study that explores unknown opportunities. The most used cost reduction opportunity among the six firms in the study’s case sample is reducing operating costs by replacing purchasing of virgin materials and internal production with recovery of used...
Directory of Open Access Journals (Sweden)
Caldeira Roberta Lima
1998-01-01
Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.
Thermoresponsive AuNPs Stabilized by Pillararene-Containing Polymers.
Liao, Xiaojuan; Guo, Lei; Chang, Junxia; Liu, Sha; Xie, Meiran; Chen, Guosong
2015-08-01
Pillararene-containing thermoresponsive polymers are synthesized via reversible addition-fragmentation chain transfer polymerization using pillararene derivatives as the effective chain transfer agents for the first time. These polymers can self-assemble into micelles and form vesicles after guest molecules are added. Furthermore, such functional polymers can be further applied to prepare hybrid gold nanoparticles, which integrate the thermoresponsivity of polymers and molecular recognition of pillararenes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Everse, S J; Spraggon, G; Veerapandian, L; Doolittle, R F
1999-03-09
The structure of fragment double-D from human fibrin has been solved in the presence and absence of the peptide ligands that simulate the two knobs exposed by the removal of fibrinopeptides A and B, respectively. All told, six crystal structures have been determined, three of which are reported here for the first time: namely, fragments D and double-D with the peptide GHRPam alone and double-D in the absence of any peptide ligand. Comparison of the structures has revealed a series of conformational changes that are brought about by the various knob-hole interactions. Of greatest interest is a moveable "flap" of two negatively charged amino acids (Glubeta397 and Aspbeta398) whose side chains are pinned back to the coiled coil with a calcium atom bridge until GHRPam occupies the beta-chain pocket. Additionally, in the absence of the peptide ligand GPRPam, GHRPam binds to the gamma-chain pocket, a new calcium-binding site being formed concomitantly.
Directory of Open Access Journals (Sweden)
Caldeira Roberta L
2000-01-01
Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.
Reverse logistics system and recycling potential at a landfill: A case study from Kampala City
International Nuclear Information System (INIS)
Kinobe, J.R.; Gebresenbet, G.; Niwagaba, C.B.; Vinnerås, B.
2015-01-01
Highlights: • Quantifies the different waste streams delivered at the landfill. • Evaluates the amount of potential waste products that enters into the reverse cycle. • Drawing out the reverse logistics activities from Kampala City to Kiteezi landfill. • Identify the storage, collection and transportation mechanisms of products to the various destinations; and finally. • The study suggests efficient measures to improve reverse logistics system. - Abstract: The rapid growing population and high urbanisation rates in Sub-Saharan Africa has caused enormous pressure on collection services of the generated waste in the urban areas. This has put a burden on landfilling, which is the major waste disposal method. Waste reduction, re-use and recycling opportunities exist but are not fully utilized. The common items that are re-used and re-cycled are plastics, paper, aluminum, glass, steel, cardboard, and yard waste. This paper develops an overview of reverse logistics at Kiteezi landfill, the only officially recognised waste disposal facility for Kampala City. The paper analyses, in details the collection, re-processing, re-distribution and final markets of these products into a reversed supply chain network. Only 14% of the products at Kiteezi landfill are channeled into the reverse chain while 63% could be included in the distribution chain but are left out and disposed of while the remaining 23% is buried. This is because of the low processing power available, lack of market value, lack of knowledge and limited value addition activities to the products. This paper proposes possible strategies of efficient and effective reverse logistics development, applicable to Kampala City and other similar cities
Reverse logistics system and recycling potential at a landfill: A case study from Kampala City
Energy Technology Data Exchange (ETDEWEB)
Kinobe, J.R., E-mail: joel.kinobe@slu.se [Department of Energy and Technology, Swedish University of Agricultural Sciences, P.O. Box 7032, SE-750 07 Uppsala (Sweden); Department of Civil and Environmental Engineering, Makerere University College of Engineering, Design, Art and Technology (CEDAT), P.O. Box 7062, Kampala (Uganda); Gebresenbet, G. [Department of Energy and Technology, Swedish University of Agricultural Sciences, P.O. Box 7032, SE-750 07 Uppsala (Sweden); Niwagaba, C.B. [Department of Civil and Environmental Engineering, Makerere University College of Engineering, Design, Art and Technology (CEDAT), P.O. Box 7062, Kampala (Uganda); Vinnerås, B. [Department of Energy and Technology, Swedish University of Agricultural Sciences, P.O. Box 7032, SE-750 07 Uppsala (Sweden)
2015-08-15
Highlights: • Quantifies the different waste streams delivered at the landfill. • Evaluates the amount of potential waste products that enters into the reverse cycle. • Drawing out the reverse logistics activities from Kampala City to Kiteezi landfill. • Identify the storage, collection and transportation mechanisms of products to the various destinations; and finally. • The study suggests efficient measures to improve reverse logistics system. - Abstract: The rapid growing population and high urbanisation rates in Sub-Saharan Africa has caused enormous pressure on collection services of the generated waste in the urban areas. This has put a burden on landfilling, which is the major waste disposal method. Waste reduction, re-use and recycling opportunities exist but are not fully utilized. The common items that are re-used and re-cycled are plastics, paper, aluminum, glass, steel, cardboard, and yard waste. This paper develops an overview of reverse logistics at Kiteezi landfill, the only officially recognised waste disposal facility for Kampala City. The paper analyses, in details the collection, re-processing, re-distribution and final markets of these products into a reversed supply chain network. Only 14% of the products at Kiteezi landfill are channeled into the reverse chain while 63% could be included in the distribution chain but are left out and disposed of while the remaining 23% is buried. This is because of the low processing power available, lack of market value, lack of knowledge and limited value addition activities to the products. This paper proposes possible strategies of efficient and effective reverse logistics development, applicable to Kampala City and other similar cities.
Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.
2003-01-01
An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical
Farr, W. M.; Mandel, I.; Stevens, D.
2015-01-01
Selection among alternative theoretical models given an observed dataset is an important challenge in many areas of physics and astronomy. Reversible-jump Markov chain Monte Carlo (RJMCMC) is an extremely powerful technique for performing Bayesian model selection, but it suffers from a fundamental difficulty and it requires jumps between model parameter spaces, but cannot efficiently explore both parameter spaces at once. Thus, a naive jump between parameter spaces is unlikely to be accepted in the Markov chain Monte Carlo (MCMC) algorithm and convergence is correspondingly slow. Here, we demonstrate an interpolation technique that uses samples from single-model MCMCs to propose intermodel jumps from an approximation to the single-model posterior of the target parameter space. The interpolation technique, based on a kD-tree data structure, is adaptive and efficient in modest dimensionality. We show that our technique leads to improved convergence over naive jumps in an RJMCMC, and compare it to other proposals in the literature to improve the convergence of RJMCMCs. We also demonstrate the use of the same interpolation technique as a way to construct efficient ‘global’ proposal distributions for single-model MCMCs without prior knowledge of the structure of the posterior distribution, and discuss improvements that permit the method to be used in higher dimensional spaces efficiently. PMID:26543580
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Economic trade-offs of additive manufacturing integration in injection moulding process chain
DEFF Research Database (Denmark)
Charalambis, Alessandro; Kerbache, Laoucine; Tosello, Guido
2017-01-01
Additive Manufacturing has emerged as an innovative set of novel technologies capable of replacing established manufacturing processes due to fabrication of highly complex parts and its continuous improvements of efficiency and cost effectiveness. This study is based on the idea that through...... the creation of synergies between additive and conventional manufacturing technologies it is possible to achieve greater cost advantages and operational benefits than by substituting injection moulding with additive manufacturing. The analysis presented explores the cost advantages that can be secured when...... additive manufacturing is used to support the fabrication of mould inserts for the product development phase of the injection moulding process chain. This study shows that fabrication of soft tooling by mean of AM is economically convenient with a cost reduction between 80% and 90%. Break-even points...
Dong, Sa; Bo, Zongyi; Zhang, Cunzheng; Feng, Jianguo; Liu, Xianjin
2018-04-01
Single-chain variable fragment (scFv) is a kind of antibody that possess only one chain of the complete antibody while maintaining the antigen-specific binding abilities and can be expressed in prokaryotic system. In this study, scFvs against Cry1 toxins were screened out from an immunized mouse phage displayed antibody library, which was successfully constructed with capacity of 6.25 × 10 7 CFU/mL. Using the mixed and alternative antigen coating strategy and after four rounds of affinity screening, seven positive phage-scFvs against Cry1 toxins were selected and characterized. Among them, clone scFv-3H9 (MG214869) showing relative stable and high binding abilities to six Cry1 toxins was selected for expression and purification. SDS-PAGE indicated that the scFv-3H9 fragments approximately 27 kDa were successfully expressed in Escherichia coli HB2151 strain. The purified scFv-3H9 was used to establish the double antibody sandwich enzyme-linked immunosorbent assay method (DAS-ELISA) for detecting six Cry1 toxins, of which the lowest detectable limits (LOD) and the lowest quantitative limits (LOQ) were 3.14-11.07 and 8.22-39.44 ng mL -1 , respectively, with the correlation coefficient higher than 0.997. The average recoveries of Cry1 toxins from spiked rice leaf samples were ranged from 84 to 95%, with coefficient of variation (CV) less than 8.2%, showing good accuracy for the multi-residue determination of six Cry1 toxins in agricultural samples. This research suggested that the constructed phage display antibody library based on the animal which was immunized with the mixture of several antigens under the same category can be used for the quick and effective screening of generic antibodies.
Czech Academy of Sciences Publication Activity Database
Kaupp, M.; Quick, A. S.; Rodriguez-Emmenegger, Cesar; Welle, A.; Trouillet, V.; Pop-Georgievski, Ognen; Wegener, M.; Barner-Kowollik, C.
2014-01-01
Roč. 24, č. 36 (2014), s. 5649-5661 ISSN 1616-301X R&D Projects: GA ČR GAP205/12/1702; GA ČR(CZ) GAP108/11/1857 Institutional support: RVO:61389013 Keywords : surface modification * porous materials * reversible addition fragmentation chain transfer polymerization Subject RIV: CD - Macromolecular Chemistry Impact factor: 11.805, year: 2014
Wu, Di; Li, Peng; Chen, Juhong
2018-01-01
In recent years, the Internet technology has been deeply influencing recycling industry to make it more intelligent and interconnected. However, most existing papers on “Internet Recycling” neglected the problem of pricing strategy under online and offline channels for different levels of recyclers. Moreover, the effect of regional differences has been emphasized a lot in dual-channel forward supply chain, but recycling field has seldom been concerned about it. In this paper, a recycling system consisting of one recycling center and several third-party recyclers (TPR) was investigated based on traditional mode and dual-channel mode. The dual-channel reverse supply chain model is transformed from traditional mode by the introduction of online channel. It involves two recycling modes, as recycling centre for online recovery and “Recycling center+TPR” for offline recovery. By establishing pricing strategies based on Stackelberg game model, the impacts of regional differences were analysed. Finally, numerical analysis was given to illustrate the effectiveness of the pricing mechanisms and strategies.
Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo
2004-01-01
We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...
How the reverse supply chain impacts the firm’s financial performance: A manufacturer’s perspective
DEFF Research Database (Denmark)
Larsen, Samuel Brüning; Masi, Donato; Feibert, Diana Cordes
2018-01-01
Purpose – Although manufacturers have traditionally viewed reverse supply chain (RSC) activities as a costly nuisance, more recent research has found that the RSC can contribute to the firm’s financial performance. This paper identifies how the RSC can contribute to the firm’s financial performance...... identified 15 distinct opportunities for RSC-contribution to the firm’s financial performance. The study has identified 56 contingency factors. These are related to market segmentation, customer behavior, product design, and the firm’s distributor network. The study includes an interrelationship network...... between factors and the RSC’s contribution. Practical implications – For managers, the paper shows how the RSC can increase the firm’s financial performance and which contingency factors determine whether operating a RSC will be financially viable if implemented. Originality/Value – While extant...
Nitroxide radicals formed in situ as polymer chain growth regulators
International Nuclear Information System (INIS)
Kolyakina, Elena V; Grishin, Dmitry F
2009-01-01
Published data on controlled synthesis of macromolecules using nitroxide radicals, formed in situ during polymerization, as polymer chain growth regulators are systematized and generalized. The attention is focused on the mechanism of polymer chain growth control during reversibly inhibited radical homopolymerization and the effect of structure of precursors and regulating additives on the polymerization kinetics of monomers of different nature and the molecular-mass characteristics of the polymers thus formed. The key methods for generation of nitroxide radicals directly during polymerization are considered. The prospects for development and practical use of these approaches for the synthesis of new polymeric materials are evaluated.
Culture impact in construction supply chain management
Tzortzatou, E. P.
2008-01-01
Awareness of cultural differences in construction supply chains is of fundamental importance because only through a thorough understanding of the manifestations of culture can fragmented supply chains be appropriately integrated into cohesive and collaborating teams which enhance project performance Hence the concept of cultural alignment with the project supply chain is introduced in order for long-term collaborative relationships based on trust, co ordination and mutual benefit to be establ...
Impact of supply chain management practices on sustainability
DEFF Research Database (Denmark)
Govindan, Kannan; Azevedo, Susana G.; Carvalho, Helena
2014-01-01
elimination," "supply chain risk management" and "cleaner production." The following lean, resilient and green supply chain management practices do not have a significant impact on supply chain sustainability: "flexible transportation," "flexible sourcing," "ISO 14001 certification," and "reverse logistics...
Selective disulfide reduction for labeling and enhancement of Fab antibody fragments
International Nuclear Information System (INIS)
Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.
2016-01-01
Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying
Liu, Yihua; Inoue, Yuuki; Ishihara, Kazuhiko
2015-11-01
To add novel functionality to quantum dots (QDs), we synthesized water-soluble and pH-responsive block-type polymers by reversible addition-fragmentation chain transfer (RAFT) polymerization. The polymers were composed of cytocompatible 2-methacryloyloxyethyl phosphorylcholine (MPC) polymer segments, which contain a small fraction of active ester groups and can be used to conjugate biologically active compounds to the polymer, and pH-responsive poly(2-(N,N-diethylamino) ethyl methacrylate (DEAEMA)) segments. One terminal of the polymer chain had a hydrophobic alkyl group that originated from the RAFT initiator. This hydrophobic group can bind to the hydrophobic layer on the QD surface. A fluorescent dye was conjugated to the polymer chains via the active ester group. The block-type polymers have an amphiphilic nature in aqueous medium. The polymers were thus easily bound to the QD surface upon evaporation of the solvent from a solution containing the block-type polymer and QDs, yielding QD/fluorescence dye-conjugated polymer hybrid nanoparticles. Fluorescence resonance energy transfer (FRET) between the QDs (donors) and the fluorescent dye molecules (acceptors) was used to obtain information on the conformational dynamics of the immobilized polymers. Higher FRET efficiency of the QD/fluorescent dye-conjugated polymer hybrid nanoparticles was observed at pH 7.4 as compared to pH 5.0 due to a stretching-shrinking conformational motion of the poly(DEAEMA) segments in response to changes in pH. We concluded that the block-type MPC polymer-modified nanoparticles could be used to evaluate the pH of cells via FRET fluorescence based on the cytocompatibility of the MPC polymer. Copyright © 2015 Elsevier B.V. All rights reserved.
Protein-Templated Fragment Ligations-From Molecular Recognition to Drug Discovery.
Jaegle, Mike; Wong, Ee Lin; Tauber, Carolin; Nawrotzky, Eric; Arkona, Christoph; Rademann, Jörg
2017-06-19
Protein-templated fragment ligation is a novel concept to support drug discovery and can help to improve the efficacy of protein ligands. Protein-templated fragment ligations are chemical reactions between small molecules ("fragments") utilizing a protein's surface as a reaction vessel to catalyze the formation of a protein ligand with increased binding affinity. The approach exploits the molecular recognition of reactive small-molecule fragments by proteins both for ligand assembly and for the identification of bioactive fragment combinations. In this way, chemical synthesis and bioassay are integrated in one single step. This Review discusses the biophysical basis of reversible and irreversible fragment ligations and gives an overview of the available methods to detect protein-templated ligation products. The chemical scope and recent applications as well as future potential of the concept in drug discovery are reviewed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Polyurea with luminophor fragments in polymer chain: synthesis and spectral properties
Novikova, Tamara S.; Barashkov, Nikolay N.; Sakhno, Tamara V.
2003-12-01
A series of aliphatic polyureas with chromophore moieties in the polymer chain, such as 7-amino-2(4"-aminophenyl)benzoxazole, have been prepared. The absorption and fluorescence spectra of these polymers as well as corresponding chromophore-containing model urea (product of condensation of 7-amino-2(4"-amino-2"-hydroxyphenyl)benzoxazole and phenylisocyanate) were studied and compared. It was found that the special feature of the model compound and polyureas is the large value of Stokes shift due to the presence of a hydroxy group in the ortho-position to the nitrogen atom of the benzoxazole ring. The model of the excited-state proton transfer in molecules containing fragments of 2-(2"-hydroxyphenyl)benzoxazole has been used for the description of bathochromic shift in emission spectra of polymer solutions and films. According to this model, the proton remains predominantly on the phenol oxygen while in the ground state (enol form). Upon UV excitation, in the first excited singlet state, the phenol is a considerably stronger acid and the nitrogen is a stronger base. Thus, the proton is transferred from the oxygen site to the nitrogen site, and the isomer formed (S"1*) is more stable than the isomer before proton transfer (S1*) S"1* can be then regarded as a vibrationally excited form of S1*. Then the molecule de-excites to the ground state, emitting a photon. In the ground state the enol form is again the more stable form and the proton will then transfer back to the oxygen. S"o is also a vibrationally excited state of So. Because of this process the absorption and fluorescence spectra of model urea and polyureas do not intersect and the value of Stokes shift is about 6000 cm-1.
International Nuclear Information System (INIS)
Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.
1990-01-01
The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome
DEFF Research Database (Denmark)
Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.
1999-01-01
A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...
"Nail" and "comb" effects of cholesterol modified NIPAm oligomers on cancer targeting liposomes
Li, Wengang; Deng, Lin; Moosa, Basem; Wang, Guangchao; Mashat, Afnan; Khashab, Niveen M.
2014-01-01
Thermosensitive liposomes are a promising approach to controlled release and reduced drug cytotoxicity. Low molecular weight N-isopropylacrylamide (NIPAm) oligomers (NOs) with different architectures (main chain NOs (MCNOs) and side chain NOs (SCNOs)) were synthesized by reversible addition-fragmentation chain transfer (RAFT) polymerization and radical polymerization and then separately used to prepare thermosensitive liposomes. A more controlled and enhanced release was observed for both NO liposomes compared to pristine ones. Two release mechanisms depending on the oligomer architecture, namely "nail" for MCNOs and "comb" for SCNOs, are proposed. In addition to thermosensitivity, the cancer targeting property of NO liposomes was achieved by further biotinylation of the delivery system. © The Royal Society of Chemistry.
Reverse Logistics: RFID the key to optimality
Directory of Open Access Journals (Sweden)
Rezwan Asif
2011-07-01
Full Text Available Purpose: The purpose of this paper is to find ways to reduce uncertainties in Reverse logistic supply chain (RLSC through the use of Radio-frequency identification (RFID technology.Design/methodology/approach: This paper reviews literature and builds model to relate RFID with uncertainties in order to optimize Reverse Logistics. Findings: RFID is really efficient to determine and detect quantity, variety and cycle times of returns; however it's not as convenient to determine quality of the returns. The collected information from RFID can be used to standardize the RLSC.Research limitations: Though it’s several and unique advantages some limitations of RFID have been identified in quality and processing sequence, collecting points and different standards, and in global usage.Originality/value: Previous studies in the area of Reverse Logistics and RFID don’t cover all impacts of this technology on RLSC. This review paper has investigated these impacts and offers a model for optimizing the Reverse Logistics Supply Chain.
SCEDS: protein fragments for molecular replacement in Phaser
Energy Technology Data Exchange (ETDEWEB)
McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)
2013-11-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.
SCEDS: protein fragments for molecular replacement in Phaser
International Nuclear Information System (INIS)
McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.
2013-01-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser
Rapid and sensitive detection of potyvirus infecting tropical tuber ...
African Journals Online (AJOL)
A reverse transcription polymerase chain reaction assay using potyvirus specific primers designed from the core of the coat protein was carried out, and a cDNA fragment of 327 bp was obtained from most of the potyviruses infecting the tropical tuber crops. Reverse transcription polymerase chain reaction (RT-PCR) ...
DEFF Research Database (Denmark)
Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte
2012-01-01
To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...
Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels
2011-12-01
Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.
Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong
2013-01-01
In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.
Artificial Synthesis of Conserved Segment S Gene Fragment of Rift ...
African Journals Online (AJOL)
Fragment of Rift Valley Fever Virus and Preliminary Study of Its Reverse ... blindness, encephalitis, hemorrhagic hepatitis, and, in serious ... over 30 mosquito species [5] of mosquito. As ..... RVFV, as a mosquito-borne virus for a multitude.
String fragmentation; La fragmentation des cordes
Energy Technology Data Exchange (ETDEWEB)
Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)
1997-10-01
The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
Non-immunogenic, hydrophilic/cationic block copolymers and uses thereof
Scales, Charles W.; Huang, Faqing; McCormick, Charles L.
2010-05-18
The present invention provides novel non-immunogenic, hydrophilic/cationic block copolymers comprising a neutral-hydrophilic polymer and a cationic polymer, wherein both polymers have well-defined chain-end functionality. A representative example of such a block copolymer comprises poly(N-(2-hydroxypropyl)methacrylamide) (PHPMA) and poly(N-[3-(dimethylamino)propyl]methacrylamide) (PDMAPMA). Also provided is a synthesis method thereof in aqueous media via reversible addition fragmentation chain transfer (RAFT) polymerization. Further provided are uses of these block copolymers as drug delivery vehicles and protection agents.
DEFF Research Database (Denmark)
Headlam, Henrietta A; Davies, Michael Jonathan
2002-01-01
Exposure of proteins to radicals in the presence of O(2) results in side-chain oxidation and backbone fragmentation; the interrelationship between these processes is not fully understood. Recently, initial attack on Ala side-chains was shown to give alpha-carbon radicals (and hence backbone cleav...
It's hard to be green: Reverse green value chain.
Couto, João; Tiago, Teresa; Gil, Artur; Tiago, Flávio; Faria, Sandra
2016-08-01
Firms have recently discovered that it is not enough to optimize internal processes and relationships with partners along the value chain to create a sustainable competitive market position. A clear customer orientation, which acknowledges that consumer buying behavior is complex and includes many elements implied in the value chain, is required. As companies offering green products are no exception to this rule, this study analyzes consumer behavior in Europe from a reserve green supply chain management perspective, using descriptive analyses and a structural equation model, with data collected by Flash Barometer comprising 26,573 responses from 28 European countries. The results suggest that European consumers are conscious of the green concept, but are not willing to buy or pay more for these products since the value is unclear. Companies offering green products must therefore rethink their strategies, especially in terms of value proposition, communication strategies, and eco-labeling. Copyright © 2016 Elsevier Inc. All rights reserved.
