WorldWideScience

Sample records for reversible addition fragmentation

  1. Olefin copolymerization via reversible addition-fragmentation chain transfer

    NARCIS (Netherlands)

    Venkatesh, R.; Staal, B.B.P.; Klumperman, B.

    2004-01-01

    Successful statistical copolymn. of an a-olefin (1-octene) with an acrylate (Bu acrylate, BA) and with a methacrylate (Me methacrylate, MMA), employing reversible addn.-fragmentation chain transfer (RAFT) mediated polymn. has been accomplished

  2. Reversible addition-fragmentation chain transfer polymerization of 2-chloro-1,3-butadiene

    OpenAIRE

    Pullan, Nikki; Liu, Max; Topham, Paul D.

    2013-01-01

    Controlled polymerization of 2-chloro-1,3-butadiene using reversible addition–fragmentation chain transfer (RAFT) polymerization has been demonstrated for the first time. 2-Chloro-1,3-butadiene, more commonly known as chloroprene, has significant industrial relevance as a crosslinked rubber, with uses ranging from adhesives to integral automotive components. However, problems surrounding the inherent toxicity of the lifecycle of the thiourea-vulcanized rubber have led to the need for control ...

  3. Preparation of nanocomposites by reversible addition-fragmentation chain transfer polymerization from the surface of quantum dots in miniemulsion

    NARCIS (Netherlands)

    Carvalho Esteves, de A.C.; Hodge, P.; Trindade, T.; Barros-Timmons, A.M.M.V.

    2009-01-01

    Herein, we report the synthesis of quantum dots (QDs)/polymer nanocomposites by reversible addition-fragmentation chain transfer (RAFT) polymerization in miniemulsions using a grafting from approach. First, the surfaces of CdS and CdSe QDs were functionalized using a chain transfer agent, a

  4. A guide to the synthesis of block copolymers using reversible-addition fragmentation chain transfer (RAFT) polymerization.

    Science.gov (United States)

    Keddie, Daniel J

    2014-01-21

    The discovery of reversible-deactivation radical polymerization (RDRP) has provided an avenue for the synthesis of a vast array of polymers with a rich variety of functionality and architecture. The preparation of block copolymers has received significant focus in this burgeoning research field, due to their diverse properties and potential in a wide range of research environments. This tutorial review will address the important concepts behind the design and synthesis of block copolymers using reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerization is arguably the most versatile of the RDRP methods due to its compatibility with a wide range of functional monomers and reaction media along with its relative ease of use. With an ever increasing array of researchers that possess a variety of backgrounds now turning to RDRP, and RAFT in particular, to prepare their required polymeric materials, it is pertinent to discuss the important points which enable the preparation of high purity functional block copolymers with targeted molar mass and narrow molar mass distribution using RAFT polymerization. The key principles of appropriate RAFT agent selection, the order of monomer addition in block synthesis and potential issues with maintaining high end-group fidelity are addressed. Additionally, techniques which allow block copolymers to be accessed using a combination of RAFT polymerization and complementary techniques are touched upon.

  5. Carprofen-imprinted monolith prepared by reversible addition-fragmentation chain transfer polymerization in room temperature ionic liquids.

    Science.gov (United States)

    Ban, Lu; Han, Xu; Wang, Xian-Hua; Huang, Yan-Ping; Liu, Zhao-Sheng

    2013-10-01

    To obtain fast separation, ionic liquids were used as porogens first in combination with reversible addition-fragmentation chain transfer (RAFT) polymerization to prepare a new type of molecularly imprinted polymer (MIP) monolith. The imprinted monolithic column was synthesized using a mixture of carprofen (template), 4-vinylpyridine, ethylene glycol dimethacrylate, [BMIM]BF4, and chain transfer agent (CTA). Some polymerization factors, such as template-monomer molar ratio, the degree of crosslinking, the composition of the porogen, and the content of CTA, on the column efficiency and imprinting effect of the resulting MIP monolith were systematically investigated. Affinity screening of structurally similar compounds with the template can be achieved in 200 s on the MIP monolith due to high column efficiency (up to 12,070 plates/m) and good column permeability. Recognition mechanism of the imprinted monolith was also investigated.

  6. Functionalization of vertically aligned carbon nanotubes with polystyrene via surface initiated reversible addition fragmentation chain transfer polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G. [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia)

    2012-01-15

    Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated 'grafting-from' process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.

  7. Functionalization of vertically aligned carbon nanotubes with polystyrene via surface initiated reversible addition fragmentation chain transfer polymerization

    International Nuclear Information System (INIS)

    Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G.; Ellis, Amanda V.

    2012-01-01

    Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated “grafting-from” process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.

  8. Early career: Templating of liquid crystal microstructures by reversible addition-fragmentation chain transfer polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Heinen, Jennifer M. (O' Donnell) [Iowa State Univ., Ames, IA (United States)

    2014-12-31

    This research has shown that the microstructure of self-assembled copolymers can be decoupled from the polymer chemistry. The simplest polymer architecture, linear block copolymers, is valuable for a broad range of applications, including adhesives and coatings, medical devices, electronics and energy storage, because these block copolymers reproducibly self-assemble into microphase separated nanoscale domains. Unfortunately, the self-assembled microstructure is tuned by polymer composition, thus limiting the potential to simultaneously optimize chemical, mechanical, and transport properties for desired applications. To this end, much work was been put into manipulating block copolymer self-assembly independently of polymer composition. These efforts have included the use of additives or solvents to alter polymer chain conformation, the addition of a third monomer to produce ABC triblock terpolymers, architectures with mixed blocks, such as tapered/gradient polymers, and the synthesis of other nonlinear molecular architectures. This work has shown that the microstructures formed by linear ABC terpolymers can be altered by controlling the architecture of the polymer molecules at a constant monomer composition, so that the microstructure is tuned independently from the chemical properties.

  9. Self-assembly of block copolymer micelles: synthesis via reversible addition-fragmentation chain transfer polymerization and aqueous solution properties.

    Science.gov (United States)

    Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin

    2010-07-22

    Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.

  10. Scale-up of the Reversible Addition-Fragmentation Chain Transfer (RAFT Polymerization Using Continuous Flow Processing

    Directory of Open Access Journals (Sweden)

    Nenad Micic

    2014-01-01

    Full Text Available A controlled radical polymerization process using the Reversible Addition-Fragmentation Chain Transfer (RAFT approach was scaled up by a factor of 100 from a small laboratory scale of 5 mL to a preparative scale of 500 mL, using batch and continuous flow processing. The batch polymerizations were carried out in a series of different glass vessels, using either magnetic or overhead stirring, and different modes of heating: Microwave irradiation or conductive heating in an oil bath. The continuous process was conducted in a prototype tubular flow reactor, consisting of 6 mm ID stainless steel tubing, fitted with static mixers. Both reactor types were tested for polymerizations of the acid functional monomers acrylic acid and 2-acrylamido-2-methylpropane-1-sulfonic acid in water at 80 °C with reaction times of 30 to 40 min. By monitoring the temperature during the exothermic polymerization process, it was observed that the type and size of reactor had a significant influence on the temperature profile of the reaction.

  11. Synthesis of butyl acrylate-styrene block copolymers in emulsion by reversible addition-fragmentation chain transfer : effect of surfactant migration upon film formation

    NARCIS (Netherlands)

    Monteiro, M.J.; Sjöberg, M.; Göttgens, C.M.; Vlist, van der J.

    2000-01-01

    The synthesis of block copolymers in an environmentally friendly medium was carried out in emulsion polymerizations through the reversible addition-fragmentation chain transfer process, using a transfer active xanthate (MADIX) agent, under batch and starved-feed conditions. First, ab initio

  12. Highly efficient reversible addition-fragmentation chain-transfer polymerization in ethanol/water via flow chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Ye, Piaoran [Case Western Reserve Univ., Cleveland, OH (United States); Cao, Peng -Fei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Su, Zhe [Case Western Reserve Univ., Cleveland, OH (United States); Advincula, Rigoberto [Case Western Reserve Univ., Cleveland, OH (United States)

    2017-03-23

    Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR), and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L–1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.

  13. Synthesis of Thermally Switchable Chromatographic Materials with Immobilized Ti4+ for Enrichment of Phosphopeptides by Reversible Addition Fragmentation Chain Transfer Polymerization

    Science.gov (United States)

    Wang, Di; Cao, Zhihan; Pang, Xinzhu; Deng, Yulin; Li, Bo; Dai, Rongji

    2018-01-01

    Reversible phosphorylation of proteins is one of the most crucial types of post-translational modifications (PTMs). And it shows significant work in diversified biological processes. However, the separation technology of phosphorylated peptides is still an analytical challenge in phosphoproteomics, because phosphopeptides are alway in low stoichiometry. Thus, enrichment of phosphopeptides before detection is indispensable. In this study, a novel temperature regulated separation protocol was developed. Silica@p (NIPAAm-co-IPPA)-Ti4+, a new Ti(IV)-IMAC (Immobilized Metal Affinity chromatography) materials was synthesized by reversible addition fragmentation chain transfer polymerization (RAFT). By the unique thermally responsive properties of poly(N-isopropylacrylamide) (PNIPAAm), the captured phosphorylated peptides could be released by changing temperature only without applying any other eluant which could damage the phosphopeptides. We employed isopropanol phosphonic acid (IPPA) as an IMAC ligand for the immobilization of Ti(IV) which could increase the specific adsorption of phosphopeptides. The enrichment and release properties were examined by treatment with pyridoxal 5’-phosphate (PLP) and casein phosphopeptides (CPP). Two phosphorylated compounds above have temperature-stimulated binding to Ti4+. Finally, silica@p (NIPAAm-co-IPPA)-Ti4+ was successfully employed in pretreatment of phosphopeptides in a tryptic digest of a-casein and human serum albumin (HSA). The results indicated a great potential of this new temperature-responsive material in phosphoproteomics study.

  14. Controlled radical copolymerization of styrene and maleic anhydride and the synthesis of novel polyolefin-based block copolymers by reversible addition-fragmentation chain-transfer (RAFT) polymerization

    NARCIS (Netherlands)

    Brouwer, de J.A.M.; Schellekens, M.A.J.; Klumperman, B.; Monteiro, M.J.; German, A.L.

    2000-01-01

    Reversible addn.-fragmentation chain transfer (RAFT) was applied to the copolymn. of styrene and maleic anhydride. The product had a low polydispersity and a predetd. molar mass. Novel, well-defined polyolefin-based block copolymers were prepd. with a macromol. RAFT agent prepd. from a com.

  15. Thermally conductive, electrically insulating and melt-processable polystyrene/boron nitride nanocomposites prepared by in situ reversible addition fragmentation chain transfer polymerization

    International Nuclear Information System (INIS)

    Huang, Xingyi; Wang, Shen; Zhu, Ming; Yang, Ke; Jiang, Pingkai; Bando, Yoshio; Golberg, Dmitri; Zhi, Chunyi

    2015-01-01

    Thermally conductive and electrically insulating polymer/boron nitride (BN) nanocomposites are highly attractive for various applications in many thermal management fields. However, so far most of the preparation methods for polymer/BN nanocomposites have usually caused difficulties in the material post processing. Here, an in situ grafting approach is designed to fabricate thermally conductive, electrically insulating and post-melt processable polystyrene (PS)/BN nanosphere (BNNS) nanocomposites by initiating styrene (St) on the surface functionalized BNNSs via reversible addition fragmentation chain transfer polymerization. The nanocomposites exhibit significantly enhanced thermal conductivity. For example, at a St/BN feeding ratio of 5:1, an enhancement ratio of 1375% is achieved in comparison with pure PS. Moreover, the dielectric properties of the nanocomposites show a desirable weak dependence on frequency, and the dielectric loss tangent of the nanocomposites remains at a very low level. More importantly, the nanocomposites can be subjected to multiple melt processing to form different shapes. Our method can become a universal approach to prepare thermally conductive, electrically insulating and melt-processable polymer nanocomposites with diverse monomers and nanofillers. (paper)

  16. Non-surface activity and micellization behavior of cationic amphiphilic block copolymer synthesized by reversible addition-fragmentation chain transfer process.

    Science.gov (United States)

    Ghosh, Arjun; Yusa, Shin-ichi; Matsuoka, Hideki; Saruwatari, Yoshiyuki

    2011-08-02

    Cationic amphiphilic diblock copolymers of poly(n-butylacrylate)-b-poly(3-(methacryloylamino)propyl)trimethylammonium chloride) (PBA-b-PMAPTAC) with various hydrophobic and hydrophilic chain lengths were synthesized by a reversible addition-fragmentation chain transfer (RAFT) process. Their molecular characteristics such as surface activity/nonactivity were investigated by surface tension measurements and foam formation observation. Their micelle formation behavior and micelle structure were investigated by fluorescence probe technique, static and dynamic light scattering (SLS and DLS), etc., as a function of hydrophilic and hydrophobic chain lengths. The block copolymers were found to be non-surface active because the surface tension of the aqueous solutions did not change with increasing polymer concentration. Critical micelle concentration (cmc) of the polymers could be determined by fluorescence and SLS measurements, which means that these polymers form micelles in bulk solution, although they were non-surface active. Above the cmc, the large blue shift of the emission maximum of N-phenyl-1-naphthylamine (NPN) probe and the low micropolarity value of the pyrene probe in polymer solution indicate the core of the micelle is nonpolar in nature. Also, the high value of the relative intensity of the NPN probe and the fluorescence anisotropy of the 1,6-diphenyl-1,3,5-hexatriene (DPH) probe indicated that the core of the micelle is highly viscous in nature. DLS was used to measure the average hydrodynamic radii and size distribution of the copolymer micelles. The copolymer with the longest PBA block had the poorest water solubility and consequently formed micelles with larger size while having a lower cmc. The "non-surface activity" was confirmed for cationic amphiphilic diblock copolymers in addition to anionic ones studied previously, indicating the universality of non-surface activity nature.

  17. Grafting of Polystyrene Chains at the Edge of Graphene Nanolayers by "Grafting Through" Approach Using Reversible Addition-Fragmentation Chain Transfer Polymerization

    Directory of Open Access Journals (Sweden)

    Hossein Roghani-Mamaqani

    2017-09-01

    Full Text Available Edge-functionalized graphene nanolayers with polystyrene chains were prepared by a “grafting through” reversible addition-fragmentation chain transfer (RAFT polymerization. For this purpose, double-bond containing modifier (MD was prepared. After edge-functionalization of graphene oxide (GO by two different amounts of MD and preparation of modified graphenes (LFG and HFG, RAFT polymerization of styrene was applied for preparation of functionalized GO with different densities of polystyrene chains. Fourier transform infrared spectroscopy showed that MD and polystyrene chains were grafted at the edge of GO. Gas chromatography showed that conversion decreased by the addition of modified GO content and also grafting density of MD. Number-average molecular weight and polydispersity index of polystyrene chains were derived from gel permeation chromatography. Increase of modified graphene content results in a decrease in molecular weight of attached polystyrene chains and also an increase in their PDI value. Increase of grafting density of MD results in decrease of molecular weight of polystyrene chains with no considerable variation in PDI value. Thermogravimetric analysis results showed that char residue is about 45.1 and 46.8% for LFG and HFG, respectively. The content of degradation ascribed to polystyrene increased with increase of grafting density of MD and decreased with increase of modified graphene content. X-ray diffraction results were used for evaluation of interlayer spacing of graphene layers after functionalization process and also study of nanocomposites structure. The results of scanning electron microscopy and transmission electron microscopy show that graphene layers with high clarity turned to opaque layers with lots of creases by oxidation and attachment of polystyrene chains.

  18. Surface molecular imprinting onto fluorescein-coated magnetic nanoparticlesvia reversible addition fragmentation chain transfer polymerization: A facile three-in-one system for recognition and separation of endocrine disrupting chemicals

    Science.gov (United States)

    Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin

    2011-01-01

    In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic

  19. Surface-Confined Aqueous Reversible Addition-Fragmentation Chain Transfer (SCARAFT) Polymerization Method for Preparation of Coated Capillary Leads to over 10 000 Peptides Identified from 25 ng HeLa Digest by Using Capillary Zone Electrophoresis-Tandem Mass Spectrometry.

    Science.gov (United States)

    Zhang, Zhenbin; Peuchen, Elizabeth H; Dovichi, Norman J

    2017-06-20

    A surface-confined aqueous reversible addition-fragmentation chain transfer (SCARAFT) polymerization method was developed to coat capillaries for use in capillary zone electrophoresis (CZE). SCARAFT polymerization primarily takes place on the inner surface of the capillary instead of in solution, which greatly improves the homogeneity of the coating. Capillaries treated with this coating produced an electroosmotic mobility of 2.8 ± 0.2 × 10 -6 cm 2 ·V -1 ·s -1 (N = 3), which is roughly an order of magnitude lower than that of commercial linear polyacrylamide (LPA)-coated capillaries. Coated capillaries were evaluated for bottom-up proteomic analysis using CZE. The very low electroosmotic mobility results in a 200 min separation and improved single-shot analysis. An average of 977 protein groups and 5605 unique peptides were identified from 50 ng of an E. coli digest, and 2158 protein groups and 10 005 peptides were identified from 25 ng of a HeLa digest using single-shot analysis with a SCARAFT-acrylamide capillary coupled to a Q Exactive HF mass spectrometer. The coating is stable. A single capillary was used for over 200 h (8.4 days) of continuous operation. RSD in migration time was between 2 and 3% for selected ion electropherograms (SIEs) generated for six ions; median theoretical plate counts ranged from 240 000 to 600 000 for these SIEs. Various types of coatings could be prepared by simply changing the functional vinyl monomers in the polymerization mixture. Positively charged coatings using direct attachment and formation of a block copolymer were prepared and demonstrated for the separation of mixtures of intact proteins.

  20. Time reversal odd fragmentation functions in semi-inclusive deep inelastic lepton-hadron scattering

    Energy Technology Data Exchange (ETDEWEB)

    Mulders, P.J. [National Inst. for Nuclear Physics and High Energy Physics, Amsterdam (Netherlands); Levelt, J. [Univ. of Erlangen-Nuernberg (Germany)

    1994-04-01

    In semi-inclusive scattering of polarized leptons from unpolarized hadrons, one can measure a time reversal odd structure function. It shows up as a sin({phi}) asymmetry of the produced hadrons. This asymmetry can be expressed as the product of a twist-three {open_quotes}hadron {r_arrow} quark{close_quotes} profile function and a time reversal odd twist-two {open_quotes}quark {r_arrow} hadron{close_quotes} fragmentation function. This fragmentation function can only be measured for nonzero transverse momenta of the produced hadron. Its appearance is a consequence of final state interactions between the produced hadron and the rest of the final state.

  1. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

    Science.gov (United States)

    Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

    2016-01-01

    Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

  2. Quantitative evaluation of stone fragments in extracorporeal shock wave lithotripsy using a time reversal operator

    Science.gov (United States)

    Wang, Jen-Chieh; Zhou, Yufeng

    2017-03-01

    Extracorporeal shock wave lithotripsy (ESWL) has been used widely in the noninvasive treatment of kidney calculi. The fine fragments less than 2 mm in size can be discharged by urination, which determines the success of ESWL. Although ultrasonic and fluorescent imaging are used to localize the calculi, it's challenging to monitor the stone comminution progress, especially at the late stage of ESWL when fragments spread out as a cloud. The lack of real-time and quantitative evaluation makes this procedure semi-blind, resulting in either under- or over-treatment after the legal number of pulses required by FDA. The time reversal operator (TRO) method has the ability to detect point-like scatterers, and the number of non-zero eigenvalues of TRO is equal to that of the scatterers. In this study, the validation of TRO method to identify stones was illustrated from both numerical and experimental results for one to two stones with various sizes and locations. Furthermore, the parameters affecting the performance of TRO method has also been investigated. Overall, TRO method is effective in identifying the fragments in a stone cluster in real-time. Further development of a detection system and evaluation of its performance both in vitro and in vivo during ESWL is necessary for application.

  3. Use of reverse kinematics in the identification of large fragments evaporated by compound nuclei

    International Nuclear Information System (INIS)

    Sobotka, L.G.; McMahan, M.A.; McDonald, R.J.

    1985-01-01

    Fragments ranging in charge from Z = 2 to Z = Z/sub symmetry/ have been identified from the compound nucleus decay associated with a variety of heavy ion reactions. The use of reverse kinematics (projectile heavier than the target) was crucial in performing these measurements. The experiments were carried out at the SuperHILAC utilizing beams of 550 MeV 74 Ge, 782 MeV 93 Nb and 1157 MeV 139 La, to bombard targets of 0.54 mg/cm 2 12 C and 1.0 mg/cm 2 9 Be. The detection system consisted of four solid state ΔE-E silicon telescopes (40-70 μm, 3-5 mm) situated at 7.5 0 , 15 0 , 25 0 , and 35 0 from the beam with solid angles of approximately 1.0 msr. For the heavier 139 La beam these detectors were supplemented by two gas ΔE - solid state E telescopes at -7.5 0 and -22.5 0

  4. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  5. Alterations in brain Protein Kinase A activity and reversal of morphine tolerance by two fragments of native Protein Kinase A inhibitor peptide (PKI).

    Science.gov (United States)

    Dalton, George D; Smith, Forrest L; Smith, Paul A; Dewey, William L

    2005-04-01

    Two peptide fragments of native Protein Kinase A inhibitor (PKI), PKI-(6-22)-amide and PKI-(Myr-14-22)-amide, significantly reversed low-level morphine antinociceptive tolerance in mice. The inhibition of Protein Kinase A (PKA) activity by both peptide fragments was then measured in specific brain regions (thalamus, periaqueductal gray (PAG), and medulla) and in lumbar spinal cord (LSC), which in previous studies have been shown to play a role in morphine-induced analgesia. In drug naive animals, cytosolic PKA activity was greater than particulate PKA activity in each region, while cytosolic and particulate PKA activities were greater in thalamus and PAG compared to medulla and LSC. The addition of both peptides to homogenates from each region completely abolished cytosolic and particulate PKA activities in vitro. Following injection into the lateral ventricle of the brain of drug naive mice and morphine-tolerant mice, both peptides inhibited PKA activity in the cytosolic, but not the particulate fraction of LSC. In addition, cytosolic and particulate PKA activities were inhibited by both peptides in thalamus. These results demonstrate that the inhibition of PKA reverses morphine tolerance. Moreover, the inhibition of PKA activity in specific brain regions and LSC from morphine-tolerant mice by PKI analogs administered i.c.v. is evidence that PKA plays a role in morphine tolerance.

  6. Addition of Sodium Bicarbonate to Irrigation Solution May Assist in Dissolution of Uric Acid Fragments During Ureteroscopy.

    Science.gov (United States)

    Paonessa, Jessica E; Williams, James C; Lingeman, James E

    2018-04-01

    We hypothesized that adding sodium bicarbonate (bicarb) to normal saline (NS) irrigation during ureteroscopy in patients with uric acid (UA) nephrolithiasis may assist in dissolving small stone fragments produced during laser lithotripsy. In vitro testing was performed to determine whether dissolution of UA fragments could be accomplished within 1 hour. In total 100% UA renal calculi were fragmented, filtered, and separated by size. Fragment sizes were <0.5 mm and 0.5 to 1 mm. Similar amounts of stone material were agitated in solution at room temperature. Four solutions were tested (NS, NS +1 ampule bicarb/L, NS +2, NS +3). Both groups were filtered to remove solutions after fixed periods. Filtered specimens were dried and weighed. Fragment dissolution rates were calculated as percent removed per hour. Additional testing was performed to determine whether increasing the temperature of solution affected dissolution rates. For fragments <0.5 mm, adding 2 or 3 bicarb ampules/L NS produced a dissolution rate averaging 91% ± 29% per hour. This rate averaged 226% faster than NS alone. With fragments 0.5 to 1 mm, addition of 2 or 3 bicarb ampules/L NS yielded a dissolution rate averaging 22% ± 7% per hour, which was nearly five times higher than NS alone. There was a trend for an increase in mean dissolution rate with higher temperature but this increase was not significant (p = 0.30). The addition of bicarbonate to NS more than doubles the dissolution rate of UA stone fragments and fragments less than 0.5 mm can be completely dissolved within 1 hour. Addition of bicarb to NS irrigation is a simple and inexpensive approach that may assist in the dissolution of UA fragments produced during ureteroscopic laser lithotripsy. Further studies are needed to determine whether a clinical benefit exists.

  7. The retro Grignard addition reaction revisited: the reversible addition of benzyl reagents to ketones

    DEFF Research Database (Denmark)

    Christensen, Stig Holden; Holm, Torkil; Madsen, Robert

    2014-01-01

    transformation. The retro benzyl reaction was shown by the addition of benzylmagnesium chloride to di-tert-butyl ketone followed by exchange of both the benzyl and the ketone moiety with another substrate. Similar experiments were performed with phenylmagnesium bromide and tert-butylmagnesium chloride...

  8. Reversed double PCL sign: unusual location of a meniscal fragment of the knee observed by MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Niitsu, M.; Itai, Y. [Dept. of Radiology, Inst. of Clinical Medicine, Univ. of Tsukuba, Ibaraki (Japan); Ikeda, K. [Inst. of Clinical Medicine, Univ. of Tsukuba, Ibaraki (Japan)

    2003-12-01

    A 36-year-old woman with tears of the anterior cruciate ligament and medial meniscus received a meniscectomy. The MR images obtained prior to the partial meniscectomy showed a bucket-handle meniscal tear with centrally displaced fragment lying anterior to the posterior cruciate ligament (PCL), representing a ''double PCL sign''; however, after the meniscectomy, MR images demonstrated a fragment in the space posterior to the PCL where no structure is generally recognized except for the ligament of wrisberg. This article reports a ''reversed'' double PCL sign, caused by inadequate surgical clearance of a bucket-handle tear of the medial meniscus. (orig.)

  9. Current reversal in a continuously periodic system driven by an additive noise and a multiplicative noise

    International Nuclear Information System (INIS)

    Wang Canjun; Chen Shibo; Mei Dongcheng

    2006-01-01

    We study the noise-induce transport and current reversal of Brownian particles in a continuously periodic potential driven by cross correlation between a multiplicative white noise and an additive white noise. We find that directed motion of the Brownian particles can be induced by the correlation between the additive noise and the multiplicative noise. The current reversal and the direction of the current is controlled by the values of the intensity (λ) of the correlated noises and a dimensionless parameter R (R=α/D, D is the intensity of multiplicative noise and α is the intensity of additive noise)

  10. Random attractors for stochastic lattice reversible Gray-Scott systems with additive noise

    Directory of Open Access Journals (Sweden)

    Hongyan Li

    2015-10-01

    Full Text Available In this article, we prove the existence of a random attractor of the stochastic three-component reversible Gray-Scott system on infinite lattice with additive noise. We use a transformation of addition involved with Ornstein-Uhlenbeck process, for proving the pullback absorbing property and the pullback asymptotic compactness of the reaction diffusion system with cubic nonlinearity.

  11. Fragment profiling of low molecular weight heparins using reversed phase ion pair liquid chromatography-electrospray mass spectrometry.

    Science.gov (United States)

    Xu, Xiaohui; Li, Daoyuan; Chi, Lequan; Du, Xuzhao; Bai, Xue; Chi, Lianli

    2015-04-30

    Low molecular weight heparins (LMWHs) are linear and highly charged carbohydrate polymers prepared by chemical or enzymatic depolymerization of heparin. Compared to unfractionated heparin (UFH), LMWHs are prevalently used as clinical anticoagulant drugs due to their lower side effects and better bioavailability. The work presented herein provides a rapid and powerful fragment mapping method for structural characterization of LMWHs. The chain fragments of two types of LMWHs, enoxaparin and nadroparin, were generated by controlled enzymatic digestion with each of heparinase I (Hep I, Enzyme Commission (EC) # 4.2.2.7), heparinase II (Hep II, no EC # assigned) and heparinase III (Hep III, EC # 4.2.2.8). Reversed phase ion pair high performance liquid chromatography (RPIP-HPLC) coupled with electrospray ion trap time-of-flight mass spectrometry (ESI-IT-TOF-MS) was used to profile the oligosaccharide chains ranging from disaccharides to decasaccharides. A database containing all theoretical structural compositions was established to assist the mass spectra interpretation. The six digests derived by three enzymes from two types of LMWHs exhibited distinguishable fingerprinting patterns. And a total of 94 enoxaparin fragments and 109 nadroparin fragments were detected and identified. Besides the common LMWH oligosaccharides, many components containing characteristic LMWH structures such as saturated L-idopyranosuronic acid, 2,5-anhydro-D-mannitol, 1,6-anhydro-D-aminopyranose, as well as odd number oligosaccharides were also revealed. Quantitative comparison of major components derived from innovator and generic nadroparin products was presented. This approach to profile LMWHs' fragments offers a highly reproducible, high resolution and information-rich tool for evaluating the quality of this category of anticoagulant drugs or comparing structural similarities among samples from various sources. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Biomedical applications of polymers derived by reversible addition - fragmentation chain-transfer (RAFT).

    Science.gov (United States)

    Fairbanks, Benjamin D; Gunatillake, Pathiraja A; Meagher, Laurence

    2015-08-30

    RAFT- mediated polymerization, providing control over polymer length and architecture as well as facilitating post polymerization modification of end groups, has been applied to virtually every facet of biomedical materials research. RAFT polymers have seen particularly extensive use in drug delivery research. Facile generation of functional and telechelic polymers permits straightforward conjugation to many therapeutic compounds while synthesis of amphiphilic block copolymers via RAFT allows for the generation of self-assembled structures capable of carrying therapeutic payloads. With the large and growing body of literature employing RAFT polymers as drug delivery aids and vehicles, concern over the potential toxicity of RAFT derived polymers has been raised. While literature exploring this complication is relatively limited, the emerging consensus may be summed up in three parts: toxicity of polymers generated with dithiobenzoate RAFT agents is observed at high concentrations but not with polymers generated with trithiocarbonate RAFT agents; even for polymers generated with dithiobenzoate RAFT agents, most reported applications call for concentrations well below the toxicity threshold; and RAFT end-groups may be easily removed via any of a variety of techniques that leave the polymer with no intrinsic toxicity attributable to the mechanism of polymerization. The low toxicity of RAFT-derived polymers and the ability to remove end groups via straightforward and scalable processes make RAFT technology a valuable tool for practically any application in which a polymer of defined molecular weight and architecture is desired. Copyright © 2015. Published by Elsevier B.V.

  13. On the record process of time-reversible spectrally-negative Markov additive processes

    NARCIS (Netherlands)

    J. Ivanovs; M.R.H. Mandjes (Michel)

    2009-01-01

    htmlabstractWe study the record process of a spectrally-negative Markov additive process (MAP). Assuming time-reversibility, a number of key quantities can be given explicitly. It is shown how these key quantities can be used when analyzing the distribution of the all-time maximum attained by MAPs

  14. IgG Fab Fragments Forming Bivalent Complexes by a Conformational Mechanism That Is Reversible by Osmolytes*

    Science.gov (United States)

    Nelson, Alfreda D.; Hoffmann, Michele M.; Parks, Christopher A.; Dasari, Surendra; Schrum, Adam G.; Gil, Diana

    2012-01-01

    Generated by proteolytic cleavage of immunoglobulin, Fab fragments possess great promise as blocking reagents, able to bind receptors or other targets without inducing cross-linking. However, aggregation of Fab preparations is a common occurrence, which generates intrinsic stimulatory capacity and thwarts signal blockade strategies. Using a panel of biochemical approaches, including size exclusion chromatography, SDS-PAGE, mass spectrometry, and cell stimulation followed by flow cytometry, we have measured the oligomerization and acquisition of stimulatory capacity that occurs in four monoclonal IgG Fabs specific for TCR/CD3. Unexpectedly, we observed that all Fabs spontaneously formed complexes that were precisely bivalent, and these bivalent complexes possessed most of the stimulatory activity of each Fab preparation. Fabs composing bivalent complexes were more susceptible to proteolysis than monovalent Fabs, indicating a difference in conformation between the Fabs involved in these two different states of valency. Because osmolytes represent a class of compounds that stabilize protein folding and conformation, we sought to determine the extent to which the amino acid osmolyte l-proline might impact bivalent Fab complexation. We found that l-proline (i) inhibited the adoption of the conformation associated with bivalent complexation, (ii) preserved Fab monovalency, (iii) reversed the conformation of preformed bivalent Fabs to that of monovalent Fabs, and (iv) separated a significant percentage of preformed bivalent complexes into monovalent species. Thus, Fab fragments can adopt a conformation that is compatible with folding or packing of a bivalent complex in a process that can be inhibited by osmolytes. PMID:23109335

  15. Dissecting Orthosteric Contacts for a Reverse-Fragment-Based Ligand Design.

    Science.gov (United States)

    Chandramohan, Arun; Tulsian, Nikhil K; Anand, Ganesh S

    2017-08-01

    Orthosteric sites on proteins are formed typically from noncontiguous interacting sites in three-dimensional space where the composite binding interaction of a biological ligand is mediated by multiple synergistic interactions of its constituent functional groups. Through these multiple interactions, ligands stabilize both the ligand binding site and the local secondary structure. However, relative energetic contributions of the individual contacts in these protein-ligand interactions are difficult to resolve. Deconvolution of the contributions of these various functional groups in natural inhibitors/ligand would greatly aid in iterative fragment-based drug discovery (FBDD). In this study, we describe an approach of progressive unfolding of a target protein using a gradient of denaturant urea to reveal the individual energetic contributions of various ligand-functional groups to the affinity of the entire ligand. Through calibrated unfolding of two protein-ligand systems: cAMP-bound regulatory subunit of Protein Kinase A (RIα) and IBMX-bound phosphodiesterase8 (PDE8), monitored by amide hydrogen-deuterium exchange mass spectrometry, we show progressive disruption of individual orthosteric contacts in the ligand binding sites, allowing us to rank the energetic contributions of these individual interactions. In the two cAMP-binding sites of RIα, exocyclic phosphate oxygens of cAMP were identified to mediate stronger interactions than ribose 2'-OH in both the RIα-cAMP binding interfaces. Further, we have also ranked the relative contributions of the different functional groups of IBMX based on their interactions with the orthosteric residues of PDE8. This strategy for deconstruction of individual binding sites and identification of the strongest functional group interaction in enzyme orthosteric sites offers a rational starting point for FBDD.

  16. Hyaluronate fragments reverse skin atrophy by a CD44-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Gürkan Kaya

    2006-12-01

    Full Text Available BACKGROUND: Skin atrophy is a common manifestation of aging and is frequently accompanied by ulceration and delayed wound healing. With an increasingly aging patient population, management of skin atrophy is becoming a major challenge in the clinic, particularly in light of the fact that there are no effective therapeutic options at present. METHODS AND FINDINGS: Atrophic skin displays a decreased hyaluronate (HA content and expression of the major cell-surface hyaluronate receptor, CD44. In an effort to develop a therapeutic strategy for skin atrophy, we addressed the effect of topical administration of defined-size HA fragments (HAF on skin trophicity. Treatment of primary keratinocyte cultures with intermediate-size HAF (HAFi; 50,000-400,000 Da but not with small-size HAF (HAFs; 400,000 Da induced wild-type (wt but not CD44-deficient (CD44-/- keratinocyte proliferation. Topical application of HAFi caused marked epidermal hyperplasia in wt but not in CD44-/- mice, and significant skin thickening in patients with age- or corticosteroid-related skin atrophy. The effect of HAFi on keratinocyte proliferation was abrogated by antibodies against heparin-binding epidermal growth factor (HB-EGF and its receptor, erbB1, which form a complex with a particular isoform of CD44 (CD44v3, and by tissue inhibitor of metalloproteinase-3 (TIMP-3. CONCLUSIONS: Our observations provide a novel CD44-dependent mechanism for HA oligosaccharide-induced keratinocyte proliferation and suggest that topical HAFi application may provide an attractive therapeutic option in human skin atrophy.

  17. Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 1.

    Science.gov (United States)

    Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

    2016-06-15

    Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Addition of Sodium Bicarbonate to Irrigation Solution May Assist in Dissolution of Uric Acid Fragments During Ureteroscopy

    DEFF Research Database (Denmark)

    Paonessa, Jessica E; Williams, James C; Lingeman, James E

    2018-01-01

    INTRODUCTION: We hypothesized that adding sodium bicarbonate (bicarb) to normal saline (NS) irrigation during ureteroscopy in patients with uric acid (UA) nephrolithiasis may assist in dissolving small stone fragments produced during laser lithotripsy. In vitro testing was performed to determine....../L NS yielded a dissolution rate averaging 22% ± 7% per hour, which was nearly five times higher than NS alone. There was a trend for an increase in mean dissolution rate with higher temperature but this increase was not significant (p = 0.30). CONCLUSIONS: The addition of bicarbonate to NS more than...

  19. Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 2.

    Science.gov (United States)

    McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

    2016-06-15

    Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. In-line monitoring and reverse 3D model reconstruction in additive manufacturing

    DEFF Research Database (Denmark)

    Pedersen, David Bue; Hansen, Hans Nørgaard; Nielsen, Jakob Skov

    2010-01-01

    Additive manufacturing allows for close-to unrestrained geometrical freedom in part design. The ability to manufacture geometries of such complexity is however limited by the fact that it proves difficult to verify tolerances of these parts. Tolerancs of featuress that are inaccessible...

  1. Validation of Reverse-Engineered and Additive-Manufactured Microsurgical Instrument Prototype.

    Science.gov (United States)

    Singh, Ramandeep; Suri, Ashish; Anand, Sneh; Baby, Britty

    2016-12-01

    With advancements in imaging techniques, neurosurgical procedures are becoming highly precise and minimally invasive, thus demanding development of new ergonomically aesthetic instruments. Conventionally, neurosurgical instruments are manufactured using subtractive manufacturing methods. Such a process is complex, time-consuming, and impractical for prototype development and validation of new designs. Therefore, an alternative design process has been used utilizing blue light scanning, computer-aided designing, and additive manufacturing direct metal laser sintering (DMLS) for microsurgical instrument prototype development. Deviations of DMLS-fabricated instrument were studied by superimposing scan data of fabricated instrument with the computer-aided designing model. Content and concurrent validity of the fabricated prototypes was done by a group of 15 neurosurgeons by performing sciatic nerve anastomosis in small laboratory animals. Comparative scoring was obtained for the control and study instrument. T test was applied to the individual parameters and P values for force (P direct application of these additive-manufactured instruments in the operating room requires further validation. © The Author(s) 2016.

  2. Codon-Precise, Synthetic, Antibody Fragment Libraries Built Using Automated Hexamer Codon Additions and Validated through Next Generation Sequencing

    Directory of Open Access Journals (Sweden)

    Laura Frigotto

    2015-05-01

    Full Text Available We have previously described ProxiMAX, a technology that enables the fabrication of precise, combinatorial gene libraries via codon-by-codon saturation mutagenesis. ProxiMAX was originally performed using manual, enzymatic transfer of codons via blunt-end ligation. Here we present Colibra™: an automated, proprietary version of ProxiMAX used specifically for antibody library generation, in which double-codon hexamers are transferred during the saturation cycling process. The reduction in process complexity, resulting library quality and an unprecedented saturation of up to 24 contiguous codons are described. Utility of the method is demonstrated via fabrication of complementarity determining regions (CDR in antibody fragment libraries and next generation sequencing (NGS analysis of their quality and diversity.

  3. An Additional Method for Analyzing the Reversible Inhibition of an 
Enzyme Using Acid Phosphatase as a Model.

    Science.gov (United States)

    Baumhardt, Jordan M; Dorsey, Benjamin M; McLauchlan, Craig C; Jones, Marjorie A

    2015-08-01

    Using wheat germ acid phosphatase and sodium orthovanadate as a competitive inhibitor, a novel method for analyzing reversible inhibition was carried out. Our alternative approach involves plotting the initial velocity at which product is formed as a function of the ratio of substrate concentration to inhibitor concentration at a constant enzyme concentration and constant assay conditions. The concept of initial concentrations driving equilibrium leads to the chosen axes. Three apparent constants can be derived from this plot: K max , K min , and K inflect . K max and K min represent the substrate to inhibitor concentration ratio for complete inhibition and minimal inhibition, respectively. K inflect represents the substrate to inhibitor concentration ratio at which the enzyme-substrate complex is equal to the inhibitory complex. These constants can be interpolated from the graph or calculated using the first and second derivative of the plot. We conclude that a steeper slope and a shift of the line to the right (increased x-axis values) would indicate a better inhibitor. Since initial velocity is not a linear function of the substrate/inhibitor ratio, this means that inhibition changes more quickly with the change in the [S]/ [I] ratio. When preincubating the enzyme with substrate before the addition of inhibitor, preincubating the enzyme with inhibitor before the addition of substrate or with concurrent addition of both substrate and inhibitor, modest changes in the slopes and y-intercepts were obtained. This plot appears useful for known competitive and non-competitive inhibitors and may have general applicability.