The Financial Supply Chain Management: a New Solution for Supply Chain Resilience
Directory of Open Access Journals (Sweden)
Virgil Popa
2013-02-01
Full Text Available In the present article, the author aims to find solutions to optimize the supply chain for the cash flow – a flow of products reversed from the physical one and the two-ways flow of information. In the last 15-20 years, academics and practitioners were oriented towards increasing the speed, cost reduction on supply chain material’s flow, oriented towards 3RP (3 Resource Planning logistics solutions and management solutions such as outsourcing or collaborative management. In terms of information flow, there has been a real revolution with the rise of the Internet and information technology standards introduced by the VICS (Voluntary Interindustry Commerce Standards, CSCMP (Council of Supply Chain Management Professionals, SCC (Supply Chain Council şi ECR Europe (Efficient Consumer Respons. The objective of this paper is to identify new ways of working together on supply chain financial flows. Methods used are the documentation in the literature and the practices of transnational companies under recession. Results refer to the identification of new solutions such as reverse factoring. A comparative analysis regarding the european and national regulations gets us to the conclusion that Romania is still tributary to traditional commercial credit. We propose that the Collaborative management, as a modus vivendi in a globalized and super computerized world, must be included within all Romanian organizations life, within the Supply Chain, but also those which are 3PL (Third Part Logistics and 4PL (Four Part Logistics organizations, where not only information services are included, but also financial services (banks and specialized financial institutions.
Primary structure of the hemoglobin alpha-chain of rose-ringed parakeet (Psittacula krameri).
Islam, A; Beg, O U; Persson, B; Zaidi, Z H; Jörnvall, H
1988-10-01
The structure of the hemoglobin alpha-chain of Rose-ringed Parakeet was determined by sequence degradations of the intact subunit, the CNBr fragments, and peptides obtained by digestion with staphylococcal Glu-specific protease and trypsin. Using this analysis, the complete alpha-chain structure of 21 avian species is known, permitting comparisons of the protein structure and of avian relationships. The structure exhibits differences from previously established avian alpha-chains at a total of 61 positions, five of which have residues unique to those of the parakeet (Ser-12, Gly-65, Ser-67, Ala-121, and Leu-134). The analysis defines hemoglobin variation within an additional avian order (Psittaciformes), demonstrates distant patterns for evaluation of relationships within other avian orders, and lends support to taxonomic conclusions from molecular data.
Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui
2016-11-22
Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.
Packing motifs as predictors of the propensity of antibody fragments to crystallize
Edmundson, Allen B.; DeWitt, Christina R.; Goldsteen, Benjamin Z.; Ramsland, Paul A.
1999-01-01
A recurring theme in the crystallization of antibody fragments in our laboratory has been a packing pattern involving formation of intermolecular, antiparallel β-pleated sheets across two-fold axes. The most common motif is the antiparallel stacking of constant (C) domains of light (L) chain dimers or Fab molecules. Here, cross-molecule six-stranded sheets are produced by hydrogen-bonding interactions of three-residue polypeptide segments (triads), in the i, i+2 and i+4 positions of the final strands (designated 3-3) of the three-chain layers from two adjacent molecules. In the variable (V) domains the triads are supplied by the first strands (4-1) of the four-chain layers and the resulting cross-molecule sheets contain eight strands. The latter type of packing is more likely to be seen in crystals of Fv fragments (V domains only) than in those of L chain dimers or Fabs. Amongst the triads from either the V or C domains, there are on average four sets of backbone carbonyl and amide groups within hydrogen bonding distance (chain dimers, Fab and Fvs are likely to crystallize in these packing patterns.
A reversible-jump Markov chain Monte Carlo algorithm for 1D inversion of magnetotelluric data
Mandolesi, Eric; Ogaya, Xenia; Campanyà, Joan; Piana Agostinetti, Nicola
2018-04-01
This paper presents a new computer code developed to solve the 1D magnetotelluric (MT) inverse problem using a Bayesian trans-dimensional Markov chain Monte Carlo algorithm. MT data are sensitive to the depth-distribution of rock electric conductivity (or its reciprocal, resistivity). The solution provided is a probability distribution - the so-called posterior probability distribution (PPD) for the conductivity at depth, together with the PPD of the interface depths. The PPD is sampled via a reversible-jump Markov Chain Monte Carlo (rjMcMC) algorithm, using a modified Metropolis-Hastings (MH) rule to accept or discard candidate models along the chains. As the optimal parameterization for the inversion process is generally unknown a trans-dimensional approach is used to allow the dataset itself to indicate the most probable number of parameters needed to sample the PPD. The algorithm is tested against two simulated datasets and a set of MT data acquired in the Clare Basin (County Clare, Ireland). For the simulated datasets the correct number of conductive layers at depth and the associated electrical conductivity values is retrieved, together with reasonable estimates of the uncertainties on the investigated parameters. Results from the inversion of field measurements are compared with results obtained using a deterministic method and with well-log data from a nearby borehole. The PPD is in good agreement with the well-log data, showing as a main structure a high conductive layer associated with the Clare Shale formation. In this study, we demonstrate that our new code go beyond algorithms developend using a linear inversion scheme, as it can be used: (1) to by-pass the subjective choices in the 1D parameterizations, i.e. the number of horizontal layers in the 1D parameterization, and (2) to estimate realistic uncertainties on the retrieved parameters. The algorithm is implemented using a simple MPI approach, where independent chains run on isolated CPU, to take
Yuan, Qing; Jordan, Ramon; Brlansky, Ronald H; Istomina, Olga; Hartung, John
2015-10-01
Xylella fastidiosa is a member of the gamma proteobacteria. It is fastidious, insect-vectored and xylem-limited and causes a variety of diseases, some severe, on a wide range of economically important perennial crops, including grape and citrus. Antibody based detection assays are commercially available for X. fastidiosa, and are effective at the species, but not at the subspecies level. We have made a library of scFv antibody fragments directed against X. fastidiosa subsp. pauca strain 9a5c (citrus) by using phage display technology. Antibody gene repertoires were PCR-amplified using 23 primers for the heavy chain variable region (V(H)) and 21 primers for the light chain variable region (V(L)). The V(H) and V(L) were joined by overlap extension PCR, and then the genes of the scFv library were ligated into the phage vector pKM19. The library contained 1.2×10(7) independent clones with full-length scFv inserts. In each of 3cycles of affinity-selection with 9a5c, about 1.0×10(12) phage were used for panning with 4.1×10(6), 7.1×10(6), 2.1×10(7) phage recovered after the first, second and third cycles, respectively. Sixty-six percent of clones from the final library bound X. fastidiosa 9a5c in an ELISA. Some of these scFv antibodies recognized strain 9a5c and did not recognize X. fastidiosa strains that cause Pierce's disease of grapevine. Published by Elsevier B.V.
Compound nucleus studies withy reverse kinematics
International Nuclear Information System (INIS)
Moretto, L.G.
1985-06-01
Reverse kinematics reactions are used to demonstrate the compound nucleus origin of intermediate mass particles at low energies and the extension of the same mechanism at higher energies. No evidence has appeared in our energy range for liquid-vapor equilibrium or cold fragmentation mechanisms. 11 refs., 12 figs
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
Directory of Open Access Journals (Sweden)
Pooja H. Gupta
2015-05-01
Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.
Gladysz, Rafaela; Cleenewerck, Matthias; Joossens, Jurgen; Lambeir, Anne-Marie; Augustyns, Koen; Van der Veken, Pieter
2014-10-13
Fragment-based drug discovery (FBDD) has evolved into an established approach for "hit" identification. Typically, most applications of FBDD depend on specialised cost- and time-intensive biophysical techniques. The substrate activity screening (SAS) approach has been proposed as a relatively cheap and straightforward alternative for identification of fragments for enzyme inhibitors. We have investigated SAS for the discovery of inhibitors of oncology target urokinase (uPA). Although our results support the key hypotheses of SAS, we also encountered a number of unreported limitations. In response, we propose an efficient modified methodology: "MSAS" (modified substrate activity screening). MSAS circumvents the limitations of SAS and broadens its scope by providing additional fragments and more coherent SAR data. As well as presenting and validating MSAS, this study expands existing SAR knowledge for the S1 pocket of uPA and reports new reversible and irreversible uPA inhibitor scaffolds. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Combining or Separating Forward and Reverse Logistics
DEFF Research Database (Denmark)
Herbert-Hansen, Zaza Nadja Lee; Larsen, Samuel; Nielsen, Anders
2018-01-01
Purpose – While forward logistics handles and manages the flow of goods downstream in the supply chain from suppliers to customers, reverse logistics (RL) manages the flow of returned goods upstream. A firm can combine reverse logistics with forward logistics, keep the flows separated, or choose......-research addresses intra-RL issues while the relationship between forward and reverse logistics is under-researched. This paper contributes to RL-theory by identifying the contextual factors that determine the most advantageous relationship between forward and reverse logistics, and proposes a novel decision making...
Jian, Zhongbao; Cui, Dongmei; Hou, Zhaomin; Li, Xiaofang
2010-05-07
Aminophenyl functionalized cyclopentadienyl ligated rare-earth metal allyl mediated cationic systems display high cis-1,4 selectivity for the polymerization of isoprene, and living reversible and rapid chain transfer to aluminium additives.
International Nuclear Information System (INIS)
Miyata, Kenichi; Takagi, Satoshi; Sato, Shigeo; Morioka, Hiroshi; Shiba, Kiyotaka; Minamisawa, Tamiko; Takami, Miho; Fujita, Naoya
2014-01-01
Almost all highly metastatic tumor cells possess high platelet aggregating abilities, thereby form large tumor cell-platelet aggregates in the microvasculature. Embolization of tumor cells in the microvasculature is considered to be the first step in metastasis to distant organs. We previously identified the platelet aggregation-inducing factor expressed on the surfaces of highly metastatic tumor cells and named as Aggrus. Aggrus was observed to be identical to the marker protein podoplanin (alternative names, T1α, OTS-8, and others). Aggrus is frequently overexpressed in several types of tumors and enhances platelet aggregation by interacting with the platelet receptor C-type lectin-like receptor 2 (CLEC-2). Here, we generated a novel single-chain antibody variable region fragment (scFv) by linking the variable regions of heavy and light chains of the neutralizing anti-human Aggrus monoclonal antibody MS-1 with a flexible peptide linker. Unfortunately, the generated KM10 scFv failed to suppress Aggrus-induced platelet aggregation in vitro. Therefore, we performed phage display screening and finally obtained a high-affinity scFv, K-11. K-11 scFv was able to suppress Aggrus-induced platelet aggregation in vitro. Moreover, K-11 scFv prevented the formation of pulmonary metastasis in vivo. These results suggest that K-11 scFv may be useful as metastasis inhibitory scFv and is expected to aid in the development of preclinical and clinical examinations of Aggrus-targeted cancer therapies
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
The production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi
Joosten, V.; Lokman, C.; Hondel, C.A.M.J.J. van den; Punt, P.J.
2003-01-01
In this review we will focus on the current status and views concerning the production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi. We will focus on single-chain antibody fragment production (scFv and VHH) by these lower eukaryotes and the possible applications
Zhu, Shuzhe; Li, Zhan-Wei; Zhao, Hanying
2015-04-14
Patchy particles are a type of colloidal particles with one or more well-defined patches on the surfaces. The patchy particles with multiple compositions and functionalities have found wide applications from the fundamental studies to practical uses. In this research patchy micelles with thiol groups in the patches were prepared based on coassembly of free block copolymer chains and block copolymer brushes on silica particles. Thiol-terminated and cyanoisopropyl-capped polystyrene-block-poly(N-isopropylacrylamide) block copolymers (PS-b-PNIPAM-SH and PS-b-PNIPAM-CIP) were synthesized by reversible addition-fragmentation chain transfer polymerization and chemical modifications. Pyridyl disulfide-functionalized silica particles (SiO2-SS-Py) were prepared by four-step surface chemical reactions. PS-b-PNIPAM brushes on silica particles were prepared by thiol-disulfide exchange reaction between PS-b-PNIPAM-SH and SiO2-SS-Py. Surface micelles on silica particles were prepared by coassembly of PS-b-PNIPAM-CIP and block copolymer brushes. Upon cleavage of the surface micelles from silica particles, patchy micelles with thiol groups in the patches were obtained. Dynamic light scattering, transmission electron microscopy, and zeta-potential measurements demonstrate the preparation of patchy micelles. Gold nanoparticles can be anchored onto the patchy micelles through S-Au bonds, and asymmetric hybrid structures are formed. The thiol groups can be oxidized to disulfides, which results in directional assembly of the patchy micelles. The self-assembly behavior of the patchy micelles was studied experimentally and by computer simulation.
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
Directory of Open Access Journals (Sweden)
Azzedine Bounamous
2014-07-01
Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.
The mediating effect of sustainability control system on reverse ...
African Journals Online (AJOL)
This paper analyses part of the viability of green supply chain management practices created for fisheries industry to implement sustainability control system adoption as mediating on reverse logistics innovation and customer environmental collaboration towards sustainability performance. It examines reverse logistics ...
Kinetics of a Migration-Driven Aggregation-Fragmentation Process
Institute of Scientific and Technical Information of China (English)
ZHUANGYou-Yi; LINZhen-Quan; KEJian-Hon~
2003-01-01
We propose a reversible model of the migration-driven aggregation-fragmentation process with the symmetric migration rate kernels K (k; j) = K′(k; j) =λkjv and the constant aggregation rates I1, I2 and fragmentation rates Jl, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions in several cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When Jl = 0 and J2 = O, the aggregate size distributions αk(t) and bk(t) obey the conventional scaling law, while when Jl > 0 and J2 > O, they obey the modified scaling law with an exponential scaling function. The total mass of either species remains conserved.
Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L
2015-01-01
Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Directory of Open Access Journals (Sweden)
Ji Yeon Kwon
2013-09-01
Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.
Derboven, Pieter; Van Steenberge, Paul H M; Vandenbergh, Joke; Reyniers, Marie-Francoise; Junkers, Thomas; D'hooge, Dagmar R; Marin, Guy B
2015-12-01
The superior capabilities of structured microreactors over batch reactors are demonstrated for reversible addition-fragmentation chain transfer (RAFT) solution polymerization of n-butyl acrylate with the aid of simulations, explicitly accounting for the chain length distribution of all macrospecies types. Since perfect isothermicity can be established in a microreactor, less side products due to backbiting and β-scission are formed compared to the batch operation in which ineffective heat removal leads to an undesirable temperature spike. For a given RAFT chain transfer agent (CTA), additional microstructural control results under microflow conditions by optimizing the reaction temperature, lowering the dilution degree, or decreasing the initial molar ratio of monomer to RAFT CTA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Monotone measures of ergodicity for Markov chains
Directory of Open Access Journals (Sweden)
J. Keilson
1998-01-01
Full Text Available The following paper, first written in 1974, was never published other than as part of an internal research series. Its lack of publication is unrelated to the merits of the paper and the paper is of current importance by virtue of its relation to the relaxation time. A systematic discussion is provided of the approach of a finite Markov chain to ergodicity by proving the monotonicity of an important set of norms, each measures of egodicity, whether or not time reversibility is present. The paper is of particular interest because the discussion of the relaxation time of a finite Markov chain [2] has only been clean for time reversible chains, a small subset of the chains of interest. This restriction is not present here. Indeed, a new relaxation time quoted quantifies the relaxation time for all finite ergodic chains (cf. the discussion of Q1(t below Equation (1.7]. This relaxation time was developed by Keilson with A. Roy in his thesis [6], yet to be published.
Weber, Juliane; Zachow, Christopher; Witthaut, Dirk
2018-03-01
Wind power generation exhibits a strong temporal variability, which is crucial for system integration in highly renewable power systems. Different methods exist to simulate wind power generation but they often cannot represent the crucial temporal fluctuations properly. We apply the concept of additive binary Markov chains to model a wind generation time series consisting of two states: periods of high and low wind generation. The only input parameter for this model is the empirical autocorrelation function. The two-state model is readily extended to stochastically reproduce the actual generation per period. To evaluate the additive binary Markov chain method, we introduce a coarse model of the electric power system to derive backup and storage needs. We find that the temporal correlations of wind power generation, the backup need as a function of the storage capacity, and the resting time distribution of high and low wind events for different shares of wind generation can be reconstructed.
Weber, Juliane; Zachow, Christopher; Witthaut, Dirk
2018-03-01
Wind power generation exhibits a strong temporal variability, which is crucial for system integration in highly renewable power systems. Different methods exist to simulate wind power generation but they often cannot represent the crucial temporal fluctuations properly. We apply the concept of additive binary Markov chains to model a wind generation time series consisting of two states: periods of high and low wind generation. The only input parameter for this model is the empirical autocorrelation function. The two-state model is readily extended to stochastically reproduce the actual generation per period. To evaluate the additive binary Markov chain method, we introduce a coarse model of the electric power system to derive backup and storage needs. We find that the temporal correlations of wind power generation, the backup need as a function of the storage capacity, and the resting time distribution of high and low wind events for different shares of wind generation can be reconstructed.
Applying Revenue Management to the Reverse Supply Chain
M. Ferguson (Mark); M. Fleischmann (Moritz); G.C. Souza (Gilvan)
2008-01-01
textabstractWe study the disposition decision for product returns in a closed-loop supply chain. Motivated by the asset recovery process at IBM, we consider two disposition alternatives. Returns may be either refurbished for reselling or dismantled for spare parts. Reselling a refurbished unit
International Nuclear Information System (INIS)
He, Jia; Qin, Weichao; Zhang, Xujia; Wen, Yang; Su, Limin; Zhao, Yuanhui
2013-01-01
Prediction of the biodegradability of organic pollutants is an ecologically desirable and economically feasible tool for estimating the environmental fate of chemicals. In this paper, linear and nonlinear relationships between biological oxygen demand (BOD) and molecular descriptors/fragments have been investigated for 1130 organic chemicals. Significant relationships have been observed between the simple molecular descriptors and %BOD for some homologous compounds, but not for the whole set of compounds. Electronic parameters, such as E HOMO and E LUMO , are the dominant factors affecting the biodegradability for some homologous chemicals. However, other descriptors, such as molecular weight, acid dissociation constant and polarity still have a significant impact on the biodegradation. The best global model for %BOD prediction is that developed from a chain-based fragmentation scheme. At the same time, the theoretical relationship between %BOD and molecular descriptors/fragments has been investigated, based on a first-order kinetic process. The %BOD is nonlinearly, rather than linearly, related to the descriptors. The coefficients of determination can be significantly improved by using nonlinear models for the homologous compounds and the whole data set. After analysing 1130 ready and not ready biodegradable compounds using 23 simple descriptors and various fragmentation schemes, it was revealed that biodegradation could be well predicted from a chain-based fragmentation scheme, a decision tree and a %BOD model. The models were capable of separating NRB and RB with an overall accuracy of 87.2%, 83.0% and 82.5%, respectively. The best classification model developed was a chain-based model but it used 155 fragments. The simplest model was a decision tree which only used 10 structural fragments. The effect of structures on the biodegradation has been analysed and the biodegradation pathway and mechanisms have been discussed based on activating and inactivating
International Nuclear Information System (INIS)
Trinh, Thi-Kim-Hoang; Passarello, Jean-Philippe; Hemptinne, Jean-Charles de; Lugo, Rafael; Lachet, Veronique
2016-01-01
This work consists of the adaptation of a non-additive hard sphere theory inspired by Malakhov and Volkov [Polym. Sci., Ser. A 49(6), 745–756 (2007)] to a square-well chain. Using the thermodynamic perturbation theory, an additional term is proposed that describes the effect of perturbing the chain of square well spheres by a non-additive parameter. In order to validate this development, NPT Monte Carlo simulations of thermodynamic and structural properties of the non-additive square well for a pure chain and a binary mixture of chains are performed. Good agreements are observed between the compressibility factors originating from the theory and those from molecular simulations.
The response of dense dry granular material to the shear reversal
Zhang, Jie; Ren, Jie; Farhadi, Somayeh; Behringer, Robert
2008-11-01
We have performed two dimensional granular experiments under pure shear using bidisperse photo-elastic disks. Starting from a stress free state, a square box filled with granular particles is subject to shear. The forward shears involved various number of steps, leading to maximum strains between 0.1 and 0.3. The area is kept constant during the shear. The network of force chains gradually built up as the strain increased, leading to increased pressure and shear stress. Reverse shear was then applied to the system. Depending on the initial packing fraction and the strain at which the shear is reversed, the force chain network built prior to the shear reversal may be destroyed completely or partially destroyed. Following the force chain weakening, when the reserve shear is continuously applied to the system, there is a force chain strengthening. Following each change of the system, contact forces of individual disks were measured by applying an inverse algorithm. We also kept track of the displacement and angle of rotation of every particle from frame to frame. We present the results for the structure failure and reconstruction during shear reversals. We also present data for stresses, contact force distributions and other statistical measures.
Fei, Pengzhan; Cavicchi, Kevin
2011-03-01
A new ABA triblock copolymer of poly(styrene-block- methylacrylate-random-octadecylacrylate-block-styrene) (PS-b- PMA-r-PODA-b-PS) was synthesized by reversible addition fragmentation chain transfer polymerization. The triblock copolymer can generate a three-dimensional, physically crosslinked network by self-assembly, where the glassy PS domains physically crosslink the midblock chains. The side chain crystallization of the polyoctadecylacrylare (PODA) side chain generates a second reversible network enabling shape memory properties. Shape memory tests by uniaxial deformation and recovery of molded dog-bone shape samples demonstrate that shape fixities above 96% and shape recoveries above 98% were obtained for extensional strains up to 300%. An outstanding advantage of this shape memory material is that it can be very easily shaped and remolded by elevating the temperature to 140circ; C, and after remolding the initial shape memory properties are totally recovered by eliminating the defects introduced by the previous deformation cycling.
Isolation and characterization of anti c-met single chain fragment variable (scFv) antibodies.