  4. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  5. An Additional Method for Analyzing the Reversible Inhibition of an ?Enzyme Using Acid Phosphatase as a Model

    OpenAIRE

    Baumhardt, Jordan M.; Dorsey, Benjamin M.; McLauchlan, Craig C.; Jones, Marjorie A.

    2015-01-01

    Using wheat germ acid phosphatase and sodium orthovanadate as a competitive inhibitor, a novel method for analyzing reversible inhibition was carried out. Our alternative approach involves plotting the initial velocity at which product is formed as a function of the ratio of substrate concentration to inhibitor concentration at a constant enzyme concentration and constant assay conditions. The concept of initial concentrations driving equilibrium leads to the chosen axes. Three apparent const...

  6. The Effect of Allylic Sulfide-Mediated IrreversibleAddition-Fragment Chain Transfer on the EmulsionPolymerization Kinetics of Styrene

    Directory of Open Access Journals (Sweden)

    Li An

    2015-09-01

    Full Text Available The effect of the irreversible addition-fragment chain transfer agent, butyl(2-phenylallylsulfane (BPAS, on the course of the emulsion polymerization of styrene and on the product molecular weight was investigated. The emulsion polymerizations were performed using various amounts of sodium dodecyl sulfate (SDS as the surfactant and potassium peroxodisulfate (KPS as the initiator. The relationships between the rates of polymerization (\\(R_{p} \\ and the number of particles per volume (\\(N_{c} \\ with respect to the concentrations of KPS, SDS, and BPAS were found to be \\(R_{p} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.29} \\, \\(N_{c} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.26} \\,\\(R_{p} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.68} \\, \\(N_{c} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.72} \\, and \\(R_{p} \\propto \\left\\lbrack BPAS \\right\\rbrack^{- 0.73} \\ . The obtained relationships can be attributed to the exit of the leaving group radicals on BPAS from the polymer particles. The experimental values of the average number of radicals per particle (\\(\\overset{\\_}{n} \\ were strongly dependent on the BPAS concentration and were in good agreement with the theoretical values (\\({\\overset{\\_}{n}}_{theo} \\ from model calculations. The number-average molecular weight (\\(\\overset{\\_}{M_{n}} \\ can be controlled by BPAS over nearly the entire conversion range, which is also in agreement with the mathematical model. In addition, the transfer rate coefficient (\\(k_{tr} \\ of BPAS can be estimated as 326 L/mol/s at 70 \\(^\\circ\\C. Moreover, similar good results were found for the tested redox reactions at 30 \\(^\\circ\\C.

  7. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  8. A Standard Addition Method to Assay the Concentration of Biologically Interesting Polyphenols in Grape Berries by Reversed-Phase HPLC

    Directory of Open Access Journals (Sweden)

    Serkos A. Haroutounian

    2007-09-01

    Full Text Available A reversed-phase HPLC method which allows the simultaneous assay of (+- catechin, (–-epicatechin, trans-resveratrol, quercetin and quercetin glycosides in grape berries is described. Kromasil 100 served as stationary phase and a gradient of acetic acid, water and methanol was used. The analytical run requires 42 min for complete sample elution. Satisfactory peak resolution was achieved following a novel extraction process and direct injection of a 20 μL sample. The method was used for the analyses of eighteen samples. Linearities were in the range of 0.98 to 0.999 regression coefficient, for all phenolics, while detection limits ranged from 30 μg mL–1 for trans-resveratrol to 1.5 mg mL–1 for (+-catechin. Recoveries ranged from 95.1 to 98.7% while the method provided good precision, with standard deviations between 3.5 and 6.1%, n=5.

  9. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  10. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  11. Complete reversal of muscle wasting in experimental cancer cachexia: Additive effects of activin type II receptor inhibition and β-2 agonist.

    Science.gov (United States)

    Toledo, Míriam; Busquets, Sílvia; Penna, Fabio; Zhou, Xiaolan; Marmonti, Enrica; Betancourt, Angelica; Massa, David; López-Soriano, Francisco J; Han, H Q; Argilés, Josep M

    2016-04-15

    Formoterol is a highly potent β2-adrenoceptor-selective agonist, which is a muscle growth promoter in many animal species. Myostatin/activin inhibition reverses skeletal muscle loss and prolongs survival of tumor-bearing animals. The aim of this investigation was to evaluate the effects of a combination of the soluble myostatin receptor ActRIIB (sActRIIB) and the β2-agonist formoterol in the cachectic Lewis lung carcinoma model. The combination of formoterol and sActRIIB was extremely effective in reversing muscle wasting associated with experimental cancer cachexia in mice. Muscle weights from tumor-bearing animals were completely recovered following treatment and this was also reflected in the measured grip strength. This combination increased food intake in both control and tumor-bearing animals. The double treatment also prolonged survival significantly without affecting the weight and growth of the primary tumor. In addition, it significantly reduced the number of metastasis. Concerning the mechanisms for the preservation of muscle mass during cachexia, the effects of formoterol and sActRIIB seemed to be additive, since formoterol reduced the rate of protein degradation (as measured in vitro as tyrosine release, using incubated isolated individual muscles) while sActRIIB only affected protein synthesis (as measured in vivo using tritiated phenylalanine). Formoterol also increased the rate of protein synthesis and this seemed to be favored by the presence of sActRIIB. Combining formoterol and sActRIIB seemed to be a very promising treatment for experimental cancer cachexia. Further studies in human patients are necessary and may lead to a highly effective treatment option for muscle wasting associated with cancer. © 2015 UICC.

  12. [Influences of ion-suppressors on retention behaviors of nine food additives in reversed-phase high performance liquid chromatographic separation].

    Science.gov (United States)

    Zhao, Yonggang; Chen, Xiaohong; Li, Xiaoping; Yao, Shanshan; Jin, Micong

    2011-10-01

    The influences of ion-suppressors on retention behaviors of nine food additives, i.e., acesulfame, saccharin, caffeine, aspartame, benzoic acid, sorbic acid, stevioside, dehydroacetic acid and neotame in reversed-phase high performance liquid chromatographic (RP-HPLC) separation were investigated. The organic modification effects of acids, i. e. , trifluoroacetic acid (TFA) and buffer salts, i. e. , TFA-ammonium acetate (AmAc) were studied emphatically. The relationships between retention factors of solutes and volume percentages of ion-suppressors in the mobile phase systems of acetonitrile-TFA aqueous solution and acetonitrile-TFA-AmAc aqueous solution were quantitatively established, separately. The separation of nine food additives was completed by a gradient elution with acetonitrile-TFA (0.01%, v/v)-AmAc (2. 5 mmol/L) aqueous solution as the mobile phases. An RP-HPLC method was established for the simultaneous determination of nine food additives in red wine. In the range of 10. 0 - 100. 0 mg/L, nine food additives showed good linearity with the correlation coefficients ( r2 ) larger than 0. 999 1. The limits of detection (LODs) were in the range of 0. 33 - 2. 36 mg/L and the limits of quantification (LOQs) were in the range of 1. 11 - 7. 80 mg/L. The spiked recoveries were between 87. 61% and 108. 4% with the relative standard deviations (RSDs) of 2. 2% -9. 4%. These results are of referential significance for the rapid establishment and accu- rate optimization of RP-HPLC separation for the simultaneous determination of food additives in other foods.

  13. Establishment of a Charge Reversal Derivatization Strategy to Improve the Ionization Efficiency of Limaprost and Investigation of the Fragmentation Patterns of Limaprost Derivatives Via Exclusive Neutral Loss and Survival Yield Method

    Science.gov (United States)

    Sun, Dong; Meng, Xiangjun; Ren, Tianming; Fawcett, John Paul; Wang, Hualu; Gu, Jingkai

    2018-04-01

    Sensitivity is generally an issue in bioassays of prostaglandins and their synthetic analogs due to their extremely low concentration in vivo. To improve the ionization efficiency of limaprost, an oral prostaglandin E1 (PGE1) synthetic analog, we investigated a charge reversal derivatization strategy in electrospray ionization mass spectrometry (ESI-MS). We established that the cholamine derivative exhibits much greater signal intensity in the positive-ion mode compared with limaprost in the negative ion mode. Collision-induced dissociation (CID) involved exclusive neutral mass loss and positive charge migration to form stable cationic product ions with the positive charge on the limaprost residue rather than on the modifying group. This has the effect of maintaining the efficiency and specificity of multiple reaction monitoring (MRM) and avoiding cross talk. CID fragmentation patterns of other limaprost derivatives allowed us to relate the dissociation tendency of different neutral leaving groups to an internal energy distribution scale based on the survival yield method. Knowledge of the energy involved in the production of stabilized positive ions will potentially assist the selection of suitable derivatization reagents for the analysis of a wide variety of lipid acids. [Figure not available: see fulltext.

  14. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  15. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  16. Virtual fragment preparation for computational fragment-based drug design.

    Science.gov (United States)

    Ludington, Jennifer L

    2015-01-01

    Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

  17. PP087. Deep trial secondary analysis: Digoxin immune fab fragment treatment has additional benefits in endogenous digitalis-like factor positive preeclamptic women.

    Science.gov (United States)

    Graves, S W; Hopoate-Sitake, M; Johnston, A; Buckalew, V; Lam, G; Mason, L; Adair, D

    2012-07-01

    A double blinded placebo controlled clinical trial of a commercial digoxin immune Fab fragment (DIF) in preeclamptic (PE) women provided some benefit to treated subjects (1). In that study DIF, relative to placebo, prevented a decline in CrCl and lowered levels of endogenous digitalis-like factor (EDLF) activity as measured by sodium pump inhibition (SPI). However, some PE subjects had undetectable EDLF. The hypothesis tested was that only PE women with measureable EDLF would respond to DIF treatment and analysis of EDLF positive women might reveal treatment effects masked by inclusion of EDLF negative, and hence non-responding, PE women. Accordingly, analyses of DIF effects in EDLF positive PE women were conducted. Patient characteristics and study design have been published (1). In these subanalyses, subjects were considered to be EDLF positive if their plasma inhibited red cell sodium pump mediated Rb uptake. All analyses were redone for the EDLF positive subgroup by Covance Inc as in the original trial. Continuous data were analyzed by ANCOVA. Categorical data were analyzed by Barnard Exact Test. 45 subjects (23 DIF, 22 placebo) had baseline SPI evaluated. Of these 22% had undetectable SPI. EDLF positive PE women showed greater and more significant reductions of SPI in response to DIF at each time point (12, 24, 48 hr treatment) than in the original analysis. Subjects with undetectable EDLF showed no significant change in response to DIF or placebo. For CrCl, EDLF positive PE women showed greater and more significant preservation of CrCl compared with original analyses. Subjects absent EDLF showed deterioration of CrCl with or without DIF. Among EDLF positive PE women DIF treated women had significantly less maternal pulmonary edema (p=0.035) and significantly less intraventricular hemorrhage in their infants (p=0.015). There was the suggestion of reductions in the incidence of other maternal and neonatal abnormalities. These data indicate that EDLF positive PE

  18. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  19. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  20. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  1. Temperatures of fragment kinetic energy spectra

    International Nuclear Information System (INIS)

    Bauer, W.

    1995-01-01

    Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework

  2. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....

  3. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  4. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2016-01-01

    , investigating levels of control and uncertainty encountering with these. Through tangible experiments, the project discusses materiality and digitally controlled fabrications tools as direct expansions of the architect's digital drawing and workflow. The project sees this expansion as an opportunity to connect...... architectural designs, tectonics and aesthetics. In this Ph.D.-project a series a physical, but conceptual, experiment plays the central role in the knowledge production. The experiments result in materialised architectural fragments and tangible experiences. However, these creations also become the driving...

  5. rHDL administration increases reverse cholesterol transport in mice, but is not additive on top of ezetimibe or cholestyramine treatment

    NARCIS (Netherlands)

    Maugeais, Cyrille; Annema, Wijtske; Blum, Denise; Mary, Jean-Luc; Tietge, Uwe J. F.

    Objective: Promoting reverse cholesterol transport (RCT) is a major atheroprotective property of HDL. The present study explored the effect of stimulating the first step of RCT (cholesterol efflux from macrophages) alone or in combination with stimulating the last step of RCT (fecal sterol

  6. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  7. The formation of planets by disc fragmentation

    Directory of Open Access Journals (Sweden)

    Stamatellos Dimitris

    2013-04-01

    Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

  8. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    Contemporary industrialized architecture based on advanced information technology and highly technological production processes, implies a radically different approach to architecture than what we have experienced in the past. Works of architecture composed of prefabricated building components......, contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...

  9. Improvement of the MSG code for the MONJU evaporators. Additional function of reverse flow calculation on water/steam model and animation for post processing

    International Nuclear Information System (INIS)

    Toda, Shin-ichi; Yoshikawa, Shinji; Oketani, Kazuhiro

    2003-05-01

    The improved version of the MSG code (Multi-dimensional Thermal-hydraulic Analysis Code for Steam Generators) has been released. It has been carried out to improve based on the original version in order to calculate reverse flow on water/steam side, and to animate the post-processing data. To calculate reverse flow locally, modification to set pressure at each divided node point of water/steam region in the helical-coil heat transfer tubes has been carried out. And the matrix solver has been also improved to treat a problem within practical calculation time against increasing the pressure points. In this case pressure and enthalpy have to be calculated simultaneously, however, it was found out that using the block-Jacobean method make a diagonal-dominant matrix, and solve the matrix efficiently with a relaxation method. As the result of calculations of a steady-state condition and a transient of SG blow down with manual trip operation, the improvement on calculation function of the MSG code was confirmed. And an animation function of temperature contour in the sodium shell side as a post processing has been added. Since the animation is very effective to understand thermal-hydraulic behavior on the sodium shell side of the SG, especially in case of transient condition, the analysis and evaluation of the calculation results will be enabled to be more quickly and effectively. (author)

  10. Direct access to dithiobenzoate RAFT agent fragmentation rate coefficients by ESR spin-trapping.

    Science.gov (United States)

    Ranieri, Kayte; Delaittre, Guillaume; Barner-Kowollik, Christopher; Junkers, Thomas

    2014-12-01

    The β-scission rate coefficient of tert-butyl radicals fragmenting off the intermediate resulting from their addition to tert-butyl dithiobenzoate-a reversible addition-fragmentation chain transfer (RAFT) agent-is estimated via the recently introduced electron spin resonance (ESR)-trapping methodology as a function of temperature. The newly introduced ESR-trapping methodology is critically evaluated and found to be reliable. At 20 °C, a fragmentation rate coefficient of close to 0.042 s(-1) is observed, whereas the activation parameters for the fragmentation reaction-determined for the first time-read EA = 82 ± 13.3 kJ mol(-1) and A = (1.4 ± 0.25) × 10(13) s(-1) . The ESR spin-trapping methodology thus efficiently probes the stability of the RAFT adduct radical under conditions relevant for the pre-equilibrium of the RAFT process. It particularly indicates that stable RAFT adduct radicals are indeed formed in early stages of the RAFT poly-merization, at least when dithiobenzoates are employed as controlling agents as stipulated by the so-called slow fragmentation theory. By design of the methodology, the obtained fragmentation rate coefficients represent an upper limit. The ESR spin-trapping methodology is thus seen as a suitable tool for evaluating the fragmentation rate coefficients of a wide range of RAFT adduct radicals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Reverse Algols

    Science.gov (United States)

    Leung, K. C.

    1989-01-01

    Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.

  12. Reverse Logistics

    OpenAIRE

    Kulikova, Olga

    2016-01-01

    This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...

  13. Reverse Osmosis

    Indian Academy of Sciences (India)

    many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...

  14. Double quick, double click reversible peptide “stapling”† †Electronic supplementary information (ESI) available: Synthesis and characterization, additional biophysical and biochemical analyses. See DOI: 10.1039/c7sc01342f Click here for additional data file. Click here for additional data file. Click here for additional data file.

    Science.gov (United States)

    Grison, Claire M.; Burslem, George M.; Miles, Jennifer A.; Pilsl, Ludwig K. A.; Yeo, David J.; Imani, Zeynab; Warriner, Stuart L.; Webb, Michael E.

    2017-01-01

    The development of constrained peptides for inhibition of protein–protein interactions is an emerging strategy in chemical biology and drug discovery. This manuscript introduces a versatile, rapid and reversible approach to constrain peptides in a bioactive helical conformation using BID and RNase S peptides as models. Dibromomaleimide is used to constrain BID and RNase S peptide sequence variants bearing cysteine (Cys) or homocysteine (hCys) amino acids spaced at i and i + 4 positions by double substitution. The constraint can be readily removed by displacement of the maleimide using excess thiol. This new constraining methodology results in enhanced α-helical conformation (BID and RNase S peptide) as demonstrated by circular dichroism and molecular dynamics simulations, resistance to proteolysis (BID) as demonstrated by trypsin proteolysis experiments and retained or enhanced potency of inhibition for Bcl-2 family protein–protein interactions (BID), or greater capability to restore the hydrolytic activity of the RNAse S protein (RNase S peptide). Finally, use of a dibromomaleimide functionalized with an alkyne permits further divergent functionalization through alkyne–azide cycloaddition chemistry on the constrained peptide with fluorescein, oligoethylene glycol or biotin groups to facilitate biophysical and cellular analyses. Hence this methodology may extend the scope and accessibility of peptide stapling. PMID:28970902

  15. Artificial Synthesis of Conserved Segment S Gene Fragment of Rift ...

    African Journals Online (AJOL)

    Fragment of Rift Valley Fever Virus and Preliminary Study of Its Reverse ... blindness, encephalitis, hemorrhagic hepatitis, and, in serious ... over 30 mosquito species [5] of mosquito. As ..... RVFV, as a mosquito-borne virus for a multitude.

  16. Part I: Reverse-docking studies of a squaramide-catalyzed conjugate addition of a diketone to a nitro-olefin Part II: The development of ChemSort: an education game for organic chemistry

    Science.gov (United States)

    Granger, Jenna Christine

    Part 1: Reverse-docking studies of a squaramide-catalyzed conjugate addition of a diketone to a nitro-olefin. Asymmetric organocatalysis, the catalysis of asymmetric reactions by small organic molecules, is a rapidly growing field within organic synthesis. The ability to rationally design organocatalysts is therefore of increasing interest to organic chemists. Computational chemistry is quickly proving to be an extremely successful method for understanding and predicting the roles of organocatalysts, and therefore is certain to be of use in the rational design of such catalysts. A methodology for reverse-docking flexible organocatalysts to rigid transition state models of asymmetric reactions has been previously developed by the Deslongchamps group. The investigation of Rawal's squaramide-based organocatalyst for the addition of a diketone to a nitro-olefin is described, and the results of the reverse docking of Rawal's catalyst to the geometry optimized transition state models of the uncatalyzed reaction for both the R and S-product enantiomers are presented. The results of this study indicate a preference for binding of the organocatalyst to the R-enantiomer transition state model with a predicted enantiomeric excess of 99%, which is consistent with the experimental results. A plausible geometric model of the transition state for the catalyzed reaction is also presented. The success of this study demonstrates the credibility of using reverse docking methods for the rational design of asymmetric organocatalysts. Part 2: The development of ChemSort: an educational game for organic chemistry. With the advent of the millennial learner, we need to rethink traditional classroom approaches to science learning in terms of goals, approaches, and assessments. Digital simulations and games hold much promise in support of this educational shift. Although the idea of using games for education is not a new one, well-designed computer-based "serious games" are only beginning to

  17. Fragmentation of random trees

    International Nuclear Information System (INIS)

    Kalay, Z; Ben-Naim, E

    2015-01-01

    We study fragmentation of a random recursive tree into a forest by repeated removal of nodes. The initial tree consists of N nodes and it is generated by sequential addition of nodes with each new node attaching to a randomly-selected existing node. As nodes are removed from the tree, one at a time, the tree dissolves into an ensemble of separate trees, namely, a forest. We study statistical properties of trees and nodes in this heterogeneous forest, and find that the fraction of remaining nodes m characterizes the system in the limit N→∞. We obtain analytically the size density ϕ s of trees of size s. The size density has power-law tail ϕ s ∼s −α with exponent α=1+(1/m). Therefore, the tail becomes steeper as further nodes are removed, and the fragmentation process is unusual in that exponent α increases continuously with time. We also extend our analysis to the case where nodes are added as well as removed, and obtain the asymptotic size density for growing trees. (paper)

  18. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  19. Reversal Strategies for NOACs

    DEFF Research Database (Denmark)

    Husted, Steen; Verheugt, Freek; Comuth, Willemijn

    2015-01-01

    , coagulation factor concentrates or NOAC-specific antidotes could be used. Coagulation factor concentrates can be used in patients with haemophilia and to reverse the effect of VKAs but, in NOAC-treated patients, results are inconsistent and these agents could potentially have pro-thrombotic effects. Specific...... antidotes for NOACs are expected to be on the market soon. Phase III clinical trials with a humanized antibody fragment directed against dabigatran (idarucizumab) and recombinant, modified factor Xa (andexanet alfa) are ongoing. A molecule (aripazine) with broad activity against various anticoagulants...

  20. Measuring the temperature of hot nuclear fragments

    International Nuclear Information System (INIS)

    Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.

    2010-01-01

    A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.

  1. Gallstone fragmentation by control electrohydraulic lithotripsy

    International Nuclear Information System (INIS)

    Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

    1989-01-01

    The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

  2. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  3. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  4. Analysis of nine food additives in red wine by ion-suppression reversed-phase high-performance liquid chromatography using trifluoroacetic acid and ammonium acetate as ion-suppressors.

    Science.gov (United States)

    Zhao, Yong-Gang; Chen, Xiao-Hong; Yao, Shan-Shan; Pan, Sheng-Dong; Li, Xiao-Ping; Jin, Mi-Cong

    2012-01-01

    A reversed-phase high-performance liquid chromatography (RP-HPLC) method was developed for the simultaneous determination of nine food additives, i.e., acesulfame, saccharin, caffeine, aspartame, benzoic acid, sorbic acid, stevioside, dehydroacetic acid and neotame in red wine. The effects of ion-suppressors, i.e., trifluoroacetic acid (TFA) and ammonium acetate (AmAc) on retention behavior of nine food additives in RP-HPLC separation were discussed in detail. The relationships between retention factors of solutes and volume percent of ion-suppressors in the mobile-phase systems of acetonitrile-TFA aqueous solution and acetonitrile-TFA-AmAc aqueous solution were quantitatively established, respectively. The results showed that the ion suppressors had not only an ion suppression effect, but also an organic modification effect on the acidic analytes. The baseline separation of nine food additives was completed by a gradient elution with acetonitrile-TFA(0.01%, v/v)-AmAc(2.5 mmol L(-1)) aqueous solution as the mobile phase. The recoveries were between 80.2 - 99.5% for all analytes with RSDs in the range of 1.5 - 8.9%. The linearities were in the range of 0.2 - 100.0 mg L(-1) with determination coefficients (r(2)) higher than 0.9991 for all analytes. The limits of quantification (LOQs) were between 0.53 - 0.99 mg L(-1). The applicability of the proposed method to detect and quantify food additives has been demonstrated in the analysis of 30 real samples.

  5. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  6. Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

    Science.gov (United States)

    Lirman

    2000-08-23

    Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

  7. Heart Rate Fragmentation: A Symbolic Dynamical Approach

    Directory of Open Access Journals (Sweden)

    Madalena D. Costa

    2017-11-01

    Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to

  8. Towards novel therapeutics for HIV through fragment-based screening and drug design.

    Science.gov (United States)

    Tiefendbrunn, Theresa; Stout, C David

    2014-01-01

    Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.

  9. Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

    Science.gov (United States)

    Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

    2015-01-01

    Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

  10. Dimensional crossover in fragmentation

    Science.gov (United States)

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  11. Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

    Science.gov (United States)

    Gouge, Michael F.

    2011-01-01

    Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

  12. Fragmentation of percolation cluster perimeters

    Science.gov (United States)

    Debierre, Jean-Marc; Bradley, R. Mark

    1996-05-01

    We introduce a model for the fragmentation of porous random solids under the action of an external agent. In our model, the solid is represented by a bond percolation cluster on the square lattice and bonds are removed only at the external perimeter (or `hull') of the cluster. This model is shown to be related to the self-avoiding walk on the Manhattan lattice and to the disconnection events at a diffusion front. These correspondences are used to predict the leading and the first correction-to-scaling exponents for several quantities defined for hull fragmentation. Our numerical results support these predictions. In addition, the algorithm used to construct the perimeters reveals itself to be a very efficient tool for detecting subtle correlations in the pseudo-random number generator used. We present a quantitative test of two generators which supports recent results reported in more systematic studies.

  13. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  14. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  15. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  16. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Unknown

    In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavi- ... ment system like radiation pressure balance, the power is given by ... Thus the bubble size has direct relationship with its life and.

  17. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  18. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  19. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  20. Idarucizumab for Reversing Dabigatran-Induced Anticoagulation: A Systematic Review.

    Science.gov (United States)

    Thibault, Nathan; Morrill, Amanda M; Willett, Kristine C

    The approval of the oral direct thrombin inhibitor, dabigatran etexilate, gave patients an alternative to oral anticoagulation with warfarin. Like all anticoagulants, the primary adverse event (AE) associated with dabigatran is bleeding. Until the FDA approval of idarucizumab, there had been no reversal agent for dabigatran-induced anticoagulation in patients with life-threatening or uncontrollable bleeding, or those requiring emergent procedures. The primary purpose of this review is to summarize the safety and efficacy of idarucizumab, a monoclonal antibody fragment, and its use as a reversal agent for dabigatran. A literature search was conducted through MEDLINE (1946 to November week 1 2015) and Embase (1980-2015 week 46) using the search term idarucizumab. Clinicaltrials.gov was consulted for a comprehensive list of ongoing and completed studies. Additional studies were identified through bibliographical citations. Clinical trials in animals and humans published in English evaluating the safety and efficacy of idarucizumab for reversal of anticoagulant treatment with dabigatran were included for review. Idarucizumab has been shown to significantly reverse the anticoagulant effects of dabigatran in both healthy volunteers and patients requiring a reversal agent because of either overt bleeding or an emergency surgery or invasive procedure. The most common AEs were headache, nasopharyngitis, back pain, skin irritation, hypokalemia, delirium, constipation, pyrexia, and pneumonia. Deaths reported in idarucizumab studies were attributed to either the index event or a preexisting comorbidity. Most adverse effects were minor, but 21 serious AEs have been reported in the published data including thrombotic events. Given the increased use of direct oral anticoagulants, such as dabigatran, a need for specific reversal agents exists. Idarucizumab has been shown to be safe and effective in the reversal of dabigatran-induced anticoagulation in patients requiring emergent

  1. Dual Fragment Impact of PBX Charges

    Science.gov (United States)

    Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

    2017-06-01

    Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

  2. Fragmentation of relativistic nuclei

    International Nuclear Information System (INIS)

    Cork, B.

    1975-06-01

    Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

  3. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  4. Land fragmentation and production diversification

    NARCIS (Netherlands)

    Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

    2018-01-01

    We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

  5. Heavy fragment radioactivity

    International Nuclear Information System (INIS)

    Silisteanu, I.

    1991-06-01

    The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

  6. Reversible Statistics

    DEFF Research Database (Denmark)

    Tryggestad, Kjell

    2004-01-01

    The study aims is to describe how the inclusion and exclusion of materials and calculative devices construct the boundaries and distinctions between statistical facts and artifacts in economics. My methodological approach is inspired by John Graunt's (1667) Political arithmetic and more recent work...... within constructivism and the field of Science and Technology Studies (STS). The result of this approach is here termed reversible statistics, reconstructing the findings of a statistical study within economics in three different ways. It is argued that all three accounts are quite normal, albeit...... in different ways. The presence and absence of diverse materials, both natural and political, is what distinguishes them from each other. Arguments are presented for a more symmetric relation between the scientific statistical text and the reader. I will argue that a more symmetric relation can be achieved...

  7. An improved algorithm for MFR fragment assembly

    International Nuclear Information System (INIS)

    Kontaxis, Georg

    2012-01-01

    A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.

  8. Compound nucleus studies withy reverse kinematics

    International Nuclear Information System (INIS)

    Moretto, L.G.

    1985-06-01

    Reverse kinematics reactions are used to demonstrate the compound nucleus origin of intermediate mass particles at low energies and the extension of the same mechanism at higher energies. No evidence has appeared in our energy range for liquid-vapor equilibrium or cold fragmentation mechanisms. 11 refs., 12 figs

  9. Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

    Science.gov (United States)

    Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

    2017-02-01

    A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Identification and characterization of a thermally cleaved fragment of monoclonal antibody-A detected by sodium dodecyl sulfate-capillary gel electrophoresis.

    Science.gov (United States)

    Kubota, Kei; Kobayashi, Naoki; Yabuta, Masayuki; Ohara, Motomu; Naito, Toyohiro; Kubo, Takuya; Otsuka, Koji

    2017-06-05

    This report describes a novel, comprehensive approach to identifying a fragment peak of monoclonal antibody-A (mAb-A), detected by sodium dodecyl sulfate-capillary gel electrophoresis (SDS-cGE). The fragment migrated close to the internal standard (10kDa marker) of SDS-cGE and increased about 0.5% under a 25°C condition for 6 months. Generally, identification of fragments observed in SDS-cGE is challenging to carry out due to the difficulty of collecting analytical amounts of fractionations from the capillary. In this study, in-gel digestion peptide mapping and reversed phase liquid chromatography-mass spectrometry (RPLC-MS) were employed to elucidate the structure of the fragment. In addition, a Gelfree 8100 fractionation system was newly introduced to collect the fragment and the fraction was applied to the structural analysis of a mAb for the first time. These three analytical methods showed comparable results, proving that the fragment was a fraction of heavy chain HC1-104. The fragment contained complementarity determining regions (CDRs), which are significant to antigen binding, and thus would affect the efficacy of mAb-A. In addition, SDS-cGE without the 10kDa marker was demonstrated to clarify the increased amount of the fragment, and the experiment revealed that the fragment increases 0.2% per year in storage at 5°C. The combination of the three analytical methodologies successfully identified the impurity peak detected by SDS-cGE, providing information critical to assuring the quality and stability of the biotherapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. PELE fragmentation dynamics

    NARCIS (Netherlands)

    Verreault, J.; Hinsberg, N.P. van; Abadjieva, E.

    2013-01-01

    An analytical model that describes the PELE fragmentation dynamics is presented and compared with experimental results from literature. The model accounts for strong shock effects and detailed interactions taking place between the filling – the inner core of the ammunition – and the target

  12. Cryobiology of coral fragments.

    Science.gov (United States)

    Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

    2013-02-01

    Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  14. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  15. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  16. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  17. The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

    Science.gov (United States)

    Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

    2013-01-01

    In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

  18. Sex Reversal in Birds.

    Science.gov (United States)

    Major, Andrew T; Smith, Craig A

    2016-01-01

    Sexual differentiation in birds is controlled genetically as in mammals, although the sex chromosomes are different. Males have a ZZ sex chromosome constitution, while females are ZW. Gene(s) on the sex chromosomes must initiate gonadal sex differentiation during embryonic life, inducing paired testes in ZZ individuals and unilateral ovaries in ZW individuals. The traditional view of avian sexual differentiation aligns with that expounded for other vertebrates; upon sexual differentiation, the gonads secrete sex steroid hormones that masculinise or feminise the rest of the body. However, recent studies on naturally occurring or experimentally induced avian sex reversal suggest a significant role for direct genetic factors, in addition to sex hormones, in regulating sexual differentiation of the soma in birds. This review will provide an overview of sex determination in birds and both naturally and experimentally induced sex reversal, with emphasis on the key role of oestrogen. We then consider how recent studies on sex reversal and gynandromorphic birds (half male:half female) are shaping our understanding of sexual differentiation in avians and in vertebrates more broadly. Current evidence shows that sexual differentiation in birds is a mix of direct genetic and hormonal mechanisms. Perturbation of either of these components may lead to sex reversal. © 2016 S. Karger AG, Basel.

  19. Predicting "Hot" and "Warm" Spots for Fragment Binding.

    Science.gov (United States)

    Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L

    2017-05-11

    Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .

  20. Fragman: an R package for fragment analysis.

    Science.gov (United States)

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  1. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...... made almost completely of still images, recounting the end of the world. These stills can be viewed as fragments that have survived the end of the world and now provide the only access to the events that occured. Shane Carruth's Primer has a different approach to time travel, the narrative diegesis...... that is presented; how do we understand such films and to what extent is it even possible to make sense of a film that has no real beginning, middle or end?...

  2. Fragmentation of atomic systems

    International Nuclear Information System (INIS)

    Bohn, J.L.; Fano, U.

    1996-01-01

    We report recent progress toward a nonperturbative formulation of many-body quantum dynamics that treats all constituent particles on an equal footing. This formulation is capable of detailing the evolution of a system toward the diverse fragments into which it can break up. We illustrate the general concept with the simple example of the simultaneous excitation of both electrons in a helium atom. copyright 1996 The American Physical Society

  3. Modelling the fragmentation mechanisms

    International Nuclear Information System (INIS)

    Bougault, R.; Durand, D.; Gulminelli, F.

    1998-01-01

    We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way

  4. Hot nuclei and fragmentation

    International Nuclear Information System (INIS)

    Guerreau, D.

    1993-01-01

    A review is made of the present status concerning the production of nuclei above 5 MeV temperature. Considerable progress has been made recently on the understanding of the formation and the fate of such hot nuclei. It appears that the nucleus seems more stable against temperature than predicted by static calculations. However, the occurrence of multifragment production at high excitation energies is now well established. The various experimental features of the fragmentation process are discussed. (author) 59 refs., 12 figs

  5. Excited nuclei fragmentation

    International Nuclear Information System (INIS)

    Ngo, C.

    1986-11-01

    Experimental indications leading to the thought of a very excited nucleus fragmentation are resumed. Theoretical approaches are briefly described; they are used to explain the phenomenon in showing off they are based on a minimum information principle. This model is based on time dependent Thomas-Fermi calculation which allows the mean field effect description, and with a site-bound percolation model which allows the fluctuation description [fr

  6. Periodicity and Immortality in Reversible Computing

    OpenAIRE

    Kari , Jarkko; Ollinger , Nicolas

    2008-01-01

    Additional material available on the web at http://www.lif.univ-mrs.fr/~nollinge/rec/gnirut/; We investigate the decidability of the periodicity and the immortality problems in three models of reversible computation: reversible counter machines, reversible Turing machines and reversible one-dimensional cellular automata. Immortality and periodicity are properties that describe the behavior of the model starting from arbitrary initial configurations: immortality is the property of having at le...

  7. Azimuthal Anisotropies in Nuclear Fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

    2002-01-01

    The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

  8. Universality of projectile fragmentation model

    International Nuclear Information System (INIS)

    Chaudhuri, G.; Mallik, S.; Das Gupta, S.

    2012-01-01

    Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

  9. Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

    Science.gov (United States)

    Dubinets, Nikita; Slipchenko, Lyudmila V

    2017-07-20

    Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

  10. Radio Frequency Fragment Separator at NSCL

    International Nuclear Information System (INIS)

    Bazin, D.; Andreev, V.; Becerril, A.; Doleans, M.; Mantica, P.F.; Ottarson, J.; Schatz, H.; Stoker, J.B.; Vincent, J.

    2009-01-01

    A new device has been designed and built at NSCL which provides additional filtering of radioactive beams produced via projectile fragmentation. The Radio Frequency Fragment Separator (RFFS) uses the time micro structure of the beams accelerated by the cyclotrons to deflect particles according to their time-of-flight, in effect producing a phase filtering. The transverse RF (Radio Frequency) electric field of the RFFS has superior filtering performance compared to other electrostatic devices, such as Wien filters. Such filtering is critical for radioactive beams produced on the neutron-deficient side of the valley of stability, where strong contamination occurs at intermediate energies from 50 to 200 MeV/u.

  11. An Archeology of Fragments

    Directory of Open Access Journals (Sweden)

    Gerald L. Bruns

    2014-10-01

    Full Text Available This is a short (fragmentary history of fragmentary writing from the German Romantics (F. W. Schlegel, Friedrich Hölderlin to modern and contemporary concrete or visual poetry. Such writing is (often deliberately a critique of the logic of subsumption that tries to assimilate whatever is singular and irreducible into totalities of various categorical or systematic sorts. Arguably, the fragment (parataxis is the distinctive feature of literary Modernism, which is a rejection, not of what precedes it, but of what Max Weber called “the rationalization of the world” (or Modernity whose aim is to keep everything, including all that is written, under surveillance and control.

  12. Positioning paper on reversibility

    International Nuclear Information System (INIS)

    2016-01-01

    After having recalled the legal framework adopted in 2006 for the deep geological storage of radioactive wastes, and briefly introduced the concept of reversibility, this publication presents the principle of geological storage, presents high and medium level and long life wastes, highlights the ethical necessity to deal with these radioactive wastes, outlines that geological storage is the generally admitted and adopted solution at the international level, and presents additional means implemented for radioactive waste management. It presents the Cigeo project as the technical answer to the issue of radioactive waste storage, describes the Cigeo development process, its current status and its development planning, and justifies the choice of this technical solution, notably from an ethical point of view. It addresses the issue of reversibility and proposes an overview of the various tools and means which aim at guaranteeing this reversibility. Appendices propose figures illustrating the Cigeo project and its development process, and a rather detailed Power Point presentation of the project by the ANDRA (history, object, planning, installations, and so on)

  13. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  14. Light fragment formation at intermediate energies

    International Nuclear Information System (INIS)

    Boal, D.H.

    1982-03-01

    This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model

  15. Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

    Science.gov (United States)

    Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

    2009-08-01

    For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

  16. Fragmented medial coronoid process

    International Nuclear Information System (INIS)

    Juhasz, Cs.; Juhasz, T.

    1997-01-01

    Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established

  17. Fractal statistics of brittle fragmentation

    Directory of Open Access Journals (Sweden)

    M. Davydova

    2013-04-01

    Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

  18. Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

    International Nuclear Information System (INIS)

    Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James

    2014-01-01

    In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

  19. Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

    Energy Technology Data Exchange (ETDEWEB)

    Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)

    2014-04-10

    In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

  20. Managing Reverse Logistics or Reversing Logistics Management?

    OpenAIRE

    Brito, Marisa

    2004-01-01

    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...

  1. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  2. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  3. MRI of displaced meniscal fragments

    Energy Technology Data Exchange (ETDEWEB)

    Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

    2012-01-15

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  4. Fuel fragmentation data review and separate effects testing

    International Nuclear Information System (INIS)

    Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.

    2014-01-01

    A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)

  5. Managing Reverse Logistics or Reversing Logistics Management?

    NARCIS (Netherlands)

    M.P. de Brito (Marisa)

    2004-01-01

    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse

  6. Thermodynamical string fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Nadine [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden); School of Physics and Astronomy, Monash University,Wellington Road, Clayton, VIC-3800 (Australia); Sjöstrand, Torbjörn [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden)

    2017-01-31

    The observation of heavy-ion-like behaviour in pp collisions at the LHC suggests that more physics mechanisms are at play than traditionally assumed. The introduction e.g. of quark-gluon plasma or colour rope formation can describe several of the observations, but as of yet there is no established paradigm. In this article we study a few possible modifications to the Pythia event generator, which describes a wealth of data but fails for a number of recent observations. Firstly, we present a new model for generating the transverse momentum of hadrons during the string fragmentation process, inspired by thermodynamics, where heavier hadrons naturally are suppressed in rate but obtain a higher average transverse momentum. Secondly, close-packing of strings is taken into account by making the temperature or string tension environment-dependent. Thirdly, a simple model for hadron rescattering is added. The effect of these modifications is studied, individually and taken together, and compared with data mainly from the LHC. While some improvements can be noted, it turns out to be nontrivial to obtain effects as big as required, and further work is called for.

  7. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  8. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

  9. Fracture mechanics model of fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

    1986-01-01

    A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

  10. Reversible Thermoset Adhesives

    Science.gov (United States)

    Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)

    2016-01-01

    Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.

  11. Fragmentation and structure of silicon microclusters

    International Nuclear Information System (INIS)

    Feuston, B.P.; Kalia, R.K.; Vashishta, P.

    1987-01-01

    It may be possible to determine the magic numbers and fragmentation spectra from the ground-state binding energies and structure, but the relationship between the lowest-energy zero-temperature configurations and the energetics of finite-temperature microclusters is not obvious. Recall fragmentation of Si clusters occurs at temperatures the order of the melting temperature (T∼2000 K). What is needed, a first-principles finite-temperature calculation, allowing the determination of all possible structures, their corresponding binding energies, and fragmentation spectra, is not presently possible. However, a molecular dynamics calculation does allow one to study the nature of fragmentation in addition to determination of the global ground-state structure and all mechanically stable configurations underlying the finite-temperature cluster, once given an interaction potential. The authors present results for such a calculation for Si/sub 2-14/ using the Stillinger-Weber 3-body potential. Their results indicate that the existence of magic numbers is determined by the topology and energetics of high-energy bound structures rather than the structure and ground-state energies at zero temperature

  12. Element Distribution and Multiplicity of Heavy Fragments

    CERN Multimedia

    2002-01-01

    This experiment will measure the energy and angular distribution of heavy fragments produced in the reactions of |1|2C on several targets between |2|7Al and |2|3|8U at 86~MeV/u. The systematic investigation of a highly excited interaction region (fireball) by means of a clean N and Z identification of heavy tar fragments, may result in a better understanding of temperature concept and of the degree of equilibration of the local interaction region with respect to the total system. For this investigation a large-area position sensitive ionization chamber of 50~msr solid angle in conjunction with a time-of-flight telescope consisting of parallel-plate detectors will be used. \\\\ \\\\ In order to get information on the transverse momentum transfer and the inelasticity of the collision, the energy of the PROJECTILE-FRAGMENTS will be measured at forward angles with a plastic scintillator hodoscope. In addition to this inclusive measurement correlations between heavy fragments will be investigated by means of three pos...

  13. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  14. Mass spectrometry for fragment screening.

    Science.gov (United States)

    Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

    2017-11-08

    Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  15. Fission fragment spins and spectroscopy

    International Nuclear Information System (INIS)

    Durell, J.L.

    1988-01-01

    Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

  16. Fragment-based drug design.

    Science.gov (United States)

    Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

    2011-01-01

    Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

  17. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  18. Kinetics of a Migration-Driven Aggregation-Fragmentation Process

    Institute of Scientific and Technical Information of China (English)

    ZHUANGYou-Yi; LINZhen-Quan; KEJian-Hon~

    2003-01-01

    We propose a reversible model of the migration-driven aggregation-fragmentation process with the symmetric migration rate kernels K (k; j) = K′(k; j) =λkjv and the constant aggregation rates I1, I2 and fragmentation rates Jl, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions in several cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When Jl = 0 and J2 = O, the aggregate size distributions αk(t) and bk(t) obey the conventional scaling law, while when Jl > 0 and J2 > O, they obey the modified scaling law with an exponential scaling function. The total mass of either species remains conserved.

  19. Tubal Ligation Reversal

    Science.gov (United States)

    ... seal off the fallopian tubes, such as the Essure or Adiana systems, generally aren't reversible. Why ... electrocautery). Some types of sterilization, such as the Essure or Adiana systems, aren't considered reversible. Risks ...

  20. Observation of different isoscaling behavior between emitted fragments and residues

    Energy Technology Data Exchange (ETDEWEB)

    Youngs, M., E-mail: mdyoungs@comp.tamu.edu [Cyclotron Institute, Texas A& M University, College Station, TX 77843 (United States); McIntosh, A.B.; Hagel, K. [Cyclotron Institute, Texas A& M University, College Station, TX 77843 (United States); Heilborn, L. [Cyclotron Institute, Texas A& M University, College Station, TX 77843 (United States); Chemistry Department, Texas A& M University, College Station, TX 77843 (United States); Huang, M. [Cyclotron Institute, Texas A& M University, College Station, TX 77843 (United States); Jedele, A.; Kohley, Z.; May, L.W. [Cyclotron Institute, Texas A& M University, College Station, TX 77843 (United States); Chemistry Department, Texas A& M University, College Station, TX 77843 (United States); McCleskey, E. [Cyclotron Institute, Texas A& M University, College Station, TX 77843 (United States); Zarrella, A.; Yennello, S.J. [Cyclotron Institute, Texas A& M University, College Station, TX 77843 (United States); Chemistry Department, Texas A& M University, College Station, TX 77843 (United States)

    2017-06-15

    The traditional isoscaling technique has been used to analyze all isotopically identified particles from {sup 70}Zn+{sup 70}Zn and {sup 64}Zn+{sup 64}Zn collisions at 35 MeV/u. Two additional techniques, using an energy-averaged ratio and using the data present in the tail of energy spectra, are compared to the traditional method and show similar results. Isoscaling fit parameters α and β are found both globally and for each individual series of constant Z and N. The data are then split up between emitted fragments and projectile-like fragments. Isoscaling values for the two different types of fragments are shown to be different, emphasizing the importance of experimentally distinguishing between projectile-like fragments and emitted fragments in order to achieve accurate isoscaling parameters.

  1. Reverse logistics - a framework

    NARCIS (Netherlands)

    M.P. de Brito (Marisa); R. Dekker (Rommert)

    2002-01-01

    textabstractIn this paper we define and compare Reverse Logistics definitions. We start by giving an understanding framework of Reverse Logistics: the why-what-how. By this means, we put in context the driving forces for Reverse Logistics, a typology of return reasons, a classification of

  2. Protein-Templated Fragment Ligations-From Molecular Recognition to Drug Discovery.

    Science.gov (United States)

    Jaegle, Mike; Wong, Ee Lin; Tauber, Carolin; Nawrotzky, Eric; Arkona, Christoph; Rademann, Jörg

    2017-06-19

    Protein-templated fragment ligation is a novel concept to support drug discovery and can help to improve the efficacy of protein ligands. Protein-templated fragment ligations are chemical reactions between small molecules ("fragments") utilizing a protein's surface as a reaction vessel to catalyze the formation of a protein ligand with increased binding affinity. The approach exploits the molecular recognition of reactive small-molecule fragments by proteins both for ligand assembly and for the identification of bioactive fragment combinations. In this way, chemical synthesis and bioassay are integrated in one single step. This Review discusses the biophysical basis of reversible and irreversible fragment ligations and gives an overview of the available methods to detect protein-templated ligation products. The chemical scope and recent applications as well as future potential of the concept in drug discovery are reviewed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Fragmentation functions approach in pQCD fragmentation phenomena

    International Nuclear Information System (INIS)

    Rolli, S.

    1996-07-01

    Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

  4. Reverse logistics: A review of case studies

    NARCIS (Netherlands)

    Brito, de M.P.; Dekker, Rommert; Flapper, S.D.P.; Fleischmann, B.; Klose, A.

    2004-01-01

    This paper gives an overview of scientific literature that describes and discusses cases of reverse logistics activities in practice. Over sixty case studies are considered. Based on these studies we are able to indicate critical factors for the practice of reverse logistics. In addition we compare

  5. A model for projectile fragmentation

    International Nuclear Information System (INIS)

    Chaudhuri, G; Mallik, S; Gupta, S Das

    2013-01-01

    A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

  6. Gamma Radiation from Fission Fragments

    International Nuclear Information System (INIS)

    Higbie, Jack

    1969-10-01

    The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass

  7. Gamma Radiation from Fission Fragments

    Energy Technology Data Exchange (ETDEWEB)

    Higbie, Jack

    1969-10-15

    The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.

  8. The spectroscopy of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

    1998-12-31

    High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

  9. The spectroscopy of fission fragments

    International Nuclear Information System (INIS)

    Phillips, W.R.

    1998-01-01

    High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

  10. Release and characteristics of fungal fragments in various conditions

    Energy Technology Data Exchange (ETDEWEB)

    Mensah-Attipoe, Jacob [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Saari, Sampo [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Veijalainen, Anna-Maria; Pasanen, Pertti [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Keskinen, Jorma [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Leskinen, Jari T.T. [SIB Labs, University of Eastern Finland, Yliopistonranta 1E, P. O. Box 1627, FI-70211, Kuopio (Finland); Reponen, Tiina, E-mail: reponeta@ucmail.uc.edu [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Department of Environmental Health, University of Cincinnati, P.O. Box 670056, Cincinnati, OH 45267-0056 (United States)

    2016-03-15

    Intact spores and submicrometer size fragments are released from moldy building materials during growth and sporulation. It is unclear whether all fragments originate from fungal growth or if small pieces of building materials are also aerosolized as a result of microbial decomposition. In addition, particles may be formed through nucleation from secondary metabolites of fungi, such as microbial volatile organic compounds (MVOCs). In this study, we used the elemental composition of particles to characterize the origin of submicrometer fragments released from materials contaminated by fungi. Particles from three fungal species (Aspergillus versicolor, Cladosporium cladosporioides and Penicillium brevicompactum), grown on agar, wood and gypsum board were aerosolized using the Fungal Spore Source Strength Tester (FSSST) at three air velocities (5, 16 and 27 m/s). Released spores (optical size, d{sub p} ≥ 0.8 μm) and fragments (d{sub p} ≤ 0.8 μm) were counted using direct-reading optical aerosol instruments. Particles were also collected on filters, and their morphology and elemental composition analyzed using scanning electron microscopes (SEMs) coupled with an Energy-Dispersive X-ray spectroscopy (EDX). Among the studied factors, air velocity resulted in the most consistent trends in the release of fungal particles. Total concentrations of both fragments and spores increased with an increase in air velocity for all species whereas fragment–spore (F/S) ratios decreased. EDX analysis showed common elements, such as C, O, Mg and Ca, for blank material samples and fungal growth. However, N and P were exclusive to the fungal growth, and therefore were used to differentiate biological fragments from non-biological ones. Our results indicated that majority of fragments contained N and P. Because we observed increased release of fragments with increased air velocities, nucleation of MVOCs was likely not a relevant process in the formation of fungal fragments. Based

  11. Rapid experimental SAD phasing and hot-spot identification with halogenated fragments

    Directory of Open Access Journals (Sweden)

    Joseph D. Bauman

    2016-01-01

    Full Text Available Through X-ray crystallographic fragment screening, 4-bromopyrazole was discovered to be a `magic bullet' that is capable of binding at many of the ligand `hot spots' found in HIV-1 reverse transcriptase (RT. The binding locations can be in pockets that are `hidden' in the unliganded crystal form, allowing rapid identification of these sites for in silico screening. In addition to hot-spot identification, this ubiquitous yet specific binding provides an avenue for X-ray crystallographic phase determination, which can be a significant bottleneck in the determination of the structures of novel proteins. The anomalous signal from 4-bromopyrazole or 4-iodopyrazole was sufficient to determine the structures of three proteins (HIV-1 RT, influenza A endonuclease and proteinase K by single-wavelength anomalous dispersion (SAD from single crystals. Both compounds are inexpensive, readily available, safe and very soluble in DMSO or water, allowing efficient soaking into crystals.

  12. The dynamics of fragment formation

    International Nuclear Information System (INIS)

    Keane, D.

    1994-09-01

    We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

  13. Chemical Production using Fission Fragments

    International Nuclear Information System (INIS)

    Dawson, J. K.; Moseley, F.

    1960-01-01

    Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

  14. QGP and Modified Jet Fragmentation

    International Nuclear Information System (INIS)

    Wang, Xin-Nian

    2005-01-01

    Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed

  15. Robust Object Tracking Using Valid Fragments Selection.

    Science.gov (United States)

    Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

    Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

  16. Recent progress on perturbative QCD fragmentation functions

    International Nuclear Information System (INIS)

    Cheung, K.

    1995-05-01

    The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

  17. Additive manufacturing.

    Science.gov (United States)

    Mumith, A; Thomas, M; Shah, Z; Coathup, M; Blunn, G

    2018-04-01

    Increasing innovation in rapid prototyping (RP) and additive manufacturing (AM), also known as 3D printing, is bringing about major changes in translational surgical research. This review describes the current position in the use of additive manufacturing in orthopaedic surgery. Cite this article: Bone Joint J 2018;100-B:455-60.

  18. Reversible flowchart languages and the structured reversible program theorem

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2008-01-01

    Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...

  19. Food additives

    Science.gov (United States)

    ... GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Food additives URL of this page: //medlineplus.gov/ency/article/ ...

  20. DNA labeled during phosphonoacetate inhibition and following its reversal in herpesvirus infected cells

    International Nuclear Information System (INIS)

    Jacob, R.J.

    1984-01-01

    Human embryonic lung cells were pre-equilibrated with phosphonoacetate and 32 P orthophosphate label, then infected with phosphonoacetate-sensitive herpes simplex virus (HSV) type 1. Analyses of viral DNA produced in these cells showed the following. i) Viral DNA was synthesized in infected cells exposed to 100 μg of the drug per ml of medium but not in cells exposed to four-fold higher concentrations of the drug. ii) At 300 μg/ml a region of the DNA between 0.58 and 0.69 map units became transiently labeled, but the restriction endonuclease fragment containing these sequences migrated more slowly than the corresponding fragment from virion DNA. iii) Viral DNA extracted from infected cells 1.5 hours post drug withdrawal (300 μg/ml) was preferentially labeled in 2 regions of the genome mapping between 0.17 and 0.23 and 0.58-0.69 map units. This finding is in agreement with a report of Friedman et al. suggesting that HSV DNA contains two different sites if initiation. In addition a 4.8 x 10 6 molecular weight fragment was also preferentially labeled. This fragment could represent a smaller, aberrantly migrating fragment from the 0.17-0.27 map unit region of the DNA. iv) Viral DNA extracted from infected cells at longer intervals after drug withdrawal showed an increasing gradient of radioactivity progressively labeling the genome. These results are consistent with the hypothesis that viral DNA has at least two sites of initiation of DNA synthesis and that both sites are within the L component of the DNA. Alternatively, the results could be interpreted as two sites of localized synthesis (repair) that are detected at high concentrations of phosphonoacetate and immediately following reversal of inhibition of DNA synthesis. The results do not exclude the possibility that secondary sites in both L and S are utilized late in infection or in untreated cells. (Author)

  1. Reverse logistics in the construction industry.

    Science.gov (United States)

    Hosseini, M Reza; Rameezdeen, Raufdeen; Chileshe, Nicholas; Lehmann, Steffen

    2015-06-01

    Reverse logistics in construction refers to the movement of products and materials from salvaged buildings to a new construction site. While there is a plethora of studies looking at various aspects of the reverse logistics chain, there is no systematic review of literature on this important subject as applied to the construction industry. Therefore, the objective of this study is to integrate the fragmented body of knowledge on reverse logistics in construction, with the aim of promoting the concept among industry stakeholders and the wider construction community. Through a qualitative meta-analysis, the study synthesises the findings of previous studies and presents some actions needed by industry stakeholders to promote this concept within the real-life context. First, the trend of research and terminology related with reverse logistics is introduced. Second, it unearths the main advantages and barriers of reverse logistics in construction while providing some suggestions to harness the advantages and mitigate these barriers. Finally, it provides a future research direction based on the review. © The Author(s) 2015.

  2. Introduction to reversible computing

    CERN Document Server

    Perumalla, Kalyan S

    2013-01-01

    Few books comprehensively cover the software and programming aspects of reversible computing. Filling this gap, Introduction to Reversible Computing offers an expanded view of the field that includes the traditional energy-motivated hardware viewpoint as well as the emerging application-motivated software approach. Collecting scattered knowledge into one coherent account, the book provides a compendium of both classical and recently developed results on reversible computing. It explores up-and-coming theories, techniques, and tools for the application of rever

  3. Reverse genetics with animal viruses. NSV reverse genetics

    International Nuclear Information System (INIS)

    Mebatsion, T.

    2005-01-01

    New strategies to genetically manipulate the genomes of several important animal pathogens have been established in recent years. This article focuses on the reverse genetics techniques, which enables genetic manipulation of the genomes of non-segmented negative-sense RNA viruses. Recovery of a negative-sense RNA virus entirely from cDNA was first achieved for rabies virus in 1994. Since then, reverse genetic systems have been established for several pathogens of medical and veterinary importance. Based on the reverse genetics technique, it is now possible to design safe and more effective live attenuated vaccines against important viral agents. In addition, genetically tagged recombinant viruses can be designed to facilitate serological differentiation of vaccinated animals from infected animals. The approach of delivering protective immunogens of different pathogens using a single vector was made possible with the introduction of the reverse genetics system, and these novel broad-spectrum vaccine vectors have potential applications in improving animal health in developing countries. (author)

  4. In silico fragment-based drug design.

    Science.gov (United States)

    Konteatis, Zenon D

    2010-11-01

    In silico fragment-based drug design (FBDD) is a relatively new approach inspired by the success of the biophysical fragment-based drug discovery field. Here, we review the progress made by this approach in the last decade and showcase how it complements and expands the capabilities of biophysical FBDD and structure-based drug design to generate diverse, efficient drug candidates. Advancements in several areas of research that have enabled the development of in silico FBDD and some applications in drug discovery projects are reviewed. The reader is introduced to various computational methods that are used for in silico FBDD, the fragment library composition for this technique, special applications used to identify binding sites on the surface of proteins and how to assess the druggability of these sites. In addition, the reader will gain insight into the proper application of this approach from examples of successful programs. In silico FBDD captures a much larger chemical space than high-throughput screening and biophysical FBDD increasing the probability of developing more diverse, patentable and efficient molecules that can become oral drugs. The application of in silico FBDD holds great promise for historically challenging targets such as protein-protein interactions. Future advances in force fields, scoring functions and automated methods for determining synthetic accessibility will all aid in delivering more successes with in silico FBDD.

  5. Fragment size distribution in viscous bag breakup of a drop

    Science.gov (United States)

    Kulkarni, Varun; Bulusu, Kartik V.; Plesniak, Michael W.; Sojka, Paul E.

    2015-11-01

    In this study we examine the drop size distribution resulting from the fragmentation of a single drop in the presence of a continuous air jet. Specifically, we study the effect of Weber number, We, and Ohnesorge number, Oh on the disintegration process. The regime of breakup considered is observed between 12 phase Doppler anemometry. Both the number and volume fragment size probability distributions are plotted. The volume probability distribution revealed a bi-modal behavior with two distinct peaks: one corresponding to the rim fragments and the other to the bag fragments. This behavior was suppressed in the number probability distribution. Additionally, we employ an in-house particle detection code to isolate the rim fragment size distribution from the total probability distributions. Our experiments showed that the bag fragments are smaller in diameter and larger in number, while the rim fragments are larger in diameter and smaller in number. Furthermore, with increasing We for a given Ohwe observe a large number of small-diameter drops and small number of large-diameter drops. On the other hand, with increasing Oh for a fixed We the opposite is seen.

  6. Fragmentation of rotating protostellar clouds

    International Nuclear Information System (INIS)

    Tohline, J.E.

    1980-01-01

    We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

  7. Repositioning the substrate activity screening (SAS) approach as a fragment-based method for identification of weak binders.

    Science.gov (United States)

    Gladysz, Rafaela; Cleenewerck, Matthias; Joossens, Jurgen; Lambeir, Anne-Marie; Augustyns, Koen; Van der Veken, Pieter

    2014-10-13

    Fragment-based drug discovery (FBDD) has evolved into an established approach for "hit" identification. Typically, most applications of FBDD depend on specialised cost- and time-intensive biophysical techniques. The substrate activity screening (SAS) approach has been proposed as a relatively cheap and straightforward alternative for identification of fragments for enzyme inhibitors. We have investigated SAS for the discovery of inhibitors of oncology target urokinase (uPA). Although our results support the key hypotheses of SAS, we also encountered a number of unreported limitations. In response, we propose an efficient modified methodology: "MSAS" (modified substrate activity screening). MSAS circumvents the limitations of SAS and broadens its scope by providing additional fragments and more coherent SAR data. As well as presenting and validating MSAS, this study expands existing SAR knowledge for the S1 pocket of uPA and reports new reversible and irreversible uPA inhibitor scaffolds. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Reversibility of female sterilization.

    Science.gov (United States)

    Siegler, A M; Hulka, J; Peretz, A

    1985-04-01

    The discussion considers the current status of reversibility of sterilization in the US and describes clinical and experimental efforts for developing techniques designed for reversibility. It focuses on regret following sterilization, reversal potential of current sterilization techniques, patient selection, current reversal techniques, results of sterilization procedures, experimental approaches to reversal of current techniques of sterilization, and sterilization procedures devised for reversibility, in humans and in animals. Request is the 1st stage of reversal, but a request for sterilization reversal (SR) does not always mean regret for a decision made at the time. Frequently it is a wish to restore fertility because life circumstances have changed after a sterilization that was ppropriate at the time it was performed. Schwyhart and Kutner reviewed 22 studies published between 1949-69 in which they found that the percentage of patients regretting the procedure ranged from 1.3-15%. Requests for reversal remain low in most countries, but if sterilization becomes a more popular method of contraception, requests will also increase. The ideal operation considered as a reversaible method of sterilization should include an easy, reliable outpatient method of tubal occlusion with miniml risk or patient discomfort that subsequently could be reversed without the need for a major surgical intervention. Endoscopic methods have progressed toward the 1st objective. A recent search of the literature uncovered few series of SR of more than 50 cases. The 767 operations found were analyzed with regard to pregnancy outcome. The precent of live births varied from 74-78.8%, and the occurance of tubal pregnancies ranged from 1.7-6.5%. All of the confounding variables in patient selection and small numbers of reported procedures preclude any conclusion about the different techniques or the number of operations that give a surgeon a level of expertise. Few authors classify their

  9. Memory effects in nuclear fragmentation?

    International Nuclear Information System (INIS)

    Colonna, M.; Di Toro, M.; Guarnera, A.

    1994-01-01

    A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))

  10. Fragmentation properties of 6Li

    International Nuclear Information System (INIS)

    Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

    1987-01-01

    The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

  11. Hands as markers of fragmentation

    Directory of Open Access Journals (Sweden)

    A. Barnard

    2005-07-01

    Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

  12. Dynamics of fragments and associated phenomena in heavy-ion collisions using a modified secondary algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Rohit [Department of Physics, Panjab University, Chandigarh-160014 (India)

    2016-05-06

    We discuss the stability of fragments identified by secondary algorithms used to construct fragments within quantum molecular dynamics model. For this purpose we employ three different algorithms for fragment identification. 1) The conventional minimum spanning tree (MST) method based on the spatial correlations, 2) an improved version of MST with additional binding energy constraints of cold nuclear matter, 3) and that of hot matter. We find significant role of thermal binding energies over cold matter binding energies. Significant role is observed for fragment multiplicities and stopping of fragments. Whereas insignificant effect is observed on fragment’s flow.

  13. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Baur, G.; Roesel, F.; Trautmann, D.; Shyam, R.

    1983-10-01

    Fragmentation processes in nuclear collisions are reviewed. The main emphasis is put on light ion breakup at nonrelativistic energies. The post- and prior-form DWBA theories are discussed. The post-form DWBA, appropriate for the ''spectator breakup'' describes elastic as well as inelastic breakup modes. This theory can also account for the stripping to unbound states. The theoretical models are compared to typical experimental results to illustrate the various possible mechanisms. It is discussed, how breakup reactions can be used to study high-lying single particle strength in the continuum; how it can yield information about momentum distributions of fragments in the nucleus. (orig.)

  14. Refolding Technologies for Antibody Fragments

    Directory of Open Access Journals (Sweden)

    Tsutomu Arakawa

    2014-05-01

    Full Text Available Refolding is one of the production technologies for pharmaceutical grade antibody fragments. Detergents and denaturants are primarily used to solubilize the insoluble proteins. The solubilized and denatured proteins are refolded by reducing the concentration of the denaturants or detergents. Several refolding technologies have been used for antibody fragments, comprising dilution, dialysis, solid phase solvent exchange and size exclusion chromatography, as reviewed here. Aggregation suppressor or folding-assisting agents, including arginine hydrochloride, ionic liquids and detergents or denaturants at low concentrations, are included in the refolding solvent to enhance refolding yield.

  15. High-energy nuclear reaction mechanisms - fission, fragmentation and spallation

    International Nuclear Information System (INIS)

    Kaufman, S.B.

    1987-01-01

    Measurements of the correlations in kinetic energy, mass, charge, and angle of coincident fragments formed in high-energy nuclear reactions have helped to characterize the processes of fission, fragmentation and spallation. For example, fission or fission-like two-body breakup mechanisms result in a strong angular correlation between two heavy fragments; in addition, the momentum transfer in the reaction can be deduced from the correlation. Another example is the multiplicity of light charged particles associated with a given heavy fragment, which is a measure of the violence of the collision, thus distinguishing between central and peripheral collisions. A summary of what has been learned about these processes from such studies will be given, along with some suggestions for further experiments

  16. Quantum reverse hypercontractivity

    Energy Technology Data Exchange (ETDEWEB)

    Cubitt, Toby [Department of Computer Science, University College London, London, United Kingdom and Centre for Quantum Information and Foundations, DAMTP, University of Cambridge, Cambridge (United Kingdom); Kastoryano, Michael [NBIA, Niels Bohr Institute, University of Copenhagen, 2100 Copenhagen (Denmark); Montanaro, Ashley [School of Mathematics, University of Bristol, Bristol (United Kingdom); Temme, Kristan [Institute for Quantum Information and Matter, California Institute of Technology, Pasadena, California 91125 (United States)

    2015-10-15

    We develop reverse versions of hypercontractive inequalities for quantum channels. By generalizing classical techniques, we prove a reverse hypercontractive inequality for tensor products of qubit depolarizing channels. We apply this to obtain a rapid mixing result for depolarizing noise applied to large subspaces and to prove bounds on a quantum generalization of non-interactive correlation distillation.

  17. Atrioventricular Pacemaker Lead Reversal

    Directory of Open Access Journals (Sweden)

    Mehmet K Aktas, MD

    2007-01-01

    Full Text Available During cardiac surgery temporary epicardial atrial and ventricular leads are placed in case cardiac pacing is required postoperatively. We present the first reported series of patients with reversal of atrioventricular electrodes in the temporary pacemaker without any consequent deleterious hemodynamic effect. We review the electrocardiographic findings and discuss the findings that lead to the discovery of atrioventricular lead reversal.

  18. Reversible modulation of CsPbBr3 perovskite nanocrystal/gold nanoparticle heterostructures.

    Science.gov (United States)

    Chen, Shanshan; Lyu, Danya; Ling, Tao; Guo, Weiwei

    2018-04-19

    A facile strategy is illustrated to reversibly modulate CsPbBr3 perovskite nanocrystal/Au nanoparticle heterostructures with the reversible formation and fragmentation of gold nanoparticles anchored to the corners and surface of CsPbBr3 perovskite nanocrystals. The modulation process was performed under ambient conditions and could be conducted for cycles.

  19. Fragmentation of atomic clusters: A theoretical study

    International Nuclear Information System (INIS)

    Lopez, M.J.; Jellinek, J.

    1994-01-01

    Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

  20. Fragmentation of cluster ions produced by electron impact ionization

    International Nuclear Information System (INIS)

    Parajuli, R.

    2001-12-01

    By studying fragmentation of dimer and cluster ions produced by electron impact ionization of a neutral cluster beam, it is possible to elucidate structure, stability and energetics of these species and the dynamics of the corresponding decay reactions. Fragmentation of carbon cluster ions formed from C 6 0 fullerenes, rare gas cluster ions and dimer ions and simple molecular cluster ions (oxygen and nitrogen) and dimer ions have been studied in this thesis using a high resolution two sector field mass spectrometer of reversed geometry and a NIER type electron impact ion source. Spontaneous decay reactions of triply and quadruply charged C 4 0 z + and C 4 1 z + cluster ions which are formed from C 6 0 fullerenes by electron impact ionization have been analyzed. A new but very weak decay reaction for the even-sized carbon clusters ions is observed, namely loss of C 3 . The odd-sized clusters ions preferentially decay by loss of carbon atoms and, to a lesser degree, trimers. A weak signal due to C 2 loss is observed for C 4 1 3 + ion. These decay channels are discussed in terms of the geometric structure of these metastable, relatively cold cluster ions. Measurements on metastable fragmentation of mass selected rare gas cluster ions (Ne, Ar, Kr) which are produced by electron impact ionization of a neutral rare gas cluster beam have been carried out. From the shape of the fragment ion peaks (MIKE scan technique) information about the distribution of kinetic energy that is released in the decay reaction can be deduced. In this study, the peak shape observed for cluster ions with sizes larger than five is Gaussian and thus from the peak width the mean kinetic energy release of the corresponding decay reactions can be calculated. Using finite heat bath theory, the binding energies of the decaying cluster ions are calculated from these data and have been compared to data in the literature where available. In addition to the decay reactions of cluster ions the metastable

  1. Nuclear energy release from fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)

    2016-08-15

    It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

  2. Fission fragment driven neutron source

    Science.gov (United States)

    Miller, Lowell G.; Young, Robert C.; Brugger, Robert M.

    1976-01-01

    Fissionable uranium formed into a foil is bombarded with thermal neutrons in the presence of deuterium-tritium gas. The resulting fission fragments impart energy to accelerate deuterium and tritium particles which in turn provide approximately 14 MeV neutrons by the reactions t(d,n).sup.4 He and d(t,n).sup.4 He.

  3. Developments in SPR Fragment Screening.

    Science.gov (United States)

    Chavanieu, Alain; Pugnière, Martine

    2016-01-01

    Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

  4. Nuclear fragmentation by nucleation approach

    International Nuclear Information System (INIS)

    Chung, K.C.

    1992-01-01

    The nucleation model is used to simulate nuclear fragmentation processes. The critical value of the effective interaction radius is shown to vary linearly with the expansion factor α. The calculated mass and charge distributions are compared with some experimental data. (author)

  5. Neutron multiplicity of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Abdelrahman, Y S [Physics department, mu` rah university Al-Karak, (Jordan)

    1995-10-01

    The total average neutron multiplicity of the fission fragments produced by the spontaneous fission of {sup 248} Cm has been measured. This measurement has been done by using a new experimental technique. This technique mainly depends on {gamma}-{gamma} coincidence using a very high resolution high purity germanium (HPGe) detector. 2 figs.

  6. Fragmented nature: consequences for biodiversity

    NARCIS (Netherlands)

    Olff, H.; Ritchie, M.E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  7. Fragmented nature : consequences for biodiversity

    NARCIS (Netherlands)

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  8. Research of nuclear fragmentation characteristics

    International Nuclear Information System (INIS)

    Richert, J.

    1989-01-01

    Motivations for the study of nuclear fragmentation are presented. Different models and methods which were developed in the past are reviewed, critically discussed and confronted in connection with the experimental information gathered over the past years. Specific aspects related to the onset of the process, its characteristics and the mechanism which governs it are discussed [fr

  9. FRAGMENTED IDENTITIES: THE CULTURAL COLLISION ...

    African Journals Online (AJOL)

    User

    Born in the former French and German colony of. Togo, Komla-Ebri ... of how cultural barriers not only lead to isolation and fragmented identities, but also ..... and, in recreating bits of Italy, in the form of music, cinema and food, absorbs parts of ...

  10. Phthalocyanides sensitized fragmentation of proteins

    Czech Academy of Sciences Publication Activity Database

    Klementová, S.; Tothová, D.; Revaková, R.; Kasková, M.; Wagnerová, Dana Marie

    2001-01-01

    Roč. 5, č. 1 (2001), s. 13-18 ISSN 0972-0626 R&D Projects: GA ČR GA203/96/1322 Institutional research plan: CEZ:AV0Z4032918 Keywords : phthalocyanides * photosensitied fragmentation of proteins Subject RIV: CA - Inorganic Chemistry

  11. Constraining the reversing and non-reversing modes of the geodynamo. New insights from magnetostratigraphy.

    Science.gov (United States)

    Gallet, Y.; Pavlov, V.; Shatsillo, A.; Hulot, G.

    2015-12-01

    Constraining the evolution in the geomagnetic reversal frequency over hundreds of million years is not a trivial matter. Beyond the fact that there are long periods without reversals, known as superchrons, and periods with many reversals, the way the reversal frequency changes through time during reversing periods is still debated. A smooth evolution or a succession of stationary segments have both been suggested to account for the geomagnetic polarity time scale since the Middle-Late Jurassic. Sudden changes from a reversing mode to a non-reversing mode of the geodynamo may also well have happened, the switch between the two modes having then possibly been controlled by the thermal conditions at the core-mantle boundary. There is, nevertheless, a growing set of magnetostratigraphic data, which could help decipher a proper interpretation of the reversal history, in particular in the early Paleozoic and even during the Precambrian. Although yielding a fragmentary record, these data reveal the occurrence of both additional superchrons and periods characterized by extremely high, not to say extraordinary, magnetic reversal frequencies. In this talk, we will present a synthesis of these data, mainly obtained from Siberia, and discuss their implication for the magnetic reversal behavior over the past billion years.

  12. The AT-Hook motif as a versatile minor groove anchor for promoting DNA binding of transcription factor fragments? ?Electronic supplementary information (ESI) available: Peptide synthesis, full experimental procedures and analytical data of the peptides and products obtained. See DOI: 10.1039/c5sc01415h Click here for additional data file.

    OpenAIRE

    Rodr?guez, J?ssica; Mosquera, Jes?s; Couceiro, Jose R.; V?zquez, M. Eugenio; Mascare?as, Jos? L.

    2015-01-01

    We report the development of chimeric DNA binding peptides comprising a DNA binding fragment of natural transcription factors (the basic region of a bZIP protein or a monomeric zinc finger module) and an AT-Hook peptide motif. The resulting peptide conjugates display high DNA affinity and excellent sequence selectivity. Furthermore, the AT-Hook motif also favors the cell internalization of the conjugates.

  13. The VERDI fission fragment spectrometer

    Directory of Open Access Journals (Sweden)

    Frégeau M.O.

    2013-12-01

    Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.

  14. Trend towards reverse leach process

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    The South African gold mining industry is making notable strides in improving recovery methods for both gold and uranium with significant additions to profits because of higher efficiencies and reductions in costs in the recovery processes. The most notable step on the gold side recently is the adoption of the reverse leach process at Buffelsfontein and Western Deep Levels. This process was pioneered at Hartebeesfontein as far back as 1975 and when introduced there resulted in a two and a half per cent improvement in recovery efficiencies. The essence of reverse leaching under which the uranium is recovered before the gold is the fact that the gold partly coated with iron oxide or locked in uranite, is exposed to be recovered later by cyanidation

  15. Kinetics of a Migration-Driven Aggregation-Fragmentation Process

    Institute of Scientific and Technical Information of China (English)

    ZHUANG You-Yi; LIN Zhen-Quan; KE Jian-Hong

    2003-01-01

    We propose a reversible model of the migration-driven aggregation-fragmentation process with the sym-metric migration rate kernels K(k;j) = K'(k;j) = λkjv and the constant aggregation rates I1, I2 and fragmentationrates J1, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions inseveral cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When J1 = 0 and J2 = 0, the aggregate sizedistributions ak(t) and bk(t) obey the conventional scaling law, while when J1 > 0 and J2 > 0, they obey the modifiedscaling law with an exponential scaling function. The total mass of either species remains conserved.

  16. Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

    International Nuclear Information System (INIS)

    Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

    1983-01-01

    Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

  17. An algebra of reversible computation.

    Science.gov (United States)

    Wang, Yong

    2016-01-01

    We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.

  18. Elastic least-squares reverse time migration

    KAUST Repository

    Feng, Zongcai; Schuster, Gerard T.

    2016-01-01

    Elastic least-squares reverse time migration (LSRTM) is used to invert synthetic particle-velocity data and crosswell pressure field data. The migration images consist of both the P- and Svelocity perturbation images. Numerical tests on synthetic and field data illustrate the advantages of elastic LSRTM over elastic reverse time migration (RTM). In addition, elastic LSRTM images are better focused and have better reflector continuity than do the acoustic LSRTM images.

  19. SLE local martingales, reversibility and duality

    Energy Technology Data Exchange (ETDEWEB)

    Kytoelae, Kalle; Kemppainen, Antti [Department of Mathematics and Statistics, PO Box 68, FIN-00014 University of Helsinki (Finland)

    2006-11-17

    We study Schramm-Loewner evolutions (SLEs) reversibility and duality using the Virasoro structure of the space of local martingales. For both problems we formulate a setup where the questions boil down to comparing two processes at a stopping time. We state algebraic results showing that local martingales for the processes have enough in common. When one has in addition integrability, the method gives reversibility and duality for any polynomial expected value. (letter to the editor)

  20. SLE local martingales, reversibility and duality

    International Nuclear Information System (INIS)

    Kytoelae, Kalle; Kemppainen, Antti

    2006-01-01

    We study Schramm-Loewner evolutions (SLEs) reversibility and duality using the Virasoro structure of the space of local martingales. For both problems we formulate a setup where the questions boil down to comparing two processes at a stopping time. We state algebraic results showing that local martingales for the processes have enough in common. When one has in addition integrability, the method gives reversibility and duality for any polynomial expected value. (letter to the editor)

  1. Elastic least-squares reverse time migration

    KAUST Repository

    Feng, Zongcai

    2016-09-06

    Elastic least-squares reverse time migration (LSRTM) is used to invert synthetic particle-velocity data and crosswell pressure field data. The migration images consist of both the P- and Svelocity perturbation images. Numerical tests on synthetic and field data illustrate the advantages of elastic LSRTM over elastic reverse time migration (RTM). In addition, elastic LSRTM images are better focused and have better reflector continuity than do the acoustic LSRTM images.

  2. Modified Borohydrides for Reversible Hydrogen Storage (2)

    International Nuclear Information System (INIS)

    Ming Au

    2006-01-01

    This paper reports the results in the effort to destabilize lithium borohydride for reversible hydrogen storage. A number of metals, metal hydrides, metal chlorides and complex hydrides were selected and evaluated as the destabilization agents for reducing de-hydriding temperature and generating de-hydriding-re-hydriding reversibility. It is found that some additives are effective. The Raman spectroscopic analysis shows the change of B-H binding nature. (authors)

  3. Fragmentation of the medial malleolus of dogs with and without tarsal osteochondrosis

    International Nuclear Information System (INIS)

    Newell, S.M.; Mahaffey, M.B.; Aron, D.N.

    1994-01-01

    Fragmentation of the medial malleolus of the tibia was found radiographically in 5 canine tarsi which did not have evidence of osteochondrosis of the medial trochlear ridge. An additional 5 tarsi were found where both medial malleolar fragmentation and osteochondrosis of the medial trochlear ridge were present. Radiographic evidence of degenerative joint disease was present in 3 of 5 dogs with medial malleolar fragmentation alone, and 5 of 5 dogs with medial malleolar fragmentation and medial trochlear ridge osteochondrosis. Eight of the 9 dogs were Rottweilers. Considering the sites of occurrence of osteochondrosis in other species, the authors propose that medial malleolar fragmentation could be secondary to osteochondrosis of the medial malleolus. Osteochondrosis of the medial malleolus has not been previously reported in dogs. Histological examination of the medial malleolar fragmentation was unavailable because surgery was not performed, therefore the hypothesis that the medial malleolar fragmentation is due to osteochondrosis was not proven

  4. Fragments

    Science.gov (United States)

    Moreira, Claudio

    2008-01-01

    This performance autoethnography shows the author's struggle in finding his place, scholarship, voice, and body, into the academic setting. Mixing together memories of his lived experience with sugar cane workers, notes, and leftovers of different fieldworks, plus 6 years of life as grad student at the University of Illinois, the author looks for…

  5. Fragmentation

    Science.gov (United States)

    K.H. Riitters

    2009-01-01

    Effective resource management takes into account the administrative and biophysical settings within which natural resources occur. A setting may be described in many ways; for example, by forest land ownership, by reserved and roadless designation, or by the distribution of human populations in relation to forest (chapter 3). The physical arrangement of forest in a...