Qamsari, Elmira Safaie; Sharifzadeh, Zahra; Bagheri, Salman; Riazi-Rad, Farhad; Younesi, Vahid; Abolhassani, Mohsen; Ghaderi, Sepideh Safaei; Baradaran, Behzad; Somi, Mohammad Hossein; Yousefi, Mehdi
2017-12-01
The receptor tyrosine kinase (RTK) Met is the cell surface receptor for hepatocyte growth factor (HGF) involved in invasive growth programs during embryogenesis and tumorgenesis. There is compelling evidence suggesting important roles for c-Met in colorectal cancer proliferation, migration, invasion, angiogenesis, and survival. Hence, a molecular inhibitor of an extracellular domain of c-Met receptor that blocks c-Met-cell surface interactions could be of great thera-peutic importance. In an attempt to develop molecular inhibitors of c-Met, single chain variable fragment (scFv) phage display libraries Tomlinson I + J against a specific synthetic oligopeptide from the extracellular domain of c-Met receptor were screened; selected scFv were then characterized using various immune techniques. Three c-Met specific scFv (ES1, ES2, and ES3) were selected following five rounds of panning procedures. The scFv showed specific binding to c-Met receptor, and significantly inhibited proliferation responses of a human colorectal carcinoma cell line (HCT-116). Moreover, anti- apoptotic effects of selected scFv antibodies on the HCT-116 cell line were also evaluated using Annexin V/PI assays. The results demonstrated rates of apoptotic cell death of 46.0, 25.5, and 37.8% among these cells were induced by use of ES1, ES2, and ES3, respectively. The results demonstrated ability to successfully isolate/char-acterize specific c-Met scFv that could ultimately have a great therapeutic potential in immuno-therapies against (colorectal) cancers.
Energy Technology Data Exchange (ETDEWEB)
Niyazi, F. F.; Kalontarov, I. Ya.; Chayko, Yu. V.; Kasimova, E. I. [V.I. Nikitin Institute of Chemistry, Academy of Sciences of the Republic of Tajikistan, Dushanbe, (Tajikistan)
1994-07-01
Indane and carbazole derivatives, poly conjugated azomethine, bis-benzimidazole were studied as chemical additives. Photo stabilizing effect was studied as well. It was found that photo stabilizing effect doesn't depend on nature of functional groups of substituent in aromatic nucleus and specified by length and efficiency of conjugation chains.
Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George
2003-05-01
Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.
Microbial platform technology for recombinant antibody fragment production: A review.
Gupta, Sanjeev Kumar; Shukla, Pratyoosh
2017-02-01
Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.
SCit: web tools for protein side chain conformation analysis
Gautier, R.; Camproux, A.-C.; Tufféry, P.
2004-01-01
SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each...
Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Cesare Bonacina
2010-01-01
Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.
SCit: web tools for protein side chain conformation analysis.
Gautier, R; Camproux, A-C; Tufféry, P
2004-07-01
SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each protein for side chain positioning and the identification of side chains with unlikely conformations. The SCit web server is accessible at http://bioserv.rpbs.jussieu.fr/SCit.
International Nuclear Information System (INIS)
Vojtsitskij, V.M.; Fedorov, A.N.; Lugovskoj, Eh.B.; Derzskaya, S.G.; Khizhnyak, S.V.; Kurskij, M.D.; Kucherenko, N.E.
1990-01-01
Early (1 and 24 h) after X-irradiation with a dose of 0.21 C/kg changes occurred in the acceptibility of the polypeptide chain parts of sarcoplasmic reticulum Ca-ATPase for the effect of trypsin. The analysis of the results of studying the structural and functional properties of a hydrophobic fragment of this enzyme in the control and after irradiation permitted to define the part of the Ca-ATPase polypeptide chain that provided ion selectivity of the fragment
Constant region of a kappa III immunoglobulin light chain as a major AL-amyloid protein
DEFF Research Database (Denmark)
Engvig, J P; Olsen, K E; Gislefoss, R E
1998-01-01
AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein and the correspond......AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein...... and the corresponding AL protein as a kappa III immunoglobulin light chain from material of a patient with systemic AL-amyloidosis presenting as a local inguinal tumour. The two proteins showed some unique features. The major part of the AL amyloid fibril protein consisted of C-terminal fragments of the Bence......-Jones protein. Furthermore, both the Bence-Jones protein and the AL protein were glycosylated, with possibly a glycosylation in the constant part of the light chain....
Properties, production and applications of camelid single-domain antibody fragments
Harmsen, M.M.; Haard, de H.J.
2007-01-01
Camelids produce functional antibodies devoid of light chains of which the single N-terminal domain is fully capable of antigen binding. These single-domain antibody fragments (VHHs or Nanobodies®) have several advantages for biotechnological applications. They are well expressed in microorganisms
Energy Technology Data Exchange (ETDEWEB)
Dey, Sumit K.; Saha, Shekhar; Das, Provas; Das, Mahua R.; Jana, Siddhartha S., E-mail: bcssj@iacs.res.in
2014-08-01
3-Methylcholanthrene (3MC) induces tumor formation at the site of injection in the hind leg of mice within 110 days. Recent reports reveal that the transformation of normal muscle cells to atypical cells is one of the causes for tumor formation, however the molecular mechanism behind this process is not well understood. Here, we show in an in vitro study that 3MC induces fragmentation of multinucleate myotubes into viable mononucleates. These mononucleates form colonies when they are seeded into soft agar, indicative of cellular transformation. Immunoblot analysis reveals that phosphorylation of myosin regulatory light chain (RLC{sub 20}) is 5.6±0.5 fold reduced in 3MC treated myotubes in comparison to vehicle treated myotubes during the fragmentation of myotubes. In contrast, levels of myogenic factors such as MyoD, Myogenin and cell cycle regulators such as Cyclin D, Cyclin E1 remain unchanged as assessed by real-time PCR array and reverse transcriptase PCR analysis, respectively. Interestingly, addition of the myosin light chain kinase inhibitor, ML-7, enhances the fragmentation, whereas phosphatase inhibitor perturbs the 3MC induced fragmentation of myotubes. These results suggest that decrease in RLC{sub 20} phosphorylation may be associated with the fragmentation step of dedifferentiation. - Highlights: • 3-Methylcholanthrene induces fragmentation of C2C12-myotubes. • Dedifferentiation can be divided into two steps – fragmentation and proliferation. • Fragmentation is associated with rearrangement of nonmuscle myosin II. • Genes associated with differentiation and proliferation are not altered during fragmentation. • Phosphorylation of myosin regulatory light chain is reduced during fragmentation.
International Nuclear Information System (INIS)
Liu Renlong; Zhang Huiyan; Li Yintao; Zhou Yuanlin; Zhang Quanping; Zheng Jian; Wang Shanqiang
2016-01-01
The poly(methyl methacrylate)-block-poly(methacrylic acid) diblock copolymer with different monomer compositions was synthesized via reversible addition-fragmentation chain transfer polymerization. Meanwhile, a novel self-embrittling strippable coating was prepared using the diblock copolymers, which is proposed to be used as radioactive decontamination agents without manual operation. Furthermore, the decontamination efficiencies of self-embrittling strippable coatings for radioactive contamination on glass, marble, and stainless steel surfaces were studied. (author)
Reversible modulation of CsPbBr3 perovskite nanocrystal/gold nanoparticle heterostructures.
Chen, Shanshan; Lyu, Danya; Ling, Tao; Guo, Weiwei
2018-04-19
A facile strategy is illustrated to reversibly modulate CsPbBr3 perovskite nanocrystal/Au nanoparticle heterostructures with the reversible formation and fragmentation of gold nanoparticles anchored to the corners and surface of CsPbBr3 perovskite nanocrystals. The modulation process was performed under ambient conditions and could be conducted for cycles.
Top Management Support Partially Optimized Reverse Logistics in The Manufacturing Sector of Pakistan
Directory of Open Access Journals (Sweden)
Ms. Sitara Shafiq
2013-07-01
Full Text Available Supply chain management urges reverse logistics to be an effective tool for organizational competitive advantage. Reverse chains demand astute resource deployments and strategic focus by the top management. In Pakistan manufacturing industries employing reverse logistics for cost effectiveness reported heavy reliance on top management support. However, literature is yet not benefited by such empirical facts. This study hypothesized that top management support is key for cost effective reverse logistics. Collecting and analyzing reliable data for various elements of its variables of interests, the study confirmed considerable multi linear regression between top management support and cost effectiveness. Substantiating the hypothesis, it contributes that a significant impact of strategic focus and resource commitment by top management leads reverse logistics based manufacturers to success.
Characterization of Lipid A Variants by Energy-Resolved Mass Spectrometry: Impact of Acyl Chains
Crittenden, Christopher M.; Akin, Lucas D.; Morrison, Lindsay J.; Trent, M. Stephen; Brodbelt, Jennifer S.
2017-06-01
Lipid A molecules consist of a diglucosamine sugar core with a number of appended acyl chains that vary in their length and connectivity. Because of the challenging nature of characterizing these molecules and differentiating between isomeric species, an energy-resolved MS/MS strategy was undertaken to track the fragmentation trends and map genealogies of product ions originating from consecutive cleavages of acyl chains. Generalizations were developed based on the number and locations of the primary and secondary acyl chains as well as variations in preferential cleavages arising from the location of the phosphate groups. Secondary acyl chain cleavage occurs most readily for lipid A species at the 3' position, followed by primary acyl chain fragmentation at both the 3' and 3 positions. In the instances of bisphosphorylated lipid A variants, phosphate loss occurs readily in conjunction with the most favorable primary and secondary acyl chain cleavages. [Figure not available: see fulltext.
Wang, Dong; Ming, Fei; Huang, Ai-Jun; Sun, Wen-Yang; Ye, Liu
2017-09-01
The uncertainty principle configures a low bound to the measuring precision for a pair of non-commuting observables, and hence is considerably nontrivial to quantum precision measurement in the field of quantum information theory. In this letter, we consider the entropic uncertainty relation (EUR) in the context of quantum memory in a two-qubit isotropic Heisenberg spin chain. Specifically, we explore the dynamics of EUR in a practical scenario, where two associated nodes of a one-dimensional XXX-spin chain, under an inhomogeneous magnetic field, are connected to a thermal entanglement. We show that the temperature and magnetic field effect can lead to the inflation of the measuring uncertainty, stemming from the reduction of systematic quantum correlation. Notably, we reveal that, firstly, the uncertainty is not fully dependent on the observed quantum correlation of the system; secondly, the dynamical behaviors of the measuring uncertainty are relatively distinct with respect to ferromagnetism and antiferromagnetism chains. Meanwhile, we deduce that the measuring uncertainty is dramatically correlated with the mixedness of the system, implying that smaller mixedness tends to reduce the uncertainty. Furthermore, we propose an effective strategy to control the uncertainty of interest by means of quantum weak measurement reversal. Therefore, our work may shed light on the dynamics of the measuring uncertainty in the Heisenberg spin chain, and thus be important to quantum precision measurement in various solid-state systems.
Probing the RAFT process using a model reaction between alkoxyamine and dithioester
Zhou, Y.
2012-01-01
A small-molecular model reaction was designed to probe the reversible addition–fragmentation chain transfer (RAFT) process. In this reaction, alkoxyamine releases radicals that react in situ with dithioester through the RAFT process, generating new radicals through the fragmentation of the
Stability of global entanglement in thermal states of spin chains
International Nuclear Information System (INIS)
Brennen, Gavin K.; Bullock, Stephen S.
2004-01-01
We investigate the entanglement properties of a one-dimensional chain of qubits coupled via nearest-neighbor spin-spin interactions. The entanglement measure used is the n-concurrence, which is distinct from other measures on spin chains such as bipartite entanglement in that it can quantify 'global' entanglement across the spin chain. Specifically, it computes the overlap of a quantum state with its time-reversed state. As such, this measure is well suited to study ground states of spin-chain Hamiltonians that are intrinsically time-reversal-symmetric. We study the robustness of n-concurrence of ground states when the interaction is subject to a time-reversal antisymmetric magnetic field perturbation. The n-concurrence in the ground state of the isotropic XX model is computed and it is shown that there is a critical magnetic field strength at which the entanglement experiences a jump discontinuity from the maximum value to zero. The n-concurrence for thermal mixed states is derived and a threshold temperature is computed below which the system has nonzero entanglement
Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E
2017-02-01
A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.
Idarucizumab for Reversing Dabigatran-Induced Anticoagulation: A Systematic Review.
Thibault, Nathan; Morrill, Amanda M; Willett, Kristine C
The approval of the oral direct thrombin inhibitor, dabigatran etexilate, gave patients an alternative to oral anticoagulation with warfarin. Like all anticoagulants, the primary adverse event (AE) associated with dabigatran is bleeding. Until the FDA approval of idarucizumab, there had been no reversal agent for dabigatran-induced anticoagulation in patients with life-threatening or uncontrollable bleeding, or those requiring emergent procedures. The primary purpose of this review is to summarize the safety and efficacy of idarucizumab, a monoclonal antibody fragment, and its use as a reversal agent for dabigatran. A literature search was conducted through MEDLINE (1946 to November week 1 2015) and Embase (1980-2015 week 46) using the search term idarucizumab. Clinicaltrials.gov was consulted for a comprehensive list of ongoing and completed studies. Additional studies were identified through bibliographical citations. Clinical trials in animals and humans published in English evaluating the safety and efficacy of idarucizumab for reversal of anticoagulant treatment with dabigatran were included for review. Idarucizumab has been shown to significantly reverse the anticoagulant effects of dabigatran in both healthy volunteers and patients requiring a reversal agent because of either overt bleeding or an emergency surgery or invasive procedure. The most common AEs were headache, nasopharyngitis, back pain, skin irritation, hypokalemia, delirium, constipation, pyrexia, and pneumonia. Deaths reported in idarucizumab studies were attributed to either the index event or a preexisting comorbidity. Most adverse effects were minor, but 21 serious AEs have been reported in the published data including thrombotic events. Given the increased use of direct oral anticoagulants, such as dabigatran, a need for specific reversal agents exists. Idarucizumab has been shown to be safe and effective in the reversal of dabigatran-induced anticoagulation in patients requiring emergent
Applying Fuzzy Multiobjective Integrated Logistics Model to Green Supply Chain Problems
Directory of Open Access Journals (Sweden)
Chui-Yu Chiu
2014-01-01
Full Text Available The aim of this paper is attempting to explore the optimal way of supply chain management within the domain of environmental responsibility and concerns. The background of this research involves the issue of green supply chain management (GSCM and the concept of the multiobjective integrated logistics model. More specifically, in this paper, we suggest the fuzzy multiobjective integrated logistics model with the transportation cost and demand fuzziness to solve green supply chain problems in the uncertain environment which is illustrated via the detailed numerical example. Results and the sensitivity analysis of the numerical example indicate that when the governmental subsidy value increased the profits of the reverse chain also increased. The finding shows that the governmental subsidy policy could remain of significant influence for used-product reverse logistics chain.
Gharakhanian, Eric G; Deming, Timothy J
2016-07-07
A series of thermoresponsive polypeptides has been synthesized using a methodology that allowed facile adjustment of side-chain functional groups. The lower critical solution temperature (LCST) properties of these polymers in water were then evaluated relative to systematic molecular modifications in their side-chains. It was found that in addition to the number of ethylene glycol repeats in the side-chains, terminal and linker groups also have substantial and predictable effects on cloud point temperatures (Tcp). In particular, we found that the structure of these polypeptides allowed for inclusion of polar hydroxyl groups, which significantly increased their hydrophilicity and decreased the need to use long oligoethylene glycol repeats to obtain LCSTs. The thioether linkages in these polypeptides were found to provide an additional structural feature for reversible switching of both polypeptide conformation and thermoresponsive properties.
Ma, Xin; Dagan, Shai; Somogyi, Árpád; Wysocki, Vicki H.; Scaraffia, Patricia Y.
2013-04-01
Glu, Gln, Pro, and Ala are the main amino acids involved in ammonia detoxification in mosquitoes. In order to develop a tandem mass spectrometry method (MS2) to monitor each carbon of the above isotopically-labeled 13C-amino acids for metabolic studies, the compositions and origins of atoms in fragments of the protonated amino acid should be first elucidated. Thus, various electrospray (ESI)-based MS2 tools were employed to study the fragmentation of these unlabeled and isotopically-labeled amino acids and better understand their dissociation pathways. A broad range of fragments, including previously-undescribed low m/z fragments was revealed. The formulae of the fragments (from m/z 130 down to m/z 27) were confirmed by their accurate masses. The structures and conformations of the larger fragments of Glu were also explored by ion mobility mass spectrometry (IM-MS) and gas-phase hydrogen/deuterium exchange (HDX) experiments. It was found that some low m/z fragments ( m/z 27-30) are common to Glu, Gln, Pro, and Ala. The origins of carbons in these small fragments are discussed and additional collision induced dissociation (CID) MS2 fragmentation pathways are proposed for them. It was also found that small fragments (≤ m/z 84) of protonated, methylated Glu, and methylated Gln are the same as those of the underivatized Glu and Gln. Taken together, the new approach of utilizing low m/z fragments can be applied to distinguish, identify, and quantify 13C-amino acids labeled at various positions, either in the backbone or side chain.
Directory of Open Access Journals (Sweden)
Meina Hua
2017-10-01
Full Text Available Improper disposal of household unwanted medications (UMs is an emergency problem around the world that adversely affects the sustainability of the environment and human’s health. However, the current disposal practices, mainly based on advertising and collecting status, are unsatisfactory in most countries and regions. Thus, some scholars proposed an alternative disposal practice that is to provide incentives to customers. This study aims to compare a Single Model (advertising only with a Joint Model (advertising with take-back pricing in a two-echelon reverse supply chain (RSC that is composed of one disposer and one collector. In each model, four games (non-cooperative, collector as the Stackelberg leader, disposer as the Stackelberg leader, and cooperative were established in order to identify the optimal pricing and advertising strategies for both members. The results of the study indicate that there is a Pareto dominant range for Joint Model compared to Single Model, whereas Single Model has no Pareto improvement in any games. Furthermore, in non-cooperative games of Joint Model, it is better to implement the leader-follower structure rather than simultaneous movement structure. Additionally, it is verified that the cooperative game is feasible, which leads to the cooperation between the disposer and the collector, and the extra profit from the cooperation can be shared based on the Nash bargaining game. However, in Single Model, it is better for the disposer to act as a channel leader and the collector figures the follower.
Ricotta, Fernanda
2010-01-01
In this paper the extent of international fragmentation of production in Italian manufacturing industries for the years 1985, 1995 and 2000 is assessed with different indicators. The objective is to determine where fragmentation is most prevalent and to provide a description of the key characteristics of those sectors. The paper first presents a survey of global value chain indicators and how these have been used in the economic literature. The second part supplies empirical evidence on the g...
Plasmon-Polariton Properties in Metallic Nanosphere Chains
Directory of Open Access Journals (Sweden)
Witold Aleksander Jacak
2015-06-01
Full Text Available The propagation of collective wave type plasmonic excitations along infinite chains of metallic nanospheres has been analyzed, including near-, medium- and far-field contributions to the plasmon dipole interaction with all retardation effects taken into account. It is proven that there exist weakly-damped self-modes of plasmon-polaritons in the chain for which the propagation range is limited by relatively small Ohmic losses only. In this regime, the Lorentz friction irradiation losses on each nanosphere in the chain are ideally compensated by the energy income from the rest of the chain. The completely undamped collective waves were identified in the case of the presence of persistent external excitation of some fragment of the chain. The obtained characteristics of these excitations fit the experimental observations well.
Global Value Chains from a 3D Printing Perspective
DEFF Research Database (Denmark)
Laplume, André O; Petersen, Bent; Pearce, Joshua M.
2016-01-01
This article outlines the evolution of additive manufacturing technology, culminating in 3D printing and presents a vision of how this evolution is affecting existing global value chains (GVCs) in production. In particular, we bring up questions about how this new technology can affect...... the geographic span and density of GVCs. Potentially, wider adoption of this technology has the potential to partially reverse the trend towards global specialization of production systems into elements that may be geographically dispersed and closer to the end users (localization). This leaves the question...
Voorhaar, Lenny; De Meyer, Bernhard; Du Prez, Filip; Hoogenboom, Richard
2016-10-01
The preparation of physically crosslinked hydrogels from quasi ABA-triblock copolymers with a water-soluble middle block and hydrophobic end groups is reported. The hydrophilic monomer N-acryloylmorpholine is copolymerized with hydrophobic isobornyl acrylate via a one-pot sequential monomer addition through reversible addition fragmentation chain-transfer (RAFT) polymerization in an automated parallel synthesizer, allowing systematic variation of polymer chain length and hydrophobic-hydrophilic ratio. Hydrophobic interactions between the outer blocks cause them to phase-separate into larger hydrophobic domains in water, forming physical crosslinks between the polymers. The resulting hydrogels are studied using rheology and their self-healing ability after large strain damage is shown. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Embedded top-coat for reducing the effect out of band radiation in EUV lithography
Du, Ke; Siauw, Meiliana; Valade, David; Jasieniak, Marek; Voelcker, Nico; Trefonas, Peter; Thackeray, Jim; Blakey, Idriss; Whittaker, Andrew
2017-03-01
Out of band (OOB) radiation from the EUV source has significant implications for the performance of EUVL photoresists. Here we introduce a surface-active polymer additive, capable of partitioning to the top of the resist film during casting and annealing, to protect the underlying photoresist from OOB radiation. Copolymers were prepared using reversible addition-fragmentation chain transfer (RAFT) polymerization, and rendered surface active by chain extension with a block of fluoro-monomer. Films were prepared from the EUV resist with added surface-active Embedded Barrier Layer (EBL), and characterized using measurements of contact angles and spectroscopic ellipsometry. Finally, the lithographic performance of the resist containing the EBL was evaluated using Electron Beam Lithography exposure
DEFF Research Database (Denmark)
Paonessa, Jessica E; Williams, James C; Lingeman, James E
2018-01-01
INTRODUCTION: We hypothesized that adding sodium bicarbonate (bicarb) to normal saline (NS) irrigation during ureteroscopy in patients with uric acid (UA) nephrolithiasis may assist in dissolving small stone fragments produced during laser lithotripsy. In vitro testing was performed to determine....../L NS yielded a dissolution rate averaging 22% ± 7% per hour, which was nearly five times higher than NS alone. There was a trend for an increase in mean dissolution rate with higher temperature but this increase was not significant (p = 0.30). CONCLUSIONS: The addition of bicarbonate to NS more than...
The ATPG Attack for Reverse Engineering of Combinational Hybrid Custom-Programmable Circuits
2017-03-23
Introduction The widely practiced horizontal integrated circuit supply chain exposes a design to various types of attacks including the reverse engineering ...STT_CMOS designs for reverse- engineering prevention, DAC 2016. [5] M. E. Massad and et. al. Integrated circuit (IC) decamouflaging: reverse...The ATPG Attack for Reverse Engineering of Combinational Hybrid Custom-Programmable Circuits Raza Shafiq Hamid Mahmoodi Houman Homayoun Hassan
Balancing Technologies for Reverse Supply Chain with Modularity as Strategy for Competitiveness
DEFF Research Database (Denmark)
Vettorato, Giovanna; Hsuan, Juliana
In this paper we review applications, case studies, models and techniques proposed for the design and optimization of reverse logistics systems according to the principle of modularity. Based on these studies we give an overview of scientific literature that describes and discusses cases of reverse...
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Nieuwenhuizen, W.; Gravesen, M.