  6. The biokinetics of uranium migrating from embedded DU fragments

    International Nuclear Information System (INIS)

    Leggett, R.W.; Pellmar, T.C.

    2003-01-01

    Military uses of depleted uranium (DU) munitions have resulted in casualties with embedded DU fragments. Assessment of radiological or chemical health risks from these fragments requires a model relating urinary U to the rate of migration of U from the fragments, and its accumulation in systemic tissues. A detailed biokinetic model for U has been published by the International Commission on Radiological Protection (ICRP), but its applicability to U migrating from embedded DU fragments is uncertain. Recently, ) conducted a study at the Armed Forces Radiobiology Research Institute (AFRRI) on the redistribution and toxicology of U in rats with implanted DU pellets, simulating embedded fragments. This paper compares the biokinetic data from that study with the behavior of commonly studied forms of U in rats (e.g., intravenously injected U nitrate). The comparisons indicate that the biokinetics of U migrating from embedded DU is similar to that of commonly studied forms of U with regard to long-term accumulation in kidneys, bone, and liver. The results provide limited support for the application of the ICRP's model to persons with embedded DU fragments. Additional information is needed with regard to the short-term behavior of migrating U and its accumulation in lymph nodes, brain, testicles, and other infrequently studied U repositories

  7. Fragment-based drug discovery using rational design.

    Science.gov (United States)

    Jhoti, H

    2007-01-01

    Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.

  8. Sex reversal in vertebrates

    OpenAIRE

    2016-01-01

    This special topic issue of Sexual Development gives an overview of sex reversal in vertebrates, from fishes naturally changing their sex, to rodents escaping the mammalian SRY-determining system. It offers eight up-to-date reviews on specific subjects in sex reversal, considering fishes, amphibians, reptiles, birds, marsupials, and placental mammals, including humans. The broad scope of represented animals makes this ideal for students and researchers, especially those interested in the...

  9. Energy production using fission fragment rockets

    International Nuclear Information System (INIS)

    Chapline, G.; Matsuda, Y.

    1991-08-01

    Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

  10. Fragmentation of suddenly heated liquids

    International Nuclear Information System (INIS)

    Blink, J.A.

    1985-03-01

    Fragmentation of free liquids in Inertial Confinement Fusion reactors could determine the upper bound on reactor pulse rate. The x-ray ablated materials must cool and recondense to allow driver beam propagation. The increased surface area caused by fragmentation will enhance the cooling and condensation rates. Relaxation from the suddenly heated state will move a liquid into the negative pressure region under the liquid-vapor P-V dome. The lithium equation of state was used to demonstrate that neutron-induced vaporization uses only a minor fraction of the added heat, much less than would be required to drive the expansion. A 77% expansion of the lithium is required before the rapid vaporization process of spinodal decomposition could begin, and nucleation and growth are too slow to contribute to the expansion

  11. Fragment separator momentum compression schemes

    Energy Technology Data Exchange (ETDEWEB)

    Bandura, Laura, E-mail: bandura@anl.gov [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Erdelyi, Bela [Argonne National Laboratory, Argonne, IL 60439 (United States); Northern Illinois University, DeKalb, IL 60115 (United States); Hausmann, Marc [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Kubo, Toshiyuki [RIKEN Nishina Center, RIKEN, Wako (Japan); Nolen, Jerry [Argonne National Laboratory, Argonne, IL 60439 (United States); Portillo, Mauricio [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Sherrill, Bradley M. [National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States)

    2011-07-21

    We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.

  12. Fragment separator momentum compression schemes

    International Nuclear Information System (INIS)

    Bandura, Laura; Erdelyi, Bela; Hausmann, Marc; Kubo, Toshiyuki; Nolen, Jerry; Portillo, Mauricio; Sherrill, Bradley M.

    2011-01-01

    We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.

  13. Asymmetry effects in fragment production

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Manpreet [Sri Guru Granth Sahib World University, Fatehgarh Sahib-140406, Punjab (India); Kaur, Varinderjit, E-mail: drvarinderjit@gmail.com [Mata Gujri College, Fatehgarh Sahib-140406, Punjab (India)

    2016-05-06

    The production of different fragments has been studied by taking into account the mass asymmetry of the reaction and employing the momentum dependent interactions. Two different set of asymmetric reactions have been analyzed while keeping At{sub otal} fixed using soft momentum dependent equation of state. Our results indicate that the impact of momentum dependent interactions is different in lighter projectile systems as compared to heavier ones. The comparative analysis of IQMD simulations with the experimental data in case of heavier projectile and lighter target system for the reaction of {sup 197}Au+{sup 27}Al (η = 0.7) at E = 600 MeV/nucleon shows that with the inclusion of MDI we are able, upto some extent, to reproduce the experimental universality of rise and fall of intermediate mass fragments (IMFs).

  14. Fragmented nature: consequences for biodiversity

    OpenAIRE

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species with different size and mobility can be regulated by different processes at the same spatial scale, a principle that may contribute to diversity. Differences in species richness between local commu...

  15. On thermodynamic and microscopic reversibility

    International Nuclear Information System (INIS)

    Crooks, Gavin E

    2011-01-01

    The word 'reversible' has two (apparently) distinct applications in statistical thermodynamics. A thermodynamically reversible process indicates an experimental protocol for which the entropy change is zero, whereas the principle of microscopic reversibility asserts that the probability of any trajectory of a system through phase space equals that of the time reversed trajectory. However, these two terms are actually synonymous: a thermodynamically reversible process is microscopically reversible, and vice versa

  16. Intermittency in 197Au fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Holynski, R.; Olszewski, A.; Szarska, M.; Wilczynska, B.; Wolter, W.; Wosiek, B.; Cherry, M.L.; Deines-Jones, P.; Jones, W.V.; Sengupta, K.; Wefel, B.

    1995-07-01

    The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs

  17. Residual Fragments after Percutaneous Nephrolithotomy

    Directory of Open Access Journals (Sweden)

    Kaan Özdedeli

    2012-09-01

    Full Text Available Clinically insignificant residual fragments (CIRFs are described as asymptomatic, noninfectious and nonobstructive stone fragments (≤4 mm remaining in the urinary system after the last session of any intervention (ESWL, URS or PCNL for urinary stones. Their insignificance is questionable since CIRFs could eventually become significant, as their presence may result in recurrent stone growth and they may cause pain and infection due to urinary obstruction. They may become the source of persistent infections and a significant portion of the patients will have a stone-related event, requiring auxilliary interventions. CT seems to be the ultimate choice of assessment. Although there is no concensus about the timing, recent data suggests that it may be performed one month after the procedure. However, imaging can be done in the immediate postoperative period, if there are no tubes blurring the assessment. There is some evidence indicating that selective medical therapy may have an impact on decreasing stone formation rates. Retrograde intrarenal surgery, with its minimally invasive nature, seems to be the best way to deal with residual fragments.

  18. Fragmentation measurement using image processing

    Directory of Open Access Journals (Sweden)

    Farhang Sereshki

    2016-12-01

    Full Text Available In this research, first of all, the existing problems in fragmentation measurement are reviewed for the sake of its fast and reliable evaluation. Then, the available methods used for evaluation of blast results are mentioned. The produced errors especially in recognizing the rock fragments in computer-aided methods, and also, the importance of determination of their sizes in the image analysis methods are described. After reviewing the previous work done, an algorithm is proposed for the automated determination of rock particles’ boundary in the Matlab software. This method can determinate automatically the particles boundary in the minimum time. The results of proposed method are compared with those of Split Desktop and GoldSize software in two automated and manual states. Comparing the curves extracted from different methods reveals that the proposed approach is accurately applicable in measuring the size distribution of laboratory samples, while the manual determination of boundaries in the conventional software is very time-consuming, and the results of automated netting of fragments are very different with the real value due to the error in separation of the objects.

  19. Geometrical scaling of jet fragmentation photons

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)

    2016-12-15

    We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.

  20. Site Identification by Ligand Competitive Saturation (SILCS) Simulations for Fragment-Based Drug Design

    OpenAIRE

    Faller, Christina E.; Raman, E. Prabhu; MacKerell, Alexander D.; Guvench, Olgun

    2015-01-01

    Fragment-based drug design (FBDD) involves screening low molecular weight molecules (“fragments”) that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind non-overlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR ...

  1. Evolution equations for extended dihadron fragmentation functions

    International Nuclear Information System (INIS)

    Ceccopieri, F.A.; Bacchetta, A.

    2007-03-01

    We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)

  2. Polarization and alignment of nucleus fission fragments

    International Nuclear Information System (INIS)

    Barabanov, A.L.; Grechukhin, D.P.

    1987-01-01

    Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists

  3. Improvements to a model of projectile fragmentation

    International Nuclear Information System (INIS)

    Mallik, S.; Chaudhuri, G.; Das Gupta, S.

    2011-01-01

    In a recent paper [Phys. Rev. C 83, 044612 (2011)] we proposed a model for calculating cross sections of various reaction products which arise from disintegration of projectile-like fragments resulting from heavy-ion collisions at intermediate or higher energy. The model has three parts: (1) abrasion, (2) disintegration of the hot abraded projectile-like fragment (PLF) into nucleons and primary composites using a model of equilibrium statistical mechanics, and (3) possible evaporation of hot primary composites. It was assumed that the PLF resulting from abrasion has one temperature T. Data suggested that, while just one value of T seemed adequate for most cross-section calculations, a single value failed when dealing with very peripheral collisions. We have now introduced a variable T=T(b) where b is the impact parameter of the collision. We argue that there are data which not only show that T must be a function of b but, in addition, also point to an approximate value of T for a given b. We propose a very simple formula: T(b)=D 0 +D 1 [A s (b)/A 0 ] where A s (b) is the mass of the abraded PLF and A 0 is the mass of the projectile; D 0 and D 1 are constants. Using this model we compute cross sections for several collisions and compare with data.

  4. Reversible Communicating Processes

    Directory of Open Access Journals (Sweden)

    Geoffrey Brown

    2016-02-01

    Full Text Available Reversible distributed programs have the ability to abort unproductive computation paths and backtrack, while unwinding communication that occurred in the aborted paths. While it is natural to assume that reversibility implies full state recovery (as with traditional roll-back recovery protocols, an interesting alternative is to separate backtracking from local state recovery. For example, such a model could be used to create complex transactions out of nested compensable transactions where a programmer-supplied compensation defines the work required to "unwind" a transaction. Reversible distributed computing has received considerable theoretical attention, but little reduction to practice; the few published implementations of languages supporting reversibility depend upon a high degree of central control. The objective of this paper is to demonstrate that a practical reversible distributed language can be efficiently implemented in a fully distributed manner. We discuss such a language, supporting CSP-style synchronous communication, embedded in Scala. While this language provided the motivation for the work described in this paper, our focus is upon the distributed implementation. In particular, we demonstrate that a "high-level" semantic model can be implemented using a simple point-to-point protocol.

  5. Photon-hadron fragmentation: theoretical situation

    International Nuclear Information System (INIS)

    Peschanski, R.

    1983-07-01

    Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

  6. Scaling and critical behaviour in nuclear fragmentation

    International Nuclear Information System (INIS)

    Campi, X.

    1990-09-01

    These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling

  7. Remarks about the hypothesis of limiting fragmentation

    International Nuclear Information System (INIS)

    Chou, T.T.; Yang, C.N.

    1987-01-01

    Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

  8. Quark fragmentation in e+e- collisions

    International Nuclear Information System (INIS)

    Oddone, P.

    1984-12-01

    This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

  9. Self-organized criticality in fragmenting

    DEFF Research Database (Denmark)

    Oddershede, L.; Dimon, P.; Bohr, J.

    1993-01-01

    The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

  10. Neighbouring charge fragmentations in low energy fission

    International Nuclear Information System (INIS)

    Montoya, M.

    1986-10-01

    Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs

  11. Reverse cope elimination of hydroxylamines and alkenes or alkynes: theoretical investigation of tether length and substituent effects.

    Science.gov (United States)

    Krenske, Elizabeth H; Davison, Edwin C; Forbes, Ian T; Warner, Jacqueline A; Smith, Adrian L; Holmes, Andrew B; Houk, K N

    2012-02-01

    Quantum mechanical calculations have been used to study the intramolecular additions of hydroxylamines to alkenes and alkynes ("reverse Cope eliminations"). In intermolecular reverse Cope eliminations, alkynes are more reactive than alkenes. However, competition experiments have shown that tethering the hydroxylamine to the alkene or alkyne can reverse the reactivity order from that normally observed. The exact outcome depends on the length of the tether. In agreement with experiment, a range of density functional theory methods and CBS-QB3 calculations predict that the activation energies for intramolecular reverse Cope eliminations follow the order 6-exo-dig hydroxylamine and alkyne. Cyclization onto an alkene in the 5-exo-trig fashion incurs slightly less tether strain than a 6-exo-dig alkyne cyclization, but its activation energy is higher because the hydroxylamine fragment must distort more before the TS is reached. If the alkene terminus is substituted with two methyl groups, the barrier becomes so much higher that it is also disfavored compared to the 5- and 7-exo-dig cyclizations. © 2012 American Chemical Society

  12. The Reverse Cope Elimination of Hydroxylamines and Alkenes or Alkynes: Theoretical Investigation of Tether Length and Substituent Effects

    Science.gov (United States)

    Krenske, Elizabeth H.; Davison, Edwin C.; Forbes, Ian T.; Warner, Jacqueline A.; Smith, Adrian L.; Holmes, Andrew B.; Houk, K. N.

    2012-01-01

    Quantum mechanical calculations have been used to study the intramolecular additions of hydroxylamines to alkenes and alkynes (“reverse Cope eliminations”). In intermolecular reverse Cope eliminations, alkynes are more reactive than alkenes. However, competition experiments have shown that tethering the hydroxylamine to the alkene or alkyne can reverse the reactivity order from that normally observed. The exact outcome depends on the length of the tether. In agreement with experiment, a range of density functional theory methods and CBS-QB3 calculations predict that the activation energies for intramolecular reverse Cope eliminations follow the order 6-exo-dig hydroxylamine and alkyne. Cyclization onto an alkene in the 5-exo-trig fashion incurs slightly less tether strain than a 6-exo-dig alkyne cyclization, but its activation energy is higher because the hydroxylamine fragment must distort more before the TS is reached. If the alkene terminus is substituted with two methyl groups, the barrier becomes so much higher that it is also disfavored compared to the 5- and 7-exo-dig cyclizations. PMID:22280245

  13. Monoclonal antibody fragment removal mediated by mixed mode resins.

    Science.gov (United States)

    O'Connor, Ellen; Aspelund, Matthew; Bartnik, Frank; Berge, Mark; Coughlin, Kelly; Kambarami, Mutsa; Spencer, David; Yan, Huiming; Wang, William

    2017-05-26

    Efforts to increase monoclonal antibody expression in cell culture can result in the presence of fragmented species requiring removal in downstream processing. Capto adhere, HEA Hypercel, and PPA Hypercel anion exchange/hydrophobic interaction mixed mode resins were evaluated for their fragment removal capabilities and found to separate large hinge IgG1 antibody fragment (LHF) from monomer. Removal of greater than 75% of LHF population occurred at pH 8 and low conductivity. The mechanism of fragment removal was investigated in two series of experiments. The first experimental series consisted of comparison to chromatographic behavior on corresponding single mode resins. Both single mode anion exchange and hydrophobic interaction resins failed to separate LHF. The second experimental series studied the impact of phase modifiers, ethylene glycol, urea, and arginine on the mixed mode mediated removal. The addition of ethylene glycol decreased LHF removal by half. Further decreases in LHF separation were seen upon incubation with urea and arginine. Therefore, it was discovered that the purification is the result of a mixed mode phenomena dominated by hydrophobic interaction and hydrogen bonding effects. The site of interaction between the LHF and mixed mode resin was determined by chemical labeling of lysine residues with sulfo-NHS acetate. The labeling identified the antibody hinge and light chain regions as mediating the fragment separation. Sequence analysis showed that under separation conditions, a hydrophobic proline patch and hydrogen bonding serine and threonine residues mediate the hinge interaction with the Capto adhere ligand. Additionally, a case study is presented detailing the optimization of fragment removal using Capto adhere resin to achieve purity and yield targets in a manufacturing facility. This study demonstrated that mixed mode resins can be readily integrated into commercial antibody platform processes when additional chromatographic abilities

  14. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    Science.gov (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  15. Economic impact of reversion

    International Nuclear Information System (INIS)

    2005-01-01

    Estimations of the Norwegian hydropower production and various reversion models' market value have been made. The value of the Norwegian hydropower production until 01.01.2007 is estimated to about Nok 289 billion after taxes, or about 2,42 Nok/kWh medium production, given an expected future electricity price of around 0,25 Nok/kWh and a discount rate at 6,5 percent in nominal terms after taxes. The estimate is slightly above the level of prices for Norwegian hydropower plants in the last 8-10 years. The value of reversion in private plants which today have a limited licence time is estimated to Nok 5,5 billion. The value of reversion in public-owned Norwegian hydropower plants are about Nok 21 billion with a 60 year licence period from 01.01.2007, and about 12 billion for 75 years (ml)

  16. Reversible deep disposal

    International Nuclear Information System (INIS)

    2009-10-01

    This presentation, given by the national agency of radioactive waste management (ANDRA) at the meeting of October 8, 2009 of the high committee for the nuclear safety transparency and information (HCTISN), describes the concept of deep reversible disposal for high level/long living radioactive wastes, as considered by the ANDRA in the framework of the program law of June 28, 2006 about the sustainable management of radioactive materials and wastes. The document presents the social and political reasons of reversibility, the technical means considered (containers, disposal cavities, monitoring system, test facilities and industrial prototypes), the decisional process (progressive development and blocked off of the facility, public information and debate). (J.S.)

  17. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  18. Fission fragment excited laser system

    Science.gov (United States)

    McArthur, David A.; Tollefsrud, Philip B.

    1976-01-01

    A laser system and method for exciting lasing action in a molecular gas lasing medium which includes cooling the lasing medium to a temperature below about 150 K and injecting fission fragments through the lasing medium so as to preferentially excite low lying vibrational levels of the medium and to cause population inversions therein. The cooled gas lasing medium should have a mass areal density of about 5 .times. 10.sup.-.sup.3 grams/square centimeter, relaxation times of greater than 50 microseconds, and a broad range of excitable vibrational levels which are excitable by molecular collisions.

  19. Fragment emission from modestly excited nuclear systems

    Energy Technology Data Exchange (ETDEWEB)

    Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

    1996-07-08

    Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

  20. Velocity distribution of fragments of catastrophic impacts

    Science.gov (United States)

    Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

    1992-01-01

    Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

  1. Tooth fragment reattachment techniques-A systematic review.

    Science.gov (United States)

    Garcia, Fernanda Cristina P; Poubel, Déborah L N; Almeida, Júlio César F; Toledo, Isabela P; Poi, Wilson R; Guerra, Eliete N S; Rezende, Liliana V M L

    2018-03-07

    Several strategies have been developed for tooth fragment reattachment following fracture. Although many techniques have been reported, there is no consensus on which one has the best results in terms of the bond strength between the fragment and the dentin over time. The aim of this study was to assess the currently reported tooth fragment reattachment techniques for fractured crowns of anterior teeth. The PubMed, LILACS, Web of Science, Cochrane, and Scopus databases were searched in October 2016, and the search was updated in February 2017. A search of the gray literature was performed in Google Scholar and OpenGrey. Reference lists of eligible studies were cross-checked to identify additional studies; gray literature and ongoing trials were investigated. Two authors assessed studies to determine inclusion and undertook data extraction. Case reports/series of three or more cases, cross-sectional studies, cohort studies, and in vivo clinical trials in all languages were included. Five articles remained after screening. These studies predominantly reported on fragment reattachment with composite resin and resin cement. There was little consistency among the studies in regard to the technique used for tooth fragment reattachment and length of the follow-up period. According to the evidence found in the studies included in this review, simple tooth fragment reattachment was the preferred reattachment technique. An increase in the bond strength between tooth fragment and dentin was observed when an intermediate material was used. Further investigation is needed, using standard follow-up periods and larger samples. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Models of fragmentation with composite power laws

    Science.gov (United States)

    Tavassoli, Z.; Rodgers, G. J.

    1999-06-01

    Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

  3. Extraction of 16th Century Calender Fragments

    DEFF Research Database (Denmark)

    Holck, Jakob Povl; Etheridge, Christian

    at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

  4. Reframing landscape fragmentation's effects on ecosystem services.

    Science.gov (United States)

    Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

    2015-04-01

    Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Neutralisation and binding of VHS virus by monovalent antibody fragments

    DEFF Research Database (Denmark)

    Cupit, P.M.; Lorenzen, Niels; Strachan, G.

    2001-01-01

    We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...

  6. Oxidative stress induces mitochondrial fragmentation in frataxin-deficient cells

    Energy Technology Data Exchange (ETDEWEB)

    Lefevre, Sophie [Mitochondria, Metals and Oxidative Stress Laboratory, Institut Jacques Monod, CNRS-Universite Paris-Diderot, Sorbonne Paris Cite, 15 rue Helene Brion, 75205 Paris cedex 13 (France); ED515 UPMC, 4 place Jussieu 75005 Paris (France); Sliwa, Dominika [Mitochondria, Metals and Oxidative Stress Laboratory, Institut Jacques Monod, CNRS-Universite Paris-Diderot, Sorbonne Paris Cite, 15 rue Helene Brion, 75205 Paris cedex 13 (France); Rustin, Pierre [Inserm, U676, Physiopathology and Therapy of Mitochondrial Disease Laboratory, 75019 Paris (France); Universite Paris-Diderot, Faculte de Medecine Denis Diderot, IFR02 Paris (France); Camadro, Jean-Michel [Mitochondria, Metals and Oxidative Stress Laboratory, Institut Jacques Monod, CNRS-Universite Paris-Diderot, Sorbonne Paris Cite, 15 rue Helene Brion, 75205 Paris cedex 13 (France); Santos, Renata, E-mail: santos.renata@ijm.univ-paris-diderot.fr [Mitochondria, Metals and Oxidative Stress Laboratory, Institut Jacques Monod, CNRS-Universite Paris-Diderot, Sorbonne Paris Cite, 15 rue Helene Brion, 75205 Paris cedex 13 (France)

    2012-02-10

    Highlights: Black-Right-Pointing-Pointer Yeast frataxin-deficiency leads to increased proportion of fragmented mitochondria. Black-Right-Pointing-Pointer Oxidative stress induces complete mitochondrial fragmentation in {Delta}yfh1 cells. Black-Right-Pointing-Pointer Oxidative stress increases mitochondrial fragmentation in patient fibroblasts. Black-Right-Pointing-Pointer Inhibition of mitochondrial fission in {Delta}yfh1 induces oxidative stress resistance. -- Abstract: Friedreich ataxia (FA) is the most common recessive neurodegenerative disease. It is caused by deficiency in mitochondrial frataxin, which participates in iron-sulfur cluster assembly. Yeast cells lacking frataxin ({Delta}yfh1 mutant) showed an increased proportion of fragmented mitochondria compared to wild-type. In addition, oxidative stress induced complete fragmentation of mitochondria in {Delta}yfh1 cells. Genetically controlled inhibition of mitochondrial fission in these cells led to increased resistance to oxidative stress. Here we present evidence that in yeast frataxin-deficiency interferes with mitochondrial dynamics, which might therefore be relevant for the pathophysiology of FA.

  7. Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

    Science.gov (United States)

    Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

    2016-05-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

  8. Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

    Science.gov (United States)

    Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

    2016-01-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

  9. Thermosensory reversal effect quantified

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2008-01-01

    At room temperature, some materials feel colder than others due to differences in thermal conductivity, heat capacity and geometry. When the ambient temperature is well above skin temperature, the roles of 'cold' and 'warm' materials are reversed. In this paper, this effect is quantified by

  10. Thermosensory reversal effect quantified

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2008-01-01

    At room temperature, some materials feel colder than others due to differences in thermal conductivity, heat capacity and geometry. When the ambient temperature is well above skin temperature, the roles of ‘cold’ and ‘warm’ materials are reversed. In this paper, this effect is quantified by

  11. Time reversal communication system

    Science.gov (United States)

    Candy, James V.; Meyer, Alan W.

    2008-12-02

    A system of transmitting a signal through a channel medium comprises digitizing the signal, time-reversing the digitized signal, and transmitting the signal through the channel medium. The channel medium may be air, earth, water, tissue, metal, and/or non-metal.

  12. Engineering Encounters: Reverse Engineering

    Science.gov (United States)

    McGowan, Veronica Cassone; Ventura, Marcia; Bell, Philip

    2017-01-01

    This column presents ideas and techniques to enhance your science teaching. This month's issue shares information on how students' everyday experiences can support science learning through engineering design. In this article, the authors outline a reverse-engineering model of instruction and describe one example of how it looked in our fifth-grade…

  13. Elastomers with Reversible Nanoporosity

    DEFF Research Database (Denmark)

    Szewczykowski, Piotr Przemyslaw; Andersen, K.; Schulte, Lars

    2009-01-01

    nanostructure and displays liquid-filled cavities. Upon several cycles of swelling and drying the cavities open and close in a reversible fashion. When exposed to a nonsolvent, the material remains collapsed. This discriminating behavior of liquid-material interaction holds potential for the use...

  14. Revisiting the Lund Fragmentation Model

    International Nuclear Information System (INIS)

    Andersson, B.; Nilsson, A.

    1992-10-01

    We present a new method to implement the Lund Model fragmentation distributions for multi-gluon situations. The method of Sjoestrand, implemented in the well-known Monte Carlo simulation program JETSET, is robust and direct and according to his findings there are no observable differences between different ways to implement his scheme. His method can be described as a space-time method because the breakup proper time plays a major role. The method described in this paper is built on energy-momentum space methods. We make use of the χ-curve, which is defined directly from the energy momentum vectors of the partons. We have shown that the χ-curve describes the breakup properties and the final state energy momentum distributions in the mean. We present a method to find the variations around the χ-curve, which also implements the basic Lund Model fragmentation distributions (the area-law and the corresponding iterative cascade). We find differences when comparing the corresponding Monte Carlo implementation REVJET to the JETSET distributions inside the gluon jets. (au)

  15. Fragmentation of organic ions bearing fixed multiple charges observed in MALDI MS.

    Science.gov (United States)

    Lou, Xianwen; Li, Bao; de Waal, Bas F M; Schill, Jurgen; Baker, Matthew B; Bovee, Ralf A A; van Dongen, Joost L J; Milroy, Lech-Gustav; Meijer, E W

    2018-01-01

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF MS) was used to analyze a series of synthetic organic ions bearing fixed multiple charges. Despite the multiple intrinsic charges, only singly charged ions were recorded in each case. In addition to the pseudo-molecular ions formed by counterion adduction, deprotonation and electron capture, a number of fragment ions were also observed. Charge splitting by fragmentation was found to be a viable route for charge reduction leading to the formation of the observed singly charged fragment ions. Unlike multivalent metal ions, organic ions can rearrange and/or fragment during charge reduction. This fragmentation process will evidently complicate the interpretation of the MALDI MS spectrum. Because MALDI MS is usually considered as a soft ionization technique, the fragment ion peaks can easily be erroneously interpreted as impurities. Therefore, the awareness and understanding of the underlying MALDI-induced fragmentation pathways is essential for a proper interpretation of the corresponding mass spectra. Due to the fragment ions generated during charge reduction, special care should be taken in the MALDI MS analysis of multiply charged ions. In this work, the possible mechanisms by which the organic ions bearing fixed multiple charges fragment are investigated. With an improved understanding of the fragmentation mechanisms, MALDI TOF MS should still be a useful technique for the characterization of organic ions with fixed multiple charges. Copyright © 2017 John Wiley & Sons, Ltd.

  16. Label free fragment screening using surface plasmon resonance as a tool for fragment finding - analyzing parkin, a difficult CNS target.

    Directory of Open Access Journals (Sweden)

    Karin Regnström

    Full Text Available Surface Plasmon Resonance (SPR is rarely used as a primary High-throughput Screening (HTS tool in fragment-based approaches. With SPR instruments becoming increasingly high-throughput it is now possible to use SPR as a primary tool for fragment finding. SPR becomes, therefore, a valuable tool in the screening of difficult targets such as the ubiquitin E3 ligase Parkin. As a prerequisite for the screen, a large number of SPR tests were performed to characterize and validate the active form of Parkin. A set of compounds was designed and used to define optimal SPR assay conditions for this fragment screen. Using these conditions, more than 5000 pre-selected fragments from our in-house library were screened for binding to Parkin. Additionally, all fragments were simultaneously screened for binding to two off target proteins to exclude promiscuous binding compounds. A low hit rate was observed that is in line with hit rates usually obtained by other HTS screening assays. All hits were further tested in dose responses on the target protein by SPR for confirmation before channeling the hits into Nuclear Magnetic Resonance (NMR and other hit-confirmation assays.

  17. Coincidence study of alpha particle fragmentation at E/sub alpha/ = 140 MeV

    International Nuclear Information System (INIS)

    Koontz, R.W.

    1980-01-01

    Results of an experimental study of the interaction of 140 MeV alpha particles with 90 Zr nuclei resulting in fragmentation of the alpha particle are reported. The experimental observations of the study are analyzed and are found to show that alpha particle breakup reactions leading to at least 4-body final states, composed of two charged alpha particle fragments, contribute significantly to the singles yield of charged fragments observed at a fixed forward angle. The conclusions are based on coincidence measurements where one charged fragment is detected at a small forward angle which remains fixed, while the second charged fragment is detected at a series of coplanar secondary angles. The largest coincidence charged particle yield for the multiparticle final state events results from 90 Zr(α,pp)X reactions, where both of the measured protons have energy distributions similar to the proton singles energy distributions. The second largest observed coincidence yield involving two charged fragments arises from 90 Zr(α,pd)X reactions, where the p and d fragments, as in the 90 Zr(α,pp)X reactions also have energy distribution similar to the singles energy distributions. Analysis of additional measurements, where alpha particle fragments at the fixed angle are detected in coincidence with evaporation and nonequilibrium particles at many coplanar angles, show that the alpha particle fragmentation reactions are also generally associated with large energy transfer to the target nucleus. A multiple scattering model of the fragmentation reaction is employed, in conjunction with the experimental observations, to estimate the cross sections for alpha particle fragmentation into multi-particle final states resulting in n, 2n, p, pp, d, dn, dp, t and 3 He fragments. The estimated total cross section for all fragmentation reactions is 755 mb or approximately 38% of the total reaction cross section for 140 MeV alpha particle interactions with 90 Zr

  18. Knowledge-based Fragment Binding Prediction

    Science.gov (United States)

    Tang, Grace W.; Altman, Russ B.

    2014-01-01

    Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

  19. Fragmentation of Ceramics in Rapid Expansion Mode

    Science.gov (United States)

    Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

    The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

  20. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

    Science.gov (United States)

    Arora, Shagun; Tandon, Simran

    2015-01-01

    In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  1. Dynamic effects in fragmentation reactions

    International Nuclear Information System (INIS)

    Bertsch, G. F.; Esbensen, H.

    2002-01-01

    Fragmentation reactions offer a useful tool to study the spectroscopy of halo nuclei, but the large extent of the halo wave function makes the reaction theory more difficult. The simple reaction models based on the eikonal approximation for the nuclear interaction or first-order perturbation theory for the Coulomb interaction have systematic errors that they investigate here, comparing to the predictions of complete dynamical calculations. They find that stripping probabilities are underpredicted by the eikonal model, leading to extracted spectroscopy strengths that are two large. In contrast, the Coulomb excitation is overpredicted by the simple theory. They attribute this to a screening effect, as is well known in the Barkas effect on stopping powers. The errors decrease with beam energy as E(sub beam)(sup -1), and are not significant at beam energies above 50 MeV/u. At lower beam energies, the effects should be taken into account when extracting quantitative spectroscopic strengths

  2. Long-term carbon loss in fragmented Neotropical forests.

    Science.gov (United States)

    Pütz, Sandro; Groeneveld, Jürgen; Henle, Klaus; Knogge, Christoph; Martensen, Alexandre Camargo; Metz, Markus; Metzger, Jean Paul; Ribeiro, Milton Cezar; de Paula, Mateus Dantas; Huth, Andreas

    2014-10-07

    Tropical forests play an important role in the global carbon cycle, as they store a large amount of carbon (C). Tropical forest deforestation has been identified as a major source of CO2 emissions, though biomass loss due to fragmentation--the creation of additional forest edges--has been largely overlooked as an additional CO2 source. Here, through the combination of remote sensing and knowledge on ecological processes, we present long-term carbon loss estimates due to fragmentation of Neotropical forests: within 10 years the Brazilian Atlantic Forest has lost 69 (±14) Tg C, and the Amazon 599 (±120) Tg C due to fragmentation alone. For all tropical forests, we estimate emissions up to 0.2 Pg C y(-1) or 9 to 24% of the annual global C loss due to deforestation. In conclusion, tropical forest fragmentation increases carbon loss and should be accounted for when attempting to understand the role of vegetation in the global carbon balance.

  3. Reversed field pinch diagnostics

    International Nuclear Information System (INIS)

    Weber, P.G.

    1986-01-01

    The Reversed Field Pinch (RFP) is a toroidal, axisymmetric magnetic confinement configuration characterized by a magnetic field configuration in which the toroidal magnetic field is of similar strength to the poloidal field, and is reversed at the edge compared to the center. The RFP routinely operates at high beta, and is a strong candidate for a compact fusion device. Relevant attributes of the configuration will be presented, together with an overview of present and planned experiments and their diagnostics. RFP diagnostics are in many ways similar to those of other magnetic confinement devices (such as tokamaks); these lectures will point out pertinent differences, and will present some diagnostics which provide special insights into unique attributes of the RFP

  4. Posterior Reversible Encephalopathy (PRES)

    International Nuclear Information System (INIS)

    Moron E, Fanny E; Diaz Marchan, Pedro

    2005-01-01

    The Posterior Reversible Encephalopathy Syndrome (PRES) is a clinical Syndrome composed of cephalea, alteration in vision and convulsions, usually observed in patients with sudden elevation of arterial pressure. The imagenologic evidence shows reversible vasogenic brain edema without stroke. Its location is predominantly posterior; it affects the cortex and the subcortical white matter of the occipital, parietal and temporal lobes. The treatment with antihypertensive drugs and the removing of immunosupressor medication are generally associated with complete neurological recovery; this is reflected also in the images which return to their basal condition. The untreated hypertension, on the other side, can result in a progressive defect of the autoregulation system of the central nervous system with cerebral hemorrhage, irreversible brain stroke, coma and death

  5. Impact failure and fragmentation properties of metals

    Energy Technology Data Exchange (ETDEWEB)

    Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)

    1998-03-01

    In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

  6. Fragmentation and flow in central collisions

    International Nuclear Information System (INIS)

    Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

    1987-01-01

    Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

  7. Fragmentation Pathways of Lithiated Hexose Monosaccharides

    Science.gov (United States)

    Abutokaikah, Maha T.; Frye, Joseph W.; Tschampel, John; Rabus, Jordan M.; Bythell, Benjamin J.

    2018-05-01

    We characterize the primary fragmentation reactions of three isomeric lithiated D-hexose sugars (glucose, galactose, and mannose) utilizing tandem mass spectrometry, regiospecific labeling, and theory. We provide evidence that these three isomers populate similar fragmentation pathways to produce the abundant cross-ring cleavage peaks (0,2A1 and 0,3A1). These pathways are highly consistent with the prior literature (Hofmeister et al. J. Am. Chem. Soc. 113, 5964-5970, 1991, Bythell et al. J. Am. Soc. Mass Spectrom. 28, 688-703, 2017, Rabus et al. Phys. Chem. Chem. Phys. 19, 25643-25652, 2017) and the present labeling data. However, the structure-specific energetics and rate-determining steps of these reactions differ as a function of precursor sugar and anomeric configuration. The lowest energy water loss pathways involve loss of the anomeric oxygen to furnish B1 ions. For glucose and galactose, the lithiated α-anomers generate ketone structures at C2 in a concerted reaction involving a 1,2-migration of the C2-H to the anomeric carbon (C1). In contrast, the β-anomers are predicted to form 1,3-anhydroglucose/galactose B1 ion structures. Initiation of the water loss reactions from each anomeric configuration requires distinct reactive conformers, resulting in different product ion structures. Inversion of the stereochemistry at C2 has marked consequences. Both lithiated mannose forms expel water to form 1,2-anhydromannose B1 ions with the newly formed epoxide group above the ring. Additionally, provided water loss is not instantaneous, the α-anomer can also isomerize to generate a ketone structure at C2 in a concerted reaction involving a 1,2-migration of the C2-H to C1. This product is indistinguishable to that from α-glucose. The energetics and interplay of these pathways are discussed. [Figure not available: see fulltext.

  8. Reversible infantile mitochondrial diseases.

    Science.gov (United States)

    Boczonadi, Veronika; Bansagi, Boglarka; Horvath, Rita

    2015-05-01

    Mitochondrial diseases are usually severe and progressive conditions; however, there are rare forms that show remarkable spontaneous recoveries. Two homoplasmic mitochondrial tRNA mutations (m.14674T>C/G in mt-tRNA(Glu)) have been reported to cause severe infantile mitochondrial myopathy in the first months of life. If these patients survive the first year of life by extensive life-sustaining measures they usually recover and develop normally. Another mitochondrial disease due to deficiency of the 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU) causes severe liver failure in infancy, but similar to the reversible mitochondrial myopathy, within the first year of life these infants may also recover completely. Partial recovery has been noted in some other rare forms of mitochondrial disease due to deficiency of mitochondrial tRNA synthetases and mitochondrial tRNA modifying enzymes. Here we summarize the clinical presentation of these unique reversible mitochondrial diseases and discuss potential molecular mechanisms behind the reversibility. Understanding these mechanisms may provide the key to treatments of potential broader relevance in mitochondrial disease, where for the majority of the patients no effective treatment is currently available.

  9. Computational Fragment-Based Drug Design: Current Trends, Strategies, and Applications.

    Science.gov (United States)

    Bian, Yuemin; Xie, Xiang-Qun Sean

    2018-04-09

    Fragment-based drug design (FBDD) has become an effective methodology for drug development for decades. Successful applications of this strategy brought both opportunities and challenges to the field of Pharmaceutical Science. Recent progress in the computational fragment-based drug design provide an additional approach for future research in a time- and labor-efficient manner. Combining multiple in silico methodologies, computational FBDD possesses flexibilities on fragment library selection, protein model generation, and fragments/compounds docking mode prediction. These characteristics provide computational FBDD superiority in designing novel and potential compounds for a certain target. The purpose of this review is to discuss the latest advances, ranging from commonly used strategies to novel concepts and technologies in computational fragment-based drug design. Particularly, in this review, specifications and advantages are compared between experimental and computational FBDD, and additionally, limitations and future prospective are discussed and emphasized.

  10. Complex fragment emission from hot compound nuclei

    International Nuclear Information System (INIS)

    Moretto, L.G.

    1986-03-01

    The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs

  11. Fragment Size Distribution of Blasted Rock Mass

    Science.gov (United States)

    Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

    2017-12-01

    Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

  12. Fragmentation of neck-like structures

    International Nuclear Information System (INIS)

    Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

    1994-01-01

    Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

  13. Tunable, Quantitative Fenton-RAFT Polymerization via Metered Reagent Addition.

    Science.gov (United States)

    Nothling, Mitchell D; McKenzie, Thomas G; Reyhani, Amin; Qiao, Greg G

    2018-05-10

    A continuous supply of radical species is a key requirement for activating chain growth and accessing quantitative monomer conversions in reversible addition-fragmentation chain transfer (RAFT) polymerization. In Fenton-RAFT, activation is provided by hydroxyl radicals, whose indiscriminate reactivity and short-lived nature poses a challenge to accessing extended polymerization times and quantitative monomer conversions. Here, an alternative Fenton-RAFT procedure is presented, whereby radical generation can be finely controlled via metered dosing of a component of the Fenton redox reaction (H 2 O 2 ) using an external pumping system. By limiting the instantaneous flux of radicals and ensuring sustained radical generation over tunable time periods, metered reagent addition reduces unwanted radical "wasting" reactions and provides access to consistent quantitative monomer conversions with high chain-end fidelity. Fine tuning of radical concentration during polymerization is achieved simply via adjustment of reagent dose rate, offering significant potential for automation. This modular strategy holds promise for extending traditional RAFT initiation toward more tightly regulated radical concentration profiles and affords excellent prospects for the automation of Fenton-RAFT polymerization. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Fragment-based approaches to TB drugs.

    Science.gov (United States)

    Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris

    2018-02-01

    Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.

  15. Gluon fragmentation in T(1S) decays

    International Nuclear Information System (INIS)

    Bienlein, J.K.

    1983-05-01

    In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)

  16. Kinetics of fragmentation-annihilation processes

    OpenAIRE

    Filipe, JAN; Rodgers, GJ

    1996-01-01

    We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

  17. Status of time reversal invariance

    International Nuclear Information System (INIS)

    Henley, E.M.

    1989-01-01

    Time Reversal Invariance is introduced, and theories for its violation are reviewed. The present experimental and theoretical status of Time Reversal Invariance and tests thereof will be presented. Possible future tests will be discussed. 30 refs., 2 figs., 1 tab

  18. Introduction to time reversal theory

    International Nuclear Information System (INIS)

    Henley, E.M.

    1987-01-01

    Theory and reaction mechanisms relevant to time reversal invariance are reviewed. Consequences of time reversal invariance are presented under the headings of CP tests, electromagnetic moments, weak emissions or absorptions, and scattering reactions. 8 refs., 4 figs

  19. Model of fragmentation of limestone particles during thermal shock and calcination in fluidised beds

    Energy Technology Data Exchange (ETDEWEB)

    Saastamoinen, J.; Pikkarainen, T.; Tourunen, A.; Rasanen, M.; Jantti, T. [VTT Technical Research Center, Jyvaskyla (Finland)

    2008-11-15

    Fragmentation of limestone due to thermal shock and calcination in a fluidised bed was studied through experiments and modelling. The time for heating was estimated by model calculations and the time for calcination by measurements. Fragmentation due to thermal shock was carried out by experiments in a CO{sub 2} atmosphere in order to prevent the effect of calcination. It was found to be much less than fragmentation due to calcination. Average particle sizes before and after fragmentation are presented for several types of limestone. The effects of particle size and gas composition on the primary fragmentation were studied through experiments. Increasing the fluidisation velocity increased the tendency to fragment. The evolution of the particle size distribution (PSD) of limestone particles due to thermal shock and during calcination (or simultaneous calcination and sulphation) were calculated using a population balance model. Fragmentation due to thermal shock is treated as an instantaneous process. The fragmentation frequency during calcination is presented as exponentially decaying over time. In addition to the final PSD, this model also predicts the PSD during the calcination process. The fragmentation was practically found to end after 10 min. Furthermore. a population balance method to calculate the particle size distribution and amount of limestone in fluidised beds in dynamic and steady state, when feeding history is known, is presented.

  20. Analytical and experimental evaluation of a proposed self-forging fragment munition

    International Nuclear Information System (INIS)

    Tuft, D.B.; Folsom, E.N.

    1982-01-01

    Analytical and experimental tools have been used to study the formation of a proposed self-forging fragment projectile. The primary objective of this study is the determination of the interior and exterior shape of the fully formed fragment, and to determine if the fragment tumbles in flight. In addition, it is of interest to compare computer predictions to experimental results. An experiment was performed using high speed photography and high-energy flash x-ray radiography to study liner and case motion and projectile formation. Fabrication and assembly tolerances were closely controlled in an effort to eliminate tolerances as a possible source of fragment instability. X-ray film-density contours were analyzed to determine the fully formed fragment interior and exterior shape. Down-range yaw screens showed fragment tumbling in flight. The computed fragment shape was compared to experimental results and it was found that a retaining ring in the computational model near the liner periphery had a significant effect on the final computed fragment shape. With the retaining ring in the computational model and full two-way sliding between all material interfaces, the final computed fragment showed very good agreement with the experiment on both exterior and interior shapes

  1. The Causes of Preference Reversal.

    OpenAIRE

    Tversky, Amos; Slovic, Paul; Kahneman, Daniel

    1990-01-01

    Observed preference reversal cannot be adequately explained by violations of independence, the reduction axiom, or transitivity. The primary cause of preference reversal is the failure of procedure invariance, especially the overpricing of low-probability, high-payoff bets. This result violates regret theory and generalized (nonindependent) utility models. Preference reversal and a new reversal involving time preferences are explained by scale compatibility, which implies that payoffs are wei...

  2. Geomagnetic Field During a Reversal

    Science.gov (United States)

    Heirtzler, J. R.

    2003-01-01

    It has frequently been suggested that only the geomagnetic dipole, rather than higher order poles, reverse during a geomagnetic field reversal. Under this assumption the geomagnetic field strength has been calculated for the surface of the Earth for various steps of the reversal process. Even without an eminent a reversal of the field, extrapolation of the present secular change (although problematic) shows that the field strength may become zero in some geographic areas within a few hundred years.

  3. A Study on Reverse Logistics

    OpenAIRE

    Reddy, Dhananjaya

    2011-01-01

    In the competitive world of manufacturing, companies are often searching for new ways to improve their process, customer satisfaction and stay ahead in the game with their competitors. Reverse logistics has been considered a strategy to bring these things to life for the past decade or so. This thesis work tries to shed some light on the basics of reverse logistics and how reverse logistics can be used as a management strategy. This paper points out the fundamentals of reverse logistics and l...

  4. Geomagnetic Reversals during the Phanerozoic.

    Science.gov (United States)

    McElhinny, M W

    1971-04-09

    An antalysis of worldwide paleomagnetic measurements suggests a periodicity of 350 x 10(6) years in the polarity of the geomagnetic field. During the Mesozoic it is predominantly normal, whereas during the Upper Paleozoic it is predominantly reversed. Although geomagnetic reversals occur at different rates throughout the Phanerozoic, there appeaars to be no clear correlation between biological evolutionary rates and reversal frequency.

  5. Causes of fragmented crystals in ignimbrites: a case study of the Cardones ignimbrite, Northern Chile

    Science.gov (United States)

    van Zalinge, M. E.; Cashman, K. V.; Sparks, R. S. J.

    2018-03-01

    Broken crystals have been documented in many large-volume caldera-forming ignimbrites and can help to understand the role of crystal fragmentation in both eruption and compaction processes, the latter generally overlooked in the literature. This study investigates the origin of fragmented crystals in the > 1260 km3, crystal-rich Cardones ignimbrites located in the Central Andes. Observations of fragmented crystals in non-welded pumice clasts indicate that primary fragmentation includes extensive crystal breakage and an associated ca. 5 vol% expansion of individual crystals while preserving their original shapes. These observations are consistent with the hypothesis that crystals fragment in a brittle response to rapid decompression associated with the eruption. Additionally, we observe that the extent of crystal fragmentation increases with increasing stratigraphic depth in the ignimbrite, recording secondary crystal fragmentation during welding and compaction. Secondary crystal fragmentation aids welding and compaction in two ways. First, enhanced crystal fragmentation at crystal-crystal contacts accommodates compaction along the principal axis of stress. Second, rotation and displacement of individual crystal fragments enhances lateral flow in the direction(s) of least principal stress. This process increases crystal aspect ratios and forms textures that resemble mantled porphyroclasts in shear zones, indicating lateral flow adds to processes of compaction and welding alongside bubble collapse. In the Cardones ignimbrite, secondary fragmentation commences at depths of 175-250 m (lithostatic pressures 4-6 MPa), and is modulated by both the overlying crystal load and the time spent above the glass transition temperature. Under these conditions, the existence of force-chains can produce stresses at crystal-crystal contacts of a few times the lithostatic pressure. We suggest that documenting crystal textures, in addition to conventional welding parameters, can

  6. Mechanisms Affecting Population Density in Fragmented Habitat

    Directory of Open Access Journals (Sweden)

    Lutz Tischendorf

    2005-06-01

    Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation

  7. Systemic Thrombolysis in Acute Ischemic Stroke after Dabigatran Etexilate Reversal with Idarucizumab—A Case Report

    DEFF Research Database (Denmark)

    Tireli, Derya; He, Jun; Nordling, Mette Maria

    2017-01-01

    Introduction Idarucizumab is a reversal agent for dabigatran etexilate. By reversing the anticoagulating effect of dabigatran etexilate with idarucizumab (Praxbind), patients presenting with an acute ischemic stroke can now be eligible for thrombolysis. Patient We describe our experience with ida......Introduction Idarucizumab is a reversal agent for dabigatran etexilate. By reversing the anticoagulating effect of dabigatran etexilate with idarucizumab (Praxbind), patients presenting with an acute ischemic stroke can now be eligible for thrombolysis. Patient We describe our experience...... of embolic stroke in patients with atrial fibrillation. Dabigatran etexilate is an oral thrombin inhibitor that can be reversed by idarucizumab. Idarucizumab, a monoclonal antibody fragment, directly binds dabigatran etexilate and neutralizes its activity. Conclusion Reversal of dabigatran etexilate using...

  8. Parton fragmentation and string dynamics

    International Nuclear Information System (INIS)

    Andersson, B.; Gustafson, G.; Ingelman, G.; Sjoestrand, T.

    1983-01-01

    While much has been learned recently about quark and gluon interactions in the framework of perturbative Quantum Chromodynamics, the relation between calculated parton properties and observed hadron densities involves models where dynamics and jet empirical rules have to be combined. The purpose of this article is to describe a presently successful approach which is based on a cascade jet model using String dynamics. It can readily lead to Monte Carlo jet programmes of great use when analyzing data. Production processes in an iterative cascade approach, with tunneling in a constant force field, are reviewed. Expected differences between quark and gluon jets are discussed. Low transverse momentum phenomena are also reviewed with emphasis on hyperon polarization. In so far as this approach uses a fragmentation scheme based on String dynamics, it was deemed appropriate to also include under the same cover a special report on the Classical theory of relativistic Strings, seen as the classical limit of the Dual Resonance model. The Equations of motion and interaction among strings are presented. (orig.)

  9. Reversible brazing process

    Science.gov (United States)

    Pierce, Jim D.; Stephens, John J.; Walker, Charles A.

    1999-01-01

    A method of reversibly brazing surfaces together. An interface is affixed to each surface. The interfaces can be affixed by processes such as mechanical joining, welding, or brazing. The two interfaces are then brazed together using a brazing process that does not defeat the surface to interface joint. Interfaces of materials such as Ni-200 can be affixed to metallic surfaces by welding or by brazing with a first braze alloy. The Ni-200 interfaces can then be brazed together using a second braze alloy. The second braze alloy can be chosen so that it minimally alters the properties of the interfaces to allow multiple braze, heat and disassemble, rebraze cycles.

  10. Baculovirus display of functional antibody Fab fragments.

    Science.gov (United States)

    Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

    2015-08-01

    The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

  11. Fragmentation of eastern United States forest types

    Science.gov (United States)

    Kurt H. Riitters; John W. Coulston

    2013-01-01

    Fragmentation is a continuing threat to the sustainability of forests in the Eastern United States, where land use changes supporting a growing human population are the primary driver of forest fragmentation (Stein and others 2009). While once mostly forested, approximately 40 percent of the original forest area has been converted to other land uses, and most of the...

  12. Thermodynamics of the fuel fragmentation gas

    International Nuclear Information System (INIS)

    Perez, R.B.; Alsmiller, R.G. Jr.

    1977-01-01

    In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

  13. Momentum sum rules for fragmentation functions

    International Nuclear Information System (INIS)

    Meissner, S.; Metz, A.; Pitonyak, D.

    2010-01-01

    Momentum sum rules for fragmentation functions are considered. In particular, we give a general proof of the Schaefer-Teryaev sum rule for the transverse momentum dependent Collins function. We also argue that corresponding sum rules for related fragmentation functions do not exist. Our model-independent analysis is supplemented by calculations in a simple field-theoretical model.

  14. A note on convex renorming and fragmentability

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    Abstract. Using the game approach to fragmentability, we give new and simpler proofs of the following known results: (a) If the Banach space admits an equivalent. Kadec norm, then its weak topology is fragmented by a metric which is stronger than the norm topology. (b) If the Banach space admits an equivalent rotund ...

  15. Pollen and gene flow in fragmented habitats

    NARCIS (Netherlands)

    Kwak, Manja M.; Velterop, Odilia; van Andel, Jelte

    . Habitat fragmentation affects both plants and pollinators. Habitat fragmentation leads to changes in species richness, population number and size, density, and shape, thus to changes in the spatial arrangement of flowers. These changes influence the amount of food for flower-visiting insects and

  16. Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

    Science.gov (United States)

    David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

    2010-01-01

    Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

  17. Fragmentation and reactivity of energy-selected ferrocenium ions

    International Nuclear Information System (INIS)

    Mestdagh, H.; Dutuit, O.; Heninger, M.; Thissen, R.; Alcaraz, C.

    2002-01-01

    In this study, results concerning the discussion of state-selected ferrocenium ions (c-C 5 H 5 ) 2 Fe + commonly called Cp 2 Fe + , as well as their reactions with methanol and ethanol are presented. Parent ions Cp 2 Fe + were produced by vacuumultraviolett (VUV) photoionization of neutral ferrocene using synchrotron radiation, and selected in internal energy by threshold photoelectron-photoion coincidences. The apparatus is divided into three differentially pumped regions: the source, the reaction and the detection zones. In source, state-selected parent ions are formed and can be selected in mass by a first quadrupole filter. State-selected ions are then injected in the second zone which is a RF octopole ion guide where reaction product ions are mass analyzed by a second quadrupole filter and detected by microchannelplates. In addition, the long flight time in the octopoles (several hundreds of microseconds) allows studying long-lived metastable ions. Total mass spectra were recorded at different photon energies, in addition to the main CpFe + and Fe + fragments, several minor fragments were detected such as C 10 H 10 + which reflects the formation of a C-C bond between the two Cp ligands. Losses of CH 3 , C 2 H 2 and C-4H 4 also indicate that important structure rearrangements take place before cleavage. The appearance energies of each mass-selected fragment ion were measured by recording fragment ion yields as a function of photon energy. Surprisingly, all fragments were found to have the same energy onset, i.e. 13.2 eV photon energy, except for C 3 H 3 Fe + (m/z 95). For Fe + ions, a sharp increase was observed at 17 eV, above the thermochemical onset of Fe + + 2 Cp. The 13.2 eV appearance energy of Fe + is thus assigned to the formation of Fe - + C 10 H 10 . The reactivity of ferrocenium ion with methanol and ethanol was investigated as a function of photon energy. While no reaction occurs at lower photon energies, several reaction products appear at 13.0 e

  18. Faunal Communities Are Invariant to Fragmentation in Experimental Seagrass Landscapes.

    Directory of Open Access Journals (Sweden)

    Jonathan S Lefcheck

    Full Text Available Human-driven habitat fragmentation is cited as one of the most pressing threats facing many coastal ecosystems today. Many experiments have explored the consequences of fragmentation on fauna in one foundational habitat, seagrass beds, but have either surveyed along a gradient of existing patchiness, used artificial materials to mimic a natural bed, or sampled over short timescales. Here, we describe faunal responses to constructed fragmented landscapes varying from 4-400 m2 in two transplant garden experiments incorporating live eelgrass (Zostera marina L.. In experiments replicated within two subestuaries of the Chesapeake Bay, USA across multiple seasons and non-consecutive years, we comprehensively censused mesopredators and epifaunal communities using complementary quantitative methods. We found that community properties, including abundance, species richness, Simpson and functional diversity, and composition were generally unaffected by the number of patches and the size of the landscape, or the intensity of sampling. Additionally, an index of competition based on species co-occurrences revealed no trends with increasing patch size, contrary to theoretical predictions. We extend conclusions concerning the invariance of animal communities to habitat fragmentation from small-scale observational surveys and artificial experiments to experiments conducted with actual living plants and at more realistic scales. Our findings are likely a consequence of the rapid life histories and high mobility of the organisms common to eelgrass beds, and have implications for both conservation and restoration, suggesting that even small patches can rapidly promote abundant and diverse faunal communities.

  19. The program LISE: a simulation of fragment separators

    International Nuclear Information System (INIS)

    Bazin, D.; Tarasov, O.; Lewitowicz, M.; Sorlin, O.

    2001-01-01

    The program LISE, which simulates the operation of fragment separators, used in the production of radioactive beams via fragmentation is described. Various aspects of the physical phenomenon involved in the production of such radioactive beams are discussed. They include fragmentation cross sections, energy losses in materials, ionic charge state distributions, as well as ion optics calculations and acceptance effects. Among the goals of this program is a highly user-friendly environment, designed not only to forecast intensities and purities for future experiments, but also as a tuning tool during experiments where its results can be quickly compared to on-line data. In addition, several general purpose tools such as a physical parameters calculator, a database of nuclei properties, and relativistic two-body kinematics calculations make it also attractive in experiments where radioactive beams are not involved. After a general description of fragment separators, the principles underlying the calculations are presented, followed by a practical description of the program and its many features. Finally, a few examples of calculations are compared to on-line data, both qualitatively and quantitatively

  20. Rapid experimental SAD phasing and hot-spot identification with halogenated fragments

    Energy Technology Data Exchange (ETDEWEB)

    Bauman, Joseph D.; Harrison, Jerry Joe E. K.; Arnold, Eddy

    2016-01-01

    Through X-ray crystallographic fragment screening, 4-bromopyrazole was discovered to be a `magic bullet' that is capable of binding at many of the ligand `hot spots' found in HIV-1 reverse transcriptase (RT). The binding locations can be in pockets that are `hidden' in the unliganded crystal form, allowing rapid identification of these sites forin silicoscreening. In addition to hot-spot identification, this ubiquitous yet specific binding provides an avenue for X-ray crystallographic phase determination, which can be a significant bottleneck in the determination of the structures of novel proteins. The anomalous signal from 4-bromopyrazole or 4-iodopyrazole was sufficient to determine the structures of three proteins (HIV-1 RT, influenza A endonuclease and proteinase K) by single-wavelength anomalous dispersion (SAD) from single crystals. Both compounds are inexpensive, readily available, safe and very soluble in DMSO or water, allowing efficient soaking into crystals.

  1. Current fragmentation in deep inelastic scattering

    International Nuclear Information System (INIS)

    Hamer, C.J.

    1975-04-01

    It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

  2. The politics of municipal fragmentation in Ghana

    Directory of Open Access Journals (Sweden)

    Abdulai Kuyini Mohammed

    2015-06-01

    Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.

  3. Graph Theory. 1. Fragmentation of Structural Graphs

    Directory of Open Access Journals (Sweden)

    Lorentz JÄNTSCHI

    2002-12-01

    Full Text Available The investigation of structural graphs has many fields of applications in engineering, especially in applied sciences like as applied chemistry and physics, computer sciences and automation, electronics and telecommunication. The main subject of the paper is to express fragmentation criteria in graph using a new method of investigation: terminal paths. Using terminal paths are defined most of the fragmentation criteria that are in use in molecular topology, but the fields of applications are more generally than that, as I mentioned before. Graphical examples of fragmentation are given for every fragmentation criteria. Note that all fragmentation is made with a computer program that implements a routine for every criterion.[1] A web routine for tracing all terminal paths in graph can be found at the address: http://vl.academicdirect.ro/molecular_topology/tpaths/ [1] M. V. Diudea, I. Gutman, L. Jäntschi, Molecular Topology, Nova Science, Commack, New York, 2001, 2002.

  4. Boiler feedwater treatment using reverse osmosis at Suncor OSG

    International Nuclear Information System (INIS)

    Brown, T.

    1997-01-01

    The installation of a new 1000 cu m/hr reverse osmosis water treatment system for boiler feedwater at a Suncor plant was discussed. The selection process began in 1993 when Suncor identified a need to increase its boiler feedwater capacity. The company reviewed many options available to increase the treated water capacity. These included: contracting the supply of treated water, adding additional capacity, replacing the entire plant, reverse osmosis, and demineralization. The eventual decision was to build a new 1000 cu m/hr reverse osmosis water treatment plant with the following key components: a Degremont Infilco Ultra Pulsator Clarifier and a Glegg Water Conditioning multimedia filter, Amberpack softeners and reverse osmosis arrays. The reverse osmosis plant was environmentally favourable over an equivalent demineralization plant. A technical comparison was provided between demineralization and reverse osmosis. The system has proven to be successful and economical in meeting the plants needs. 5 figs

  5. Reversibly Bistable Flexible Electronics

    KAUST Repository

    Alfaraj, Nasir

    2015-05-01

    Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent. While maintaining large-scale production and prototyping rapidity, this flexible and translucent scheme demonstrates the potential to transform conventionally stiff electronic devices into thin and foldable ones without compromising long-term performance and reliability. In this work, we report on the fabrication and characterization of reversibly bistable flexible electronic switches that utilize flexible n-channel metal-oxide-semiconductor field-effect transistors. The transistors are fabricated initially on rigid (100) silicon substrates before they are peeled off. They can be used to control flexible batches of light-emitting diodes, demonstrating both the relative ease of scaling at minimum cost and maximum reliability and the feasibility of integration. The peeled-off silicon fabric is about 25 µm thick. The fabricated devices are transferred to a reversibly bistable flexible platform through which, for example, a flexible smartphone can be wrapped around a user’s wrist and can also be set back to its original mechanical position. Buckling and cyclic bending of such host platforms brings a completely new dimension to the development of flexible electronics, especially rollable displays.

  6. Haiku: New paradigm for the reverse genetics of emerging RNA viruses.

    Directory of Open Access Journals (Sweden)

    Thérèse Atieh

    Full Text Available Reverse genetics is key technology for producing wild-type and genetically modified viruses. The ISA (Infectious Subgenomic Amplicons method is a recent versatile and user-friendly reverse genetics method to rescue RNA viruses. The main constraint of its canonic protocol was the requirement to produce (e.g., by DNA synthesis or fusion PCR 5' and 3' modified genomic fragments encompassing the human cytomegalovirus promoter (pCMV and the hepatitis delta virus ribozyme/simian virus 40 polyadenylation signal (HDR/SV40pA, respectively. Here, we propose the ultimately simplified "Haiku" designs in which terminal pCMV and HDR/SV40pA sequences are provided as additional separate DNA amplicons. This improved procedure was successfully applied to the rescue of a wide range of viruses belonging to genera Flavivirus, Alphavirus and Enterovirus in mosquito or mammalian cells using only standard PCR amplification techniques and starting from a variety of original materials including viral RNAs extracted from cell supernatant media or animal samples. We also demonstrate that, in specific experimental conditions, the presence of the HDR/SV40pA is not necessary to rescue the targeted viruses. These ultimately simplified "Haiku" designs provide an even more simple, rapid, versatile and cost-effective tool to rescue RNA viruses since only generation of overlapping amplicons encompassing the entire viral genome is now required to generate infectious virus. This new approach may completely modify our capacity to obtain infectious RNA viruses.

  7. Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

    Directory of Open Access Journals (Sweden)

    S. C. Oukouomi Noutchie

    2014-01-01

    Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

  8. Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

    Science.gov (United States)

    2012-01-01

    The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

  9. Antral content, secretion and peripheral metabolism of N-terminal progastrin fragments

    DEFF Research Database (Denmark)

    Goetze, Jens Peter; Hansen, Carsten Palnaes; Rehfeld, Jens F

    2006-01-01

    OBJECTIVES: In addition to the acid-stimulatory gastrins, progastrin also release N-terminal fragments. In order to examine the cellular content, secretion and peripheral metabolism of these fragments, we developed an immunoassay specific for the N-terminal sequence of human progastrin. RESULTS......-terminal progastrin fragments. The basal concentration of N-terminal fragments in normal human plasma was almost 30-fold higher than that of the amidated, acid-stimulatory gastrins (286 pmol/l versus 9.8 pmol/l, n=26, P...-35 in circulation was 30 min, and a pig model revealed the kidneys and the vasculature to the head as the primary sites of degradation. CONCLUSION: The cellular and circulatory concentration profiles of N-terminal progastrin fragments differ markedly from those of the acid-stimulatory gastrins. The high basal...

  10. Study of charm fragmentation into D{sup *{+-}} mesons in deep-inelastic scattering at HERA

    Energy Technology Data Exchange (ETDEWEB)

    Aaron, F.D.; Alexa, C.; Preda, T.; Rotaru, M. [National Inst. for Physics and Nuclear Engineering (NIPNE), Bucharest (Romania); Andreev, V.; Belousov, A.; Eliseev, A.; Fomenko, A.; Gogitidze, N.; Lebedev, A.; Loktionova, N.; Malinovski, E.; Rusakov, S.; Sheviakov, I.; Shtarkov, L.N.; Smirnov, P.; Soloviev, Y.; Vazdik, Y. [Lebedev Physical Inst., Moscow (Russian Federation); Antunovic, B.; Aplin, S.; Bacchetta, A.; Bartel, W.; Beckingham, M.; Brandt, G.; Brinkmann, M.; Campbell, A.J.; Cholewa, A.; Deak, M.; Boer, Y. de; Roeck, A. de; Eckerlin, G.; Elsen, E.; Felst, R.; Fleischer, M.; Gayler, J.; Glazov, A.; Grell, B.R.; Haidt, D.; Helebrant, C.; Janssen, M.E.; Jung, H.; Katzy, J.; Kleinwort, C.; Klimkovich, T.; Knutsson, A.; Korbel, V.; Kraemer, M.; Krastev, K.; Kutak, K.; Levonian, S.; List, J.; Lucaci-Timoce, A.I.; Marti, L.; Meyer, A.B.; Meyer, H.; Meyer, J.; Michels, V.; Niebuhr, C.; Nikiforov, A.; Nozicka, M.; Olsson, J.E.; Panagoulias, I.; Papadopoulou, T.; Peng, H.; Pitzl, D.; Placakyte, R.; Radescu, V.; Rurikova, Z.; Salvaire, F.; Schmidt, S.; Schmitt, S.; Sefkow, F.; Staykova, Z.; Steder, M.; Toll, T.; Vargas Trevino, A.; Vinokurova, S.; Wessels, M.; Wissing, C.; Wuensch, E.; Zhu, Y.C. [DESY, Hamburg (Germany); Asmone, A.; Stella, B. [Dipt. di Fisica Univ. di Roma Tre (Italy); INFN Roma 3, Roma (Italy); Astvatsatourov, A.; Delvax, J.; Wolf, E.A. de; Favart, L.; Hreus, T.; Janssen, X.; Marage, P.; Mozer, M.U.; Roland, B.; Roosen, R.; Sunar, D.; Sykora, T.; Mechelen, P. van [Inter-University Inst. for High Energies ULB-VUB, Brussels (Belgium); Univ. Antwerpen, Antwerpen (Belgium); Backovic, S.; Dubak, A.; Lastovicka-Medin, G.; Picuric, I.; Raicevic, N. [Univ. of Montenegro, Faculty of Science, Podgorica (ME); Baghdasaryan, A.; Ghazaryan, S.; Hovhannisyan, A.; Volchinski, V.; Yeganov, V.; Zohrabyan, H. [Yerevan Physics Inst., Yerevan (Armenia); Barrelet, E. [Universites Paris VI and VII, IN2P3-CNRS, LPNHE, Paris (France)] [and others

    2009-02-15

    The process of charm quark fragmentation is studied using D{sup *{+-}} meson production in deep-inelastic scattering as measured by the H1 detector at HERA. The parameters of fragmentation functions are extracted for QCD models based on leading order matrix elements and DGLAP or CCFM evolution of partons together with string fragmentation and particle decays. Additionally, they are determined for a next-to-leading order QCD calculation in the fixed flavour number scheme using the independent fragmentation of charm quarks to D{sup *{+-}} mesons. Two different regions of phase space are investigated defined by the presence or absence of a jet containing the D{sup *{+-}} meson in the event. The fragmentation parameters extracted for the two phase space regions are found to be different. (orig.)

  11. Study of charm fragmentation into D * ± mesons in deep-inelastic scattering at HERA

    Science.gov (United States)

    Aaron, F. D.; Alexa, C.; Andreev, V.; Antunovic, B.; Aplin, S.; Asmone, A.; Astvatsatourov, A.; Bacchetta, A.; Backovic, S.; Baghdasaryan, A.; Barrelet, E.; Bartel, W.; Beckingham, M.; Begzsuren, K.; Behnke, O.; Belousov, A.; Berger, N.; Bizot, J. C.; Boenig, M.-O.; Boudry, V.; Bozovic-Jelisavcic, I.; Bracinik, J.; Brandt, G.; Brinkmann, M.; Brisson, V.; Bruncko, D.; Bunyatyan, A.; Buschhorn, G.; Bystritskaya, L.; Campbell, A. J.; Cantun Avila, K. B.; Cassol-Brunner, F.; Cerny, K.; Cerny, V.; Chekelian, V.; Cholewa, A.; Contreras, J. G.; Coughlan, J. A.; Cozzika, G.; Cvach, J.; Dainton, J. B.; Daum, K.; Deák, M.; de Boer, Y.; Delcourt, B.; Del Degan, M.; Delvax, J.; de Roeck, A.; de Wolf, E. A.; Diaconu, C.; Dodonov, V.; Dossanov, A.; Dubak, A.; Eckerlin, G.; Efremenko, V.; Egli, S.; Eliseev, A.; Elsen, E.; Essenov, S.; Falkiewicz, A.; Faulkner, P. J. W.; Favart, L.; Fedotov, A.; Felst, R.; Feltesse, J.; Ferencei, J.; Fleischer, M.; Fomenko, A.; Gabathuler, E.; Gayler, J.; Ghazaryan, S.; Glazov, A.; Glushkov, I.; Goerlich, L.; Goettlich, M.; Gogitidze, N.; Gouzevitch, M.; Grab, C.; Greenshaw, T.; Grell, B. R.; Grindhammer, G.; Habib, S.; Haidt, D.; Hansson, M.; Helebrant, C.; Henderson, R. C. W.; Hennekemper, E.; Henschel, H.; Herrera, G.; Hildebrandt, M.; Hiller, K. H.; Hoffmann, D.; Horisberger, R.; Hovhannisyan, A.; Hreus, T.; Jacquet, M.; Janssen, M. E.; Janssen, X.; Jemanov, V.; Jönsson, L.; Jung, A. W.; Jung, H.; Kapichine, M.; Katzy, J.; Kenyon, I. R.; Kiesling, C.; Klein, M.; Kleinwort, C.; Klimkovich, T.; Kluge, T.; Knutsson, A.; Kogler, R.; Korbel, V.; Kostka, P.; Kraemer, M.; Krastev, K.; Kretzschmar, J.; Kropivnitskaya, A.; Krüger, K.; Kutak, K.; Landon, M. P. J.; Lange, W.; Laštovička-Medin, G.; Laycock, P.; Lebedev, A.; Leibenguth, G.; Lendermann, V.; Levonian, S.; Li, G.; Lipka, K.; Liptaj, A.; List, B.; List, J.; Loktionova, N.; Lopez-Fernandez, R.; Lubimov, V.; Lucaci-Timoce, A.-I.; Lytkin, L.; Makankine, A.; Malinovski, E.; Marage, P.; Marti, L.; Martyn, H.-U.; Maxfield, S. J.; Mehta, A.; Meier, K.; Meyer, A. B.; Meyer, H.; Meyer, H.; Meyer, J.; Michels, V.; Mikocki, S.; Milcewicz-Mika, I.; Moreau, F.; Morozov, A.; Morris, J. V.; Mozer, M. U.; Mudrinic, M.; Müller, K.; Murín, P.; Nankov, K.; Naroska, B.; Naumann, T.; Newman, P. R.; Niebuhr, C.; Nikiforov, A.; Nowak, G.; Nowak, K.; Nozicka, M.; Olivier, B.; Olsson, J. E.; Osman, S.; Ozerov, D.; Palichik, V.; Panagoulias, I.; Pandurovic, M.; Papadopoulou, T.; Pascaud, C.; Patel, G. D.; Pejchal, O.; Peng, H.; Perez, E.; Petrukhin, A.; Picuric, I.; Piec, S.; Pitzl, D.; Plačakytė, R.; Polifka, R.; Povh, B.; Preda, T.; Radescu, V.; Rahmat, A. J.; Raicevic, N.; Raspiareza, A.; Ravdandorj, T.; Reimer, P.; Rizvi, E.; Robmann, P.; Roland, B.; Roosen, R.; Rostovtsev, A.; Rotaru, M.; Ruiz Tabasco, J. E.; Rurikova, Z.; Rusakov, S.; Salek, D.; Salvaire, F.; Sankey, D. P. C.; Sauter, M.; Sauvan, E.; Schmidt, S.; Schmitt, S.; Schmitz, C.; Schoeffel, L.; Schöning, A.; Schultz-Coulon, H.-C.; Sefkow, F.; Shaw-West, R. N.; Sheviakov, I.; Shtarkov, L. N.; Shushkevich, S.; Sloan, T.; Smiljanic, I.; Smirnov, P.; Soloviev, Y.; Sopicki, P.; South, D.; Spaskov, V.; Specka, A.; Staykova, Z.; Steder, M.; Stella, B.; Straumann, U.; Sunar, D.; Sykora, T.; Tchoulakov, V.; Thompson, G.; Thompson, P. D.; Toll, T.; Tomasz, F.; Tran, T. H.; Traynor, D.; Trinh, T. N.; Truöl, P.; Tsakov, I.; Tseepeldorj, B.; Tsurin, I.; Turnau, J.; Tzamariudaki, E.; Urban, K.; Valkárová, A.; Vallée, C.; van Mechelen, P.; Vargas Trevino, A.; Vazdik, Y.; Vinokurova, S.; Volchinski, V.; Wegener, D.; Wessels, M.; Wissing, C.; Wünsch, E.; Yeganov, V.; Žáček, J.; Zálešák, J.; Zhang, Z.; Zhelezov, A.; Zhokin, A.; Zhu, Y. C.; Zimmermann, T.; Zohrabyan, H.; Zomer, F.

    2009-02-01

    The process of charm quark fragmentation is studied using D * ± meson production in deep-inelastic scattering as measured by the H1 detector at HERA. The parameters of fragmentation functions are extracted for QCD models based on leading order matrix elements and DGLAP or CCFM evolution of partons together with string fragmentation and particle decays. Additionally, they are determined for a next-to-leading order QCD calculation in the fixed flavour number scheme using the independent fragmentation of charm quarks to D * ± mesons. Two different regions of phase space are investigated defined by the presence or absence of a jet containing the D * ± meson in the event. The fragmentation parameters extracted for the two phase space regions are found to be different.

  12. Study of charm fragmentation into D*± mesons in deep-inelastic scattering at HERA

    International Nuclear Information System (INIS)

    Aaron, F.D.; Alexa, C.; Preda, T.; Rotaru, M.; Andreev, V.; Belousov, A.; Eliseev, A.; Fomenko, A.; Gogitidze, N.; Lebedev, A.; Loktionova, N.; Malinovski, E.; Rusakov, S.; Sheviakov, I.; Shtarkov, L.N.; Smirnov, P.; Soloviev, Y.; Vazdik, Y.; Antunovic, B.; Aplin, S.; Bacchetta, A.; Bartel, W.; Beckingham, M.; Brandt, G.; Brinkmann, M.; Campbell, A.J.; Cholewa, A.; Deak, M.; Boer, Y. de; Roeck, A. de; Eckerlin, G.; Elsen, E.; Felst, R.; Fleischer, M.; Gayler, J.; Glazov, A.; Grell, B.R.; Haidt, D.; Helebrant, C.; Janssen, M.E.; Jung, H.; Katzy, J.; Kleinwort, C.; Klimkovich, T.; Knutsson, A.; Korbel, V.; Kraemer, M.; Krastev, K.; Kutak, K.; Levonian, S.; List, J.; Lucaci-Timoce, A.I.; Marti, L.; Meyer, A.B.; Meyer, H.; Meyer, J.; Michels, V.; Niebuhr, C.; Nikiforov, A.; Nozicka, M.; Olsson, J.E.; Panagoulias, I.; Papadopoulou, T.; Peng, H.; Pitzl, D.; Placakyte, R.; Radescu, V.; Rurikova, Z.; Salvaire, F.; Schmidt, S.; Schmitt, S.; Sefkow, F.; Staykova, Z.; Steder, M.; Toll, T.; Vargas Trevino, A.; Vinokurova, S.; Wessels, M.; Wissing, C.; Wuensch, E.; Zhu, Y.C.; Asmone, A.; Stella, B.; Astvatsatourov, A.; Delvax, J.; Wolf, E.A. de; Favart, L.; Hreus, T.; Janssen, X.; Marage, P.; Mozer, M.U.; Roland, B.; Roosen, R.; Sunar, D.; Sykora, T.; Mechelen, P. van; Backovic, S.; Dubak, A.; Lastovicka-Medin, G.; Picuric, I.; Raicevic, N.; Baghdasaryan, A.; Ghazaryan, S.; Hovhannisyan, A.; Volchinski, V.; Yeganov, V.; Zohrabyan, H.; Barrelet, E.; Begzsuren, K.; Ravdandorj, T.; Tseepeldorj, B.; Behnke, O.; Berger, N.; Degan, M. del; Grab, C.; Leibenguth, G.; Sauter, M.; Zimmermann, T.; Bizot, J.C.; Brisson, V.; Delcourt, B.; Jacquet, M.; Li, G.; Pascaud, C.; Tran, T.H.; Zhang, Z.; Zomer, F.; Boenig, M.O.; South, D.; Wegener, D.; Boudry, V.; Gouzevitch, M.; Moreau, F.; Specka, A.; Bozovic-Jelisavcic, I.; Mudrinic, M.; Pandurovic, M.; Smiljanic, I.; Bracinik, J.; Faulkner, P.J.W.; Kenyon, I.R.; Newman, P.R.; Shaw-West, R.N.; Thompson, P.D.; Bruncko, D.; Cerny, V.; Ferencei, J.; Murin, P.; Tomasz, F.; Bunyatyan, A.; Buschhorn, G.; Chekelian, V.; Dossanov, A.; Grindhammer, G.; Kiesling, C.; Kogler, R.; Liptaj, A.; Olivier, B.; Raspiareza, A.; Shushkevich, S.; Tzamariudaki, E.; Bystritskaya, L.; Efremenko, V.; Essenov, S.; Fedotov, A.; Kropivnitskaya, A.; Lubimov, V.; Ozerov, D.; Petrukhin, A.; Rostovtsev, A.; Zhelezov, A.; Zhokin, A.; Cantun Avila, K.B.; Contreras, J.G.; Ruiz Tabasco, J.E.; Cassol-Brunner, F.; Diaconu, C.; Hoffmann, D.; Sauvan, E.; Trinh, T.N.; Vallee, C.; Cerny, K.; Pejchal, O.; Polifka, R.; Salek, D.; Valkarova, A.; Zacek, J.; Coughlan, J.A.; Morris, J.V.; Sankey, D.P.C.; Cozzika, G.; Feltesse, J.; Perez, E.; Schoeffel, L.; Cvach, J.; Reimer, P.; Zalesak, J.; Dainton, J.B.; Gabathuler, E.; Greenshaw, T.; Klein, M.; Kluge, T.; Kretzschmar, J.; Laycock, P.; Maxfield, S.J.; Mehta, A.; Patel, G.D.; Rahmat, A.J.; Daum, K.; Meyer, H.; Dodonov, V.; Lytkin, L.; Povh, B.; Egli, S.; Hildebrandt, M.; Horisberger, R.; Falkiewicz, A.; Goerlich, L.; Mikocki, S.; Milcewicz-Mika, I.; Nowak, G.; Sopicki, P.; Turnau, J.; Glushkov, I.; Henschel, H.; Hiller, K.H.; Kostka, P.; Lange, W.; Naumann, T.; Piec, S.; Tsurin, I.; Goettlich, M.; Habib, S.; Jemanov, V.; Lipka, K.; List, B.; Naroska, B.; Hansson, M.; Joensson, L.; Osman, S.; Henderson, R.C.W.; Sloan, T.; Hennekemper, E.; Jung, A.W.; Krueger, K.; Lendermann, V.; Meier, K.; Schultz-Coulon, H.C.; Urban, K.; Herrera, G.; Lopez-Fernandez, R.; Kapichine, M.; Makankine, A.; Morozov, A.; Palichik, V.; Spaskov, V.; Tchoulakov, V.; Landon, M.P.J.; Rizvi, E.; Thompson, G.; Traynor, D.; Martyn, H.U.; Mueller, K.; Nowak, K.; Robmann, P.; Schmitz, C.; Straumann, U.; Truoel, P.; Nankov, K.; Tsakov, I.; Schoening, A.