1981-01-01
Early plasmin degradation products (X fragments) of human fibrinogen were prepared in the presence of calcium-ions or EGTA, and purified on Sepharose 6B-CL. X fragments were characterized with respect to amino-terminal amino acids, polypeptide-chain composition, anticlotting properties and
Tumour targeting with monovalent fragments of anti-neuroblastoma antibody chCE7
International Nuclear Information System (INIS)
Carrel, F.; Novak-Hofer, I.; Ruch, C.; Zimmermann, K.; Amstutz, H.
1997-01-01
The in vitro and in vivo behaviour of the monovalent single chain (scFv) and Fab-fragments derived from anti-neuroblastoma antibody chCE7 is reported. When comparing tumour uptake and -retention of radioactivity of 67 Cu-labelled monovalent chCE7 with divalent chCE7 F(ab') 2 the advantage of the radiocopper label over the radioiodine label was more pronounced with the divalent (internalising) F(ab') 2 fragments. (author) 1 fig., 1 ref
Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li
2015-07-01
Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.
Dubinets, Nikita; Slipchenko, Lyudmila V
2017-07-20
Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.
Plug and Play Firms in the TNCs' Virtual Value Chain
Directory of Open Access Journals (Sweden)
Teresa Pakulska
2016-04-01
Full Text Available Growing virtualisation of the value chain appears to be an expression of implementation of ICT solutions in international business represented by TNCs. This creates new opportunities for cooperation within the value chain and its composition. The growing importance in this area can be attributed to companies integrating the value chain, known as plug and play. Their integration into the value creation chain gives a new dimension to TNCs' strategic choices from the fragmentation of activity and its integration on an international scale point of view.
Skvortsov, A M; Leermakers, F A M; Fleer, G J
2013-08-07
In the melt polymer conformations are nearly ideal according to Flory's ideality hypothesis. Silberberg generalized this statement for chains in the interfacial region. We check the Silberberg argument by analyzing the conformations of a probe chain end-grafted at a solid surface in a sea of floating free chains of concentration φ by the self-consistent field (SCF) method. Apart from the grafting, probe chain and floating chains are identical. Most of the results were obtained for a standard SCF model with freely jointed chains on a six-choice lattice, where immediate step reversals are allowed. A few data were generated for a five-choice lattice, where such step reversals are forbidden. These coarse-grained models describe the equilibrium properties of flexible atactic polymer chains at the scale of the segment length. The concentration was varied over the whole range from φ = 0 (single grafted chain) to φ = 1 (probe chain in the melt). The number of contacts with the surface, average height of the free end and its dispersion, average loop and train length, tail size distribution, end-point and overall segment distributions were calculated for a grafted probe chain as a function of φ, for several chain lengths and substrate∕polymer interactions, which were varied from strong repulsion to strong adsorption. The computations show that the conformations of the probe chain in the melt do not depend on substrate∕polymer interactions and are very similar to the conformations of a single end-grafted chain under critical conditions, and can thus be described analytically. When the substrate∕polymer interaction is fixed at the value corresponding to critical conditions, all equilibrium properties of a probe chain are independent of φ, over the whole range from a dilute solution to the melt. We believe that the conformations of all flexible chains in the surface region of the melt are close to those of an appropriate single chain in critical conditions, provided
Directory of Open Access Journals (Sweden)
Ana Victoria da Costa Almeida
2017-09-01
Full Text Available The intensification of production and growth of consumption leads to generation of large amounts of waste, which is subsequently disposed of inappropriately, further polluting the environment. Within this context, the National Policy of Solid Waste (NPSW, through Reverse Logistics (RL, aims to maximize the use of resources by the sustainable production and rehabilitation of waste in production cycles. Acai, a valued-consumption commodity in domestic and international markets, is an example of a product whose potential has been underused. This article aims to enact these concepts on a producer from Para by the recycling of lump and consequent rationalization of the use of the product. A reverse channel structure was proposed, involving the phases of collection, screening, processing and disposal based on Fleishmann et al.’s model (2000, and other similar chain ractices, NPSW guidelines and additional influential factors on its construction based on Leite (1999. The results demonstrated the facilitators points and barriers faced by the producers.
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
Influence of magnetostatic interactions on the magnetization reversal of patterned magnetic elements
International Nuclear Information System (INIS)
Yin Xioalu; Liou, S. H.; Adeyeye, A. O.; Jain, S.; Han Baoshan
2011-01-01
The magnetization reversal in patterned thin-film arrays of elliptical submicron permalloy elements has been investigated by magnetic-force microscopy and micro-magneto-optic Kerr effect. Three different spatial arrangements of chains are considered, namely chains aligned parallel to the long axis of the ellipse, chains aligned parallel to the short axis of the ellipse, and arrays with roughly equal element-to-element spacings in both directions. Comparison of the hysteresis loops in an in-plane field perpendicular to the ellipses' long axes shows that the magnetization reversibility is highest for chains along the long axis. This is due to the nearly coherent magnetization rotation in the applied magnetic field and to the formation of a head-to-tail domain arrangement. Other arrangements, such as chains of ellipses aligned parallel to short axis, yield flux-closure domains as the applied magnetic field is changed.
A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth
Energy Technology Data Exchange (ETDEWEB)
Zhao, Shuli [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Nanjing Affiliated First Hospital, Nanjing Medical University, Nanjing (China); Zhao, Guangfeng; Xie, Hao; Huang, Yahong [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Hou, Yayi [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing (China)
2012-01-27
Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex){sub 1.3}(DOX){sub 20}. In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers.
A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth
International Nuclear Information System (INIS)
Zhao, Shuli; Zhao, Guangfeng; Xie, Hao; Huang, Yahong; Hou, Yayi
2012-01-01
Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex) 1.3 (DOX) 20 . In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers
Li, Qing; Wang, Ze-yuan; Cao, Zhi-chao; Du, Rui-yang; Luo, Hao
2015-08-01
With the process of globalisation and the development of management models and information technology, enterprise cooperation and collaboration has developed from intra-enterprise integration, outsourcing and inter-enterprise integration, and supply chain management, to virtual enterprises and enterprise networks. Some midfielder enterprises begin to serve for different supply chains. Therefore, they combine related supply chains into a complex enterprise network. The main challenges for enterprise network's integration and collaboration are business process and data fragmentation beyond organisational boundaries. This paper reviews the requirements of enterprise network's integration and collaboration, as well as the development of new information technologies. Based on service-oriented architecture (SOA), collaboration modelling and collaboration agents are introduced to solve problems of collaborative management for service convergence under the condition of process and data fragmentation. A model-driven methodology is developed to design and deploy the integrating framework. An industrial experiment is designed and implemented to illustrate the usage of developed technologies in this paper.
Heart Rate Fragmentation: A Symbolic Dynamical Approach
Directory of Open Access Journals (Sweden)
Madalena D. Costa
2017-11-01
Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to
DEFF Research Database (Denmark)
Husted, Steen; Verheugt, Freek; Comuth, Willemijn
2015-01-01
, coagulation factor concentrates or NOAC-specific antidotes could be used. Coagulation factor concentrates can be used in patients with haemophilia and to reverse the effect of VKAs but, in NOAC-treated patients, results are inconsistent and these agents could potentially have pro-thrombotic effects. Specific...... antidotes for NOACs are expected to be on the market soon. Phase III clinical trials with a humanized antibody fragment directed against dabigatran (idarucizumab) and recombinant, modified factor Xa (andexanet alfa) are ongoing. A molecule (aripazine) with broad activity against various anticoagulants...
Synthesis and characterization of telechelic polymers prepared by RAFT
Lima, V.G.R.; Brokken-Zijp, J.C.M.; Klumperman, B.; Benthem - van Duuren, van A.M.G.; Linde, van der R.
2003-01-01
The reversible addn.-fragmentation chain transfer (RAFT) polymn. technique was employed to synthesize telechelic polymers. Me methacrylate, Bu methacrylate were polymd. using RAFT polymn. The polymns. exhibit the usual characteristics of living processes, and were followed by a two-step chain-end
Ghadge, Ghanashyam D; Pavlovic, John D; Koduvayur, Sujatha P; Kay, Brian K; Roos, Raymond P
2013-08-01
Approximately 10% of amyotrophic lateral sclerosis (ALS) cases are familial (known as FALS) with an autosomal dominant inheritance pattern, and ~25% of FALS cases are caused by mutations in Cu/Zn superoxide dismutase (SOD1). There is convincing evidence that mutant SOD1 (mtSOD1) kills motor neurons (MNs) because of a gain-of-function toxicity, most likely related to aggregation of mtSOD1. A number of recent reports have suggested that antibodies can be used to treat mtSOD1-induced FALS. To follow up on the use of antibodies as potential therapeutics, we generated single chain fragments of variable region antibodies (scFvs) against SOD1, and then expressed them as 'intrabodies' within a motor neuron cell line. In the present study, we describe isolation of human scFvs that interfere with mtSOD1 in vitro aggregation and toxicity. These scFvs may have therapeutic potential in sporadic ALS, as well as FALS, given that sporadic ALS may also involve abnormalities in the SOD1 protein or activity. Copyright © 2013 Elsevier Inc. All rights reserved.
Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah
2016-07-29
A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.
Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H
1998-02-01
A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.
Carlson, Sarah J; Nandivada, Prathima; Chang, Melissa I; Mitchell, Paul D; O'Loughlin, Alison; Cowan, Eileen; Gura, Kathleen M; Nose, Vania; Bistrian, Bruce R; Puder, Mark
2015-02-01
Parenteral nutrition associated liver disease (PNALD) is a deadly complication of long term parenteral nutrition (PN) use in infants. Fish oil-based lipid emulsion has been shown in recent years to effectively treat PNALD. Alternative fat sources free of essential fatty acids have recently been investigated for health benefits related to decreased inflammatory response. We hypothesized that the addition of medium-chain triglycerides (MCT) to a purified fish oil-based diet would decrease the response to inflammatory challenge in mice, while allowing for sufficient growth and development. Six groups of ten adult male C57/Bl6 mice were pair-fed different dietary treatments for a period of twelve weeks, varying only in fat source (percent calories by weight): 10.84% soybean oil (SOY), 10% coconut oil (HCO), 10% medium-chain triglycerides (MCT), 3% purified fish oil (PFO), 3% purified fish oil with 3% medium-chain triglycerides (50:50 MCT:PFO) and 3% purified fish oil with 7.59% medium-chain triglycerides (70:30 MCT:PFO). An endotoxin challenge was administered to half of the animals in each group at the completion of dietary treatment. All groups demonstrated normal growth throughout the study period. Groups fed MCT and HCO diets demonstrated biochemical essential fatty acid deficiency and decreased IL-6 and TNF-α response to endotoxin challenge. Groups containing PFO had increased inflammatory response to endotoxin challenge, and the addition of MCT to PFO mitigated this inflammatory response. These results suggest that the addition of MCT to PFO formulations may decrease the host response to inflammatory challenge, which may pose potential for optimized PN formulations. Inclusion of MCT in lipid emulsions given with PN formulations may be of use in therapeutic interventions for disease states resulting from chronic inflammation. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
Krenske, Elizabeth H; Davison, Edwin C; Forbes, Ian T; Warner, Jacqueline A; Smith, Adrian L; Holmes, Andrew B; Houk, K N
2012-02-01
Quantum mechanical calculations have been used to study the intramolecular additions of hydroxylamines to alkenes and alkynes ("reverse Cope eliminations"). In intermolecular reverse Cope eliminations, alkynes are more reactive than alkenes. However, competition experiments have shown that tethering the hydroxylamine to the alkene or alkyne can reverse the reactivity order from that normally observed. The exact outcome depends on the length of the tether. In agreement with experiment, a range of density functional theory methods and CBS-QB3 calculations predict that the activation energies for intramolecular reverse Cope eliminations follow the order 6-exo-dig hydroxylamine and alkyne. Cyclization onto an alkene in the 5-exo-trig fashion incurs slightly less tether strain than a 6-exo-dig alkyne cyclization, but its activation energy is higher because the hydroxylamine fragment must distort more before the TS is reached. If the alkene terminus is substituted with two methyl groups, the barrier becomes so much higher that it is also disfavored compared to the 5- and 7-exo-dig cyclizations. © 2012 American Chemical Society
Reversible photocontrol of molecular assemblies of metal complex containing azo-amphiphiles
International Nuclear Information System (INIS)
Einaga, Yasuaki; Mikami, Rie; Akitsu, Takashiro; Li, Guangming
2005-01-01
Photo-controllable molecular systems, [M(en) 2 ][Pt(en) 2 Cl 2 ](1) 4 (M 2+ =Pt 2+ , Pd 2+ and en=ethylenediamine), have been designed by the self-assembly of chloride-bridged platinum/palladium complexes and photochromic amphiphiles of the azobenzene derivative, 4-[4-(N-methyl-N-n-dodecylamino)phenylazo]benzene sulfonic acid (designated as compound 1). Reversible structural changes caused by cis-trans photoisomerization of azo groups in compound 1 were observed by alternating illumination of UV and visible light. Visible illumination resulted in the formation of the plate-like structures, whereas UV illumination resulted in fragmentation of the assembling structures. Reversible changes were observed in the electronic states of the chloride-bridged platinum/palladium complexes; the plate-like structures exhibited charge transfer absorption of chloride-bridged platinum complexes and delocalized Pt(II)/Pt(IV) states, while the fragments of the separated complexes exhibited no charge transfer bands. As a consequence, we have discovered that the reversible structural changes in this system could be controlled by photoillumination
Yan, Guiping; Smiley, Richard W
2010-03-01
The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.
International Nuclear Information System (INIS)
Grennan, Kathleen; Strachan, Gillian; Porter, Andrew J.; Killard, Anthony J.; Smyth, Malcolm R.
2003-01-01
This work describes the development of an electrochemical immunosensor for the analysis of atrazine using recombinant single-chain antibody (scAb) fragments. The sensors are based on carbon paste screen-printed electrodes incorporating the conducting polymer polyaniline (PANI)/poly(vinylsulphonic acid) (PVSA), which enables direct mediatorless coupling to take place between the redox centres of antigen-labelled horseradish peroxidase (HRP) and the electrode surface. Competitive immunoassays can be performed in real-time using this separation-free system. Analytical measurements based on the pseudo-linear relationship between the slope of a real-time amperometric signal and the concentration of analyte, yield a novel immunosensor set-up capable of regenerationless amperometric analysis. Multiple, sequential measurements of standards and samples can be performed on a single scAb-modified surface in a matter of minutes. No separation of bound and unbound species was necessary prior to detection. The system is capable of measuring atrazine to a detection limit of 0.1 ppb (0.1 μg l -1 ). This system offers the potential for rapid, cost-effective immunosensing for the analysis of samples of environmental, medical and pharmaceutical significance
The dual role of fragments in fragment-assembly methods for de novo protein structure prediction
Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.
2013-01-01
In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594
Gallstone fragmentation by control electrohydraulic lithotripsy
International Nuclear Information System (INIS)
Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.
1989-01-01
The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy
Directory of Open Access Journals (Sweden)
Sylmara Lopes Francelino Gonçalves-Dias
2006-12-01
Full Text Available O trabalho propõe-se a discutir as possibilidades, limites e desafios da reciclagem de PET - Politereftalato de Etileno. Como fundamentação teórico-conceitual, recorre à discussão sobre a natureza e o alcance da logística reversa, analisando as estratégias para estruturação da cadeia de reciclagem. A pesquisa é de caráter exploratório, com adoção de diferentes estratégias para a coleta de dados, envolvendo fontes secundárias produzidas por órgãos públicos, instituições especializadas e mídia, e ainda entrevistas semi-estruturadas com especialistas na área. Os resultados apontam que múltiplos atores estão envolvidos na estrutura da cadeia reversa do PET e que, apesar do avanço no volume de reciclagem, nenhum dos setores, seja público ou privado, consegue individualmente organizar-se para o alcance da efetividade operacional e ambiental desejável no cenário brasileiro. O alcance de bons resultados depende, sobretudo, do investimento nos dois extremos da cadeia reversa: na coleta seletiva e no mercado para o produto reciclado.The work discuss the possibilities, limits and challenges of the recycling of PET packing in the Brazilian case. The authors analyze the nature and the function of the reverse logistics and its strategies for articulation of the recycling chain. The research is based in the exploratory methodological approach, with adoption of different strategies for the collection of data, involving secondary sources produced by public institutions, specialized organizations and media, and still, interviews semi-structured with specialists in the area. The results point that the Brazilian public and private sectors doesn’t get to organize this activity in the desirable environmental scale. Good performances in the PET packing reverse chain depends on investing in the selective collection and in the market for the recycled products.
Kailemia, Muchena J; Patel, Anish B; Johnson, Dane T; Li, Lingyun; Linhardt, Robert J; Amster, I Jonathan
2015-01-01
The stereochemistry of the hexuronic acid residues of the structure of glycosaminoglycans (GAGs) is a key feature that affects their interactions with proteins and other biological functions. Electron based tandem mass spectrometry methods, in particular electron detachment dissociation (EDD), have been able to distinguish glucuronic acid (GlcA) from iduronic acid (IdoA) residues in some heparan sulfate tetrasaccharides by producing epimer-specific fragments. Similarly, the relative abundance of glycosidic fragment ions produced by collision-induced dissociation (CID) or EDD has been shown to correlate with the type of hexuronic acid present in chondroitin sulfate GAGs. The present work examines the effect of charge state and degree of sodium cationization on the CID fragmentation products that can be used to distinguish GlcA and IdoA containing chondroitin sulfate A and dermatan sulfate chains. The cross-ring fragments (2,4)A(n) and (0,2)X(n) formed within the hexuronic acid residues are highly preferential for chains containing GlcA, distinguishing it from IdoA. The diagnostic capability of the fragments requires the selection of a molecular ion and fragment ions with specific ionization characteristics, namely charge state and number of ionizable protons. The ions with the appropriate characteristics display diagnostic properties for all the chondroitin sulfate and dermatan sulfate chains (degree of polymerization of 4-10) studied.
Lirman
2000-08-23
Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.
International Nuclear Information System (INIS)
Mayzelis, Z.A.; Apostolov, S.S.; Melnyk, S.S.; Usatenko, O.V.; Yampol'skii, V.A.
2007-01-01
A theory of symbolic dynamic systems with long-range correlations based on the consideration of the binary N-step Markov chains developed earlier in Phys Rev Lett 2003;90:110601 is generalized to the biased case (non-equal numbers of zeros and unities in the chain). In the model, the conditional probability that the ith symbol in the chain equals zero (or unity) is a linear function of the number of unities (zeros) among the preceding N symbols. The correlation and distribution functions as well as the variance of number of symbols in the words of arbitrary length L are obtained analytically and verified by numerical simulations. A self-similarity of the studied stochastic process is revealed and the similarity group transformation of the chain parameters is presented. The diffusion Fokker-Planck equation governing the distribution function of the L-words is explored. If the persistent correlations are not extremely strong, the distribution function is shown to be the Gaussian with the variance being nonlinearly dependent on L. An equation connecting the memory and correlation function of the additive Markov chain is presented. This equation allows reconstructing a memory function using a correlation function of the system. Effectiveness and robustness of the proposed method is demonstrated by simple model examples. Memory functions of concrete coarse-grained literary texts are found and their universal power-law behavior at long distances is revealed
Energy Technology Data Exchange (ETDEWEB)
Mayzelis, Z.A. [Department of Physics, Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine); Apostolov, S.S. [Department of Physics, Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine); Melnyk, S.S. [A. Ya. Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Usatenko, O.V. [A. Ya. Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine)]. E-mail: usatenko@ire.kharkov.ua; Yampol' skii, V.A. [A. Ya. Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine)
2007-10-15
A theory of symbolic dynamic systems with long-range correlations based on the consideration of the binary N-step Markov chains developed earlier in Phys Rev Lett 2003;90:110601 is generalized to the biased case (non-equal numbers of zeros and unities in the chain). In the model, the conditional probability that the ith symbol in the chain equals zero (or unity) is a linear function of the number of unities (zeros) among the preceding N symbols. The correlation and distribution functions as well as the variance of number of symbols in the words of arbitrary length L are obtained analytically and verified by numerical simulations. A self-similarity of the studied stochastic process is revealed and the similarity group transformation of the chain parameters is presented. The diffusion Fokker-Planck equation governing the distribution function of the L-words is explored. If the persistent correlations are not extremely strong, the distribution function is shown to be the Gaussian with the variance being nonlinearly dependent on L. An equation connecting the memory and correlation function of the additive Markov chain is presented. This equation allows reconstructing a memory function using a correlation function of the system. Effectiveness and robustness of the proposed method is demonstrated by simple model examples. Memory functions of concrete coarse-grained literary texts are found and their universal power-law behavior at long distances is revealed.
Mondal, A.
2010-03-01
In this paper, we study the uncertainty quantification in inverse problems for flows in heterogeneous porous media. Reversible jump Markov chain Monte Carlo algorithms (MCMC) are used for hierarchical modeling of channelized permeability fields. Within each channel, the permeability is assumed to have a lognormal distribution. Uncertainty quantification in history matching is carried out hierarchically by constructing geologic facies boundaries as well as permeability fields within each facies using dynamic data such as production data. The search with Metropolis-Hastings algorithm results in very low acceptance rate, and consequently, the computations are CPU demanding. To speed-up the computations, we use a two-stage MCMC that utilizes upscaled models to screen the proposals. In our numerical results, we assume that the channels intersect the wells and the intersection locations are known. Our results show that the proposed algorithms are capable of capturing the channel boundaries and describe the permeability variations within the channels using dynamic production history at the wells. © 2009 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Shrestha, Lok Kumar; Aramaki, Kenji
2009-01-01
Structure of diglycerol monolaurate (abbreviated as C 12 G 2 ) micelles in nonpolar oils cyclohexane and n-octane as a function of compositions, temperatures, and surfactant chain length has been investigated by small-angle X-ray scattering (SAXS). The SAXS data were evaluated by the generalized indirect Fourier transformation (GIFT) method and real-space structural information of particles was achieved. Conventional poly(oxyethylene) type nonionic surfactants do not form reverse micelles in oils unless a trace water is added. However, present surfactant C 12 G 2 formed reverse micelle (RM) in cyclohexane and n-octane without addition of water at normal room temperature. A clear signature of one dimensional (1-D) micellar growth was found with increasing C 12 G 2 concentration. On the other hand, increasing temperature or hydrocarbon chain length of surfactant shorten the length of RM, which is essentially a cylinder-to-sphere type transition in the aggregate structure. Drastic changes in the structure of RM, namely, transition of ellipsoidal prolate to long rod-like micelles was observed upon changing oil from cyclohexane to octane. All the microstructural transitions were explained in terms of critical packing parameter. (author)
DEFF Research Database (Denmark)
Zhu, Xinyu; De Francisci, Davide; Treu, Laura
In anaerobic digestion systems, the accumulation of long chain fatty acids (LCFA) leads to process instability and decrease of the methane production. This detrimental condition is known to be reversible depending on the concentration of the accumulated LCFAs and mainly on the microbial consortium...... due to LCFA increase in the feedstock composition. The result shows that the addition of sodium oleate caused a reversible inhibition of reactor. The correlation between the microbial community’s profile and the reactors performance indicated that Syntrophomonas was the genus most likely involved...... in sodium oleate degradation. Other genera that were found abundant are Pseudomonas, Clostridium XI and Clostridium III. The relative abundance of these genera was not significantly affected by the addition of sodium oleate, and this indicates that they are probably involved in later steps of degradation...