    2009-01-01

    The process of charm quark fragmentation is studied using D *± meson production in deep-inelastic scattering as measured by the H1 detector at HERA. The parameters of fragmentation functions are extracted for QCD models based on leading order matrix elements and DGLAP or CCFM evolution of partons together with string fragmentation and particle decays. Additionally, they are determined for a next-to-leading order QCD calculation in the fixed flavour number scheme using the independent fragmentation of charm quarks to D *± mesons. Two different regions of phase space are investigated defined by the presence or absence of a jet containing the D *± meson in the event. The fragmentation parameters extracted for the two phase space regions are found to be different. (orig.)

  13. Reversible posterior leukoencephalopathy syndrome

    International Nuclear Information System (INIS)

    Lee, Eun Ja; Yu, Won Jong; Ahn, Kook Jin; Jung, So Lyung; Lee, Yeon Soo; Kim, Ji Chang; Kang, Si Won; Song, Chang Joon; Song, Soon-Young; Koo, Ja Hong; Kim, Man Deuk

    2001-01-01

    To review reversible posterior leukoencephalopathy syndrome. We reviewed 22 patients (M:F=3:19; age, 17-46 years) with the characteristic clinical and imaging features of reversible posterior leukoencephalopathy syndrome. All underwent brain MRI, and in three cases both CT and MRI were performed. In one, MRA was obtained, and in eleven, follow-up MR images were obtained. We evaluated the causes of this syndrome, its clinical manifestations, and MR findings including the locations of lesions, the presence or absence of contrast enhancement, and the changes seen at follow-up MRI. Of the 22 patients, 13 had eclampsia (six during pregnancy and seven during puerperium). Four were receiving immunosuppressive therapy (three, cyclosporine ; one, FK 506). Four suffered renal failure and one had complicated migraine. The clinical manifestations included headache (n=12), visual disturbance (n=13), seizure (n=15), focal neurologic sign (n=3), and altered mental status (n=2). Fifteen patients had hypertension and the others normotension. MRI revealed that lesions were bilateral (n=20) or unilateral (n=2). In all patients the lesion was found in the cortical and subcortical areas of the parieto-occipital lobes ; other locations were the basal ganglia (n=9), posterior temporal lobe (n=8), frontal lobe (n=5), cerebellum (n=5), pons (n=2), and thalamus (n=1). All lesions were of high signal intensity on T2-weighted images, and of iso to low intensity on T1-weighted images. One was combined with acute hematoma in the left basal ganglia. In eight of 11 patients who underwent postcontrast T1-weighted MRI, there was no definite enhancement ; in one, enhancement was mild, and in tow, patchy. CT studies showed low attenuation, and MRA revealed mild vasospasm. The symptoms of all patients improved. Follow-up MRI in nine of 11 patients depicted complete resolution of the lesions ; in two, small infarctions remained but the extent of the lesions had decreased. Reversible posterior

  14. Reversible posterior leukoencephalopathy syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eun Ja; Yu, Won Jong; Ahn, Kook Jin; Jung, So Lyung; Lee, Yeon Soo; Kim, Ji Chang; Kang, Si Won [The Catholic Univ. of Korea, Taejon (Korea, Republic of); Song, Chang Joon [Chungnam National Univ. School of Medicine, Cheonju (Korea, Republic of); Song, Soon-Young; Koo, Ja Hong [Kwandong Univ. College of Medicine, Myungji Hospital, Seoul (Korea, Republic of); Kim, Man Deuk [College of Medicine Pochon CHA Univ., Seoul (Korea, Republic of)

    2001-10-01

    To review reversible posterior leukoencephalopathy syndrome. We reviewed 22 patients (M:F=3:19; age, 17-46 years) with the characteristic clinical and imaging features of reversible posterior leukoencephalopathy syndrome. All underwent brain MRI, and in three cases both CT and MRI were performed. In one, MRA was obtained, and in eleven, follow-up MR images were obtained. We evaluated the causes of this syndrome, its clinical manifestations, and MR findings including the locations of lesions, the presence or absence of contrast enhancement, and the changes seen at follow-up MRI. Of the 22 patients, 13 had eclampsia (six during pregnancy and seven during puerperium). Four were receiving immunosuppressive therapy (three, cyclosporine ; one, FK 506). Four suffered renal failure and one had complicated migraine. The clinical manifestations included headache (n=12), visual disturbance (n=13), seizure (n=15), focal neurologic sign (n=3), and altered mental status (n=2). Fifteen patients had hypertension and the others normotension. MRI revealed that lesions were bilateral (n=20) or unilateral (n=2). In all patients the lesion was found in the cortical and subcortical areas of the parieto-occipital lobes ; other locations were the basal ganglia (n=9), posterior temporal lobe (n=8), frontal lobe (n=5), cerebellum (n=5), pons (n=2), and thalamus (n=1). All lesions were of high signal intensity on T2-weighted images, and of iso to low intensity on T1-weighted images. One was combined with acute hematoma in the left basal ganglia. In eight of 11 patients who underwent postcontrast T1-weighted MRI, there was no definite enhancement ; in one, enhancement was mild, and in tow, patchy. CT studies showed low attenuation, and MRA revealed mild vasospasm. The symptoms of all patients improved. Follow-up MRI in nine of 11 patients depicted complete resolution of the lesions ; in two, small infarctions remained but the extent of the lesions had decreased. Reversible posterior

  15. Poloidal flux loss in a field-reversed theta pinch

    International Nuclear Information System (INIS)

    Hoffman, A.L.; Milroy, R.D.; Steinhauer, L.C.

    1981-01-01

    Poloidal flux loss has been measured in field-reversed configurations and related to anomalous resistivity near the magnetic field null. The results indicate that mechanisms in addition to the lower-hybrid drift instability are affecting transport

  16. An Imaging System for Automated Characteristic Length Measurement of Debrisat Fragments

    Science.gov (United States)

    Moraguez, Mathew; Patankar, Kunal; Fitz-Coy, Norman; Liou, J.-C.; Sorge, Marlon; Cowardin, Heather; Opiela, John; Krisko, Paula H.

    2015-01-01

    The debris fragments generated by DebriSat's hypervelocity impact test are currently being processed and characterized through an effort of NASA and USAF. The debris characteristics will be used to update satellite breakup models. In particular, the physical dimensions of the debris fragments must be measured to provide characteristic lengths for use in these models. Calipers and commercial 3D scanners were considered as measurement options, but an automated imaging system was ultimately developed to measure debris fragments. By automating the entire process, the measurement results are made repeatable and the human factor associated with calipers and 3D scanning is eliminated. Unlike using calipers to measure, the imaging system obtains non-contact measurements to avoid damaging delicate fragments. Furthermore, this fully automated measurement system minimizes fragment handling, which reduces the potential for fragment damage during the characterization process. In addition, the imaging system reduces the time required to determine the characteristic length of the debris fragment. In this way, the imaging system can measure the tens of thousands of DebriSat fragments at a rate of about six minutes per fragment, compared to hours per fragment in NASA's current 3D scanning measurement approach. The imaging system utilizes a space carving algorithm to generate a 3D point cloud of the article being measured and a custom developed algorithm then extracts the characteristic length from the point cloud. This paper describes the measurement process, results, challenges, and future work of the imaging system used for automated characteristic length measurement of DebriSat fragments.

  17. Reverse osmosis application studies

    International Nuclear Information System (INIS)

    Golomb, A.

    1982-02-01

    To assess the feasibility of applying reverse osmosis (RO) and ultrafiltration (UF) for effective treatment of process and waste streams from operations at Ontario Hydro's thermal and nuclear stations, an extensive literature survey has been carried out. It is concluded that RO is not at present economic for pretreatment of Great Lakes water prior to ion exchange demineralization for boiler makeup. Using both conventional and novel commercial membrane modules, RO pilot studies are recommended for treatment of boiler cleaning wastes, fly ash leachates, and flue gas desulphurization scrubber discharges for removal of heavy metals. Volume reduction and decontamination of nuclear station low-level active liquid waste streams by RO/UF also appear promising. Research programmes are proposed

  18. Reverse photoacoustic standoff spectroscopy

    Science.gov (United States)

    Van Neste, Charles W [Kingston, TN; Senesac, Lawrence R [Knoxville, TN; Thundat, Thomas G [Knoxville, TN

    2011-04-12

    A system and method are disclosed for generating a reversed photoacoustic spectrum at a greater distance. A source may emit a beam to a target and a detector measures signals generated as a result of the beam being emitted on the target. By emitting a chopped/pulsed light beam to the target, it may be possible to determine the target's optical absorbance by monitoring the intensity of light collected at the detector at different wavelengths. As the wavelength of light is changed, the target may absorb or reject each optical frequency. Rejection may increase the intensity at the sensing element and absorption may decrease the intensity. Accordingly, an identifying spectrum of the target may be made with the intensity variation of the detector as a function of illuminating wavelength.

  19. Reverse Osmosis Optimization

    Energy Technology Data Exchange (ETDEWEB)

    McMordie Stoughton, Kate; Duan, Xiaoli; Wendel, Emily M.

    2013-08-26

    This technology evaluation was prepared by Pacific Northwest National Laboratory on behalf of the U.S. Department of Energy’s Federal Energy Management Program (FEMP). ¬The technology evaluation assesses techniques for optimizing reverse osmosis (RO) systems to increase RO system performance and water efficiency. This evaluation provides a general description of RO systems, the influence of RO systems on water use, and key areas where RO systems can be optimized to reduce water and energy consumption. The evaluation is intended to help facility managers at Federal sites understand the basic concepts of the RO process and system optimization options, enabling them to make informed decisions during the system design process for either new projects or recommissioning of existing equipment. This evaluation is focused on commercial-sized RO systems generally treating more than 80 gallons per hour.¬

  20. Reverse Osmosis Optimization

    Energy Technology Data Exchange (ETDEWEB)

    None

    2013-08-01

    This technology evaluation was prepared by Pacific Northwest National Laboratory on behalf of the U.S. Department of Energy’s Federal Energy Management Program (FEMP). The technology evaluation assesses techniques for optimizing reverse osmosis (RO) systems to increase RO system performance and water efficiency. This evaluation provides a general description of RO systems, the influence of RO systems on water use, and key areas where RO systems can be optimized to reduce water and energy consumption. The evaluation is intended to help facility managers at Federal sites understand the basic concepts of the RO process and system optimization options, enabling them to make informed decisions during the system design process for either new projects or recommissioning of existing equipment. This evaluation is focused on commercial-sized RO systems generally treating more than 80 gallons per hour.

  1. Sex Reversal in Amphibians.

    Science.gov (United States)

    Flament, Stéphane

    2016-01-01

    Amphibians have been widely used to study developmental biology due to the fact that embryo development takes place independently of the maternal organism and that observations and experimental approaches are easy. Some amphibians like Xenopus became model organisms in this field. In the first part of this article, the differentiation of the gonads in amphibians and the mechanisms governing this process are reviewed. In the second part, the state of the art about sex reversal, which can be induced by steroid hormones in general and by temperature in some species, is presented. Also information about pollutants found in the environment that could interfere with the development of the amphibian reproductive apparatus or with their reproductive physiology is given. Such compounds could play a part in the amphibian decline, since in the wild, many amphibians are endangered species. © 2016 S. Karger AG, Basel.

  2. rRNA fragmentation induced by a yeast killer toxin.

    Science.gov (United States)

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

  3. Introduction to fragment-based drug discovery.

    Science.gov (United States)

    Erlanson, Daniel A

    2012-01-01

    Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.

  4. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  5. RAY TRACING RENDER MENGGUNAKAN FRAGMENT ANTI ALIASING

    Directory of Open Access Journals (Sweden)

    Febriliyan Samopa

    2008-07-01

    although there is some situation where the time effectiveness is equal. This is possible since the process of intersection searching on FAA needs additional time. Rendered images using FAA are relatively similar to those using OGSS.   Kata Kunci: Ray Tracing, Fragment Anti Aliasing, Ordered Grid Super Sampling, Render, Sampling, Jaggies

  6. Magmatic and fragmentation controls on volcanic ash surface chemistry

    Science.gov (United States)

    Ayris, Paul M.; Diplas, Spyros; Damby, David E.; Hornby, Adrian J.; Cimarelli, Corrado; Delmelle, Pierre; Scheu, Bettina; Dingwell, Donald B.

    2016-04-01

    partitioning effect, but crucially, disparities between surface and bulk chemistry remain evident. Simple glass-plagioclase mixing calculations suggest that this feature may indicate differences in bulk and surface mineral distributions; future QEMSCAN analysis will investigate this possibility further. Additionally, surface iron enrichments observed in our high temperature experiments suggest that hot oxidation effects can have a near-instantaneous, measurable effect on ash surface chemistry at the nanometre scale. Our preliminary results suggest that the chemical and mineral properties of the source magma, coupled with high temperature fragmentation processes, may have a significant influence on ash surface chemistry and mineralogy, and subsequently, on the post-eruptive alteration of ash particles and their reactivity within biotic and abiotic systems.

  7. The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

    Directory of Open Access Journals (Sweden)

    Tatsuya Ishikawa

    2017-06-01

    Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon

  8. HETC-3STEP included fragmentation process

    Energy Technology Data Exchange (ETDEWEB)

    Shigyo, Nobuhiro; Iga, Kiminori; Ishibashi, Kenji [Kyushu Univ., Fukuoka (Japan). Faculty of Engineering

    1997-03-01

    High Energy Transport Code (HETC) based on the cascade-evaporation model is modified to calculate the fragmentation cross section. For the cascade process, nucleon-nucleon cross sections are used for collision computation; effective in-medium-corrected cross sections are adopted instead of the original free-nucleon collision. The exciton model is adopted for improvement of backward nucleon-emission cross section for low-energy nucleon-incident events. The fragmentation reaction is incorporated into the original HETC as a subroutine set by the use of the systematics of the reaction. The modified HETC (HETC-3STEP/FRG) reproduces experimental fragment yields to a reasonable degree. (author)

  9. Gluon fragmentation into 3 PJ quarkonium

    International Nuclear Information System (INIS)

    Ma, J.P.

    1995-01-01

    The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs

  10. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2003-01-01

    Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)

  11. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  12. Aspect Ratio Dependence of Impact Fragmentation

    International Nuclear Information System (INIS)

    Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.

    1997-01-01

    A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society

  13. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2005-01-01

    Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)

  14. 49 CFR 230.89 - Reverse gear.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Reverse gear. 230.89 Section 230.89 Transportation... Reversing Gear § 230.89 Reverse gear. (a) General provisions. Reverse gear, reverse levers, and quadrants... quadrant. Proper counterbalance shall be provided for the valve gear. (b) Air-operated power reverse gear...

  15. Current perspectives in fragment-based lead discovery (FBLD)

    Science.gov (United States)

    Lamoree, Bas; Hubbard, Roderick E.

    2017-01-01

    It is over 20 years since the first fragment-based discovery projects were disclosed. The methods are now mature for most ‘conventional’ targets in drug discovery such as enzymes (kinases and proteases) but there has also been growing success on more challenging targets, such as disruption of protein–protein interactions. The main application is to identify tractable chemical startpoints that non-covalently modulate the activity of a biological molecule. In this essay, we overview current practice in the methods and discuss how they have had an impact in lead discovery – generating a large number of fragment-derived compounds that are in clinical trials and two medicines treating patients. In addition, we discuss some of the more recent applications of the methods in chemical biology – providing chemical tools to investigate biological molecules, mechanisms and systems. PMID:29118093

  16. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  17. Dihadron fragmentation function and its evolution

    International Nuclear Information System (INIS)

    Majumder, A.; Wang Xinnian

    2004-01-01

    Dihadron fragmentation functions and their evolution are studied in the process of e + e - annihilation. Under the collinear factorization approximation and facilitated by the cut-vertex technique, the two hadron inclusive cross section at leading order is shown to factorize into a short distance parton cross section and a long distance dihadron fragmentation function. We provide the definition of such a dihadron fragmentation function in terms of parton matrix elements and derive its Dokshitzer-Gribov-Lipatov-Altarelli-Parisi evolution equation at leading log. The evolution equation for the nonsinglet quark fragmentation function is solved numerically with a simple ansatz for the initial condition and results are presented for cases of physical interest

  18. A Current Logical Framework: The Propositional Fragment

    National Research Council Canada - National Science Library

    Watkins, Kevin

    2003-01-01

    We present the propositional fragment CLF of the Concurrent Logical Framework (CLF). CLF extends the Linear Logical Framework to allow the natural representation of concurrent computations in an object language...

  19. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  20. Integration of fragment screening and library design.

    Science.gov (United States)

    Siegal, Gregg; Ab, Eiso; Schultz, Jan

    2007-12-01

    With more than 10 years of practical experience and theoretical analysis, fragment-based drug discovery (FBDD) has entered the mainstream of the pharmaceutical and biotech industries. An array of biophysical techniques has been used to detect the weak interaction between a fragment and the target. Each technique presents its own requirements regarding the fragment collection and the target; therefore, in order to optimize the potential of FBDD, the nature of the target should be a driving factor for simultaneous development of both the library and the screening technology. A roadmap is now available to guide fragment-to-lead evolution when structural information is available. The next challenge is to apply FBDD to targets for which high-resolution structural information is not available.

  1. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  2. Quark fragmentation into 3PJ quarkonium

    International Nuclear Information System (INIS)

    Ma, J.P.

    1996-01-01

    The functions of parton fragmentation into 3 P J quarkonium at order α 2 s are calculated, where the parton can be a heavy or a light quark. The obtained functions explicitly satisfy the Altarelli-Parisi equation and they are divergent, behaving as z -1 near z = O. However, if one choses the renormalization scale as twice of the heavy quark mass, the fragmentation functions are regular over the whole range of z. 15 refs., 2 figs

  3. The lund Monte Carlo for jet fragmentation

    International Nuclear Information System (INIS)

    Sjoestrand, T.

    1982-03-01

    We present a Monte Carlo program based on the Lund model for jet fragmentation. Quark, gluon, diquark and hadron jets are considered. Special emphasis is put on the fragmentation of colour singlet jet systems, for which energy, momentum and flavour are conserved explicitly. The model for decays of unstable particles, in particular the weak decay of heavy hadrons, is described. The central part of the paper is a detailed description on how to use the FORTRAN 77 program. (Author)

  4. Fragmentation of Continental United States Forests

    Science.gov (United States)

    Kurt H. Riitters; James D. Wickham; Robert V. O' Neill; K. Bruce Jones; Elizabeth R. Smith; John W. Coulston; Timothy G. Wade; Jonathan H. Smith

    2002-01-01

    We report a multiple-scale analysis of forest fragmentation based on 30-m (0.09 ha pixel-1) land- cover maps for the conterminous United States. Each 0.09-ha unit of forest was classified according to fragmentation indexes measured within the surrounding landscape, for five landscape sizes including 2.25, 7.29, 65.61, 590.49, and 5314.41 ha....

  5. Fragmentation and bond strength of airborne diesel soot agglomerates

    Directory of Open Access Journals (Sweden)

    Messerer Armin

    2008-06-01

    Full Text Available Abstract Background The potential of diesel soot aerosol particles to break up into smaller units under mechanical stress was investigated by a direct impaction technique which measures the degree of fragmentation of individual agglomerates vs. impact energy. Diesel aerosol was generated by an idling diesel engine used for passenger vehicles. Both the aerosol emitted directly and aerosol that had undergone additional growth by Brownian coagulation ("aging" was investigated. Optionally a thermo-desoption technique at 280°C was used to remove all high-volatility and the majority of low-volatility HC adsorbates from the aerosol before aging. Results It was found that the primary soot agglomerates emitted directly from the engine could not be fragmented at all. Soot agglomerates permitted to grow additionally by Brownian coagulation of the primary emitted particles could be fragmented to a maximum of 75% and 60% respectively, depending on whether adsorbates were removed from their surface prior to aging or not. At most, these aged agglomerates could be broken down to roughly the size of the agglomerates from the primary emission. The energy required for a 50% fragmentation probability of all bonds within an agglomerate was reduced by roughly a factor of 2 when aging "dry" agglomerates. Average bond energies derived from the data were 0.52*10-16 and 1.2*10-16 J, respectively. This is about 2 orders of magnitude higher than estimates for pure van-der-Waals agglomerates, but agrees quite well with other observations. Conclusion Although direct conclusions regarding the behavior of inhaled diesel aerosol in contact with body fluids cannot be drawn from such measurements, the results imply that highly agglomerated soot aerosol particles are unlikely to break up into units smaller than roughly the size distribution emitted as tail pipe soot.

  6. Fragmentation and bond strength of airborne diesel soot agglomerates

    Science.gov (United States)

    Rothenbacher, Sonja; Messerer, Armin; Kasper, Gerhard

    2008-01-01

    Background The potential of diesel soot aerosol particles to break up into smaller units under mechanical stress was investigated by a direct impaction technique which measures the degree of fragmentation of individual agglomerates vs. impact energy. Diesel aerosol was generated by an idling diesel engine used for passenger vehicles. Both the aerosol emitted directly and aerosol that had undergone additional growth by Brownian coagulation ("aging") was investigated. Optionally a thermo-desoption technique at 280°C was used to remove all high-volatility and the majority of low-volatility HC adsorbates from the aerosol before aging. Results It was found that the primary soot agglomerates emitted directly from the engine could not be fragmented at all. Soot agglomerates permitted to grow additionally by Brownian coagulation of the primary emitted particles could be fragmented to a maximum of 75% and 60% respectively, depending on whether adsorbates were removed from their surface prior to aging or not. At most, these aged agglomerates could be broken down to roughly the size of the agglomerates from the primary emission. The energy required for a 50% fragmentation probability of all bonds within an agglomerate was reduced by roughly a factor of 2 when aging "dry" agglomerates. Average bond energies derived from the data were 0.52*10-16 and 1.2*10-16 J, respectively. This is about 2 orders of magnitude higher than estimates for pure van-der-Waals agglomerates, but agrees quite well with other observations. Conclusion Although direct conclusions regarding the behavior of inhaled diesel aerosol in contact with body fluids cannot be drawn from such measurements, the results imply that highly agglomerated soot aerosol particles are unlikely to break up into units smaller than roughly the size distribution emitted as tail pipe soot. PMID:18533015

  7. Microstructural characterization of pipe bomb fragments

    International Nuclear Information System (INIS)

    Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher

    2010-01-01

    Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.

  8. Fragmentation of molten core material by sodium

    International Nuclear Information System (INIS)

    Chu, T.Y.

    1982-01-01

    A series of scoping experiments was performed to study the fragmentation of prototypic high temperature melts in sodium. The quantity of melt involved was at least one order of magnitude larger than previous experiments. Two modes of contact were used: melt streaming into sodium and sodium into melt. The average bulk fragment size distribution was found to be in the range of previous data and the average size distribution was found to be insensitive to mode of contact. SEM studies showed that the metal component typically fragmented in the molten phase while the oxide component fragmented in the solid phase. For UO 2 -ZrO 2 /stainless steel melts no sigificant spatial separation of the metal and oxide was observed. The fragment size distribution was stratified vertically in the debris bed in all cases. While the bulk fragment size showed generally consistent trends, the individual experiments were sufficiently different to cause different degrees of stratification in the debris bed. For the highly stratified beds the permeability can decrease by as much as a factor of 20 from the bottom to the top of the bed

  9. Field reversal experiments (FRX)

    International Nuclear Information System (INIS)

    Linford, R.K.; Armstrong, W.T.; Platts, D.A.; Sherwood, E.G.

    1978-01-01

    The equilibrium, confinement, and stability properties of the reversed-field configuration (RFC) are being studied in two theta-pinch facilities. The RFC is an elongated toroidal plasma confined in a purely poloidal field geometry. The open field lines of the linear theta pinch support the closed-field RFC much like the vertical field centers the toroidal plasma in a tokamak. Depending on stability and confinement properties, the RFC might be used to greatly reduce the axial losses in linear fusion devices such as mirrors, theta pinches, and liners. The FRX systems produce RFC's with a major radius R = 2-6 cm, minor radius a approximately 2 cm, and a total length l approximately 35 cm. The observed temperatures are T/sub e/ approximately 100 eV and T/sub i/ = 150-350 eV with a peak density n approximately 2 x 10 15 cm -3 . After the plasma reaches equilibrium, the RFC remains stable for up to 30 μs followed by the rapid growth of the rotational m = 2 instability, which terminates the confinement. During the stable equilibrium, the particle and energy confinement times are more than 10 times longer than in an open-field system. The behavior of the m = 2 mode qualitatively agrees with the theoretically predicted instability for rotational velocities exceeding some critical value

  10. Field reversal experiments (FRX)

    International Nuclear Information System (INIS)

    Linford, R.K.; Armstrong, W.T.; Platts, D.A.; Sherwood, E.G.

    1979-01-01

    The equilibrium, confinement, and stability properties of the reversed-field configuration (RFC) are being studied in two theta-pinch facilities. The RFC is an elongated toroidal plasma confined in a purely poloidal field geometry. The open field lines of the linear theta pinch support the closed-field RFC much like the vertical field centres the toroidal plasma in a tokamak. Depending on stability and confinement properties, the RFC might be used to greatly reduce the axial losses in linear fusion devices such as mirrors, theta pinches, and liners. The FRX systems produce RFCs with a major radius R=2-6cm, a minor radius a approximately 2cm, and a total length l approximately 35cm. The observed temperatures are Tsub(e) approximately 100eV and Tsub(i)=150-350eV with a peak density n approximately 2x10 15 cm -3 . After the plasma has reached equilibrium, the RFC remains stable for up to 30μs, followed by the rapid growth of the rotational m=2 instability, which terminates the confinement. During the stable equilibrium, the particle and energy confinement times are more than 10 times longer than in an open-field system. The behaviour of the m=2 mode agrees qualitatively with the theoretically predicted instability for rotational velocities exceeding some critical value. (author)

  11. Adiabatic process reversibility: microscopic and macroscopic views

    International Nuclear Information System (INIS)

    Anacleto, Joaquim; Pereira, Mario G

    2009-01-01

    The reversibility of adiabatic processes was recently addressed by two publications. In the first (Miranda 2008 Eur. J. Phys. 29 937-43), an equation was derived relating the initial and final volumes and temperatures for adiabatic expansions of an ideal gas, using a microscopic approach. In that relation the parameter r accounts for the process reversibility, ranging between 0 and 1, which corresponds to the free and reversible expansion, respectively. In the second (Anacleto and Pereira 2009 Eur. J. Phys. 30 177-83), the authors have shown that thermodynamics can effectively and efficiently be used to obtain the general law for adiabatic processes carried out by an ideal gas, including compressions, for which r≥1. The present work integrates and extends the aforementioned studies, providing thus further insights into the analysis of the adiabatic process. It is shown that Miranda's work is wholly valid for compressions. In addition, it is demonstrated that the adiabatic reversibility coefficient given in terms of the piston velocity and the root mean square velocity of the gas particles is equivalent to the macroscopic description, given just by the quotient between surroundings and system pressure values. (letters and comments)

  12. Comprehensive preimplantation genetic screening and sperm deoxyribonucleic acid fragmentation from three males carrying balanced chromosome rearrangements.

    Science.gov (United States)

    Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima

    2015-09-01

    To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.

  13. Collins fragmentation function for pions and kaons in a spectator model

    Energy Technology Data Exchange (ETDEWEB)

    Bacchetta, A. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Gamberg, L.P. [Penn State Univ., Berks, PA (United States). Dept. of Physics; Goldstein, G.R. [Tufts Univ., Medford, MA (United States). Dept. of Physics and Astronomy; Mukherjee, A. [Indian Institute of Technology Bombay, Mumbai (India). Physics Dept.

    2007-07-15

    We calculate the Collins fragmentation function in the framework of a spectator model with pseudoscalar pion-quark coupling and a Gaussian form factor at the vertex. We determine the model parameters by fitting the unpolarized fragmentation function for pions and kaons. We show that the Collins function for the pions in this model is in reasonable agreement with recent parametrizations obtained by fits of the available data. In addition, we compute for the first time the Collins function for the kaons. (orig.)

  14. Towards a reversible functional language

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2012-01-01

    /equality operator also simplifies inverse computation and program inversion. We discuss the advantages of a reversible functional language using example programs, including run-length encoding. Program inversion is seen to be as lightweight as for imperative reversible languages and realized by recursive descent...

  15. Reverse engineering of RFID devices

    NARCIS (Netherlands)

    Bokslag, W.

    2015-01-01

    This paper discusses the relevance and potential impact of both RFID and reverse engineering of RFID technology, followed by a discussion of common protocols and internals of RFID technology. The focus of the paper is on providing an overview of the different approaches to reverse engineering RFID

  16. How decision reversibility affects motivation

    NARCIS (Netherlands)

    Bullens, L.; van Harreveld, F.; Förster, J.; Higgins, T.E.

    2014-01-01

    The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making,

  17. Enzymatic reactions in reversed micelles

    NARCIS (Netherlands)

    Hilhorst, M.H.

    1984-01-01

    It has been recognised that enzymes in reversed micelles have potential for application in chemical synthesis. Before these expectations will be realised many problems must be overcome. This thesis deals with some of them.
    In Chapter 1 the present knowledge about reversed micelles and

  18. Reversible networks in supramolecular polymers

    NARCIS (Netherlands)

    Havermans - van Beek, D.J.M.

    2007-01-01

    Non–covalent interactions between low molecular weight polymers form the basis of supramolecular polymers. The material properties of such polymers are determined by the strength and lifetime of the non–covalent reversible interactions. Due to the reversibility of the interactions between the low

  19. Reverse genetics of avian metapneumoviruses

    Science.gov (United States)

    An overview of avian metapneumovirus (aMPV) infection in turkeys and development of a reverse genetics system for aMPV subgroup C (aMPV-C) virus will be presented. By using reverse genetics technology, we generated recombinant aMPV-C viruses containing a different length of glycoprotein (G) gene or...

  20. MODELS OF PROJECT REVERSE ENGINEERING

    Directory of Open Access Journals (Sweden)

    Віктор Володимирович ІВАНОВ

    2017-03-01

    Full Text Available Reverse engineering decided important scientific and technical problems of increasing the cost of the existing technical product by transforming it into a product with other features or design. Search ideas of the new application of existing products on the base of heuristic analysis were created. The concept of reverse engineering and its division into three types: conceptual, aggregate and complete was expanded. The use of heuristic methods for reverse engineering concept was showed. The modification model of Reverse engineering based on the model of РМВОК was developed. Our model includes two new phases: identification and transformation. At the identification phase, technical control is made. At the transformation phase, search heuristic idea of the new applied existing technical product was made. The model of execution phase that included heuristic methods, metrological equipment, and CAD/CAM/CAE program complex was created. The model that connected economic indicators of reverse engineering project was developed.

  1. What do reversible programs compute?

    DEFF Research Database (Denmark)

    Axelsen, Holger Bock; Glück, Robert

    2011-01-01

    Reversible computing is the study of computation models that exhibit both forward and backward determinism. Understanding the fundamental properties of such models is not only relevant for reversible programming, but has also been found important in other fields, e.g., bidirectional model...... transformation, program transformations such as inversion, and general static prediction of program properties. Historically, work on reversible computing has focussed on reversible simulations of irreversible computations. Here, we take the viewpoint that the property of reversibility itself should...... are not strictly classically universal, but that they support another notion of universality; we call this RTM-universality. Thus, even though the RTMs are sub-universal in the classical sense, they are powerful enough as to include a self-interpreter. Lifting this to other computation models, we propose r...

  2. Fundamentals of reversible flowchart languages

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2016-01-01

    Abstract This paper presents the fundamentals of reversible flowcharts. They are intended to naturally represent the structure and control flow of reversible (imperative) programming languages in a simple computation model, in the same way classical flowcharts do for conventional languages......, structured reversible flowcharts are as expressive as unstructured ones, as shown by a reversible version of the classic Structured Program Theorem. We illustrate how reversible flowcharts can be concretized with two example programming languages, complete with syntax and semantics: a low-level unstructured...... language and a high-level structured language. We introduce concrete tools such as program inverters and translators for both languages, which follow the structure suggested by the flowchart model. To further illustrate the different concepts and tools brought together in this paper, we present two major...

  3. Energy damping and intermediate velocity fragment emission in peripheral Kr+Au collisions at 43 MeV/u

    International Nuclear Information System (INIS)

    Stuttge, L.; Adloff, J.C.; Bilwes, B.; Bilwes, R.; Cosmo, F.; Glaser, M.; Rudolf, G.; Scheibling, F.

    1991-01-01

    Triple and four-fold coincidences among fragments have been measured in the reaction 197 Au( 84 Kr,X) at 43 MeV/u. All events showing the projectile-like nucleus and fission fragments of the target-like nucleus, and all events with one additional intermediate velocity fragment, were analysed in the frame of a dissipative collision and a participant-spectator model. The mechanism is basically that of a dissipative collision but the emission of the intermediate velocity fragment by the target differs from an equilibrated evaporation. (author) 16 refs., 10 figs

  4. Differential fragmentation patterns of pectin oligogalacturonides observed by nanoelectrospray quadrupole ion-trap mass spectrometry using automated spectra interpretation

    DEFF Research Database (Denmark)

    Mutenda, Kudzai E; Matthiesen, Rune; Roepstorff, Peter

    2007-01-01

    Oligogalacturonides of different degrees of polymerization (DP) and methyl esterification (DE) were structurally analyzed by nanoESI quadrupole ion-trap mass spectrometry. The fragmentation patterns of the oligogalacturonides were compared using the program 'Virtual Expert Mass Spectrometrist...... with free carboxylic acid groups underwent higher water loss compared to fully methyl-esterified oligogalacturonides under the same fragmentation conditions. Cross-ring cleavage, in which fragmentation occurs across the ring system of the galacturonate residue and signified by unique mass losses...... water loss than methyl-esterified ones will be postulated. In addition, the VEMS program was extended to automatically interpret and assign the fragment ions peaks generated in this study....

  5. Computational medicinal chemistry in fragment-based drug discovery: what, how and when.

    Science.gov (United States)

    Rabal, Obdulia; Urbano-Cuadrado, Manuel; Oyarzabal, Julen

    2011-01-01

    The use of fragment-based drug discovery (FBDD) has increased in the last decade due to the encouraging results obtained to date. In this scenario, computational approaches, together with experimental information, play an important role to guide and speed up the process. By default, FBDD is generally considered as a constructive approach. However, such additive behavior is not always present, therefore, simple fragment maturation will not always deliver the expected results. In this review, computational approaches utilized in FBDD are reported together with real case studies, where applicability domains are exemplified, in order to analyze them, and then, maximize their performance and reliability. Thus, a proper use of these computational tools can minimize misleading conclusions, keeping the credit on FBDD strategy, as well as achieve higher impact in the drug-discovery process. FBDD goes one step beyond a simple constructive approach. A broad set of computational tools: docking, R group quantitative structure-activity relationship, fragmentation tools, fragments management tools, patents analysis and fragment-hopping, for example, can be utilized in FBDD, providing a clear positive impact if they are utilized in the proper scenario - what, how and when. An initial assessment of additive/non-additive behavior is a critical point to define the most convenient approach for fragments elaboration.

  6. Social network fragmentation and community health.

    Science.gov (United States)

    Chami, Goylette F; Ahnert, Sebastian E; Kabatereine, Narcis B; Tukahebwa, Edridah M

    2017-09-05

    Community health interventions often seek to intentionally destroy paths between individuals to prevent the spread of infectious diseases. Immunizing individuals through direct vaccination or the provision of health education prevents pathogen transmission and the propagation of misinformation concerning medical treatments. However, it remains an open question whether network-based strategies should be used in place of conventional field approaches to target individuals for medical treatment in low-income countries. We collected complete friendship and health advice networks in 17 rural villages of Mayuge District, Uganda. Here we show that acquaintance algorithms, i.e., selecting neighbors of randomly selected nodes, were systematically more efficient in fragmenting all networks than targeting well-established community roles, i.e., health workers, village government members, and schoolteachers. Additionally, community roles were not good proxy indicators of physical proximity to other households or connections to many sick people. We also show that acquaintance algorithms were effective in offsetting potential noncompliance with deworming treatments for 16,357 individuals during mass drug administration (MDA). Health advice networks were destroyed more easily than friendship networks. Only an average of 32% of nodes were removed from health advice networks to reduce the percentage of nodes at risk for refusing treatment in MDA to below 25%. Treatment compliance of at least 75% is needed in MDA to control human morbidity attributable to parasitic worms and progress toward elimination. Our findings point toward the potential use of network-based approaches as an alternative to role-based strategies for targeting individuals in rural health interventions.

  7. The Geomagnetic Field During a Reversal

    Science.gov (United States)

    Heirtzler, James R.

    2003-01-01

    By modifying the IGRF it is possible to learn what may happen to the geomagnetic field during a geomagnetic reversal. If the entire IGRF reverses then the declination and inclination only reverse when the field strength is zero. If only the dipole component of the IGRF reverses a large geomagnetic field remains when the dipole component is zero and he direction of the field at the end of the reversal is not exactly reversed from the directions at the beginning of the reversal.

  8. Fragmentation of chromatin with 125I radioactive disintegrations

    International Nuclear Information System (INIS)

    Turner, G.N.; Nobis, P.; Dewey, W.C.

    1976-01-01

    The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated

  9. Neighborhood Economic Deprivation and Social Fragmentation: Associations With Children's Sleep.

    Science.gov (United States)

    Bagley, Erika J; Fuller-Rowell, Thomas E; Saini, Ekjyot K; Philbrook, Lauren E; El-Sheikh, Mona

    2016-12-09

    A growing body of work indicates that experiences of neighborhood disadvantage place children at risk for poor sleep. This study aimed to examine how both neighborhood economic deprivation (a measure of poverty) and social fragmentation (an index of instability) are associated with objective measures of the length and quality of children's sleep. Participants were 210 children (54.3% boys) living predominantly in small towns and semirural communities in Alabama. On average children were 11.3 years old (SD = .63); 66.7% of the children were European American and 33.3% were African American. The sample was socioeconomically diverse with 67.9% of the participants living at or below the poverty line and 32.1% from lower-middle-class or middle-class families. Indicators of neighborhood characteristics were derived from the 2012 American Community Survey and composited to create two variables representing neighborhood economic deprivation and social fragmentation. Child sleep period, actual sleep minutes, and efficiency were examined using actigraphy. Higher levels of neighborhood economic deprivation were associated with fewer sleep minutes and poorer sleep efficiency. More neighborhood social fragmentation was also linked with poorer sleep efficiency. Analyses controlled for demographic characteristics, child health, and family socioeconomic status. Findings indicate that living in economically and socially disadvantaged neighborhoods predicts risk for shorter and lower-quality sleep in children. Examination of community context in addition to family and individual characteristics may provide a more comprehensive understanding of the factors shaping child sleep.

  10. Detection of secondary binding sites in proteins using fragment screening.

    Science.gov (United States)

    Ludlow, R Frederick; Verdonk, Marcel L; Saini, Harpreet K; Tickle, Ian J; Jhoti, Harren

    2015-12-29

    Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets.

  11. Research on the Environmental Performance Evaluation of Electronic Waste Reverse Logistics Enterprise

    Science.gov (United States)

    Yang, Yu-Xiang; Chen, Fei-Yang; Tong, Tong

    According to the characteristic of e-waste reverse logistics, environmental performance evaluation system of electronic waste reverse logistics enterprise is proposed. We use fuzzy analytic hierarchy process method to evaluate the system. In addition, this paper analyzes the enterprise X, as an example, to discuss the evaluation method. It's important to point out attributes and indexes which should be strengthen during the process of ewaste reverse logistics and provide guidance suggestions to domestic e-waste reverse logistics enterprises.

  12. Role of mTOR, Bad, and Survivin in RasGAP Fragment N-Mediated Cell Protection

    Science.gov (United States)

    Yang, Jiang-Yan; Widmann, Christian

    2013-01-01

    Partial cleavage of p120 RasGAP by caspase-3 in stressed cells generates an N-terminal fragment, called fragment N, which activates an anti-apoptotic Akt-dependent survival response. Akt regulates several effectors but which of these mediate fragment N-dependent cell protection has not been defined yet. Here we have investigated the role of mTORC1, Bad, and survivin in the capacity of fragment N to protect cells from apoptosis. Neither rapamycin, an inhibitor of mTORC1, nor silencing of raptor, a subunit of the mTORC1 complex, altered the ability of fragment N from inhibiting cisplatin- and Fas ligand-induced death. Cells lacking Bad, despite displaying a stronger resistance to apoptosis, were still protected by fragment N against cisplatin-induced death. Fragment N was also able to protect cells from Fas ligand-induced death in conditions where Bad plays no role in apoptosis regulation. Fragment N expression in cells did neither modulate survivin mRNA nor its protein expression. Moreover, the expression of cytoplasmic survivin, known to exert anti-apoptotic actions in cells, still occurred in UV-B-irradiated epidermis of mouse expressing a caspase-3-resistant RasGAP mutant that cannot produce fragment N. Additionally, survivin function in cell cycle progression was not affected by fragment N. These results indicate that, taken individually, mTOR, Bad, or Survivin are not required for fragment N to protect cells from cell death. We conclude that downstream targets of Akt other than mTORC1, Bad, or survivin mediate fragment N-induced protection or that several Akt effectors can compensate for each other to induce the pro-survival fragment N-dependent response. PMID:23826368

  13. Tropical forest fragmentation affects floral visitors but not the structure of individual-based palm-pollinator networks.

    Science.gov (United States)

    Dáttilo, Wesley; Aguirre, Armando; Quesada, Mauricio; Dirzo, Rodolfo

    2015-01-01

    Despite increasing knowledge about the effects of habitat loss on pollinators in natural landscapes, information is very limited regarding the underlying mechanisms of forest fragmentation affecting plant-pollinator interactions in such landscapes. Here, we used a network approach to describe the effects of forest fragmentation on the patterns of interactions involving the understory dominant palm Astrocaryum mexicanum (Arecaceae) and its floral visitors (including both effective and non-effective pollinators) at the individual level in a Mexican tropical rainforest landscape. Specifically, we asked: (i) Does fragment size affect the structure of individual-based plant-pollinator networks? (ii) Does the core of highly interacting visitor species change along the fragmentation size gradient? (iii) Does forest fragment size influence the abundance of effective pollinators of A. mexicanum? We found that fragment size did not affect the topological structure of the individual-based palm-pollinator network. Furthermore, while the composition of peripheral non-effective pollinators changed depending on fragment size, effective core generalist species of pollinators remained stable. We also observed that both abundance and variance of effective pollinators of male and female flowers of A. mexicanum increased with forest fragment size. These findings indicate that the presence of effective pollinators in the core of all forest fragments could keep the network structure stable along the gradient of forest fragmentation. In addition, pollination of A. mexicanum could be more effective in larger fragments, since the greater abundance of pollinators in these fragments may increase the amount of pollen and diversity of pollen donors between flowers of individual plants. Given the prevalence of fragmentation in tropical ecosystems, our results indicate that the current patterns of land use will have consequences on the underlying mechanisms of pollination in remnant forests.

  14. Tropical forest fragmentation affects floral visitors but not the structure of individual-based palm-pollinator networks.

    Directory of Open Access Journals (Sweden)

    Wesley Dáttilo

    Full Text Available Despite increasing knowledge about the effects of habitat loss on pollinators in natural landscapes, information is very limited regarding the underlying mechanisms of forest fragmentation affecting plant-pollinator interactions in such landscapes. Here, we used a network approach to describe the effects of forest fragmentation on the patterns of interactions involving the understory dominant palm Astrocaryum mexicanum (Arecaceae and its floral visitors (including both effective and non-effective pollinators at the individual level in a Mexican tropical rainforest landscape. Specifically, we asked: (i Does fragment size affect the structure of individual-based plant-pollinator networks? (ii Does the core of highly interacting visitor species change along the fragmentation size gradient? (iii Does forest fragment size influence the abundance of effective pollinators of A. mexicanum? We found that fragment size did not affect the topological structure of the individual-based palm-pollinator network. Furthermore, while the composition of peripheral non-effective pollinators changed depending on fragment size, effective core generalist species of pollinators remained stable. We also observed that both abundance and variance of effective pollinators of male and female flowers of A. mexicanum increased with forest fragment size. These findings indicate that the presence of effective pollinators in the core of all forest fragments could keep the network structure stable along the gradient of forest fragmentation. In addition, pollination of A. mexicanum could be more effective in larger fragments, since the greater abundance of pollinators in these fragments may increase the amount of pollen and diversity of pollen donors between flowers of individual plants. Given the prevalence of fragmentation in tropical ecosystems, our results indicate that the current patterns of land use will have consequences on the underlying mechanisms of pollination in

  15. Comminuted Distal Radial Fracture with Large Rotated Palmar Medial Osteochondral Fragment in the Joint.

    Science.gov (United States)

    Gökkus, Kemal; Sagtas, Ergin; Kesgin, Engin; Aydin, Ahmet Turan

    2018-01-01

    Intra-articular distal radius fractures have long been massively discussed in the literature, but regarding to fractures that possess rotated volar medial fragment in the joint a few amount papers has been written. In this article, we would like to emphasize the significance of the rotated palmar medial (lunate facet) fragment. A 39-year-old man fell from a height of about 3 m and landed on his right outstretched hand; within 40 min, he arrived at our clinic presenting with a severe pain and swelling in his right wrist. Initial X-rays of the wrist revealed dorsal subluxation of the radiocarpal joint with dorsal comminution of the radial articular surface and fracture of the radial styloid process, with (nearly inverted) ~ 140-150° rotation of the palmar medial fragment. With an additional volar approach, the fragment reduced and stabilized with two K-wires and wrist immobilized in external fixator. The patient returned to daily activities without any discomfort and pain after the 1 year from the surgery. Overlooking of palmar rotated osteochondral fragment will cause deficiency to build proper pre-operative strategy to approach the reduction of the fragment. The incompetence of reduction will deteriorate the articular surface and lead to early osteoarthritis of the wrist. The surgeon should detect this fragment and should be familiar with volar approaches of the wrist. Above average surgical experience would be needed for successful reduction.

  16. Adipose tissue-derived microvascular fragments from aged donors exhibit an impaired vascularisation capacity

    Directory of Open Access Journals (Sweden)

    MW Laschke

    2014-10-01

    Full Text Available Adipose tissue-derived microvascular fragments are promising vascularisation units for applications in the field of tissue engineering. Elderly patients are the major future target population of such applications due to an increasing human life expectancy. Therefore, we herein investigated the effect of aging on the fragments’ vascularisation capacity. Microvascular fragments were isolated from epididymal fat pads of adult (8 months and aged (16 months C57BL/6 donor mice. These fragments were seeded onto porous polyurethane scaffolds, which were implanted into dorsal skinfold chambers to study their vascularisation using intravital fluorescence microscopy, histology and immunohistochemistry. Scaffolds seeded with fragments from aged donors exhibited a significantly lower functional microvessel density and intravascular blood flow velocity. This was associated with an impaired vessel maturation, as indicated by vessel wall irregularities, constantly elevated diameters and a lower fraction of CD31/α-smooth muscle actin double positive microvessels in the implants’ border and centre zones. Additional in vitro analyses revealed that microvascular fragments from adult and aged donors do not differ in their stem cell content as well as in their release of angiogenic growth factors, survival and proliferative activity under hypoxic conditions. However, fragments from aged donors exhibit a significantly lower number of matrix metalloproteinase -9-positive perivascular cells. Taken together, these findings demonstrate that aging is a crucial determinant for the vascularisation capacity of isolated microvascular fragments.

  17. Gas-phase structure and fragmentation pathways of singly protonated peptides with N-terminal arginine.

    Science.gov (United States)

    Bythell, Benjamin J; Csonka, István P; Suhai, Sándor; Barofsky, Douglas F; Paizs, Béla

    2010-11-25

    The gas-phase structures and fragmentation pathways of the singly protonated peptide arginylglycylaspartic acid (RGD) are investigated by means of collision-induced-dissociation (CID) and detailed molecular mechanics and density functional theory (DFT) calculations. It is demonstrated that despite the ionizing proton being strongly sequestered at the guanidine group, protonated RGD can easily be fragmented on charge directed fragmentation pathways. This is due to facile mobilization of the C-terminal or aspartic acid COOH protons thereby generating salt-bridge (SB) stabilized structures. These SB intermediates can directly fragment to generate b(2) ions or facilely rearrange to form anhydrides from which both b(2) and b(2)+H(2)O fragments can be formed. The salt-bridge stabilized and anhydride transition structures (TSs) necessary to form b(2) and b(2)+H(2)O are much lower in energy than their traditional charge solvated counterparts. These mechanisms provide compelling evidence of the role of SB and anhydride structures in protonated peptide fragmentation which complements and supports our recent findings for tryptic systems (Bythell, B. J.; Suhai, S.; Somogyi, A.; Paizs, B. J. Am. Chem. Soc. 2009, 131, 14057-14065.). In addition to these findings we also report on the mechanisms for the formation of the b(1) ion, neutral loss (H(2)O, NH(3), guanidine) fragment ions, and the d(3) ion.

  18. Global-Scale Patterns of Forest Fragmentation

    Directory of Open Access Journals (Sweden)

    Kurt Riitters

    2000-12-01

    Full Text Available We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 x 9 pixels, "small" scale to 59,049 km 2 (243 x 243 pixels, "large" scale were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe-Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types and Europe-Asia (four types, in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland. The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf.

  19. Global-scale patterns of forest fragmentation

    Science.gov (United States)

    Riitters, K.; Wickham, J.; O'Neill, R.; Jones, B.; Smith, E.

    2000-01-01

    We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 ?? 9 pixels, "small" scale) to 59,049 km 2 (243 ?? 243 pixels, "large" scale) were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined) from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe - Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types) and Europe - Asia (four types), in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland). The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf. Copyright ?? 2000 by The Resilience Alliance.

  20. Impact fragmentation of a brittle metal compact

    Science.gov (United States)

    Tang, Megan; Hooper, Joseph P.

    2018-05-01

    The fragmentation behavior of a metal powder compact which is ductile in compression but brittle in tension is studied via impact experiments and analytical models. Consolidated metal compacts were prepared via cold-isostatic pressing of powder at 380 MPa followed by moderate annealing at 365 °C. The resulting zinc material is ductile and strain-hardening in high-rate uniaxial compression like a traditional metal, but is elastic-brittle in tension with a fracture toughness comparable to a ceramic. Cylindrical samples were launched up to 800 m/s in a gas gun into thin aluminum perforation targets, subjecting the projectile to a complex multiaxial and time-dependent stress state that leads to catastrophic fracture. A soft-catch mechanism using low-density artificial snow was developed to recover the impact debris, and collected fragments were analyzed to determine their size distribution down to 30 μm. Though brittle fracture occurs along original particle boundaries, no power-law fragmentation behavior was observed as is seen in other low-toughness materials. An analytical theory is developed to predict the characteristic fragment size accounting for both the sharp onset of fragmentation and the effect of increasing impact velocity.

  1. Rock fragmentation control in opencast blasting

    Directory of Open Access Journals (Sweden)

    P.K. Singh

    2016-04-01

    Full Text Available The blasting operation plays a pivotal role in the overall economics of opencast mines. The blasting sub-system affects all the other associated sub-systems, i.e. loading, transport, crushing and milling operations. Fragmentation control through effective blast design and its effect on productivity are the challenging tasks for practicing blasting engineer due to inadequate knowledge of actual explosive energy released in the borehole, varying initiation practice in blast design and its effect on explosive energy release characteristic. This paper describes the result of a systematic study on the impact of blast design parameters on rock fragmentation at three mines in India. The mines use draglines and shovel–dumper combination for removal of overburden. Despite its pivotal role in controlling the overall economics of a mining operation, the expected blasting performance is often judged almost exclusively on the basis of poorly defined parameters such as powder factor and is often qualitative which results in very subjective assessment of blasting performance. Such an approach is very poor substitutes for accurate assessment of explosive and blasting performance. Ninety one blasts were conducted with varying blast designs and charging patterns, and their impacts on the rock fragmentation were documented. A high-speed camera was deployed to record the detonation sequences of the blasts. The efficiency of the loading machines was also correlated with the mean fragment size obtained from the fragmentation analyses.

  2. Molten aluminum alloy fuel fragmentation experiments

    International Nuclear Information System (INIS)

    Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.

    1992-01-01

    Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water

  3. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Simulations of High Speed Fragment Trajectories

    Science.gov (United States)

    Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis

    2017-11-01

    Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.

  5. Universal Rim Thickness in Unsteady Sheet Fragmentation

    Science.gov (United States)

    Wang, Y.; Dandekar, R.; Bustos, N.; Poulain, S.; Bourouiba, L.

    2018-05-01

    Unsteady fragmentation of a fluid bulk into droplets is important for epidemiology as it governs the transport of pathogens from sneezes and coughs, or from contaminated crops in agriculture. It is also ubiquitous in industrial processes such as paint, coating, and combustion. Unsteady fragmentation is distinct from steady fragmentation on which most theoretical efforts have been focused thus far. We address this gap by studying a canonical unsteady fragmentation process: the breakup from a drop impact on a finite surface where the drop fluid is transferred to a free expanding sheet of time-varying properties and bounded by a rim of time-varying thickness. The continuous rim destabilization selects the final spray droplets, yet this process remains poorly understood. We combine theory with advanced image analysis to study the unsteady rim destabilization. We show that, at all times, the rim thickness is governed by a local instantaneous Bond number equal to unity, defined with the instantaneous, local, unsteady rim acceleration. This criterion is found to be robust and universal for a family of unsteady inviscid fluid sheet fragmentation phenomena, from impacts of drops on various surface geometries to impacts on films. We discuss under which viscous and viscoelastic conditions the criterion continues to govern the unsteady rim thickness.

  6. How decision reversibility affects motivation.

    Science.gov (United States)

    Bullens, Lottie; van Harreveld, Frenk; Förster, Jens; Higgins, Tory E

    2014-04-01

    The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making, strengthening prevention-related motivation relatively more than promotion-related motivation. If so, then decision reversibility should have effects associated with the relative differences between prevention and promotion motivation. In 5 studies, we manipulated the reversibility of a decision and used different indicators of regulatory focus motivation to test these predictions. Specifically, Study 1 tested for differences in participants' preference for approach versus avoidance strategies toward a desired end state. In Study 2, we used speed and accuracy performance as indicators of participants' regulatory motivation, and in Study 3, we measured global versus local reaction time performance. In Study 4, we approached the research question in a different way, making use of the value-from-fit hypothesis (Higgins, 2000, 2002). We tested whether a fit between chronic regulatory focus and focus induced by the reversibility of the decision increased participants' subjective positive feelings about the decision outcome. Finally, in Study 5, we tested whether regulatory motivation, induced by decision reversibility, also influenced participants' preference in specific product features. The results generally support our hypothesis showing that, compared to irreversible decisions, reversible decisions strengthen a prevention focus more than a promotion focus. Implications for research on decision making are discussed.

  7. Reverse osmosis membrane allows in situ regeneration

    International Nuclear Information System (INIS)

    Bonhomme, N.; Menjeaud, C.; Poyet, C.

    1989-01-01

    The use of mineral membranes on metallic supports has provided a novel solution to the problem of filtration by the reverse osmosis process. A new reverse osmosis membrane is described which is capable of resisting high operational temperatures (120 0 C), fluctuations in pH(3 to 12) and high pressure (100 bar), as well as significant chlorine concentrations. In addition, the membrane can be regenerated in-situ on the same porous metal support. Numerous membranes can thus be used over the multi-year life of the porous support. Moreover, accidental damage to the membrane is of no great consequence as the membrane itself can be easily replaced. The life of the installation can thus be extended and the overall cost of filtration reduced. The membrane's various applications include water and effluent treatment in the nuclear power industry. (author)

  8. Supercritical fluid reverse micelle separation

    Science.gov (United States)

    Fulton, J.L.; Smith, R.D.

    1993-11-30

    A method of separating solute material from a polar fluid in a first polar fluid phase is provided. The method comprises combining a polar fluid, a second fluid that is a gas at standard temperature and pressure and has a critical density, and a surfactant. The solute material is dissolved in the polar fluid to define the first polar fluid phase. The combined polar and second fluids, surfactant, and solute material dissolved in the polar fluid is maintained under near critical or supercritical temperature and pressure conditions such that the density of the second fluid exceeds the critical density thereof. In this way, a reverse micelle system defining a reverse micelle solvent is formed which comprises a continuous phase in the second fluid and a plurality of reverse micelles dispersed in the continuous phase. The solute material is dissolved in the polar fluid and is in chemical equilibrium with the reverse micelles. The first polar fluid phase and the continuous phase are immiscible. The reverse micelles each comprise a dynamic aggregate of surfactant molecules surrounding a core of the polar fluid. The reverse micelle solvent has a polar fluid-to-surfactant molar ratio W, which can vary over a range having a maximum ratio W[sub o] that determines the maximum size of the reverse micelles. The maximum ratio W[sub o] of the reverse micelle solvent is then varied, and the solute material from the first polar fluid phase is transported into the reverse micelles in the continuous phase at an extraction efficiency determined by the critical or supercritical conditions. 27 figures.

  9. Reversible photo-induced trap formation in mixed-halide hybrid perovskites for photovoltaics† †Electronic supplementary information (ESI) available: Experimental details, PL, PDS spectra and XRD patterns. See DOI: 10.1039/c4sc03141e Click here for additional data file.

    Science.gov (United States)

    Hoke, Eric T.; Slotcavage, Daniel J.; Dohner, Emma R.; Bowring, Andrea R.

    2015-01-01

    We report on reversible, light-induced transformations in (CH3NH3)Pb(BrxI1–x)3. Photoluminescence (PL) spectra of these perovskites develop a new, red-shifted peak at 1.68 eV that grows in intensity under constant, 1-sun illumination in less than a minute. This is accompanied by an increase in sub-bandgap absorption at ∼1.7 eV, indicating the formation of luminescent trap states. Light soaking causes a splitting of X-ray diffraction (XRD) peaks, suggesting segregation into two crystalline phases. Surprisingly, these photo-induced changes are fully reversible; the XRD patterns and the PL and absorption spectra revert to their initial states after the materials are left for a few minutes in the dark. We speculate that photoexcitation may cause halide segregation into iodide-rich minority and bromide-enriched majority domains, the former acting as a recombination center trap. This instability may limit achievable voltages from some mixed-halide perovskite solar cells and could have implications for the photostability of halide perovskites used in optoelectronics. PMID:28706629

  10. Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

    Science.gov (United States)

    Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

    2015-06-01

    A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

  11. An Amazonian rainforest and its fragments as a laboratory of global change.

    Science.gov (United States)

    Laurance, William F; Camargo, José L C; Fearnside, Philip M; Lovejoy, Thomas E; Williamson, G Bruce; Mesquita, Rita C G; Meyer, Christoph F J; Bobrowiec, Paulo E D; Laurance, Susan G W

    2018-02-01

    We synthesize findings from one of the world's largest and longest-running experimental investigations, the Biological Dynamics of Forest Fragments Project (BDFFP). Spanning an area of ∼1000 km 2 in central Amazonia, the BDFFP was initially designed to evaluate the effects of fragment area on rainforest biodiversity and ecological processes. However, over its 38-year history to date the project has far transcended its original mission, and now focuses more broadly on landscape dynamics, forest regeneration, regional- and global-change phenomena, and their potential interactions and implications for Amazonian forest conservation. The project has yielded a wealth of insights into the ecological and environmental changes in fragmented forests. For instance, many rainforest species are naturally rare and hence are either missing entirely from many fragments or so sparsely represented as to have little chance of long-term survival. Additionally, edge effects are a prominent driver of fragment dynamics, strongly affecting forest microclimate, tree mortality, carbon storage and a diversity of fauna. Even within our controlled study area, the landscape has been highly dynamic: for example, the matrix of vegetation surrounding fragments has changed markedly over time, succeeding from large cattle pastures or forest clearcuts to secondary regrowth forest. This, in turn, has influenced the dynamics of plant and animal communities and their trajectories of change over time. In general, fauna and flora have responded differently to fragmentation: the most locally extinction-prone animal species are those that have both large area requirements and low tolerance of the modified habitats surrounding fragments, whereas the most vulnerable plants are those that respond poorly to edge effects or chronic forest disturbances, and that rely on vulnerable animals for seed dispersal or pollination. Relative to intact forests, most fragments are hyperdynamic, with unstable or fluctuating

  12. Reversible hydrogen storage materials

    Science.gov (United States)

    Ritter, James A [Lexington, SC; Wang, Tao [Columbia, SC; Ebner, Armin D [Lexington, SC; Holland, Charles E [Cayce, SC

    2012-04-10

    In accordance with the present disclosure, a process for synthesis of a complex hydride material for hydrogen storage is provided. The process includes mixing a borohydride with at least one additive agent and at least one catalyst and heating the mixture at a temperature of less than about 600.degree. C. and a pressure of H.sub.2 gas to form a complex hydride material. The complex hydride material comprises MAl.sub.xB.sub.yH.sub.z, wherein M is an alkali metal or group IIA metal, Al is the element aluminum, x is any number from 0 to 1, B is the element boron, y is a number from 0 to 13, and z is a number from 4 to 57 with the additive agent and catalyst still being present. The complex hydride material is capable of cyclic dehydrogenation and rehydrogenation and has a hydrogen capacity of at least about 4 weight percent.

  13. Reverse engineering for quality systems

    International Nuclear Information System (INIS)

    Nolan, A.J.

    1995-01-01

    When the age of software engineering began, many companies were faced with a problem of how to support the older, pre-software-engineering, programs. The techniques of reverse engineering and re-engineering were developed to bridge the gap between the past and the present. Although reverse engineering can be used for generating missing documentation, it can also be used as a means to demonstrate quality in these older programs. This paper presents, in the form of a case study, how Rolls-Royce and Associates Limited addressed the quality issues of reverse engineering and re-engineering. (author)

  14. Field reversal in mirror machines

    International Nuclear Information System (INIS)

    Pearlstein, L.D.; Anderson, D.V.; Boozer, A.H.

    1978-01-01

    This report discusses some of the physics issues anticipated in field-reversed mirrors. The effect of current cancellation due to electrons is described. An estimate is made of the required impurity level to maintain a field-reversed configuration. The SUPERLAYER code is used to simulate the high-β 2XIIB results, and favorable comparisons require inclusion of quasilinear RF turbulence. Impact of a quadrupole field on field-line closure and resonant transport is discussed. A simple self-consistent model of ion currents is presented. Conditions for stability of field-reversed configurations to E x B driven rotations are determined

  15. Glucose-6-phosphate dehydrogenase is required for hpa1xoo (harpin protein fragment)-mediated salt stress tolerance in transgenic arabidopsis thaliana

    International Nuclear Information System (INIS)

    Sang, S.L.; Xie, L.L.; Cui, X.W.; Wang, Z.Y.

    2018-01-01

    Harpin induces salicylic acid and abscisic acid signaling in plants under biotic and abiotic stress, respectively. Our previous report showed that the effective harpin fragment Hpa1xoo enhanced H2O2 production and pathogen resistance in a transgenic Arabidopsis mutant. In this study, we examined contents of thiobarbituric acid reactive substance (TBARS), H2O2 and glutathione, and glucose-6-phosphate dehydrogenase (G6PDH), glutathione reductase (GR) and glutathione peroxidase (GPX) enzyme activity in Hpa1xoo-expressing Arabidopsis under salt stress. The results revealed increased amounts of TBARS and H2O2 in wild-type (WT) compared to mutant plants under salt stress conditions. In contrast, increased levels were observed in the mutant under stress-free conditions. Moreover, a higher reduced glutathione (GSH) content and ratio of GSH/oxidized glutathione (GSSG) was observed in mutant compared to WT plants under both stress-free and salt stress conditions. In addition, mutant plants exhibited significantly higher G6PDH, GR and GPX activity than WT plants under salt stress. Suppression of G6PDH activity via 6-aminonicotinamide (6-AN, a specific inhibitor of G6PDH) was partly reversed by L-buthionine-sulfoximine (BSO, a specific inhibitor of GSH regeneration) and aggravated by GSH. Combined with previous reports, these findings suggest that the G6PDH enzyme plays a key role in harpin fragment (Hpa1xoo)-mediated salt stress tolerance in transgenic Arabidopsis. (author)

  16. Corneal graft reversal: Histopathologic report of two cases.

    Science.gov (United States)

    Qahtani, Abdullah A; Alkatan, Hind M

    2014-10-01

    Graft reversal is a rare cause for failed PKP. In this case report we are presenting 2 graft failure cases in which the corneal grafts were reversed unintentionally. The onset of signs of graft failure, however was variable. We have included their clinical course and the histopathologic findings of the removed corneal grafts. A total of 6 cases including ours have been reported so far. The aim of this report is to attract the attention of corneal surgeons to an additional rare cause for failed penetrating keratoplasty (PKP) which is donor graft reversal.

  17. Diffusion properties of active particles with directional reversal

    International Nuclear Information System (INIS)

    Großmann, R; Bär, M; Peruani, F

    2016-01-01

    The diffusion properties of self-propelled particles which move at constant speed and, in addition, reverse their direction of motion repeatedly are investigated. The internal dynamics of particles triggering these reversal processes is modeled by a stochastic clock. The velocity correlation function as well as the mean squared displacement is investigated and, furthermore, a general expression for the diffusion coefficient for self-propelled particles with directional reversal is derived. Our analysis reveals the existence of an optimal, finite rotational noise amplitude which maximizes the diffusion coefficient. We comment on the relevance of these results with regard to biological systems and suggest further experiments in this context. (paper)

  18. Zero field reversal probability in thermally assisted magnetization reversal

    Science.gov (United States)

    Prasetya, E. B.; Utari; Purnama, B.

    2017-11-01

    This paper discussed about zero field reversal probability in thermally assisted magnetization reversal (TAMR). Appearance of reversal probability in zero field investigated through micromagnetic simulation by solving stochastic Landau-Lifshitz-Gibert (LLG). The perpendicularly anisotropy magnetic dot of 50×50×20 nm3 is considered as single cell magnetic storage of magnetic random acces memory (MRAM). Thermally assisted magnetization reversal was performed by cooling writing process from near/almost Curie point to room temperature on 20 times runs for different randomly magnetized state. The results show that the probability reversal under zero magnetic field decreased with the increase of the energy barrier. The zero-field probability switching of 55% attained for energy barrier of 60 k B T and the reversal probability become zero noted at energy barrier of 2348 k B T. The higest zero-field switching probability of 55% attained for energy barrier of 60 k B T which corespond to magnetif field of 150 Oe for switching.

  19. Phenomenological relation between distribution and fragmentation functions

    International Nuclear Information System (INIS)

    Ma Boqiang; Schmidt, Ivan; Soffer, Jacques; Yang Jianjun

    2002-01-01

    We study the relation between the quark distribution function q(x) and the fragmentation function D q (z) based on a general form D q (x)=C(z)z α q(z) for valence and sea quarks. By adopting two known parametrizations of quark distributions for the proton, we find three simple options for the fragmentation functions that can provide a good description of the available experimental data on proton production in e + e - inelastic annihilation. These three options support the revised Gribov-Lipatov relation D q (z)=zq(z) at z→1, as an approximate relation for the connection between distribution and fragmentation functions. The three options differ in the sea contributions and lead to distinct predictions for antiproton production in the reaction p+p→p-bar+X, thus they are distinguishable in future experiments at RHIC-BNL

  20. Projectile rapidity dependence in target fragmentation

    International Nuclear Information System (INIS)

    Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.

    1979-01-01

    The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references

  1. Antiproton Induced Fission and Fragmentation of Nuclei

    CERN Multimedia

    2002-01-01

    The annihilation of slow antiprotons with nuclei results in a large highly localized energy deposition primarily on the nuclear surface. \\\\ \\\\ The study of antiproton induced fission and fragmentation processes is expected to yield new information on special nuclear matter states, unexplored fission modes, multifragmentation of nuclei, and intranuclear cascades.\\\\ \\\\ In order to investigate the antiproton-nucleus interaction and the processes following the antiproton annihilation at the nucleus, we propose the following experiments: \\item A)~Measurement of several fragments from fission and from multifragmentation in coincidence with particle spectra, especially neutrons and kaons. \\item B)~Precise spectra of $\\pi$, K, n, p, d and t with time-of-flight techniques. \\item C)~Installation of the Berlin 4$\\pi$ neutron detector with a 4$\\pi$ Si detector placed inside for fragments and charged particles. This yields neutron multiplicity distributions and consequently distributions of thermal excitation energies and...

  2. Fragmentation in central collisions of heavy systems

    International Nuclear Information System (INIS)

    Claesson, G.; Doss, K.G.R.; Ferguson, R.

    1987-01-01

    One of the goals of heavy ion reaction studies is to understand the fragmentation of hot nuclei. The LBL/GSI Plastic Ball detector system has been used to achieve a very high solid angle for detection of light and medium-heavy fragments emitted in 200 Mev/A Au + Au and Au + Fe reactions. The simultaneous measurement of almost all of the nucleons and nuclei resulting from each collision allows an estimation of the total charged particle multiplicity and hence the impact parameter. By choosing subsets of the data corresponding to a peripheral or central collision, the assumptions inherent in various models of nuclear fragmentation can be tested. 3 refs., 3 figs

  3. Experiences in fragment-based drug discovery.

    Science.gov (United States)

    Murray, Christopher W; Verdonk, Marcel L; Rees, David C

    2012-05-01

    Fragment-based drug discovery (FBDD) has become established in both industry and academia as an alternative approach to high-throughput screening for the generation of chemical leads for drug targets. In FBDD, specialised detection methods are used to identify small chemical compounds (fragments) that bind to the drug target, and structural biology is usually employed to establish their binding mode and to facilitate their optimisation. In this article, we present three recent and successful case histories in FBDD. We then re-examine the key concepts and challenges of FBDD with particular emphasis on recent literature and our own experience from a substantial number of FBDD applications. Our opinion is that careful application of FBDD is living up to its promise of delivering high quality leads with good physical properties and that in future many drug molecules will be derived from fragment-based approaches. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. The Injured Body: Humiliation and Fragmentation

    Directory of Open Access Journals (Sweden)

    Graciela Mayet

    2017-03-01

    Full Text Available Simone de Beauvoir’s nouvelles and Titus Andronicus by Shakespeare present us opposite and complementary corporeal nature. In the first case, two women about their sixties are in front of the personal drama of their lost which happen through the years of ageing. It is a kind of fragmentation of existence. Ageing is the most authentic state of the human condition because the human being can only hang on to himself. In Titus Andronicus, are shown mutilations, murderers as fragmentation of biological body and social body. Individualism of modernity doesn’t forgive the bodies deteriorated by the years. In the early modernity, in the times of Elizabeth the First, like in the Ancient Rome, it wasn’t spared humiliations and violence towards the enemy body in order to impose power and authority. In this Shakespeare’s play, the fragmentation of the other’s body and murder are the emergence of social and individual violence.

  5. Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

    2016-11-15

    The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

  6. Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

    Science.gov (United States)

    Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

    2014-08-30

    The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

    International Nuclear Information System (INIS)

    Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.

    2013-01-01

    We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

  8. Dynamical effects in the Colomb expansion following nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.; Donangelo, R.J.; Schechter, H.

    1987-01-01

    The effects of the Colomb expansion on the fragment Kinetic energy spectrum for a fragmentating hot nuclear system is investigated. In particular, 12 C fragment spectra are calculated and compared with those predicted by the uniform expansion approximation. The results indicate that energy spectra of fragments are quite sensitive to the details of the Coulomb expansion treatment. (Author) [pt

  9. Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

    Energy Technology Data Exchange (ETDEWEB)

    Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1965-07-01

    This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

  10. The size distributions of fragments ejected at a given velocity from impact craters

    Science.gov (United States)

    O'Keefe, John D.; Ahrens, Thomas J.

    1987-01-01

    The mass distribution of fragments that are ejected at a given velocity for impact craters is modeled to allow extrapolation of laboratory, field, and numerical results to large scale planetary events. The model is semi-empirical in nature and is derived from: (1) numerical calculations of cratering and the resultant mass versus ejection velocity, (2) observed ejecta blanket particle size distributions, (3) an empirical relationship between maximum ejecta fragment size and crater diameter, (4) measurements and theory of maximum ejecta size versus ejecta velocity, and (5) an assumption on the functional form for the distribution of fragments ejected at a given velocity. This model implies that for planetary impacts into competent rock, the distribution of fragments ejected at a given velocity is broad, e.g., 68 percent of the mass of the ejecta at a given velocity contains fragments having a mass less than 0.1 times a mass of the largest fragment moving at that velocity. The broad distribution suggests that in impact processes, additional comminution of ejecta occurs after the upward initial shock has passed in the process of the ejecta velocity vector rotating from an initially downward orientation. This additional comminution produces the broader size distribution in impact ejecta as compared to that obtained in simple brittle failure experiments.

  11. Dynamics and instabilities in nuclear fragmentation

    International Nuclear Information System (INIS)

    Colonna, M.; Guarnera, A.; Di Toro, M.; Latora, V.; Smerzi, A.; Catania Univ.

    1993-01-01

    A general procedure to identify instability regions which lead to multifragmentation events is presented. The method covers all possible sources of dynamical instabilities. Informations on the instability point, like the time when the nuclear system enters the critical region, the most unstable modes and the time constant of the exponential growing of the relative variances, are deduced without any numerical bias. Important memory effects in the fragmentation pattern are revealed. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. (author) 7 refs., 3 figs

  12. Parton Propagation and Fragmentation in QCD Matter

    Energy Technology Data Exchange (ETDEWEB)

    Alberto Accardi, Francois Arleo, William Brooks, David D' Enterria, Valeria Muccifora

    2009-12-01

    We review recent progress in the study of parton propagation, interaction and fragmentation in both cold and hot strongly interacting matter. Experimental highlights on high-energy hadron production in deep inelastic lepton-nucleus scattering, proton-nucleus and heavy-ion collisions, as well as Drell-Yan processes in hadron-nucleus collisions are presented. The existing theoretical frameworks for describing the in-medium interaction of energetic partons and the space-time evolution of their fragmentation into hadrons are discussed and confronted to experimental data. We conclude with a list of theoretical and experimental open issues, and a brief description of future relevant experiments and facilities.

  13. Strain-energy effects on dynamic fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Chudnovsky, A.

    1986-01-01

    Grady's model of the dynamic fragmentation process, in which the average fragment size is determined by balancing the local kinetic energy and the surface energy, is modified to include the stored elastic (strain) energy. The revised model predicts that the strain energy should dominate for brittle materials, with low fracture toughness and high fracture-initiation stress. This conclusion is not borne out, however, by limited experimental data on brittle steels, even when the kinetic-energy density is small compared with the strain-energy density

  14. Rotating bubble and toroidal nuclei and fragmentation

    International Nuclear Information System (INIS)

    Royer, G.; Haddad, F.; Jouault, B.

    1995-01-01

    The energy of rotating bubble and toroidal nuclei predicted to be formed in central heavy-ion collisions at intermediate energies is calculated within the generalized rotating liquid drop model. The potential barriers standing in these exotic deformation paths are compared with the three dimensional and plane fragmentation barriers. In the toroidal deformation path of the heaviest systems exists a large potential pocket localised below the plane fragmentation barriers. This might allow the temporary survival of heavy nuclear toroids before the final clusterization induced by the surface and proximity tension. (author)

  15. Complejo Ojosmin: fragment of ophiolite transamazonian

    International Nuclear Information System (INIS)

    Bossi, J.; Pineyro, D. . Email geologia@fagro.edu.uy

    2004-01-01

    A preliminary geological survey of a previously unknown basic igneous complex in the Padre Alta Terrane (Pat) is presented. We report petrographic, geochemical and stratigraphic data for more than 200 outcrops. Geological evolution of the complex can be described in terms of four main events: (1) formation Pat units around 2000 Ma; (2) granodiorite thrusting onto possible ophiolite ca 1900 Ma ; (3) granophyric magmatism around 1700 Ma(4) intrusion of trachyte dykes. Data available suggest thrusting onto fragment of oceanic crust. Since the described structure presupposes the existence of pre transamazonian continental fragments in the TPA, it is very important to study the area in detail in the future [es

  16. Study of Charm Fragmentation into $D^{*\\pm}$ Mesons in Deep-Inelastic Scattering at HERA

    CERN Document Server

    Aaron, F.D.; Andreev, V.; Antunovic, B.; Aplin, S.; Asmone, A.; Astvatsatourov, A.; Bacchetta, A.; Backovic, S.; Baghdasaryan, A.; Barrelet, E.; Bartel, W.; Beckingham, M.; Begzsuren, K.; Behnke, O.; Belousov, A.; Berger, N.; Bizot, J.C.; Boenig, M.-O.; Boudry, V.; Bozovic-Jelisavcic, I.; Bracinik, J.; Brandt, G.; Brinkmann, M.; Brisson, V.; Bruncko, D.; Bunyatyan, A.; Buschhorn, G.; Bystritskaya, L.; Campbell, A.J.; Cantun Avila, K.B.; Cassol-Brunner, F.; Cerny, K.; Cerny, V.; Chekelian, V.; Cholewa, A.; Contreras, J.G.; Coughlan, J.A.; Cozzika, G.; Cvach, J.; Dainton, J.B.; Daum, K.; Deak, M.; de Boer, Y.; Delcourt, B.; Del Degan, M.; Delvax, J.; De Roeck, A.; De Wolf, E.A.; Diaconu, C.; Dodonov, V.; Dossanov, A.; Dubak, A.; Eckerlin, G.; Efremenko, V.; Egli, S.; Eliseev, A.; Elsen, E.; Essenov, S.; Falkiewicz, A.; Faulkner, P.J.W.; Favart, L.; Fedotov, A.; Felst, R.; Feltesse, J.; Ferencei, J.; Fleischer, M.; Fomenko, A.; Gabathuler, E.; Gayler, J.; Ghazaryan, Samvel; Glazov, A.; Glushkov, I.; Goerlich, L.; Goettlich, M.; Gogitidze, N.; Gouzevitch, M.; Grab, C.; Greenshaw, T.; Grell, B.R.; Grindhammer, G.; Habib, S.; Haidt, D.; Hansson, M.; Helebrant, C.; Henderson, R.C.W.; Hennekemper, E.; Henschel, H.; Herrera, G.; Hildebrandt, M.; Hiller, K.H.; Hoffmann, D.; Horisberger, R.; Hovhannisyan, A.; Hreus, T.; Jacquet, M.; Janssen, M.E.; Janssen, X.; Jemanov, V.; Jonsson, L.; Jung, Andreas Werner; Jung, H.; Kapichine, M.; Katzy, J.; Kenyon, I.R.; Kiesling, C.; Klein, M.; Kleinwort, C.; Klimkovich, T.; Kluge, T.; Knutsson, A.; Kogler, R.; Korbel, V.; Kostka, P.; Kraemer, M.; Krastev, K.; Kretzschmar, J.; Kropivnitskaya, A.; Kruger, K.; Kutak, K.; Landon, M.P.J.; Lange, W.; Lastovicka-Medin, G.; Laycock, P.; Lebedev, A.; Leibenguth, G.; Lendermann, V.; Levonian, S.; Li, G.; Lipka, K.; Liptaj, A.; List, B.; List, J.; Loktionova, N.; Lopez-Fernandez, R.; Lubimov, V.; Lucaci-Timoce, A.-I.; Lytkin, L.; Makankine, A.; Malinovski, E.; Marage, P.; Marti, Ll.; Martyn, H.-U.; Maxfield, S.J.; Mehta, A.; Meier, K.; Meyer, A.B.; Meyer, H.; Meyer, H.; Meyer, J.; Michels, V.; Mikocki, S.; Milcewicz-Mika, I.; Moreau, F.; Morozov, A.; Morris, J.V.; Mozer, Matthias Ulrich; Mudrinic, M.; Muller, K.; Murin, P.; Nankov, K.; Naroska, B.; Naumann, Th.; Newman, Paul R.; Niebuhr, C.; Nikiforov, A.; Nowak, G.; Nowak, K.; Nozicka, M.; Olivier, B.; Olsson, J.E.; Osman, S.; Ozerov, D.; Palichik, V.; Panagoulias, I.; Pandurovic, M.; Papadopoulou, Th.; Pascaud, C.; Patel, G.D.; Pejchal, O.; Peng, H.; Perez, E.; Petrukhin, A.; Picuric, I.; Piec, S.; Pitzl, D.; Placakyte, R.; Polifka, R.; Povh, B.; Preda, T.; Radescu, V.; Rahmat, A.J.; Raicevic, N.; Raspiareza, A.; Ravdandorj, T.; Reimer, P.; Rizvi, E.; Robmann, P.; Roland, B.; Roosen, R.; Rostovtsev, A.; Rotaru, M.; Ruiz Tabasco, J.E.; Rurikova, Z.; Rusakov, S.; Salek, D.; Salvaire, F.; Sankey, D.P.C.; Sauter, M.; Sauvan, E.; Schmidt, S.; Schmitt, S.; Schmitz, C.; Schoeffel, L.; Schoning, A.; Schultz-Coulon, H.-C.; Sefkow, F.; Shaw-West, R.N.; Sheviakov, I.; Shtarkov, L.N.; Shushkevich, S.; Sloan, T.; Smiljanic, Ivan; Smirnov, P.; Soloviev, Y.; Sopicki, P.; South, D.; Spaskov, V.; Specka, Arnd E.; Staykova, Z.; Steder, M.; Stella, B.; Straumann, U.; Sunar, D.; Sykora, T.; Tchoulakov, V.; Thompson, G.; Thompson, P.D.; Toll, T.; Tomasz, F.; Tran, T.H.; Traynor, D.; Trinh, T.N.; Truol, P.; Tsakov, I.; Tseepeldorj, B.; Tsurin, I.; Turnau, J.; Tzamariudaki, E.; Urban, K.; Valkarova, A.; Vallee, C.; Van Mechelen, P.; Vargas Trevino, A.; Vazdik, Y.; Vinokurova, S.; Volchinski, V.; Wegener, D.; Wessels, M.; Wissing, Ch.; Wunsch, E.; Yeganov, V.; Zacek, J.; Zalesak, J.; Zhang, Z.; Zhelezov, A.; Zhokin, A.; Zhu, Y.C.; Zimmermann, T.; Zohrabyan, H.; Zomer, F.