Krenske, Elizabeth H.; Davison, Edwin C.; Forbes, Ian T.; Warner, Jacqueline A.; Smith, Adrian L.; Holmes, Andrew B.; Houk, K. N.
2012-01-01
Quantum mechanical calculations have been used to study the intramolecular additions of hydroxylamines to alkenes and alkynes (“reverse Cope eliminations”). In intermolecular reverse Cope eliminations, alkynes are more reactive than alkenes. However, competition experiments have shown that tethering the hydroxylamine to the alkene or alkyne can reverse the reactivity order from that normally observed. The exact outcome depends on the length of the tether. In agreement with experiment, a range of density functional theory methods and CBS-QB3 calculations predict that the activation energies for intramolecular reverse Cope eliminations follow the order 6-exo-dig hydroxylamine and alkyne. Cyclization onto an alkene in the 5-exo-trig fashion incurs slightly less tether strain than a 6-exo-dig alkyne cyclization, but its activation energy is higher because the hydroxylamine fragment must distort more before the TS is reached. If the alkene terminus is substituted with two methyl groups, the barrier becomes so much higher that it is also disfavored compared to the 5- and 7-exo-dig cyclizations. PMID:22280245
Dual Fragment Impact of PBX Charges
Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team
2017-06-01
Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.
Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats
DEFF Research Database (Denmark)
Kastern, W.; Dyrberg, T.; Scholler, J.
1984-01-01
DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...
Designer genes. Recombinant antibody fragments for biological imaging
Energy Technology Data Exchange (ETDEWEB)
Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology
2000-09-01
Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering
Designer genes. Recombinant antibody fragments for biological imaging
International Nuclear Information System (INIS)
Wu, A.M.; Yazaki, P.J.
2000-01-01
Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and
Szybinski, Marcin; Sokolowska, Katarzyna; Sicinski, Rafal R; Plum, Lori A; DeLuca, Hector F
2017-10-01
Prompted by results of molecular modeling performed on the seco-d-ring-vitamins D, we turned our attention to such analogs, having reversed configurations at C-13 and C-14, as the next goals of our studies on the structure-activity relationship for vitamin D compounds. First, we developed an efficient total synthesis of the "upper" C/seco-d-ring fragment with a 7-carbon side chain. Then, we coupled it with A-ring fragments using Sonogashira or Wittig-Horner protocol, providing the targeted D-seco analogs of 1α,25-dihydroxyvitamin D 3 and 1α,25-dihydroxy-19-norvitamin D 3 possessing a vinyl substituent at C-14 and a double bond between C-17 and C-20. The affinities of the synthesized vitamin D analogs to the full-length recombinant rat VDR were examined, as well as their differentiating and transcriptional activities. In these in vitro tests, they were significantly less active compared to 1α,25-(OH) 2 D 3 . Moreover, it was established that the analogs tested in vivo in rats showed no calcemic potency. Copyright © 2016 Elsevier Ltd. All rights reserved.
Optimization and decision support systems for supply chains
Corominas, Albert; Miranda, João
2017-01-01
This contributed volume presents a collection of materials on supply chain management including industry-based case studies addressing petrochemical, pharmaceutical, manufacturing and reverse logistics topics. Moreover, the book covers sustainability issues, as well as optimization approaches. The target audience comprises academics, industry managers, and practitioners in the field of supply chain management, being the book also beneficial for graduate students.
Graft Copolymerization of Styrene from Poly(vinyl alcohol via RAFT Process
Directory of Open Access Journals (Sweden)
Gholam Ali Koohmareh
2011-01-01
Full Text Available Polystyrene, PS, was grafted from poly(vinyl alcohol, PVA, backbone by reversible addition-fragmentation chain transfer (RAFT polymerization. The hydroxyl groups of the PVA were converted into aromatic dithioester RAFT agent and polymerization began in the presence of this agent. The structure of compounds was confirmed by FT-IR and 1HNMR spectroscopy. The graft copolymer was characterized by thermogravimetric analysis (TGA, X-ray diffraction (XRD, and scanning electron microscopy (SEM. Grafted polystyrene chains were cleaved from the PVA backbone by acidic hydrolysis of the PVA-g-PS, and its polydispersity index, PDI, was determined by gel permeation chromatography (GPC showing narrow molecular weight distribution.
Recombinant fragment of an antibody tailored for direct radioiodination
Czech Academy of Sciences Publication Activity Database
Sedláček, Juraj; Fábry, Milan; Sieglová, Irena; Král, Vlastimil; Uhnáková, Bronislava; Mudra, M.; Kronrád, L.; Sawicka, A.; Mikolajczak, R.; Řezáčová, Pavlína
2012-01-01
Roč. 55, č. 1 (2012), s. 52-56 ISSN 0362-4803 R&D Projects: GA MPO 2A-2TP1/076; GA MŠk 1M0505 Institutional research plan: CEZ:AV0Z50520514 Keywords : I125 labelling * single-chain antibody variable fragment * tyrosine-rich polypeptide segment * fusion protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.240, year: 2012
Crivianu-Gaita, Victor; Thompson, Michael
2016-11-15
The choice of biosensing elements is crucial for the development of the optimal biosensor. Three of the most versatile biosensing elements are antibody single-chain Fv fragments (scFv), antibody fragment-antigen binding (Fab') units, and aptamers. This article provides an overview of these three biorecognition elements with respects to their synthesis/engineering, various immobilization techniques, and examples of their use in biosensors. Furthermore, the final section of the review compares and contrasts their characteristics (time/cost of development, ease and variability of immobilization, affinity, stability) illustrating their advantages and disadvantages. Overall, scFv fragments are found to display the highest customizability (i.e. addition of functional groups, immobilizing peptides, etc.) due to recombinant synthesis techniques. If time and cost are an issue in the development of the biosensor, Fab' fragments should be chosen as they are relatively cheap and can be developed quickly from whole antibodies (several days). However, if there are sufficient funds and time is not a factor, aptamers should be utilized as they display the greatest affinity towards their target analytes and are extremely stable (excellent biosensor regenerability). Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Duan, Zhi; Siegumfeldt, Henrik
2010-01-01
We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do....... The scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....
Attallah, Carolina; Aguilar, María Fernanda; Garay, A Sergio; Herrera, Fernando E; Etcheverrigaray, Marina; Oggero, Marcos; Rodrigues, Daniel E
2017-10-01
The Cys residues are almost perfectly conserved in all antibodies. They contribute significantly to the antibody fragment stability. The relevance of two natural contiguous Cys residues of an anti-recombinant human-follicle stimulation hormone (rhFSH) in a format of single-chain variable fragment (scFv) was studied. This scFv contains 5 Cys residues: V H 22 and V H 92 in the variable heavy chain (V H ) and V L 23, V L 87 and V L 88 in the variable light chain (V L ). The influence of two unusual contiguous Cys at positions V L 87 and V L 88 was studied by considering the wild type fragment and mutant variants: V L -C88S, V L -C87S, V L -C87Y. The analysis was carried out using antigen-binding ability measurement by indirect specific ELISA and a detailed molecular modeling that comprises homology methods, long molecular dynamics simulations and docking. We found that V L -C87 affected the antibody fragment stability without interfering with the disulfide bond formation. The effect of mutating the V L -C87 by a usual residue at this position like Tyr caused distant structural changes at the V H region that confers a higher mobility to the V H -CDR2 and V H -CDR3 loops improving the scFv binding to the antigen. Copyright © 2017 Elsevier Ltd. All rights reserved.
On DNA codes from a family of chain rings
Directory of Open Access Journals (Sweden)
Elif Segah Oztas
2017-01-01
Full Text Available In this work, we focus on reversible cyclic codes which correspond to reversible DNA codes or reversible-complement DNA codes over a family of finite chain rings, in an effort to extend what was done by Yildiz and Siap in [20]. The ring family that we have considered are of size $2^{2^k}$, $k=1,2, \\cdots$ and we match each ring element with a DNA $2^{k-1}$-mer. We use the so-called $u^2$-adic digit system to solve the reversibility problem and we characterize cyclic codes that correspond to reversible-complement DNA-codes. We then conclude our study with some examples.
DEFF Research Database (Denmark)
Eriksson, H; Nissen, Mogens Holst
1992-01-01
Apart from cleaving C1s, we demonstrate for the first time that: 1) at concentrations found in serum, the activated forms of the complement components C1r in addition to C1s can cleave the heavy chain of MHC class I antigens, 2) the cleavage by C1r and C1s is seemingly dependent upon a native con......-chain of MHC class I was shown to take place between the alpha 2- and alpha 3- domains as estimated by the Con A-Sepharose precipitation pattern on SDS-PAGE. The alpha 1/alpha 2 fragment was still shown to interact with beta 2-microglobulin as shown by immunoprecipitation....
Liu, Yang; Wang, Yue-ru; Wang, Long; Song, Rui-mei; Zhou, Bo; Song, Zhen-shun
2014-01-01
Circulating hepatocellular carcinoma cells may be detected by reverse transcription-polymerase chain reaction. We investigated the relationship between circulating hepatocellular carcinoma cells and hepatoma patient survival after different managements and survival periods. Peripheral vein blood (5 ml) samples were obtained from 113 patients with hepatocellular carcinoma and from 33 control subjects (9 with liver cirrhosis after hepatitis B, 14 with chronic hepatitis B, 10 healthy individuals) between January 1, 2009, and December 31, 2013. To detect circulating hepatocellular carcinoma cells in peripheral blood, alpha-fetoprotein messenger RNA was amplified from total RNA extracted from whole blood by reverse transcription-polymerase chain reaction. Alpha-fetoprotein messenger RNA was detected in 59 blood samples from the hepatocellular carcinoma patients (59/113, 52.2%). In contrast, there were no clinical control subjects whose samples showed detectable alpha-fetoprotein messenger RNA. The presence of alpha-fetoprotein messenger RNA in blood seemed to be correlated with the stage (by TNM classification) of hepatocellular carcinoma, serum alpha-fetoprotein value, and the presence of intrahepatic metastasis, portal vein thrombosis, tumor diameter and/or distant metastasis. In addition, alpha-fetoprotein messenger RNA was detected in the blood of 25 patients showing distant metastasis at extrahepatic organs (100%), in contrast to 32 of 88 cases without metastasis (36.4%). All the patients with hepatocellular carcinoma were followed. Seventeen patients with resection of a T 2 stage hepatocellular carcinoma had a survival of 3.2 years after surgical management, 38 cases with resection of a T3 stage hepatocellular carcinoma had a 1.3-year survival, and only 37 cases with T4 stage disease after different treatments except surgery survived for 0.6 years (P <0.01). The presence of alpha-fetoprotein messenger RNA in peripheral blood may be an indicator of circulating
2014-12-01
microparts Datar, S . M., Horngren , C. T., & Rajan, M. (2012). Cost accounting : A managerial emphasis. Upper Saddle River, NJ: Pearson Prentice Hall... Horngren , and Rajan (2012) infer that common decision criteria for managers include quality, dependability of suppliers, and costs as the most...IDENTIFICATION FOR ADDITIVE MANUFACTURING (3-D PRINTING) WITHIN THE NAVAL SUPPLY CHAIN 5. FUNDING NUMBERS 6. AUTHOR( S ) Jason A. Morgan, Jacob M
Sütekin, S. Duygu; Güven, Olgun
2018-01-01
The kinetic investigation of one-pot synthesis of poly(acrylic acid) (PAA) prepared via gamma radiation induced controlled polymerization was reported. PAA homopolymers were prepared by Reversible Addition-Fragmentation Chain Transfer (RAFT) polymerization in the presence of trithiocarbonate-based chain transfer agent (CTA) 2-(Dodecylthiocarbonothioylthio)-2-methylpropionic acid (DDMAT) and also by Reversible Addition-Fragmentation/Macromolecular Design by Inter-change of Xanthates (RAFT/MADIX) polymerization in the presence of a xanthate based CTA O-ethyl-S-(1-methoxycarbonyl) ethyl dithiocarbonate (RA1). The polymerizations were performed at room temperature by the virtue of ionizing radiation. Protic solvents were used for the RAFT polymerization of AA considering environmental profits. The linear first-order kinetic plot, close control of molecular weight by the monomer/CTA molar ratio supported that the polymerization proceeds in a living fashion. The linear increase in molecular weight with conversion monitored by Size Exclusion Chromatography (SEC) is another proof of controlling of polymerization. [Monomer]/[RAFT] ratio and conversion was controlled to obtain PAA in the molecular weight range of 6900-35,800 with narrow molecular weight distributions. Reaction kinetics and effect of the amount of RAFT agent were investigated in detail. Between two different types of CTA, trithiocarbonate based DDMAT was found to be more efficient in terms of low dispersity (Đ) and linear first-order kinetic behavior for the radiation induced controlled synthesis of PAA homopolymers.
Vincke, Cécile; Gutiérrez, Carlos; Wernery, Ulrich; Devoogdt, Nick; Hassanzadeh-Ghassabeh, Gholamreza; Muyldermans, Serge
2012-01-01
Immunizing a camelid (camels and llamas) with soluble, properly folded proteins raises an affinity-matured immune response in the unique camelid heavy-chain only antibodies (HCAbs). The peripheral blood lymphocytes of the immunized animal are used to clone the antigen-binding antibody fragment from the HCAbs in a phage display vector. A representative aliquot of the library of these antigen-binding fragments is used to retrieve single domain antigen-specific binders by successive rounds of panning. These single domain antibody fragments are cloned in tandem to generate manifold constructs (bivalent, biparatopic or bispecific constructs) to increase their functional affinity, to increase specificity, or to connect two independent antigen molecules.
Predicting "Hot" and "Warm" Spots for Fragment Binding.
Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L
2017-05-11
Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .
DEFF Research Database (Denmark)
Maida, Adriano; Chan, Jessica S K; Sjøberg, Kim Anker
2017-01-01
OBJECTIVE: Dietary protein dilution (PD) has been associated with metabolic advantages such as improved glucose homeostasis and increased energy expenditure. This phenotype involves liver-induced release of FGF21 in response to amino acid insufficiency; however, it has remained unclear whether...... dietary dilution of specific amino acids (AAs) is also required. Circulating branched chain amino acids (BCAAs) are sensitive to protein intake, elevated in the serum of obese humans and mice and thought to promote insulin resistance. We tested whether replenishment of dietary BCAAs to an AA-diluted (AAD......) diet is sufficient to reverse the glucoregulatory benefits of dietary PD. METHODS: We conducted AA profiling of serum from healthy humans and lean and high fat-fed or New Zealand obese (NZO) mice following dietary PD. We fed wildtype and NZO mice one of three amino acid defined diets: control, total...
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Kinetics of a Migration-Driven Aggregation-Fragmentation Process
Institute of Scientific and Technical Information of China (English)
ZHUANG You-Yi; LIN Zhen-Quan; KE Jian-Hong
2003-01-01
We propose a reversible model of the migration-driven aggregation-fragmentation process with the sym-metric migration rate kernels K(k;j) = K'(k;j) = λkjv and the constant aggregation rates I1, I2 and fragmentationrates J1, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions inseveral cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When J1 = 0 and J2 = 0, the aggregate sizedistributions ak(t) and bk(t) obey the conventional scaling law, while when J1 > 0 and J2 > 0, they obey the modifiedscaling law with an exponential scaling function. The total mass of either species remains conserved.
Plastic recycling in the Nordics: A value chain market analysis.
Milios, Leonidas; Holm Christensen, Lena; McKinnon, David; Christensen, Camilla; Rasch, Marie Katrine; Hallstrøm Eriksen, Mikael
2018-06-01
There is low utilisation of plastic waste in the Nordic region and only a fraction of plastic materials go back into production processes through reuse and recycling practices. This paper aims to increase knowledge concerning factors that inhibit demand for recycled plastics, and to identify critical barriers for plastic recycling across the regional plastics value chain. A literature review and targeted interviews with key actors across the plastics value chain enabled the mapping of interactions between the major actors and identified hotspots that act as barriers to the flow of plastic materials. Barriers identified include the lack of both supply and demand of recycled plastic and are mainly attributed to the fragmented market of secondary materials. The main hotspots identified are the low demand due to price considerations, insufficient traceability and transparency in value chain transactions, and general design deficiencies in the recyclability of products. Value chain coordination is considered as the most important intervention by the interviewees, followed by the need for increased investment in innovation and technology development. Complementary measures that could counteract the identified barriers include public procurement for resource efficiency, ban on the incineration of recyclable materials, and specifications on the design of plastic products for reducing the number of different polymers, and the number and usage of additives. Copyright © 2018 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
De Filippo, E; Cardella, G; Guidara, E La; Pagano, A; Papa, M; Amorini, F; Colonna, M; Gianì, S; Grassi, L; Han, J; Maiolino, C; Auditore, L; Minniti, T; Baran, V; Berceanu, I; Geraci, E; Grzeszczuk, A; Guazzoni, P; Lanzalone, G; Lombardo, I
2013-01-01
We show new data from the 64 Ni+ 124 Sn and 58 Ni+ 112 Sn reactions studied in direct kinematics with the CHIMERA detector at INFN-LNS and compared with the reverse kinematics reactions at the same incident beam energy (35 A MeV). Analyzing the data with the method of relative velocity correlations, fragments coming from statistical decay of an excited projectile-like (PLF) or target-like (TLF) fragments are discriminated from the ones coming from dynamical emission in the early stages of the reaction. By comparing data of the reverse kinematics experiment with a stochastic mean field (SMF) + GEMINI calculations our results show that observables from neck fragmentation mechanism add valuable constraints on the density dependence of symmetry energy. An indication is found for a moderately stiff symmetry energy potential term of EOS.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
Finding metastabilities in reversible Markov chains based on incomplete sampling
Directory of Open Access Journals (Sweden)
Fackeldey Konstantin
2017-01-01
Full Text Available In order to fully characterize the state-transition behaviour of finite Markov chains one needs to provide the corresponding transition matrix P. In many applications such as molecular simulation and drug design, the entries of the transition matrix P are estimated by generating realizations of the Markov chain and determining the one-step conditional probability Pij for a transition from one state i to state j. This sampling can be computational very demanding. Therefore, it is a good idea to reduce the sampling effort. The main purpose of this paper is to design a sampling strategy, which provides a partial sampling of only a subset of the rows of such a matrix P. Our proposed approach fits very well to stochastic processes stemming from simulation of molecular systems or random walks on graphs and it is different from the matrix completion approaches which try to approximate the transition matrix by using a low-rank-assumption. It will be shown how Markov chains can be analyzed on the basis of a partial sampling. More precisely. First, we will estimate the stationary distribution from a partially given matrix P. Second, we will estimate the infinitesimal generator Q of P on the basis of this stationary distribution. Third, from the generator we will compute the leading invariant subspace, which should be identical to the leading invariant subspace of P. Forth, we will apply Robust Perron Cluster Analysis (PCCA+ in order to identify metastabilities using this subspace.
DEFF Research Database (Denmark)
Refslund, Bjarke
Stigende international økonomisk integration har betydet en stigende fragmentering af produktionen, hvor store dele udføres i forskellige lande. Dertil kommer en stigende disintegration af vertikale styringsformer i produktions-værdikæder (Global Value Chains). Dette konferencepaper diskutere...
Reverse logistics: an empirical study for operational framework
International Nuclear Information System (INIS)
Yusuf, I.
2013-01-01
This paper presents framework of reverse logistics optimizing the stakeholders gain, social gain, economic gain and environmental gain. It identifies the roadblocks that prevail in recycling industry and describes various types of returns and wastes. Framework of the reverse logistics is evolved on the basis of actual happening of the items shown in table 1-4 disposed off from industries shown in table 6. The rejected items require environmental disposal passing through the different phases described in flow of operational framework. An operational framework of reverse logistics is developed studying fifty organizations.. In ad -dition three best practices of reverse logistics are proposed by consolidating the experiential information and rich hands on industrial experience in supply chain and reverse logistics area. The research has proposed the Social, Stakeholder, Economic and Environmental (SSEE) sustained gain model optimizing the benefits of stakeholders and highlights the variety of waste and its operational methodology in Pakistani industry. The proposed framework does not include the hospital waste, radioactive waste, hazardous materials waste, municipal waste, agricultural waste and cold chain waste like meat, milk, etc.The operational framework is existing way of doing that takes the waste materials from point of origin to the point of recycling. A better understanding of this framework may help researchers and front line managers to develop better, more ac -curate models for effective and sustainable utilization of waste materials, benefiting organizations and soci -ety by simultaneously enhancing the cost effectiveness and improving environmental awareness. The paper provides an operational framework of reverse logistics and 2S2E sustained gain model. Specific applications are examined through empirical research. (author)
Threshold Switching Induced by Controllable Fragmentation in Silver Nanowire Networks.
Wan, Tao; Pan, Ying; Du, Haiwei; Qu, Bo; Yi, Jiabao; Chu, Dewei
2018-01-24
Silver nanowire (Ag NW) networks have been widely studied because of a great potential in various electronic devices. However, nanowires usually undergo a fragmentation process at elevated temperatures due to the Rayleigh instability that is a result of reduction of surface/interface energy. In this case, the nanowires become completely insulating due to the formation of randomly distributed Ag particles with a large distance and further applications are hindered. Herein, we demonstrate a novel concept based on the combination of ultraviolet/ozone irradiation and a low-temperature annealing process to effectively utilize and control the fragmentation behavior to realize the resistive switching performances. In contrast to the conventional fragmentation, the designed Ag/AgO x interface facilitates a unique morphology of short nanorod-like segments or chains of tiny Ag nanoparticles with a very small spacing distance, providing conduction paths for achieving the tunneling process between the isolated fragments under the electric field. On the basis of this specific morphology, the Ag NW network has a tunable resistance and shows volatile threshold switching characteristics with a high selectivity, which is the ON/OFF current ratio in selector devices. Our concept exploits a new function of Ag NW network, i.e., resistive switching, which can be developed by designing a controllable fragmentation.
Forbidden subgraph pairs for traceability of block-chains
Li, Binlong; Li, Binlong; Broersma, Haitze J.; Zhang, Shenggui
2013-01-01
A block-chain is a graph whose block graph is a path, i.e. it is either a P1, a P2, or a 2-connected graph, or a graph of connectivity 1 with exactly two end-blocks. A graph is called traceable if it contains a Hamilton path. A traceable graph is clearly a block-chain, but the reverse does not hold
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Banerjee, Chiranjib; Mandal, Sarthak; Ghosh, Surajit; Rao, Vishal Govind; Sarkar, Nilmoni
2012-09-13
In this manuscript, we have modulated the location of an anionic probe, Coumarin-343 (C-343) in a zwitterionic (N-hexadecyl-N,N-dimethylammonio-1-propanesulfonate (SB-16)) micellar system by three different approaches. The effect of addition of the surfactant sodium dodecyl sulfate (SDS) and the room temperature ionic liquid (RTIL), 1-ethyl-3-methylimidazolium octylsulfate (EmimOs) and N,N-dimethylethanol hexanoate (DAH), to the micellar solution has been studied. The effect of pH variation has been studied as well using solvent and rotational measurements. Migration of the anionic probe, C-343, from the palisade layer of SB-16 micelle to the bulk water has been observed to varying extents with the addition of SDS and EmimOs. The effect is much more pronounced in the presence of SDS and can be ascribed to the presence of the long alkyl (dodecyl) chain on SDS which can easily orient itself and fuse inside the SB-16 micelle and facilitate the observed migration of the probe molecule. This phenomenon is confirmed by faster solvation and rotational relaxation of the investigated probe molecule. The analogous fusion process is difficult in case of EmimOs and DAH because of their comparatively smaller alkyl (octyl and hexanoate) chain. However, the direction of C-343 migration is reversed with the decrease of pH of the SB-16 micellar medium. An increase in the average solvation and rotational relaxation time of the probe in acidic medium has been observed. Since experimental conditions are maintained such that the probe molecules and the zwitterionic SB-16 micelles remain oppositely charged, the observed results can be attributed to the increased electrostatic interaction (attractive) between them. Temperature dependent study also supports this finding.
Structure of antigenetic determinants in the amino-terminal region of bovine fibrinogen Aα chain
International Nuclear Information System (INIS)
Tanswell, P.; Reiter, H.; Timpl, R.
1978-01-01
A radioimmunoassay was developed for peptide F-CB1α from the amino of bovine fibrinogen Aα chain, isolated after reduction and carboxymethylation of the multichain disulfide-linked cyanogen bromide peptide F-CB1. Seven out of twelve different rabbit antisera produced against fibrinogen, peptide F-CB1 or Aα chain showed distinct binding to 125 I-labelled F-CB1α. Thrombin cleavage of F-CB1α yielded two fragments: fibrinopeptide A (residues 1-19) and the carboxy-terminal fragment Th2 (residues 20-54). Antisera could be classified into three groups according to whether they recognized antigenic determinants on fibrinopeptide A, on peptide Th2 or as they showed diminished reactions with both fragments. Only little or no cross-reaction was observed with the amino-terminal cyanogen bromide peptides of Bβ and γ chain. Proteolytic fragments of fibrinopeptide A were isolated and tested for inhibitory activity with two antisera. One antiserum contained anitbodies binding selectively to the amino-terminal sequence (residues 4-11) and did not cross-react with human fibrinopeptide A. Another antiserum showed a specific binding restricted to the carboxy-terminal sequence (residues 11-18) and cross-reacted completely with human fibrinopeptide A. These results correlate well with the primary structures of the two fibrinopeptides. The antigenic activity of the peptide fragment Th2 was localized on a 15-residue tryptic peptide derived from the central portion of the sequence. These and further data indicate that at least six different antigenic determinants are present in peptide F-CB1α. (orig.) 891 AJ [de
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
Azobenzene side-chain liquid crystalline polyesters with outstanding optical storage properties
DEFF Research Database (Denmark)
Hvilsted, Søren; Pedersen, M; Holme, NCR
1998-01-01
A flexible azobenzene side-chain liquid crystalline (SCLC) polyester architecture employed for reversible optical storage is described. The modular design allows four structural parameters to be individually modified. These parameters: i- the methylene side-chain spacer length, ii- the substituent......,000 are routinely obtained by melt transesterification of the novel diols and selected diacid precursors (parameter iii). Prominent storage features include no prealignment of thin SCLC polyester films prior to the writing process, and sensitivity in a broad laser wavelength window (415-532 nm). Additionally...... sign of fatigue. The non-destructive read out is performed with red light (600-750 nm). Finally, erasing the information can be achieved by heating the polyester film to 80 degrees C or irradiating it briefly with UV-light. In the latter case at least 10,000 write, read and erase cycles are possible...
Measuring the temperature of hot nuclear fragments
International Nuclear Information System (INIS)
Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.
2010-01-01
A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.
Forbidden subgraph pairs for traceability of block-chains
Directory of Open Access Journals (Sweden)
Binlong Li
2013-04-01
Full Text Available A block-chain is a graph whose block graph is a path, i.e. it is either a $P_1$, a $P_2$, or a 2-connected graph, or a graph of connectivity 1 with exactly two end-blocks. A graph is called traceable if it contains a Hamilton path. A traceable graph is clearly a block-chain, but the reverse does not hold in general.In this paper we characterize all pairs of connected graphs $\\{R,S\\}$ such that every $\\{R,S\\}$-free block-chain is traceable.
Computational Fragment-Based Drug Design: Current Trends, Strategies, and Applications.
Bian, Yuemin; Xie, Xiang-Qun Sean
2018-04-09
Fragment-based drug design (FBDD) has become an effective methodology for drug development for decades. Successful applications of this strategy brought both opportunities and challenges to the field of Pharmaceutical Science. Recent progress in the computational fragment-based drug design provide an additional approach for future research in a time- and labor-efficient manner. Combining multiple in silico methodologies, computational FBDD possesses flexibilities on fragment library selection, protein model generation, and fragments/compounds docking mode prediction. These characteristics provide computational FBDD superiority in designing novel and potential compounds for a certain target. The purpose of this review is to discuss the latest advances, ranging from commonly used strategies to novel concepts and technologies in computational fragment-based drug design. Particularly, in this review, specifications and advantages are compared between experimental and computational FBDD, and additionally, limitations and future prospective are discussed and emphasized.
DEFF Research Database (Denmark)
Tireli, Derya; He, Jun; Nordling, Mette Maria
2017-01-01
Introduction Idarucizumab is a reversal agent for dabigatran etexilate. By reversing the anticoagulating effect of dabigatran etexilate with idarucizumab (Praxbind), patients presenting with an acute ischemic stroke can now be eligible for thrombolysis. Patient We describe our experience with ida......Introduction Idarucizumab is a reversal agent for dabigatran etexilate. By reversing the anticoagulating effect of dabigatran etexilate with idarucizumab (Praxbind), patients presenting with an acute ischemic stroke can now be eligible for thrombolysis. Patient We describe our experience...... of embolic stroke in patients with atrial fibrillation. Dabigatran etexilate is an oral thrombin inhibitor that can be reversed by idarucizumab. Idarucizumab, a monoclonal antibody fragment, directly binds dabigatran etexilate and neutralizes its activity. Conclusion Reversal of dabigatran etexilate using...
Application of a GIS-BIOLOCO tool for the design and assessment of biomass delivery chains
Geijzendorffer, I.R.; Annevelink, E.; Elbersen, B.S.; Smidt, R.A.; Mol, de R.M.
2008-01-01
The spatial fragmentation of different biomass sources in one or more regions makes design and assessment of sustainable biomass delivery chains rather complicated. This paper presents a GIS tool that supports the design and facilitates a sustainability assessment of biomass delivery chains at a
Long-term carbon loss in fragmented Neotropical forests.
Pütz, Sandro; Groeneveld, Jürgen; Henle, Klaus; Knogge, Christoph; Martensen, Alexandre Camargo; Metz, Markus; Metzger, Jean Paul; Ribeiro, Milton Cezar; de Paula, Mateus Dantas; Huth, Andreas
2014-10-07
Tropical forests play an important role in the global carbon cycle, as they store a large amount of carbon (C). Tropical forest deforestation has been identified as a major source of CO2 emissions, though biomass loss due to fragmentation--the creation of additional forest edges--has been largely overlooked as an additional CO2 source. Here, through the combination of remote sensing and knowledge on ecological processes, we present long-term carbon loss estimates due to fragmentation of Neotropical forests: within 10 years the Brazilian Atlantic Forest has lost 69 (±14) Tg C, and the Amazon 599 (±120) Tg C due to fragmentation alone. For all tropical forests, we estimate emissions up to 0.2 Pg C y(-1) or 9 to 24% of the annual global C loss due to deforestation. In conclusion, tropical forest fragmentation increases carbon loss and should be accounted for when attempting to understand the role of vegetation in the global carbon balance.
Characterization of a recombinant humanized anti-cocaine monoclonal antibody and its Fab fragment.
Kirley, Terence L; Norman, Andrew B
2015-01-01
Variations of post-translational modifications are important for stability and in vivo behavior of therapeutic antibodies. A recombinant humanized anti-cocaine monoclonal antibody (h2E2) was characterized for heterogeneity of N-linked glycosylation and disulfide bonds. In addition, charge heterogeneity, which is partially due to the presence or absence of C-terminal lysine on the heavy chains, was examined. For cocaine overdose therapy, Fab fragments may be therapeutic, and thus, a simplified method of generation, purification, and characterization of the Fab fragment generated by Endoproteinase Lys-C digestion was devised. Both the intact h2E2 antibody and purified Fab fragments were analyzed for their affinities for cocaine and 2 of its metabolites, benzoylecgonine and cocaethylene, by fluorescence quenching of intrinsic antibody tyrosine and tryptophan fluorescence resulting from binding of these drugs. Binding constants obtained from fluorescence quenching measurements are in agreement with recently published radioligand and ELISA binding assays. The dissociation constants determined for the h2E2 monoclonal and its Fab fragment are approximately 1, 5, and 20 nM for cocaethylene, cocaine, and benzoylecgonine, respectively. Tryptophan fluorescence quenching (emission at 330 nm) was measured after either excitation of tyrosine and tryptophan (280 nm) or selective excitation of tryptophan alone (295 nm). More accurate binding constants are obtained using tryptophan selective excitation at 295 nm, likely due to interfering absorption of cocaine and metabolites at 280 nm. These quenching results are consistent with multiple tryptophan and tyrosine residues in or near the predicted binding location of cocaine in a previously published 3-D model of this antibody's variable region.
Reverse Logistics – Capturing Value in the Extended Supply Chain
M. Fleischmann (Moritz); J.A.E.E. van Nunen (Jo); B. Graeve; R. Gapp
2004-01-01
textabstractProduct flows in today’s supply chains do not end once they have reached the customer. Many products lead a second and even third or fourth life after having accomplished their original task at their first customer. Consequently, a product may generate revenues multiple times, rather
Directory of Open Access Journals (Sweden)
Byung Do Chung
2018-04-01
Full Text Available Interest in smart factories and smart supply chains has been increasing, and researchers have emphasized the importance and the effects of advanced technologies such as 3D printers, the Internet of Things, and cloud services. This paper considers an innovation in dynamic supply-chain design and operations: connected smart factories that share interchangeable processes through a cloud-based system for personalized production. In the system, customers are able to upload a product design file, an optimal supply chain design and operations plan are then determined based on the available resources in the network of smart factories. The concept of smart supply chains is discussed and six types of flexibilities are identified, namely: design flexibility, product flexibility, process flexibility, supply chain flexibility, collaboration flexibility, and strategic flexibility. Focusing on supply chain flexibility, a general planning framework and various optimization models for dynamic supply chain design and operations plan are proposed. Further, numerical experiments are conducted to analyze fixed, production, and transportation costs for various scenarios. The results demonstrate the extent of the dynamic supply chain design and operations problem, and the large variation in transportation cost.
International Nuclear Information System (INIS)
Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji
1991-01-01
The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C H 1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides 1 H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2'-H and Tyr C3',5'-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed
DEFF Research Database (Denmark)
Hofstätter, Thomas; Bey, Niki; Mischkot, Michael
2017-01-01
Additive manufacturing technologies applied to injection molding process chain have acquired an increasingly important role in the context of tool inserts production, especially by vat polymerization. Despite the decreased lifetime during their use in the injection molding process, the inserts come...... with improvements in terms of production time, costs, exibility, as well as potentially improved environmental performance as compared to conventional materials in a life cycle perspective.This contribution supports the development of additively manufactured injection molding inserts with the use of fiber...
International Nuclear Information System (INIS)
Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James
2014-01-01
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Energy Technology Data Exchange (ETDEWEB)
Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)
2014-04-10
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Jaberidoost, Mona; Olfat, Laya; Hosseini, Alireza; Kebriaeezadeh, Abbas; Abdollahi, Mohammad; Alaeddini, Mahdi; Dinarvand, Rassoul
2015-01-01
Pharmaceutical supply chain is a significant component of the health system in supplying medicines, particularly in countries where main drugs are provided by local pharmaceutical companies. No previous studies exist assessing risks and disruptions in pharmaceutical companies while assessing the pharmaceutical supply chain. Any risks affecting the pharmaceutical companies could disrupt supply medicines and health system efficiency. The goal of this study was the risk assessment in pharmaceutical industry in Iran considering process's priority, hazard and probability of risks. The study was carried out in 4 phases; risk identification through literature review, risk identification in Iranian pharmaceutical companies through interview with experts, risk analysis through a questionnaire and consultation with experts using group analytic hierarchy process (AHP) method and rating scale (RS) and risk evaluation of simple additive weighting (SAW) method. In total, 86 main risks were identified in the pharmaceutical supply chain with perspective of pharmaceutical companies classified in 11 classes. The majority of risks described in this study were related to the financial and economic category. Also financial management was found to be the most important factor for consideration. Although pharmaceutical industry and supply chain were affected by current political conditions in Iran during the study time, but half of total risks in the pharmaceutical supply chain were found to be internal risks which could be fixed by companies, internally. Likewise, political status and related risks forced companies to focus more on financial and supply management resulting in less attention to quality management.
Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis
Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.
2018-04-01
Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).
International Nuclear Information System (INIS)
Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.
2007-01-01
Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)
Formation of amyloid fibers by monomeric light chain variable domains.
Brumshtein, Boris; Esswein, Shannon R; Landau, Meytal; Ryan, Christopher M; Whitelegge, Julian P; Phillips, Martin L; Cascio, Duilio; Sawaya, Michael R; Eisenberg, David S
2014-10-03
Systemic light chain amyloidosis is a lethal disease characterized by excess immunoglobulin light chains and light chain fragments composed of variable domains, which aggregate into amyloid fibers. These fibers accumulate and damage organs. Some light chains induce formation of amyloid fibers, whereas others do not, making it unclear what distinguishes amyloid formers from non-formers. One mechanism by which sequence variation may reduce propensity to form amyloid fibers is by shifting the equilibrium toward an amyloid-resistant quaternary structure. Here we identify the monomeric form of the Mcg immunoglobulin light chain variable domain as the quaternary unit required for amyloid fiber assembly. Dimers of Mcg variable domains remain stable and soluble, yet become prone to assemble into amyloid fibers upon disassociation into monomers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Antiretroviral procurement and supply chain management.
Ripin, David J; Jamieson, David; Meyers, Amy; Warty, Umesh; Dain, Mary; Khamsi, Cyril
2014-01-01
Procurement, the country-level process of ordering antiretrovirals (ARVs), and supply chain management, the mechanism by which they are delivered to health-care facilities, are critical processes required to move ARVs from manufacturers to patients. To provide a glimpse into the ARV procurement and supply chain, the following pages provide an overview of the primary stakeholders, principal operating models, and policies and regulations involved in ARV procurement. Also presented are key challenges that need to be addressed to ensure that the supply chain is not a barrier to the goal of universal coverage. This article will cover the steps necessary to order and distribute ARVs, including different models of delivery, key stakeholders involved, strategic considerations that vary depending on context and policies affecting them. The single drug examples given illustrate the complications inherent in fragmented supply and demand-driven models of procurement and supply chain management, and suggest tools for navigating these hurdles that will ultimately result in more secure and reliable ARV provision. Understanding the dynamics of ARV supply chain is important for the global health community, both to ensure full and efficient treatment of persons living with HIV as well as to inform the supply chain decisions for other public health products.
A probabilistic fragment-based protein structure prediction algorithm.
Directory of Open Access Journals (Sweden)
David Simoncini
Full Text Available Conformational sampling is one of the bottlenecks in fragment-based protein structure prediction approaches. They generally start with a coarse-grained optimization where mainchain atoms and centroids of side chains are considered, followed by a fine-grained optimization with an all-atom representation of proteins. It is during this coarse-grained phase that fragment-based methods sample intensely the conformational space. If the native-like region is sampled more, the accuracy of the final all-atom predictions may be improved accordingly. In this work we present EdaFold, a new method for fragment-based protein structure prediction based on an Estimation of Distribution Algorithm. Fragment-based approaches build protein models by assembling short fragments from known protein structures. Whereas the probability mass functions over the fragment libraries are uniform in the usual case, we propose an algorithm that learns from previously generated decoys and steers the search toward native-like regions. A comparison with Rosetta AbInitio protocol shows that EdaFold is able to generate models with lower energies and to enhance the percentage of near-native coarse-grained decoys on a benchmark of [Formula: see text] proteins. The best coarse-grained models produced by both methods were refined into all-atom models and used in molecular replacement. All atom decoys produced out of EdaFold's decoy set reach high enough accuracy to solve the crystallographic phase problem by molecular replacement for some test proteins. EdaFold showed a higher success rate in molecular replacement when compared to Rosetta. Our study suggests that improving low resolution coarse-grained decoys allows computational methods to avoid subsequent sampling issues during all-atom refinement and to produce better all-atom models. EdaFold can be downloaded from http://www.riken.jp/zhangiru/software.html [corrected].
Systematics of complex fragment emission from La induced reactions at E/A = 47 MeV
International Nuclear Information System (INIS)
Kehoe, W.L.; Mignerey, A.C.; Bradley, S.
1989-03-01
Complex fragment (Z > 2) emission was studied in the reverse kinematics reactions of 139 La on 27 Al and /sup nat./Cu at a bombarding energy of E/A = 47 MeV. Experimental results from inclusive and coincidence measurements for two- and three-fold complex fragments events are presented. Measured cross sections and Z 1 -Z 2 correlations show a predominately binary-decay process for the La + Al reaction, while the La + Cu reaction is dominated by multi-body decay. 18 refs., 9 figs., 1 tab
Barriers and Prospects for Reverse Logistics as Regards oil Lube and its Packaging
Directory of Open Access Journals (Sweden)
Luis Alfredo Sencovici
2015-08-01
Full Text Available This article aims to discuss the main challenges and prospects for the implementation of reverse logistics to lube oil and its packaging. The methodology focuses on conducting in-depth interviews with representatives of these products’ chains, and the results show that technological advances now allow for the generation of re-refined oil with better economic and environmental features than crude oil, and there have been noticeable advances as to packaging too. However, issues such as conflicts in the reverse chain as to the distribution costs of collection, lack of regional solutions to recycling activities, poor supervision, lack of tax incentives and manufacturers’ low interest in modify their products and processes emphasis on prevention challenge the expansion of large-scale reverse logistics activity in the country.
Dupré, Mathieu; Cantel, Sonia; Martinez, Jean; Enjalbal, Christine
2012-02-01
By screening a data set of 392 synthetic peptides MS/MS spectra, we found that a known C-terminal rearrangement was unexpectedly frequently occurring from monoprotonated molecular ions in both ESI and MALDI tandem mass spectrometry upon low and high energy collision activated dissociations with QqTOF and TOF/TOF mass analyzer configuration, respectively. Any residue localized at the C-terminal carboxylic acid end, even a basic one, was lost, provided that a basic amino acid such arginine and to a lesser extent histidine and lysine was present in the sequence leading to a fragment ion, usually depicted as (bn-1 + H2O) ion, corresponding to a shortened non-scrambled peptide chain. Far from being an epiphenomenon, such a residue exclusion from the peptide chain C-terminal extremity gave a fragment ion that was the base peak of the MS/MS spectrum in certain cases. Within the frame of the mobile proton model, the ionizing proton being sequestered onto the basic amino acid side chain, it is known that the charge directed fragmentation mechanism involved the C-terminal carboxylic acid function forming an anhydride intermediate structure. The same mechanism was also demonstrated from cationized peptides. To confirm such assessment, we have prepared some of the peptides that displayed such C-terminal residue exclusion as a C-terminal backbone amide. As expected in this peptide amide series, the production of truncated chains was completely suppressed. Besides, multiply charged molecular ions of all peptides recorded in ESI mass spectrometry did not undergo such fragmentation validating that any mobile ionizing proton will prevent such a competitive C-terminal backbone rearrangement. Among all well-known nondirect sequence fragment ions issued from non specific loss of neutral molecules (mainly H2O and NH3) and multiple backbone amide ruptures (b-type internal ions), the described C-terminal residue exclusion is highly identifiable giving raise to a single fragment ion in
[Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].
Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan
2017-03-01
Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.
An analytic network process-based multicriteria decision making model for a reverse supply chain
DEFF Research Database (Denmark)
Govindan, Kannan; Sarkis, J.; Palaniappan, M.
2013-01-01
Reverse logistics has emerged as an important dimension for organizations to build their strategic advantage. Part of this effort relies on potentially outsourcing these activities. With this competitive issue in mind, this paper presents a multistep process to select a third-party reverse logistic...
Phase separation in short-chain lecithin/gel-state long-chain lecithin aggregates
International Nuclear Information System (INIS)
Bian, J.; Roberts, M.F.
1990-01-01
Small bilayer particles for spontaneously from gel-state long-chain phospholipids such as dipalmitoylphosphatidylcholine and 0.2 mol fraction short-chain lecithins (e.g., diheptanoylphosphatidylcholine). When the particles are incubed at temperatures greater than the T m of the long-chain phosphatidylcholine (PC), the particles rapidly fuse (from 90-angstrom to ≥ 5,000-angstrom radius); this transition is reversible. A possible explanation for this behavior involves patching or phase separation of the short-chain component within the gel-state particle and randomization of both lipid species above T m . Differential scanning calorimetry, 1 H T 1 values of proteodiheptanoyl-PC in diheptanoyl-PC-d 26 /dipalmitoyl-PC-d 62 matrices of varying deuterium content, solid-state 2 H NMR spectroscopy as a function of temperature, and fluorescence pyrene excimer-to-monomer ratios as a function of mole fraction diheptanoyl-PC provide evidence that such phase separation must occur. These results are used to construct a phase diagram for the diheptanoyl-PC/dipalmitoyl-PC system, to propose detailed geometric models for the different lipid particles involved, and to understand phospholipase kinetics toward the different aggregates
Chain Dynamics in Magnetorheological Suspensions
Gast, A. P.; Furst, E. M.
1999-01-01
Magnetorheological (MR) suspensions are composed of colloidal particles which acquire dipole moments when subjected to an external magnetic field. At sufficient field strengths and concentrations, the dipolar particles rapidly aggregate to form long chains. Subsequent lateral cross-linking of the dipolar chains is responsible for a rapid liquid-to-solid-like rheological transition. The unique, magnetically-activated rheological properties of MR suspensions make them ideal for interfacing mechanical systems to electronic controls. Additionally, the ability to experimentally probe colloidal suspensions interacting through tunable anisotropic potentials is of fundamental interest. Our current experimental work has focused on understanding the fluctuations of dipolar chains. It has been proposed by Halsey and Toor (HT) that the strong Landau-Peierls thermal fluctuations of dipolar chains could be responsible for long-range attractions between chains. Such interactions will govern the long-time relaxation of MR suspensions. We have synthesized monodisperse neutrally buoyant MR suspensions by density matching stabilized ferrofluid emulsion droplets with D2O. This allows us to probe the dynamics of the dipolar chains using light scattering without gravitational, interfacial, and polydispersity effects to resolve the short-wavelength dynamics of the dipolar chains. We used diffusing wave spectroscopy to measure these dynamics. The particle displacements at short times that show an independence to the field strength, but at long times exhibit a constrained, sub-diffusive motion that slows as the dipole strength is increased. The experiments are in good qualitative agreement with Brownian dynamics simulations of dipolar chains. Although there have been several important and detailed studies of the structure and interactions in MR suspensions, there has not been conclusive evidence that supports or contradicts the HT model prediction that long-range interactions exist between
DEFF Research Database (Denmark)
Zhou, Tongchang; Jørgensen, Lars; Mattebjerg, Maria Ahlm
2014-01-01
A nicotine imprinted polymer was synthesized by reversible addition-fragmentation chain transfer (RAFT) polymerization using methacrylic acid (MAA) as a functional monomer. The resulting molecularly imprinted polymers were monodispersed beads with an average diameter of 1.55 mm. The molecular...... selectivity of the imprinted polymer beads was evaluated by studying the uptake of nicotine and its structural analogs by the polymer beads. Equilibrium binding results indicate that the amount of nicotine bound to the imprinted polymer beads is significantly higher than that bound to the nonimprinted polymer...
International Nuclear Information System (INIS)
Southard, Glen E.; Van Houten, Kelly A.; Ott, Edward W.; Murray, George M.
2007-01-01
Molecularly imprinted polymers capable of sensing organophosphorous compounds by luminescence have been prepared by reversible addition fragmentation chain transfer (RAFT) polymerization. The polymer contained a dithiobenzoate substituted tris(β-diketonate) europium(III) complex which served as a polymerization substrate and as a luminescent binding site for pinacolyl methylphosphonate (PMP), the hydrolysis product of the nerve agent Soman. The resultant polymer allowed quantitation of PMP in the low ppb range with minimal interference from similar compounds. Polymers were characterized by luminescence spectroscopy and scanning electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji (Univ. of Tokyo (Japan))
1991-03-19
The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C{sub H}1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides {sup 1}H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2{prime}-H and Tyr C3{prime},5{prime}-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed.
On low frequency dynamics of CuO finite chains in YBa2Cu3O7-δ type high-tc superconductors
International Nuclear Information System (INIS)
Stasyuk, I.V.; Kotsur, S.S.; Ivankiv, A.L.; Dublenich, Yu.I.
1992-01-01
A problem of vibration spectrum of a crystal, featuring availability of sublattices with sufficient anharmonicity of single-ion potential is considered. Dynamics of Cu (1) O (1) finite chains in YBa 2 Cu 3 O 7-δ type crystals is studies on the basis of pseudo-spin model. Dependences of chains vibration spectra with small number of fragments on theory parameters are obtained. It is shown that in low-energy spectrum part there is a transition (from the main state), which energy decreases with increase of chain fragments number. Intensities of vibration transitions between the levels are calculated
Phase Transition of Poly(acrylic acid-co-N-isopropylacrylamide) Core-shell Nanogels
Liu, Xiao-bing; Zhou, Jian-feng; Ye, Xiao-dong
2012-08-01
A series of poly(acrylic acid) macromolecular chain transfer agents with different molecular weights were synthesized by reversible addition-fragmentation chain transfer (RAFT) polymerization and characterized by 1H NMR and gel permeation chromatography. Multiresponsive core-shell nanogels were prepared by dispersion polymerization of N-isopropylacrylamide in water using these poly(potassium acrylate) macro-RAFT agents as the electrosteric stabilizer. The size of the nanogels decreases with the amount of the macro-RAFT agent, indicating that the surface area occupied by per polyelectrolyte group is a critical parameter for stabilizing the nanogels. The volume phase transition and the zeta potentials of the nanogels in aqueous solutions were studied by dynamic light scattering and zetasizer analyzer, respectively.
Energy Technology Data Exchange (ETDEWEB)
Di Carlo, Gabriele; Damin, Francesco [Institute of Chemistry of Molecular Recognition, National Research Council of Italy, Via M. Bianco 9, 20131 Milano (Italy); Armelao, Lidia [ISTM-CNR and INSTM, Department of Chemistry, University of Padova, Via F. Marzolo 1, 35131 Padova (Italy); Maccato, Chiara [Department of Chemistry and INSTM, University of Padova, Via F. Marzolo 1, 35131 Padova (Italy); Unlu, Selim [Department of Electrical and Computer Engineering, Boston University, St. Mary Street 8, Boston, MA 02215 (United States); Department of Biomedical Engineering, Boston University, St. Mary Street 8, Boston, MA 02215 (United States); Spuhler, Philipp S. [Department of Biomedical Engineering, Boston University, St. Mary Street 8, Boston, MA 02215 (United States); Chiari, Marcella, E-mail: marcella.chiari@icrm.cnr.it [Institute of Chemistry of Molecular Recognition, National Research Council of Italy, Via M. Bianco 9, 20131 Milano (Italy)
2012-02-01
Surface initiated polymerization (SIP) coupled with reversible addition-fragmentation chain transfer polymerization (RAFT) was used to functionalize microarray glass slides with block polymer brushes. N,N-dimethylacrylamide (DMA) and N-acryloyloxysuccinimide (NAS) (graft-poly[DMA-b-(DMA-co-NAS)]) brushes, with di-block architecture, were prepared from a novel RAFT chain transfer agent bearing a silanating moiety (RAFT silane) directly anchored onto the glass surfaces. Conformational characterization of the coatings was performed by Self Spectral Interference Fluorescence Microscopy (SSFM), an innovative technique that describes the location of a fluorescent DNA molecule relative to a surface with sub-nanometer accuracy. X-ray Photoelectron Spectroscopy (XPS) and Scanning Electron Microscopy (SEM) were used to characterize the coatings composition and morphology.
International Nuclear Information System (INIS)
Di Carlo, Gabriele; Damin, Francesco; Armelao, Lidia; Maccato, Chiara; Unlu, Selim; Spuhler, Philipp S.; Chiari, Marcella
2012-01-01
Surface initiated polymerization (SIP) coupled with reversible addition-fragmentation chain transfer polymerization (RAFT) was used to functionalize microarray glass slides with block polymer brushes. N,N-dimethylacrylamide (DMA) and N-acryloyloxysuccinimide (NAS) (graft-poly[DMA-b-(DMA-co-NAS)]) brushes, with di-block architecture, were prepared from a novel RAFT chain transfer agent bearing a silanating moiety (RAFT silane) directly anchored onto the glass surfaces. Conformational characterization of the coatings was performed by Self Spectral Interference Fluorescence Microscopy (SSFM), an innovative technique that describes the location of a fluorescent DNA molecule relative to a surface with sub-nanometer accuracy. X-ray Photoelectron Spectroscopy (XPS) and Scanning Electron Microscopy (SEM) were used to characterize the coatings composition and morphology.
Directory of Open Access Journals (Sweden)
Qian Liu
2018-03-01
Full Text Available Selenium-containing monomer monophenyl maleimide selenide (MSM was synthesized and copolymerized with styrene (St using reversible addition-fragmentation chain transfer (RAFT polymerization. Copolymers with controlled molecular weight and narrow molecular weight distribution were obtained. The structure of the copolymer was characterized by nuclear magnetic resonance, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF mass spectrum, Fourier transform infrared spectroscopy (FT-IR and Ultraviolet–visible spectroscopy (UV-vis spectroscopy. The copolymer can be oxidized by H2O2 to form carbon-carbon double bonds within the main chain due to the unique sensitivity of selenide groups in the presence of oxidants. Such structure changing resulted in an interesting concentration-related photoluminescence emission enhancement.
Kinetics of Internal-Loop Formation in Polypeptide Chains: A Simulation Study
Doucet, Dana; Roitberg, Adrian; Hagen, Stephen J.
2007-01-01
The speed of simple diffusional motions, such as the formation of loops in the polypeptide chain, places one physical limit on the speed of protein folding. Many experimental studies have explored the kinetics of formation of end-to-end loops in polypeptide chains; however, protein folding more often requires the formation of contacts between interior points on the chain. One expects that, for loops of fixed contour length, interior loops will form more slowly than end-to-end loops, owing to the additional excluded volume associated with the “tails”. We estimate the magnitude of this effect by generating ensembles of randomly coiled, freely jointed chains, and then using the theory of Szabo, Schulten, and Schulten to calculate the corresponding contact formation rates for these ensembles. Adding just a few residues, to convert an end-to-end loop to an internal loop, sharply decreases the contact rate. Surprisingly, the relative change in rate increases for a longer loop; sufficiently long tails, however, actually reverse the effect and accelerate loop formation slightly. Our results show that excluded volume effects in real, full-length polypeptides may cause the rates of loop formation during folding to depart significantly from the values derived from recent loop-formation experiments on short peptides. PMID:17208979
Reverse genetics with animal viruses. NSV reverse genetics
International Nuclear Information System (INIS)
Mebatsion, T.
2005-01-01
New strategies to genetically manipulate the genomes of several important animal pathogens have been established in recent years. This article focuses on the reverse genetics techniques, which enables genetic manipulation of the genomes of non-segmented negative-sense RNA viruses. Recovery of a negative-sense RNA virus entirely from cDNA was first achieved for rabies virus in 1994. Since then, reverse genetic systems have been established for several pathogens of medical and veterinary importance. Based on the reverse genetics technique, it is now possible to design safe and more effective live attenuated vaccines against important viral agents. In addition, genetically tagged recombinant viruses can be designed to facilitate serological differentiation of vaccinated animals from infected animals. The approach of delivering protective immunogens of different pathogens using a single vector was made possible with the introduction of the reverse genetics system, and these novel broad-spectrum vaccine vectors have potential applications in improving animal health in developing countries. (author)
International Nuclear Information System (INIS)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang
1994-01-01
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
Energy Technology Data Exchange (ETDEWEB)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)
1994-07-15
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
International Nuclear Information System (INIS)
Zhu Shoupeng; Xiao Dong; Han Xiaofeng
1997-01-01
The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis
Preparation and selected properties of ion-containing reverse osmosis membranes
International Nuclear Information System (INIS)
Hegazy, E.S.A.; Dessouki, A.M.
1986-01-01
Ion-containing reverse osmosis membranes were prepared by the post radiation grafting of 4-vinylpyridine onto low density polyethylene films, followed by quaternization of the pyridine rings in the graft chains to confer ionic character to the membranes. The effect of some preparation conditions on the grafting yield was investigated. Different quaternizing agents such as methyl iodide, allyl bromide, and hydrochloric acid were used for the quaternization of the graft chains. The effect of quaternizing agent and degree of grafting on the properties of the membranes such as swelling behaviour, specific electric resistance, water flux and salt rejection, was investigated. The properties of these ionic membranes did not deteriorate with the operation time and they show a great promise for the use in the field of reverse osmosis desalination of sea water. (author)
Induced refolding of a temperature denatured llama heavy-chain antibody fragment by its antigen
Dolk, E.; Vliet, C. van; Perez, J.M.J.; Vriend, G.; Darbon, H.; Ferrat, G.; Cambillau, C.; Frenken, L.G.J.; Verrips, T.
2005-01-01
In a previous study we have shown that llama VHH antibody fragments are able to bind their antigen after a heat shock of 90°C, in contrast to the murine monoclonal antibodies. However, the molecular mechanism by which antibody:antigen interaction occurs under these extreme conditions remains
Energy Technology Data Exchange (ETDEWEB)
Miranda, S.R.P.; Gwon, S.; DeGasperi, R. [New York Univ. Medical Center, NY (United States)] [and others
1994-09-01
Tay-Sachs disease (TSD) is an autosomal recessive storage disorder caused by a deficiency of the lysosomal enzyme, {beta}-N-acetylhexosaminidase A (Hex A), a heteropolymer composed of two polypeptides, {alpha} and {beta}. Mutations in the {alpha}-chain gene render the enzyme defective, resulting in the accumulation of g{sub m2} ganglioside in the nervous system. Deficiency of Hex A was detected in a non-Ashkenazic girl of Mexican origin indicating infantile onset of TSD. Molecular investigation of the {alpha}-chain gene excluded the typical Ashkenazic 4 bp insertion in the exon 11 and the intron 12 splice-junction mutations by Hae III and Dde I restriction analysis, respectively. Single strand conformation polymorphism (SSCP) analysis showed a different pattern in the sample where exon 11 and flanking regions were amplified in the patient DNA as compared to the migration of control DNA. Sequencing of PCR amplified genomic DNA containing exon 11 and flanking intronic regions showed a single base substitution (G {r_arrow} A) at position IVS-11 +1. This mutation creates a recognition site for the restriction enzyme Mbo II. Digestion of exon 11 and flanking regions with Mbo II demonstrated homozygosity of the patient for this mutation and heterozygosity in the mother. mRNA from cultured fibroblasts obtained from a normal control and from the propositus was reverse transcribed. The cDNAs coding for Hex A {alpha}-chain were amplified in four overlapping fragments. In the patient sample it was not possible to amplify the fragment containing the exon 11/intron 11 junction, indicating that this mutation alters normal RNA processing of the Hex A pre-mRNA resulting in the deficiency of Hex A activity.
Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins
de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin
2016-01-01
Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn
2013-09-27
Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
Probing conformational states of glutaryl-CoA dehydrogenase by fragment screening
Energy Technology Data Exchange (ETDEWEB)
Begley, Darren W.; Davies, Douglas R.; Hartley, Robert C.; Hewitt, Stephen N.; Rychel, Amanda L.; Myler, Peter J.; Van Voorhis, Wesley C.; Staker, Bart L.; Stewart, Lance J. (Emerald)
2014-10-02
Glutaric acidemia type 1 is an inherited metabolic disorder which can cause macrocephaly, muscular rigidity, spastic paralysis and other progressive movement disorders in humans. The defects in glutaryl-CoA dehydrogenase (GCDH) associated with this disease are thought to increase holoenzyme instability and reduce cofactor binding. Here, the first structural analysis of a GCDH enzyme in the absence of the cofactor flavin adenine dinucleotide (FAD) is reported. The apo structure of GCDH from Burkholderia pseudomallei reveals a loss of secondary structure and increased disorder in the FAD-binding pocket relative to the ternary complex of the highly homologous human GCDH. After conducting a fragment-based screen, four small molecules were identified which bind to GCDH from B. pseudomallei. Complex structures were determined for these fragments, which cause backbone and side-chain perturbations to key active-site residues. Structural insights from this investigation highlight differences from apo GCDH and the utility of small-molecular fragments as chemical probes for capturing alternative conformational states of preformed protein crystals.
Fidlerová, Helena; Mĺkva, Miroslava
2016-06-01
Reverse logistics, the movement of materials back up the supply chain, is recognised by many organisations as an opportunity for adding value. The paper considers the theoretical framework and the conception of reverse logistics in literature and practice. The objective of the article is to propose tangible solutions which eliminate the imbalances in reverse logistics and improve the waste management in the company. The case study focuses on the improvement in the process of waste packaging in the context of sustainable development as a part of reverse logistics in the surveyed industrial company in Slovakia.
Expression, production and renaturation of a functional single-chain ...
African Journals Online (AJOL)
The single-chain variable antibody fragment (scFv) against human intercellular adhesion molecule-1 (ICAM-1) was expressed at a high level in Escherichia coli as inclusion bodies. We attempted to refold the scFv by ion-exchange chromatography (IEC), dialysis and dilution. The results show that the column ...
Li, Hui; Li, Junjie; Ke, Wendong; Ge, Zhishen
2015-10-01
Near-infrared light (NIR) possesses great advantages for light-responsive controllable drug release, such as deep tissue penetration and low damage to healthy tissues. Herein, a NIR-responsive drug delivery system is developed based on a NIR dye, indocyanine green (ICG), and anticancer drug, doxorubicin (DOX)-loaded thermoresponsive block copolymer micelles, in which the drug release can be controlled via NIR irradiation. First, block copolymers, poly(oligo(ethylene glycol) methacrylate)-block-poly(furfuryl methacrylate) (POEGMA-b-PFMA), are synthesized by sequential reversible addition-fragmentation chain-transfer (RAFT) polymerization, followed by modification with N-octyl maleimide through Diels-Alder (DA) reaction to produce POEGMA-b-POMFMA. The self-assembly of POEGMA-b-POMFMA by nano-precipitation in aqueous solution affords the polymeric micelles which are used to simultaneously encapsulate ICG and DOX. Upon irradiation by NIR light (805 nm), the loaded DOX is released rapidly from the micelles due to partial retro DA reaction and local temperature increase-induced faster drug diffusion by the photothermal effect. Cytotoxicity evaluation and intracellular distribution observation demonstrate significant synergistic effects of NIR-triggered drug release, photothermal, and chemotherapy toward cancer cells under NIR irradiation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Assis, Paulo Henrique; Aguiar, Graziele Aparecida de Jesus; Moraes, Rodolfo Minto de; Medeiros, Simone de Fatima; Santos, Amilton Martins
2016-01-01
Full text: In recent years, well-defined block copolymers composed of a hydrophilic and hydrophobic segments have gained much interest as drug carriers, because of their enhanced solubility and sustained release of the drug in controlled delivery systems [1]. The development of strategies to obtain block copolymers has attracted considerable attention, due to the possibility to combine characteristic properties of the homopolymers. A wide variety of well-defined block copolymers have been successfully synthesized by combining the efficiency and selectivity of click chemistry with the powerful RAFT polymerization mechanism. In the present work, well-defined amphiphilic, biocompatible, partially biodegradable, and thermosensitive poly(ε-caprolactone)-b-poly(N-vinylcaprolactam) (PCL-b-PNVCL) block copolymers were synthesized by combining ring opening polymerization (ROP), reversible addition-fragmentation chain transfer (RAFT) polymerization and subsequent click chemistry reaction. Alkyne-terminated poly(ε-caprolactone) (alkyne-PCL) was obtained by the ring opening polymerization of ε-caprolactone (ε-CL) using propargyl alcohol as initiator and stannous-2-ethylhexanoate [Sn(Oct) 2 ] as catalyst. The azide end-capped-poly(N-vinylcaprolactam) (PNVCL-N 3 ) was synthesized by reversible addition-fragmentation chain transfer/macromolecular design via interchange of xanthates (RAFT/MADIX) polymerization of the N-vinylcaprolactam (NVCL) mediated by a novel chain transfer agent comprising an azide function , 2-azidoethyl[(ethoxycarbonothioyl)thio](phenyl)acetate. These functionalized homopolymers, alkyne-PCL and PNVCL-N 3 , were coupled by the 1,3 dipolar cycloaddition reaction in order to obtain the corresponding block copolymers. These (co)polymers were characterized by FTIR, 1 H NMR and GPC measurements. Reference: 1. RAMESH, K., SINGH, S., MITRA, K., CHATTOPADHYAY, D., MISRA, N., & RAY, B. (2015). Colloid and Polymer Science, 1-9. (author)
Fragment-based drug discovery using rational design.
Jhoti, H
2007-01-01
Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.
Rapid experimental SAD phasing and hot-spot identification with halogenated fragments
Energy Technology Data Exchange (ETDEWEB)
Bauman, Joseph D.; Harrison, Jerry Joe E. K.; Arnold, Eddy
2016-01-01
Through X-ray crystallographic fragment screening, 4-bromopyrazole was discovered to be a `magic bullet' that is capable of binding at many of the ligand `hot spots' found in HIV-1 reverse transcriptase (RT). The binding locations can be in pockets that are `hidden' in the unliganded crystal form, allowing rapid identification of these sites for
Rapid experimental SAD phasing and hot-spot identification with halogenated fragments
Directory of Open Access Journals (Sweden)
Joseph D. Bauman
2016-01-01
Full Text Available Through X-ray crystallographic fragment screening, 4-bromopyrazole was discovered to be a `magic bullet' that is capable of binding at many of the ligand `hot spots' found in HIV-1 reverse transcriptase (RT. The binding locations can be in pockets that are `hidden' in the unliganded crystal form, allowing rapid identification of these sites for in silico screening. In addition to hot-spot identification, this ubiquitous yet specific binding provides an avenue for X-ray crystallographic phase determination, which can be a significant bottleneck in the determination of the structures of novel proteins. The anomalous signal from 4-bromopyrazole or 4-iodopyrazole was sufficient to determine the structures of three proteins (HIV-1 RT, influenza A endonuclease and proteinase K by single-wavelength anomalous dispersion (SAD from single crystals. Both compounds are inexpensive, readily available, safe and very soluble in DMSO or water, allowing efficient soaking into crystals.
Returns management in the supply chain
Directory of Open Access Journals (Sweden)
Anna Maria Jeszka
2014-09-01
Full Text Available Background: The aim of this exploratory empirical research was to evaluate the level of cooperation in the area of reverse logistics between selected retail chains and logistics operators and suppliers; to identify and evaluate the influence the procedures of handling returns have on the relationships with customers, cost reduction, value recovery, inventory reduction and increasing profitability; as well as determining to what extent logistics operators are involved in the procedures of handling returns in the analysed chains. Methods: Based on the literature and the experience of researchers from developed countries a questionnaire was constructed which was subsequently used to conduct empirical research in selected retail chains operating in two provinces in Poland. The questionnaire survey involved the sales personnel of selected retail chains in the clothing industry. Overall, 105 questionnaires were collected and analysed. Results: Various aspects of cooperation with suppliers and logistics operators in respect of handling returns were evaluated. Most indicators of cooperation were evaluated favourably, with the exception of joint access to the database, the use of inventory data available online, and access to information from the warehouse, which received low marks from the respondents. In the case of the studied stores, some of the activities in the area of reverse logistics are outsourced; for example, obtaining products from users, logistics, and the transport of returns are typically done by an outside operator. Inspection, sorting, appraisal, repairs, as well as the sales of refurbished products are usually performed within the studied retail corporations. Conclusions: The research has shown that the retail chains developed very good programmes for handling returns in the supply chain, as evidenced by the presented and highly rated indicators of cooperation, with the exception of information exchange where there is still much
An improved algorithm for MFR fragment assembly
International Nuclear Information System (INIS)
Kontaxis, Georg
2012-01-01
A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.
Adiabatic condition and the quantum hitting time of Markov chains
International Nuclear Information System (INIS)
Krovi, Hari; Ozols, Maris; Roland, Jeremie
2010-01-01
We present an adiabatic quantum algorithm for the abstract problem of searching marked vertices in a graph, or spatial search. Given a random walk (or Markov chain) P on a graph with a set of unknown marked vertices, one can define a related absorbing walk P ' where outgoing transitions from marked vertices are replaced by self-loops. We build a Hamiltonian H(s) from the interpolated Markov chain P(s)=(1-s)P+sP ' and use it in an adiabatic quantum algorithm to drive an initial superposition over all vertices to a superposition over marked vertices. The adiabatic condition implies that, for any reversible Markov chain and any set of marked vertices, the running time of the adiabatic algorithm is given by the square root of the classical hitting time. This algorithm therefore demonstrates a novel connection between the adiabatic condition and the classical notion of hitting time of a random walk. It also significantly extends the scope of previous quantum algorithms for this problem, which could only obtain a full quadratic speedup for state-transitive reversible Markov chains with a unique marked vertex.
Exact goodness-of-fit tests for Markov chains.
Besag, J; Mondal, D
2013-06-01
Goodness-of-fit tests are useful in assessing whether a statistical model is consistent with available data. However, the usual χ² asymptotics often fail, either because of the paucity of the data or because a nonstandard test statistic is of interest. In this article, we describe exact goodness-of-fit tests for first- and higher order Markov chains, with particular attention given to time-reversible ones. The tests are obtained by conditioning on the sufficient statistics for the transition probabilities and are implemented by simple Monte Carlo sampling or by Markov chain Monte Carlo. They apply both to single and to multiple sequences and allow a free choice of test statistic. Three examples are given. The first concerns multiple sequences of dry and wet January days for the years 1948-1983 at Snoqualmie Falls, Washington State, and suggests that standard analysis may be misleading. The second one is for a four-state DNA sequence and lends support to the original conclusion that a second-order Markov chain provides an adequate fit to the data. The last one is six-state atomistic data arising in molecular conformational dynamics simulation of solvated alanine dipeptide and points to strong evidence against a first-order reversible Markov chain at 6 picosecond time steps. © 2013, The International Biometric Society.
Well-defined single-chain polymer nanoparticles via thiol-Michael addition
Kröger, A. Pia P.; Boonen, Roy J.E.A.; Paulusse, Jos M.J.
2017-01-01
A synthetic strategy has been developed giving facile access to well-defined single-chain polymer nanoparticles (SCNPs) from styrene-, acrylate- and methacrylate-based polymers. Random copolymers (polydispersity indices 1.10–1.15) of methyl (meth)acrylate, benzyl methacrylate or styrene containing
Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D
2015-01-01
Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.
OECD Skills Outlook 2017: Skills and Global Value Chains
OECD Publishing, 2017
2017-01-01
Since the 1990s, the world has entered a new phase of globalisation. Information and communication technology, trade liberalisation and lower transport costs have enabled firms and countries to fragment the production process into global value chains (GVCs). Many products are now designed in one country and assembled in another country from parts…
Vasantha, Vivek Arjunan; Jana, Satyasankar; Lee, Serina Siew Chen; Lim, Chin-Sing; Teo, Serena Lay Ming; Parthiban, Anbanandam; Vancso, Gyula J.
2015-01-01
A new class of dual hydrophilic diblock copolymers (BCPs) possessing poly(ethylene glycol) (PEG) and zwitterionic polysulfabetaine (PSB) was synthesized by reversible addition–fragmentation chain transfer (RAFT) polymerization. These BCPs formed schizophrenic micelles undergoing core–shell
Effect of surfactants on the properties of hydrotalcites prepared by the reverse micelle method
Energy Technology Data Exchange (ETDEWEB)
Holgado, Patricia H., E-mail: h.holgado@usal.es; Holgado, María J., E-mail: holgado@usal.es; San Román, María S., E-mail: sanroman@usal.es; Rives, Vicente, E-mail: vrives@usal.es
2015-02-01
Layered double hydroxides with the hydrotalcite-type structure have been prepared by the reverse micelles method. The layer cations were Ni{sup 2+} and Fe{sup 3+} in all cases and the interlayer anion was carbonate. We have studied the effect of the surfactant used (with linear chains of different lengths, or cyclic) and the effect of the pH on the properties of the solids formed. These have been characterized by element chemical analysis, powder X-ray diffraction, thermogravimetric analysis, temperature-programmed reduction, FT-IR and Vis–UV spectroscopies and scanning electron microscopy. It has been found that the samples prepared at pH 9 are more crystalline than those prepared at pH 11 and their crystallite sizes are always larger than for samples prepared by the conventional precipitation method. Surfactants with cyclic organic chains lead to a larger crystallite size, probably because the water pool vesicle where the crystallite grows is larger due to sterical hindrance of the organic chains. - Graphical abstract: Layered double hydroxides with the hydrotalcite-type structure with Ni{sup 2+} and Fe{sup 3+} cations in the layers have been prepared by the reverse micelles method. Different surfactants were used at different pH synthesis. Samples prepared at pH 9 are higher crystalline than those prepared at pH 11. Surfactants with cyclic organic chains lead to a larger crystallite size. - Highlights: • Hydrotalcites were prepared by the micelles reverse method. • Straight alkyl or cyclic chain surfactants were used. • All hydrotalcites are well crystallized at pH = 9 and 11. • The crystallite size depends on the linear/cyclic nature of the surfactant chain.
Effect of surfactants on the properties of hydrotalcites prepared by the reverse micelle method
International Nuclear Information System (INIS)
Holgado, Patricia H.; Holgado, María J.; San Román, María S.; Rives, Vicente
2015-01-01
Layered double hydroxides with the hydrotalcite-type structure have been prepared by the reverse micelles method. The layer cations were Ni 2+ and Fe 3+ in all cases and the interlayer anion was carbonate. We have studied the effect of the surfactant used (with linear chains of different lengths, or cyclic) and the effect of the pH on the properties of the solids formed. These have been characterized by element chemical analysis, powder X-ray diffraction, thermogravimetric analysis, temperature-programmed reduction, FT-IR and Vis–UV spectroscopies and scanning electron microscopy. It has been found that the samples prepared at pH 9 are more crystalline than those prepared at pH 11 and their crystallite sizes are always larger than for samples prepared by the conventional precipitation method. Surfactants with cyclic organic chains lead to a larger crystallite size, probably because the water pool vesicle where the crystallite grows is larger due to sterical hindrance of the organic chains. - Graphical abstract: Layered double hydroxides with the hydrotalcite-type structure with Ni 2+ and Fe 3+ cations in the layers have been prepared by the reverse micelles method. Different surfactants were used at different pH synthesis. Samples prepared at pH 9 are higher crystalline than those prepared at pH 11. Surfactants with cyclic organic chains lead to a larger crystallite size. - Highlights: • Hydrotalcites were prepared by the micelles reverse method. • Straight alkyl or cyclic chain surfactants were used. • All hydrotalcites are well crystallized at pH = 9 and 11. • The crystallite size depends on the linear/cyclic nature of the surfactant chain
Energy Technology Data Exchange (ETDEWEB)
Harris, T.J.R.; Dunn, J.J.; Wimmer, E.
1978-11-01
The small protein (VPg) covalently linked to the 5' end of the poliovirus Type 1 (PV-1) RNA has been labeled in vitro with /sup 125/I usingthe Bolton and Hunter reagent. The RNA is not degraded under the conditions used and nearly all the label enters VPg and not the polynucleotide chain. When this /sup 125/I-labeled RNA is cleaved with RNase III at low monovalent salt concentrations, one major /sup 125/I-labeled fragment, approximately 100 nucleotides long, is produced. The corresponding fragment from similar digests of /sup 32/P-labeled RNA has also been identified. The /sup 32/P-labeled fragment changes electrophoretic mobility after protease treatment indicating that it contains VPg. Furthermore, the RNase T1 oligonucleotide known to be at the 5' terminus of poliovirus RNA is found in T1 digests of the purified fragment. These results confirm that the fragment is derived from the 5' end of the RNA. This fragment will be useful in studies concerning the initiation of protein synthesis during poliovirus infection.
Synthesis of click-reactive HPMA copolymers using RAFT polymerization for drug delivery applications
DEFF Research Database (Denmark)
Ebbesen, Morten F; Schaffert, D.H.; Crowley, Michael L
2013-01-01
This study describes a versatile strategy combining reversible addition fragmentation transfer (RAFT) polymerization and click chemistry to synthesize well-defined, reactive copolymers of N-(2-hydroxypropyl)methacrylamide (HPMA) for drug delivery applications. A novel azide containing monomer N-(3......-azidopropyl)methacrylamide (AzMA) was synthesized and copolymerized with HPMA using RAFT polymerization to provide p(HPMA-co-AzMA) copolymers with high control of molecular weight (∼10–54 kDa) and polydispersity (≤1.06). The utility of the side-chain azide functionality by Cu(I)-catalyzed azide...
Zhang, Xiayun; Yang, Zhongduo; Xie, Dengmin; Liu, Donglei; Chen, Zhenbin; Li, Ke; Li, Zhizhong; Tichnell, Brandon; Liu, Zhen
2018-01-01
The reversible addition fragmentation chain transfer (RAFT) polymerization method was adopted here to prepare a series of thermo-sensitive copolymers, poly (N,N-diethyl- acrylamide-b-N-vinylpyrrolidone). Their structures, molecular weight distribution and temperature sensitivity performances were characterized by the nuclear magnetic resonance ( 1 HNMR), the gel permeation chromatography (GPC) and the fluorescence spectrophotometer, respectively. It has been identified that the synthesis reaction of the block copolymer was living polymerization. The thermo-sensitivity study suggested that N-vinylpyrrolidone (NVP), played a key role on the lower critical solution temperature (LCST) performance.
''SMART'' MULTIFUNCTIONAL POLYMERS FOR ENHANCED OIL RECOVERY
Energy Technology Data Exchange (ETDEWEB)
Charles McCormick; Andrew Lowe
2004-10-20
Herein we report the aqueous polymerization of acrylamide using reversible addition fragmentation chain transfer (RAFT) polymerization to perform a comprehensive study on the polymerization of acrylamide. More specifically, the effect of polymerization conditions on the polymerization kinetics, molecular weight control, and blocking ability were examined. With this in mind, it was necessary to prepare ''A'' block (corona of the micelle) from a hydrophilic monomer. The responsive ''B'' block present in the core will be disclosed in the next two reports.
DEFF Research Database (Denmark)
Munch, M.; Nielsen, L.P.; Handberg, Kurt
2001-01-01
A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...
Gen2 RFID-Based System Framework for Resource Circulation in Closed-Loop Supply Chains
Directory of Open Access Journals (Sweden)
Young-woo Kim
2017-10-01
Full Text Available Product recycling has become a mandatory activity under extended producer responsibility. Therefore, it is important to operate a closed-loop supply chain that integrates sourcing, production, delivery, and recycling to achieve not only environmental sustainability, but also economic benefits. However, this goal is affected by chronic problems caused by uncertainties relating to the return timing, quantity, and quality of returned items. Many studies proved that information visibility could solve these problems. In this context, a system framework for closed-loop supply chain management is proposed that gathers real-time information within a supply chain and product lifecycle by using the Internet-of-Things, including radio frequency identification (RFID. Specifically, the most recent Gen2 RFID protocol, which provides new features to create new positive effects, is considered. Additionally, an information system is designed, including RFID tag encoding, which supports the operation of the proposed system. Finally, the lifecycle benefits are examined, such as counterfeit prevention, real-time monitoring and maintenance in the middle-of-life phase, and reverse process streamlining. The ultimate aim is to design a system that facilitates the profitable and environmentally friendly operation of the closed-loop supply chain.
Directory of Open Access Journals (Sweden)
C Coelho
2003-06-01
Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.
Reverse and closed loop supply chain coordination by considering government role
DEFF Research Database (Denmark)
Heydari, Jafar; Govindan, Kannan; Jafari, Amin
2017-01-01
consumption by increasing customers’ willingness to return used products through offering a discount or a direct fee in exchange for bringing back EOL products. Afterward, the model is extended to consider a closed loop supply chain (CLSC). Quantity discounts and increasing fee contracts are proposed...
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
International Nuclear Information System (INIS)
Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Plasil, F.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Kristiansson, P.; Loehner, H.; Obenshain, F.E.; Sorensen, S.P.; Poskanzer, A.M.; Ritter, H.G.; Siemiarczuk, T.
1989-07-01
Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 AGeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the Multi-Chain Fragmentation Model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)
International Nuclear Information System (INIS)
Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Saini, S.; Sorensen, S.P.; Tincknell, M.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Jacobs, P.; Poskanzer, A.M.; Ritter, H.G.; Kristiansson, P.
1990-01-01
Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 A GeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the multi-chain fragmentation model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)
Fragmentation and structure of silicon microclusters
International Nuclear Information System (INIS)
Feuston, B.P.; Kalia, R.K.; Vashishta, P.
1987-01-01
It may be possible to determine the magic numbers and fragmentation spectra from the ground-state binding energies and structure, but the relationship between the lowest-energy zero-temperature configurations and the energetics of finite-temperature microclusters is not obvious. Recall fragmentation of Si clusters occurs at temperatures the order of the melting temperature (T∼2000 K). What is needed, a first-principles finite-temperature calculation, allowing the determination of all possible structures, their corresponding binding energies, and fragmentation spectra, is not presently possible. However, a molecular dynamics calculation does allow one to study the nature of fragmentation in addition to determination of the global ground-state structure and all mechanically stable configurations underlying the finite-temperature cluster, once given an interaction potential. The authors present results for such a calculation for Si/sub 2-14/ using the Stillinger-Weber 3-body potential. Their results indicate that the existence of magic numbers is determined by the topology and energetics of high-energy bound structures rather than the structure and ground-state energies at zero temperature
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
Light fragment formation at intermediate energies
International Nuclear Information System (INIS)
Boal, D.H.
1982-03-01
This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model
Computational medicinal chemistry in fragment-based drug discovery: what, how and when.
Rabal, Obdulia; Urbano-Cuadrado, Manuel; Oyarzabal, Julen
2011-01-01
The use of fragment-based drug discovery (FBDD) has increased in the last decade due to the encouraging results obtained to date. In this scenario, computational approaches, together with experimental information, play an important role to guide and speed up the process. By default, FBDD is generally considered as a constructive approach. However, such additive behavior is not always present, therefore, simple fragment maturation will not always deliver the expected results. In this review, computational approaches utilized in FBDD are reported together with real case studies, where applicability domains are exemplified, in order to analyze them, and then, maximize their performance and reliability. Thus, a proper use of these computational tools can minimize misleading conclusions, keeping the credit on FBDD strategy, as well as achieve higher impact in the drug-discovery process. FBDD goes one step beyond a simple constructive approach. A broad set of computational tools: docking, R group quantitative structure-activity relationship, fragmentation tools, fragments management tools, patents analysis and fragment-hopping, for example, can be utilized in FBDD, providing a clear positive impact if they are utilized in the proper scenario - what, how and when. An initial assessment of additive/non-additive behavior is a critical point to define the most convenient approach for fragments elaboration.
International Nuclear Information System (INIS)
Saxon, D.H.
1985-10-01
The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)
Modeling risk and uncertainty in designing reverse logistics problem
Directory of Open Access Journals (Sweden)
Aida Nazari Gooran
2018-01-01
Full Text Available Increasing attention to environmental problems and social responsibility lead to appear reverse logistic (RL issues in designing supply chain which, in most recently, has received considerable attention from both academicians and practitioners. In this paper, a multi-product reverse logistic network design model is developed; then a hybrid method including Chance-constrained programming, Genetic algorithm and Monte Carlo simulation, are proposed to solve the developed model. The proposed model is solved for risk-averse and risk-seeking decision makers by conditional value at risk, sum of the excepted value and standard deviation, respectively. Comparisons of the results show that minimizing the costs had no direct relation with the kind of decision makers; however, in the most cases, risk-seeking decision maker gained more return products than risk-averse ones. It is clear that by increasing returned products to the chain, production costs of new products and material will be reduced and also by this act, environmental benefits will be created.
Samuelsen, Asta Gjetø; Støyle, Rebecka Våge
2016-01-01
Masteroppgave(MSc) in Master of Science in Business, Logistics, operations and supply chain management - Handelshøyskolen BI, 2016 Reverse logistics plays an important role in keeping resources in the supply chain for as long as possible through the creation of a circular waste management system. In household waste management, the success of such a system depends on the end-consumer, which supplies waste to the reverse supply chain. The aim of this thesis is therefore to examin...
High solute rejecting membranes for reverse osmosis: Polyetheramide hydrazide
International Nuclear Information System (INIS)
Bindal, R.C.; Ramachandhran, V.; Misra, B.M.; Ramani, M.P.S.
1991-01-01
Synthesis of benzhydrazide polymers and determination of reverse osmosis properties of their membranes were reported earlier. Their performance was not adequate for seawater desalination or for high radioactive decontamination factors (DF). The same hydrazide polymers modified by incorporation of additional monomers with ether linkages were synthesized by low temperature polycondensation of freshly prepared m-amino benzhydrazide, p-amino benzhydrazide, and 4,4'-diamino diphenyl ether, with isophthaloyl chloride and terephthaloyl chloride in dimethyl acetamide solvent. A series of film-forming polymers prepared by altering the molar ratios of the reacting monomers were characterized in terms of percent moisture regain, inherent viscosity, solubility parameters, and interfacial sorption characteristics. Asymmetric membranes prepared from these polymer samples were characterized in terms of the pure water permeability constant and the solute transport parameter, and were tested for their reverse osmosis performance. An optimum mole ratio of reaching monomers has been identified for the synthesis of polymer and the resulting membrane offered the best performance for reverse osmosis (salt rejection as high as 99.4% for 3.5% sodium chloride solution). The incorporation of aromatic ether linkages in the polyamide benzhydrazide polymeric chains appears to alter the polar and nonpolar character of the bulk polymer, and also the membrane solution interface characteristics, resulting in enhanced solute separation. These membranes appear to be potential candidates for single-stage seawater desalination and also for a variety of industrial effluent treatment applications for significantly high DF radioactive effluent treatment
The chaos and control of a food chain model supplying additional food to top-predator
International Nuclear Information System (INIS)
Sahoo, Banshidhar; Poria, Swarup
2014-01-01
Highlights: • We propose a chaotic food chain model supplying additional food to top-predator. • Local and global stability conditions are derived in presence of additional food. • Chaos is controlled only by increasing quantity of additional food. • System enters into periodic region and depicts Hopf bifurcations supplying additional food. • This an application of non-chemical methods for controlling chaos. -- Abstract: The control and management of chaotic population is one of the main objectives for constructing mathematical model in ecology today. In this paper, we apply a technique of controlling chaotic predator–prey population dynamics by supplying additional food to top-predator. We formulate a three species predator–prey model supplying additional food to top-predator. Existence conditions and local stability criteria of equilibrium points are determined analytically. Persistence conditions for the system are derived. Global stability conditions of interior equilibrium point is calculated. Theoretical results are verified through numerical simulations. Phase diagram is presented for various quality and quantity of additional food. One parameter bifurcation analysis is done with respect to quality and quantity of additional food separately keeping one of them fixed. Using MATCONT package, we derive the bifurcation scenarios when both the parameters quality and quantity of additional food vary together. We predict the existence of Hopf point (H), limit point (LP) and branch point (BP) in the model for suitable supply of additional food. We have computed the regions of different dynamical behaviour in the quantity–quality parametric plane. From our study we conclude that chaotic population dynamics of predator prey system can be controlled to obtain regular population dynamics only by supplying additional food to top predator. This study is aimed to introduce a new non-chemical chaos control mechanism in a predator–prey system with the
Periodicity and Immortality in Reversible Computing
Kari , Jarkko; Ollinger , Nicolas
2008-01-01
Additional material available on the web at http://www.lif.univ-mrs.fr/~nollinge/rec/gnirut/; We investigate the decidability of the periodicity and the immortality problems in three models of reversible computation: reversible counter machines, reversible Turing machines and reversible one-dimensional cellular automata. Immortality and periodicity are properties that describe the behavior of the model starting from arbitrary initial configurations: immortality is the property of having at le...
Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design
2012-01-01
The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472
Directory of Open Access Journals (Sweden)
Chengchao Wang
2010-01-01
Full Text Available The reversible addition-fragmentation chain transfer (RAFT copolymerizations of 2-((8-hydroxyquinolin-5-ylmethoxyethyl methacrylate (HQHEMA with styrene (St or methyl methacrylate (MMA were successfully carried out in the presence of 2-cyanoprop-2-yl dithionaphthalenoate (CPDN. The polymerization behaviors showed the typical living natures by the first-order polymerization kinetics, the linear dependence of molecular weights of the polymers on the monomer conversions with the relatively narrow molecular weight distributions (Mw/Mn, and the successful chain extension experiments. The soluble polymers having tris(8-hydroxyquinolinealuminum (Alq3 and bis(8-hydroxyquinoline znic(II (Znq2 side chains were obtained via complexation of the polymers with aluminium isopropoxide or zinc acetate in the presence of monomeric 8-hydroxyquinoline, which had strong fluorescent emission at 520 nm. The obtained polymers were characterized by GPC, NMR, UV-vis, and fluorescent spectra.
Huang, Jianbing; Li, Decai; Liang, Hui; Lu, Jiang
2017-08-01
Photo-crosslinkable and amine-containing block copolymer nanoparticles are synthesized via reversible addition-fragmentation chain transfer (RAFT) polymerization-induced self-assembly of a multifunctional core-forming monomer, 2-((3-(4-(diethylamino)phenyl)acryloyl)oxy)ethyl methacrylate (DEMA), using poly(2-hydroxypropyl methacrylate) macromolecular chain transfer agent as a steric stabilizer in methanol at 65 °C. By tuning the chain length of PDEMA, a range of nanoparticle morphologies (sphere, worm, and vesicle) can be obtained. Since cinnamate groups can easily undergo a [2 + 2] cycloaddition of the carbon-carbon double bonds upon UV irradiation, the as-prepared block copolymer nanoparticles are readily stabilized by photo-crosslinking to produce anisotropic nanoparticles. The crosslinked block copolymer nanoparticles can be used as templates for in situ formation polymer/gold hybrid nanoparticles. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fuel fragmentation data review and separate effects testing
International Nuclear Information System (INIS)
Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.
2014-01-01
A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)
Third-party Reverse logistics platform and method Based on Bilateral Resource Integration
Directory of Open Access Journals (Sweden)
Zheng Hong Zhen
2016-01-01
Full Text Available Dispersion of reverse logistics resources makes it difficult to create relationships between demanders and providers, thereby the personalized demand for the construction of enterprise reverse logistics cannot be satisfied and the service quality cannot be guaranteed. Aiming at these problems, this paper presents a platform and method of enterprise reverse logistics based on bilateral resource integration (RLBRI. The method creates a third-party reverse logistics platform to accumulate a mass of reverse logistics demanders and providers together. And the platform integrates bilateral resources and acts as an intermediary to establish relationships between two sides. Through the platform, a complete and high-quality business chain for enterprise reverse logistics will be built efficiently. Finally put forward an effective strategy of non-defective reverse logistics depends on the integrity checking service provided by third-party logistics. By using this strategy it can short the distance of non-defective reverse transportation. Computational tests validate the strategy.