    2009-01-01

    The process of charm quark fragmentation is studied using $D^{*\\pm}$ meson production in deep-inelastic scattering as measured by the H1 detector at HERA. Two different regions of phase space are investigated defined by the presence or absence of a jet containing the $D^{*\\pm}$ meson in the event. The parameters of fragmentation functions are extracted for QCD models based on leading order matrix elements and DGLAP or CCFM evolution of partons together with string fragmentation and particle decays. Additionally, they are determined for a next-to-leading order QCD calculation in the fixed flavour number scheme using the independent fragmentation of charm quarks to $D^{*\\pm}$ mesons.

  17. Systematics of complex fragment emission from La induced reactions at E/A = 47 MeV

    International Nuclear Information System (INIS)

    Kehoe, W.L.; Mignerey, A.C.; Bradley, S.

    1989-03-01

    Complex fragment (Z > 2) emission was studied in the reverse kinematics reactions of 139 La on 27 Al and /sup nat./Cu at a bombarding energy of E/A = 47 MeV. Experimental results from inclusive and coincidence measurements for two- and three-fold complex fragments events are presented. Measured cross sections and Z 1 -Z 2 correlations show a predominately binary-decay process for the La + Al reaction, while the La + Cu reaction is dominated by multi-body decay. 18 refs., 9 figs., 1 tab

  18. The Zero-Degree Detector system for fragmentation studies

    International Nuclear Information System (INIS)

    Adams, J.H.; Christl, M.J.; Howell, L.W.; Kuznetsov, E.

    2007-01-01

    The measurement of nuclear fragmentation cross-sections requires the detection and identification of individual projectile fragments. If light and heavy fragments are recorded in the same detector, it may be impossible to distinguish the signal from the light fragment. To overcome this problem, we have developed the Zero-degree Detector System (ZDDS). The ZDDS enables the measurement of cross-sections for light fragment production by using pixelated detectors to separately measure the signals of each fragment. The system has been used to measure the fragmentation of beams as heavy as Fe at the NASA Space Radiation Laboratory at Brookhaven National Laboratory and the Heavy Ion Medical Accelerator in Chiba, Japan

  19. A Typology of Reverse Innovation

    DEFF Research Database (Denmark)

    von Zedtwitz, Max; Corsi, Simone; Søberg, Peder Veng

    2015-01-01

    secondary market introduction, this study expands the espoused definition of reverse innovation beyond its market-introduction focus with reversals in the flow of innovation in the ideation and product development phases. Recognizing that each phase can take place in different geographical locations...... taking place in an emerging country. This analytical framework allows recasting of current research at the intersection between innovation and international business. Of the 10 reverse innovation flows, six are new and have not been covered in the literature to date. The study addresses questions......’s portfolio of global innovation competence and capability. The implications for management are concerned with internal and external resistance to reverse innovation. Most significantly, while greater recognition and power of innovation in formerly subordinate organizational units is inconvenient to some...

  20. Spontaneous direct and reverse osmosis

    International Nuclear Information System (INIS)

    Valitov, N.Kh.

    1996-01-01

    It has been ascertained experimentally that in the course of separation of CsCl, KCl, NaCl aqueous solutions by semi-permeable membrane from distilled water the direct and then reverse osmosis are observed. The same sequence is observed in case of separation of CsCl aqueous solutions from NaCl of different concentrations. The reason for the direct and reverse osmosis has been explained. 5 refs.; 3 figs. 1 tab

  1. Spatial distribution of bird communities in small forest fragments in central Europe in relation to distance to the forest edge, fragment size and type of forest

    Czech Academy of Sciences Publication Activity Database

    Hofmeister, Jeňýk; Hošek, J.; Brabec, Marek; Kočvara, R.

    2017-01-01

    Roč. 401, OCT (2017), s. 255-263 ISSN 0378-1127 Institutional support: RVO:67179843 ; RVO:67985807 Keywords : Clearing * Dryocopus martius * Forest bird * Forest management * Generalized additive model * Habitat fragmentation Subject RIV: GK - Forestry; BB - Applied Statistics, Operational Research (UIVT-O) OBOR OECD: Forestry; Statistics and probability (UIVT-O) Impact factor: 3.064, year: 2016

  2. Anthropogenic Matrices Favor Homogenization of Tree Reproductive Functions in a Highly Fragmented Landscape.

    Science.gov (United States)

    Carneiro, Magda Silva; Campos, Caroline Cambraia Furtado; Beijo, Luiz Alberto; Ramos, Flavio Nunes

    2016-01-01

    Species homogenization or floristic differentiation are two possible consequences of the fragmentation process in plant communities. Despite the few studies, it seems clear that fragments with low forest cover inserted in anthropogenic matrices are more likely to experience floristic homogenization. However, the homogenization process has two other components, genetic and functional, which have not been investigated. The purpose of this study was to verify whether there was homogenization of tree reproductive functions in a fragmented landscape and, if found, to determine how the process was influenced by landscape composition. The study was conducted in eight fragments in southwest Brazil. The study was conducted in eight fragments in southwestern Brazil. In each fragment, all individual trees were sampled that had a diameter at breast height ≥3 cm, in ten plots (0.2 ha) and, classified within 26 reproductive functional types (RFTs). The process of functional homogenization was evaluated using additive partitioning of diversity. Additionally, the effect of landscape composition on functional diversity and on the number of individuals within each RFT was evaluated using a generalized linear mixed model. appeared to be in a process of functional homogenization (dominance of RFTs, alpha diversity lower than expected by chance and and low beta diversity). More than 50% of the RFTs and the functional diversity were affected by the landscape parameters. In general, the percentage of forest cover has a positive effect on RFTs while the percentage of coffee matrix has a negative one. The process of functional homogenization has serious consequences for biodiversity conservation because some functions may disappear that, in the long term, would threaten the fragments. This study contributes to a better understanding of how landscape changes affect the functional diversity, abundance of individuals in RFTs and the process of functional homogenization, as well as how to

  3. Site Identification by Ligand Competitive Saturation (SILCS) simulations for fragment-based drug design.

    Science.gov (United States)

    Faller, Christina E; Raman, E Prabhu; MacKerell, Alexander D; Guvench, Olgun

    2015-01-01

    Fragment-based drug design (FBDD) involves screening low molecular weight molecules ("fragments") that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind nonoverlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy.The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is "soaked" in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called "FragMaps" can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine "Grid Free Energies (GFEs)," which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities.

  4. Garbage collection for reversible functional languages

    DEFF Research Database (Denmark)

    Mogensen, Torben Ægidius

    2015-01-01

    Reversible languages are programming languages where all programs can run both forwards and backwards. Reversible functional languages have been proposed that use symmetric pattern matching and data construction. To be reversible, these languages require linearity: Every variable must be used...

  5. The reversibility of cancer

    International Nuclear Information System (INIS)

    Dippenaar, N.; Booyens, J.; Fabbri, D.; Katzeff, I.E.

    1982-01-01

    Certain metabolic abnormalities are common to all malignant cells, and Horrobin proposed that the underlying cause is the inability of cancer cells to produce prostaglandin E 1 (PGE 1 ). This appears to be due to the lack of the enzyme delta-6-desaturase which converts the essential fatty acid, linoleic acid, to gamma-linolenic acid (GLA), from which PGE 1 is then synthesized. Our studies strongly support this contention. Addition of GLA to cancer cells, thus bypassing the block in the metabolic pathway, results in very marked, statistically highly significant inhibition of growth, while having no effect at all on normal cells. Our finding of the regression of cancer through such proposed normalization offers preliminary hope for a new effective and harmless approach to the treatment of cancer

  6. Fragment informatics and computational fragment-based drug design: an overview and update.

    Science.gov (United States)

    Sheng, Chunquan; Zhang, Wannian

    2013-05-01

    Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

  7. Relationships between Liquid Atomization and Solid Fragmentation

    Science.gov (United States)

    2016-03-01

    1 2. Basic Definitions ...expressions for average fragment sizes. These observations are surprising, given the fundamental phenomenological differences between liquid and solid...smaller children droplets in the secondary stage. The basic phenomenology of the second stage is much the same as that of the first stage. For

  8. Modelling of the PELE fragmentation dynamics

    Science.gov (United States)

    Verreault, J.

    2014-05-01

    The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.

  9. Modelling of the PELE fragmentation dynamics

    NARCIS (Netherlands)

    Verreault, J.

    2014-01-01

    The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a

  10. Modelling of the PELE fragmentation dynamics

    International Nuclear Information System (INIS)

    Verreault, J

    2014-01-01

    The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.

  11. Diquark fragmentation in leptoproduction of hadrons

    International Nuclear Information System (INIS)

    Beavis, D.; Desai, B.R.

    1981-08-01

    In the analysis of the leptoproduction data for the charge ratios of hadrons, the Sukhatme, Lassila and Orava (SLO) model for diquark fragmentation is shown to be consistent with the hypothesis of a diquark acting as a single unit. The baryon contribution to the charge ratio, ignored earlier by SLO, makes a significant effect. (author)

  12. Heavy Flavor Fragmentation and Decay at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Plano, Richard M

    1999-02-24

    Results on heavy quark fragmentation obtained using the SLD detector at the SLAC Linear Collider are presented. This talk will cover the ratio of vector to pseudoscalar charmed meson production, the inclusive B hadron energy distribution, the inclusive particle production in heavy jets compared to their production in light jets, and charged and neutral B meson lifetimes.

  13. Probabilistic Role Models and the Guarded Fragment

    DEFF Research Database (Denmark)

    Jaeger, Manfred

    2004-01-01

    We propose a uniform semantic framework for interpreting probabilistic concept subsumption and probabilistic role quantification through statistical sampling distributions. This general semantic principle serves as the foundation for the development of a probabilistic version of the guarded fragm...... fragment of first-order logic. A characterization of equivalence in that logic in terms of bisimulations is given....

  14. Probabilistic role models and the guarded fragment

    DEFF Research Database (Denmark)

    Jaeger, Manfred

    2006-01-01

    We propose a uniform semantic framework for interpreting probabilistic concept subsumption and probabilistic role quantification through statistical sampling distributions. This general semantic principle serves as the foundation for the development of a probabilistic version of the guarded fragm...... fragment of first-order logic. A characterization of equivalence in that logic in terms of bisimulations is given....

  15. OSCILLATING FILAMENTS. I. OSCILLATION AND GEOMETRICAL FRAGMENTATION

    Energy Technology Data Exchange (ETDEWEB)

    Gritschneder, Matthias; Heigl, Stefan; Burkert, Andreas, E-mail: gritschm@usm.uni-muenchen.de [University Observatory Munich, LMU Munich, Scheinerstrasse 1, D-81679 Munich (Germany)

    2017-01-10

    We study the stability of filaments in equilibrium between gravity and internal as well as external pressure using the grid-based AMR code RAMSES. A homogeneous, straight cylinder below a critical line mass is marginally stable. However, if the cylinder is bent, such as with a slight sinusoidal perturbation, an otherwise stable configuration starts to oscillate, is triggered into fragmentation, and collapses. This previously unstudied behavior allows a filament to fragment at any given scale, as long as it has slight bends. We call this process “geometrical fragmentation.” In our realization, the spacing between the cores matches the wavelength of the sinusoidal perturbation, whereas up to now, filaments were thought to be only fragmenting on the characteristic scale set by the mass-to-line ratio. Using first principles, we derive the oscillation period as well as the collapse timescale analytically. To enable a direct comparison with observations, we study the line-of-sight velocity for different inclinations. We show that the overall oscillation pattern can hide the infall signature of cores.

  16. Continuous fragment of the mu-calculus

    NARCIS (Netherlands)

    Fontaine, G.

    2008-01-01

    In this paper we investigate the Scott continuous fragment of the modal μ-calculus. We discuss its relation with constructivity, where we call a formula constructive if its least fixpoint is always reached in at most ω steps. Our main result is a syntactic characterization of this continuous

  17. Fragmentation of forest, grassland, and shrubland

    Science.gov (United States)

    Kurt H. Riitters

    2013-01-01

    As humans introduce competing land uses into natural landscapes, the public concerns regarding landcover patterns are expressed through headline issues such as urban sprawl, forest fragmentation, water quality, and wilderness preservation. The spatial arrangement of an environment affects all human perceptions and ecological processes within that environment, but this...

  18. Metagenome Fragment Classification Using -Mer Frequency Profiles

    Directory of Open Access Journals (Sweden)

    Gail Rosen

    2008-01-01

    Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.

  19. Intraday Price Discovery in Fragmented Markets

    NARCIS (Netherlands)

    S.R. Ozturk (Sait); M. van der Wel (Michel); D.J.C. van Dijk (Dick)

    2014-01-01

    textabstractFor many assets, trading is fragmented across multiple exchanges. Price discovery measures summarize the informativeness of trading on each venue for discovering the asset’s true underlying value. We explore intraday variation in price discovery using a structural model with

  20. Targeting incentives to reduce habitat fragmentation

    Science.gov (United States)

    David Lewis; Andrew Plantinga; Junjie Wu

    2009-01-01

    This article develops a theoretical model to analyze the spatial targeting of incentives for the restoration of forested landscapes when wildlife habitat can be enhanced by reducing fragmentation. The key theoretical result is that the marginal net benefits of increasing forest can be convex, in which case corner solutions--converting either none or all of the...

  1. Strategic Targeted Advertising and Market Fragmentation

    OpenAIRE

    Lola Esteban; Jose M. Hernandez

    2007-01-01

    This paper proves that oligopolistic price competition with both targeted advertising and targeted prices can lead to a permanent fragmentation of the market into a local monopoly. However, compared to mass advertising, targeting increases social welfare and turns out to be more beneficial for consumers than for firms.

  2. Habitat fragmentation causes rapid genetic differentiation and ...

    African Journals Online (AJOL)

    ... city buildings. These results were supported by multiple statistical analyses including Mantel's test, PCOORDA and AMOVA. Genetic enrichment and epigenetic variation studies can be included in habitat fragmentation analysis and its implications in inducing homogenization and susceptibility in natural plant populations.

  3. Searching Fragment Spaces with feature trees.

    Science.gov (United States)

    Lessel, Uta; Wellenzohn, Bernd; Lilienthal, Markus; Claussen, Holger

    2009-02-01

    Virtual combinatorial chemistry easily produces billions of compounds, for which conventional virtual screening cannot be performed even with the fastest methods available. An efficient solution for such a scenario is the generation of Fragment Spaces, which encode huge numbers of virtual compounds by their fragments/reagents and rules of how to combine them. Similarity-based searches can be performed in such spaces without ever fully enumerating all virtual products. Here we describe the generation of a huge Fragment Space encoding about 5 * 10(11) compounds based on established in-house synthesis protocols for combinatorial libraries, i.e., we encode practically evaluated combinatorial chemistry protocols in a machine readable form, rendering them accessible to in silico search methods. We show how such searches in this Fragment Space can be integrated as a first step in an overall workflow. It reduces the extremely huge number of virtual products by several orders of magnitude so that the resulting list of molecules becomes more manageable for further more elaborated and time-consuming analysis steps. Results of a case study are presented and discussed, which lead to some general conclusions for an efficient expansion of the chemical space to be screened in pharmaceutical companies.

  4. Efficient clustering aggregation based on data fragments.

    Science.gov (United States)

    Wu, Ou; Hu, Weiming; Maybank, Stephen J; Zhu, Mingliang; Li, Bing

    2012-06-01

    Clustering aggregation, known as clustering ensembles, has emerged as a powerful technique for combining different clustering results to obtain a single better clustering. Existing clustering aggregation algorithms are applied directly to data points, in what is referred to as the point-based approach. The algorithms are inefficient if the number of data points is large. We define an efficient approach for clustering aggregation based on data fragments. In this fragment-based approach, a data fragment is any subset of the data that is not split by any of the clustering results. To establish the theoretical bases of the proposed approach, we prove that clustering aggregation can be performed directly on data fragments under two widely used goodness measures for clustering aggregation taken from the literature. Three new clustering aggregation algorithms are described. The experimental results obtained using several public data sets show that the new algorithms have lower computational complexity than three well-known existing point-based clustering aggregation algorithms (Agglomerative, Furthest, and LocalSearch); nevertheless, the new algorithms do not sacrifice the accuracy.

  5. Albumin modification and fragmentation in renal disease.

    Science.gov (United States)

    Donadio, Carlo; Tognotti, Danika; Donadio, Elena

    2012-02-18

    Albumin is the most important antioxidant substance in plasma and performs many physiological functions. Furthermore, albumin is the major carrier of endogenous molecules and exogenous ligands. This paper reviews the importance of post-translational modifications of albumin and fragments thereof in patients with renal disease. First, current views and controversies on renal handling of proteins, mainly albumin, will be discussed. Post-translational modifications, namely the fragmentation of albumin found with proteomic techniques in nephrotic patients, diabetics, and ESRD patients will be presented and discussed. It is reasonable to hypothesize that proteolytic fragmentation of serum albumin is due to a higher susceptibility to proteases, induced by oxidative stress. The clinical relevance of the fragmentation of albumin has not yet been established. These modifications could affect some physiological functions of albumin and have a patho-physiological role in uremic syndrome. Proteomic analysis of serum allows the identification of over-expressed proteins and can detect post-translational modifications of serum proteins, hitherto hidden, using standard laboratory techniques. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Quantum properties of QCD string fragmentation

    Directory of Open Access Journals (Sweden)

    Todorova-Nová Šárka

    2016-01-01

    Full Text Available A simple quantization concept for a 3-dim QCD string is used to derive properties of QCD flux tube from the mass spectrum of light mesons and to predict observable quantum effects in correlations between adjacent hadrons. The quantized fragmentation model is presented and compared with experimental observations.

  7. Investigating the structure and fragmentation of a highly filamentary IRDC

    Science.gov (United States)

    Henshaw, J. D.; Caselli, P.; Fontani, F.; Jiménez-Serra, I.; Tan, J. C.; Longmore, S. N.; Pineda, J. E.; Parker, R. J.; Barnes, A. T.

    2016-11-01

    We present 3.7 arcsec (˜0.05 pc) resolution 3.2 mm dust continuum observations from the Institut de Radioastronomie Millimétrique Plateau de Bure Interferometer, with the aim of studying the structure and fragmentation of the filamentary infrared dark cloud (IRDC) G035.39-00.33. The continuum emission is segmented into a series of 13 quasi-regularly spaced (λobs ˜ 0.18 pc) cores, following the major axis of the IRDC. We compare the spatial distribution of the cores with that predicted by theoretical work describing the fragmentation of hydrodynamic fluid cylinders, finding a significant (a factor of ≳ 8) discrepancy between the two. Our observations are consistent with the picture emerging from kinematic studies of molecular clouds suggesting that the cores are harboured within a complex network of independent sub-filaments. This result emphasizes the importance of considering the underlying physical structure, and potentially, dynamically important magnetic fields, in any fragmentation analysis. The identified cores exhibit a range in (peak) beam-averaged column density (3.6 × 1023 cm-2 < NH, c < 8.0 × 1023 cm-2), mass (8.1 M⊙ < Mc < 26.1 M⊙), and number density (6.1 × 105 cm-3 < nH, c, eq < 14.7 × 105 cm-3). Two of these cores, dark in the mid-infrared, centrally concentrated, monolithic (with no traceable substructure at our PdBI resolution), and with estimated masses of the order ˜20-25 M⊙, are good candidates for the progenitors of intermediate-to-high-mass stars. Virial parameters span a range 0.2 < αvir < 1.3. Without additional support, possibly from dynamically important magnetic fields with strengths of the order of 230 μG < B < 670 μG, the cores are susceptible to gravitational collapse. These results may imply a multilayered fragmentation process, which incorporates the formation of sub-filaments, embedded cores, and the possibility of further fragmentation.

  8. Posterior epidural disc fragment masquerading as spinal tumor: Review of the literature.

    Science.gov (United States)

    Park, Taejune; Lee, Ho Jun; Kim, Jae Seong; Nam, Kiyeun

    2018-03-09

    Posterior epidural lumbar disc fragment is infrequent because of anatomical barriers, and it is difficult to diagnose posterior epidural lumbar disc fragment because of its rare incidence and the ambiguity of radiologic evaluations. And it is difficult to differentiate it from other diseases such as spinal tumors. Differential diagnosis of posterior epidural lumbar disc fragment is clinically important because its diagnosis can affect treatment and prognosis. To investigate the incidence, anatomical concern, etiology, symptom, diagnostic tool, management and prognosis of posterior epidural lumbar disc fragment, we reviewed articles including case report. We performed a search of all clinical studies of posterior epidural lumbar disc fragment published to date. The following keywords were searched: Posterior epidural lumbar disc fragment, disc migration, posterior epidural disc, extradural migration, dorsal epidural migration, sequestrated disc, and disc fragment. We identified 40 patients of posterior epidural lumbar disc fragment from 28 studies. The most common presentation of posterior epidural lumbar disc fragment was sudden onset radiculopathy (70.0%), followed by cauda equina syndrome (27.5%). The most frequently used diagnostic modality was magnetic resonance imaging (MRI), conducted in 36 cases (90.0%), and followed by computed tomography in 14 cases (35.0%). After the imaging studies, the preoperative diagnoses were 45.0% masses, 20.0% lesions, and 12.5% tumors. Characteristic MRI findings in posterior epidural lumbar disc fragment are helpful for diagnosis; it typically displays low signals on T1-weighted images and high signals on T2-weighted images with respect to the parent disc. In addition, most of the disc fragments show peripheral rim enhancement on MRI with gadolinium administration. Electrodiagnostic testing is useful for verifying nerve damage. Surgical treatment was performed in all cases, and neurologic complications were observed in 12.5%. As

  9. Predicting effects of rainforest fragmentation from live trapping studies of small mammals in Sri Lanka

    Directory of Open Access Journals (Sweden)

    M.R. Wijesinghe

    2012-06-01

    Full Text Available This paper examines the impact of forest fragmentation on small mammals inhabiting the rainforests of Sri Lanka. Fifteen forests ranging in size from 145 to 11000 ha were live-trapped for five to eight nights each in both interior and edge habitats, yielding a total of 18400 trap nights. A total of 444 individuals belonging to 10 species of small mammals were captured. Multiple-regression analysis incorporating three indicators of fragmentation: patch area, shape index (perimeter/area and degree of isolation, showed no significant effects on overall species richness of small mammals. This is likely because the decline of forest-adapted species from small forest fragments was accompanied by an increase in more tolerant and adaptive species. Patch size, however, had a significant positive effect on the abundance of small mammals. Of the two dominant species, the endemic Mus mayori was positively affected by patch area whilst Rattus rattus was not affected. Although no differences were evident between interior and edge habitats with respect to total species richness and abundance, endemics were more abundant in core areas while the reverse was true for the non-endemics. Core forest areas were significantly different from forest edges with respect to canopy cover, density of herbaceous vegetation, large trees and litter cover. These results suggest that forest fragmentation is detrimental to some forest specialists and beneficial to some generalists.

  10. Enantioselective conjugate addition of hydroxylamines to pyrazolidinone acrylamides.

    Science.gov (United States)

    Sibi, M P; Liu, M

    2001-12-27

    Chiral relay templates provide amplification of selectivity in conjugate addition reactions. Reversal of stereochemistry of the product isoxazolidinones has also been demonstrated by a simple change of the Lewis acid. [reaction: see text

  11. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  12. Idaho Power's reverses decline with employee increase

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    Following several years of decline, the number of full-time Idaho Power employees increased to 1,528 at the end of 1989, up from 1,500 in 1988. The increase reversed a steady decline that began in 1984 when the company had a peak employment of 1,725. Last year's increase in the work force in part reflects recent additions in customers served and the electric demands of an expanding economy in the service area, as well as new regulatory requirements, the company said

  13. Focusing over Optical Fiber Using Time Reversal

    DEFF Research Database (Denmark)

    Piels, Molly; Porto da Silva, Edson; Estaran Tolosa, Jose Manuel

    2015-01-01

    A time-reversal array in multimode fiber is proposed for lossless remotely controlled switching using passive optical splitters. The signal to be transmitted is digitally pre-distorted so that it is routed through the physical layer in order to arrive at only one receiver in an array. System...... performance in the presence of additive white gaussian noise, modal group delay, and timing error is investigated numerically for single-mode and 10-mode fiber. Focusing using a two-transmitter array and 44 km of single- mode fiber is demonstrated experimentally for 3 GBd QPSK signals with a bit error rate...

  14. Assessing the lipophilicity of fragments and early hits

    Science.gov (United States)

    Mortenson, Paul N.; Murray, Christopher W.

    2011-07-01

    A key challenge in many drug discovery programs is to accurately assess the potential value of screening hits. This is particularly true in fragment-based drug design (FBDD), where the hits often bind relatively weakly, but are correspondingly small. Ligand efficiency (LE) considers both the potency and the size of the molecule, and enables us to estimate whether or not an initial hit is likely to be optimisable to a potent, druglike lead. While size is a key property that needs to be controlled in a small molecule drug, there are a number of additional properties that should also be considered. Lipophilicity is amongst the most important of these additional properties, and here we present a new efficiency index (LLEAT) that combines lipophilicity, size and potency. The index is intuitively defined, and has been designed to have the same target value and dynamic range as LE, making it easily interpretable by medicinal chemists. Monitoring both LE and LLEAT should help both in the selection of more promising fragment hits, and controlling molecular weight and lipophilicity during optimisation.

  15. Fragmentation pathways of tungsten hexacarbonyl clusters upon electron ionization

    Energy Technology Data Exchange (ETDEWEB)

    Neustetter, M.; Jabbour Al Maalouf, E.; Denifl, S., E-mail: Stephan.Denifl@uibk.ac.at, E-mail: plimaovieira@fct.unl.pt [Institut für Ionenphysik und Angewandte Physik, Universität Innsbruck, Technikerstrasse 25, A-6020 Innsbruck (Austria); Limão-Vieira, P., E-mail: Stephan.Denifl@uibk.ac.at, E-mail: plimaovieira@fct.unl.pt [Institut für Ionenphysik und Angewandte Physik, Universität Innsbruck, Technikerstrasse 25, A-6020 Innsbruck (Austria); Laboratório de Colisões Atómicas e Moleculares, CEFITEC, Departamento de Física, Faculdade de Ciências e Tecnologia, Universidade NOVA de Lisboa, 2829-516 Caparica (Portugal)

    2016-08-07

    Electron ionization of neat tungsten hexacarbonyl (W(CO){sub 6}) clusters has been investigated in a crossed electron-molecular beam experiment coupled with a mass spectrometer system. The molecule is used for nanofabrication processes through electron beam induced deposition and ion beam induced deposition techniques. Positive ion mass spectra of W(CO){sub 6} clusters formed by electron ionization at 70 eV contain the ion series of the type W(CO){sub n}{sup +} (0 ≤ n ≤ 6) and W{sub 2}(CO){sub n}{sup +} (0 ≤ n ≤ 12). In addition, a series of peaks are observed and have been assigned to WC(CO){sub n}{sup +} (0 ≤ n ≤ 3) and W{sub 2}C(CO){sub n}{sup +} (0 ≤ n ≤ 10). A distinct change of relative fragment ion intensity can be observed for clusters compared to the single molecule. The characteristic fragmentation pattern obtained in the mass spectra can be explained by a sequential decay of the ionized organometallic, which is also supported by the study of the clusters when embedded in helium nanodroplets. In addition, appearance energies for the dissociative ionization channels for singly charged ions have been estimated from experimental ion efficiency curves.

  16. Vasectomy reversal: a clinical update

    Directory of Open Access Journals (Sweden)

    Abhishek P Patel

    2016-01-01

    Full Text Available Vasectomy is a safe and effective method of contraception used by 42-60 million men worldwide. Approximately 3%-6% of men opt for a vasectomy reversal due to the death of a child or divorce and remarriage, change in financial situation, desire for more children within the same marriage, or to alleviate the dreaded postvasectomy pain syndrome. Unlike vasectomy, vasectomy reversal is a much more technically challenging procedure that is performed only by a minority of urologists and places a larger financial strain on the patient since it is usually not covered by insurance. Interest in this procedure has increased since the operating microscope became available in the 1970s, which consequently led to improved patency and pregnancy rates following the procedure. In this clinical update, we discuss patient evaluation, variables that may influence reversal success rates, factors to consider in choosing to perform vasovasostomy versus vasoepididymostomy, and the usefulness of vasectomy reversal to alleviate postvasectomy pain syndrome. We also review the use of robotics for vasectomy reversal and other novel techniques and instrumentation that have emerged in recent years to aid in the success of this surgery.

  17. Remediating biofouling of reverse osmosis membranes

    International Nuclear Information System (INIS)

    Siler, J.L.

    1991-01-01

    Several potential additives and the use of influent pH adjustment were examined to remediated the biofouling problem of the ETF reverse osmosis (RO) system. Tests were conducted with simulated RO feed containing salt, metal hydroxides and bacteria. The addition of sodium hexametaphosphate (SHMP), sodium bisulfite, and adjusting the influent pH to 3 were each successful in reducing the RO biofouling. Little or no benefit was found from the use of a biofilm remover (Filmtec Alkaline Cleaner) or the use of surfactants (Surfynol or sodium lauryl sulfate). In addition, Surfynol use resulted in irreversible fouling and necessitated membrane replacement. At the water recoveries used in the ETF (>90%), sodium bisulfite addition resulted in the recovery of 70--90% of the flux and almost complete restoration of the DF to prefouled conditions. Based on the bench-scale tests completed, IWT would recommend that sodium bisulfite addition be tested at the ETF. This testing would involve optimizing the amount of bisulfite required. In addition, it is recommended that the addition of SHMP or influent pH adjustment be evaluated since the relative differences in labscale tests were small and scale-up effects could be present. The ETF operating permit allows each to be added

  18. Formalized Planning and Its Connection With the Development of Reverse Logistics: the Case of Services

    Directory of Open Access Journals (Sweden)

    Radoslav Škapa

    2014-01-01

    Full Text Available The best-in-class companies are able to retrieve 64 per cent of the original value of reverse flows, whereas it is only 12.5 per cent in average companies. Thus, reverse logistics is a challenge that may bring additional benefits. The article analyzes the planning range of reverse logistics in the Czech service companies, and it further notes the relations between planning and other characteristics of a company. Our results indicate that the ability to recognize different connections of reverse flows in business (opportunities, threats as well as strengths and weaknesses is one of the important factors that affect the advancement of reverse logistics in companies.

  19. A Ligand-observed Mass Spectrometry Approach Integrated into the Fragment Based Lead Discovery Pipeline

    Science.gov (United States)

    Chen, Xin; Qin, Shanshan; Chen, Shuai; Li, Jinlong; Li, Lixin; Wang, Zhongling; Wang, Quan; Lin, Jianping; Yang, Cheng; Shui, Wenqing

    2015-01-01

    In fragment-based lead discovery (FBLD), a cascade combining multiple orthogonal technologies is required for reliable detection and characterization of fragment binding to the target. Given the limitations of the mainstream screening techniques, we presented a ligand-observed mass spectrometry approach to expand the toolkits and increase the flexibility of building a FBLD pipeline especially for tough targets. In this study, this approach was integrated into a FBLD program targeting the HCV RNA polymerase NS5B. Our ligand-observed mass spectrometry analysis resulted in the discovery of 10 hits from a 384-member fragment library through two independent screens of complex cocktails and a follow-up validation assay. Moreover, this MS-based approach enabled quantitative measurement of weak binding affinities of fragments which was in general consistent with SPR analysis. Five out of the ten hits were then successfully translated to X-ray structures of fragment-bound complexes to lay a foundation for structure-based inhibitor design. With distinctive strengths in terms of high capacity and speed, minimal method development, easy sample preparation, low material consumption and quantitative capability, this MS-based assay is anticipated to be a valuable addition to the repertoire of current fragment screening techniques. PMID:25666181

  20. Environmental Impacts by Fragments Released from Nanoenabled Products: A Multiassay, Multimaterial Exploration by the SUN Approach.

    Science.gov (United States)

    Amorim, Mónica J B; Lin, Sijie; Schlich, Karsten; Navas, José M; Brunelli, Andrea; Neubauer, Nicole; Vilsmeier, Klaus; Costa, Anna L; Gondikas, Andreas; Xia, Tian; Galbis, Liliana; Badetti, Elena; Marcomini, Antonio; Hristozov, Danail; Kammer, Frank von der; Hund-Rinke, Kerstin; Scott-Fordsmand, Janeck J; Nel, André; Wohlleben, Wendel

    2018-02-06

    Nanoenabled products (NEPs) have numerous outdoor uses in construction, transportation or consumer scenarios, and there is evidence that their fragments are released in the environment at low rates. We hypothesized that the lower surface availability of NEPs fragment reduced their environmental effects with respect to pristine nanomaterials. This hypothesis was explored by testing fragments generated by intentional micronisation ("the SUN approach"; Nowack et al. Meeting the Needs for Released Nanomaterials Required for Further Testing: The SUN Approach. Environmental Science & Technology, 2016 (50), 2747). The NEPs were composed of four matrices (epoxy, polyolefin, polyoxymethylene, and cement) with up to 5% content of three nanomaterials (carbon nanotubes, iron oxide, and organic pigment). Regardless of the type of nanomaterial or matrix used, it was observed that nanomaterials were only partially exposed at the NEP fragment surface, indicating that mostly the intrinsic and extrinsic properties of the matrix drove the NEP fragment toxicity. Ecotoxicity in multiple assays was done covering relevant media from terrestrial to aquatic, including sewage treatment plant (biological activity), soil worms (Enchytraeus crypticus), and fish (zebrafish embryo and larvae and trout cell lines). We designed the studies to explore the possible modulation of ecotoxicity by nanomaterial additives in plastics/polymer/cement, finding none. The results support NEPs grouping by the matrix material regarding ecotoxicological effect during the use phase. Furthermore, control results on nanomaterial-free polymer fragments representing microplastic had no significant adverse effects up to the highest concentration tested.

  1. Fragmentation characteristics of hydroxycinnamic acids in ESI-MSn by density functional theory.

    Science.gov (United States)

    Yin, Zhi-Hui; Sun, Chang-Hai; Fang, Hong-Zhuang

    2017-07-01

    This work aims to analyze the electrospray ionization multistage mass spectrometry (ESI-MS n ) fragmentation characteristics of hydroxycinnamic acids (HCAs) in negative ion mode. The geometric parameters, energies, natural bond orbitals and frontier orbitals of fragments were calculated by density functional theory (DFT) to investigate mass spectral fragmentation mechanisms. The results showed that proton transfer always occurred during fragmentation of HCAs; their quasi-molecular ions ([M - H] - ) existed in more than one form and were mainly with the lowest energy. The fragmentation characteristics included the followings: (1) according to the different substitution position of phenolic hydroxyl group, the ring contraction reaction by CO elimination from benzene was in an increasingly difficult order: m-phenolic hydroxyl > p-phenolic hydroxyl > o-phenolic hydroxyl; and (2) ortho effect always occurred in o-dihydroxycinnamic acids (o-diHCAs), i.e. one phenolic hydroxyl group offered H + , which combined with the other one to lose H 2 O. In addition, there was a nucleophilic reaction during ring contraction in diHCAs that oxygen atom attacked the carbon atom binding with the other phenolic hydroxyl to lose CO 2 . The fragmentation characteristics and mechanism of HCAs could be used for analysis and identification of such compounds quickly and effectively, and as reference for structural analogues by ESI-MS. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  2. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  3. Mapping of the antigenic and allergenic epitopes of Lol p VB using gene fragmentation.

    Science.gov (United States)

    Ong, E K; Knox, R B; Singh, M B

    1995-03-01

    The recombinant proteins of Lol p VA and Lol p VB expressed in E. coli reacted with IgE antibodies from sera of allergic patients and mAbs FMC A7 and PpV1. Cross-absorption analyses using these recombinant proteins showed that Lol p VA and Lol p VB possess both similar and unique IgE binding determinants. Gene fragmentation was utilized to localize the antigenic and allergenic determinants of Lol p VB. When full-length cDNA of Lol p VB was digested into three fragments and expressed as the fusions from the glutathione transferase of pGEX vectors, fragments Met1-Val196 and Asp197-Val339 bound IgE while fragment Met1-Pro96 did not. The data suggest that there are at least two IgE binding determinants in Lol p VB. In addition, only fragment Met1-Val196 reacted with mAb PpV1. The localization of these determinants was further resolved using random fragment expression libraries. The mAb PpV1 determinant was near the N-terminal region of Lol p VB molecule. The IgE binding determinants were distributed in the central region: region I (amino acids 111-195) and II (199-254). These IgE binding determinants are conserved in Lol p VA.

  4. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  5. Effect of molecular structure on fragmentation of isolated organic molecules in solid rare gas matrices

    International Nuclear Information System (INIS)

    Kobzarenko, A.V.; Sukhov, F.F.; Orlov, A.Yu.; Kovalev, G.V.; Baranova, I.A.; Feldman, V.I.

    2012-01-01

    The effect of excess energy on the primary radical cations of bifunctional carbonyl compounds and aliphatic alkynes was simulated by matrix isolation method using rare gas matrices with various ionization potentials. The formation of fragmentation products was monitored by EPR and FTIR spectroscopy. It was shown that the radical cations of bifunctional compounds (CH 3 OCH 2 COCH 3 and CH 3 COCOCH 3 ) dissociated effectively yielding · CH 3 radicals upon irradiation in solid argon matrix at T≤16 K. In addition to isolated methyl radicals, the radical pairs consisting of two methyl radicals separated by two CO molecules were detected in the case of diacetyl. The probability of fragmentation decreases with the decreasing excess energy by switching from Ar to Xe. In general, bifunctional molecules were found to be less stable to “hot” ionic fragmentation in low-temperature solids in comparison with simple prototype compounds. In the case of alkynes of the R--C≡CH type, a noticeable yield of fragmentation products was observed when R=–C(CH 3 ) 3 , but it was negligible for R=–CH 3 . The mechanisms of “hot” reactions and excess energy relaxation are discussed. - Highlights: ► Radiolysis of bifunctional organic compounds and alkynes. ► Dependence of “hot” fragmentation probability from molecular structure. ► Ions of bifunctional compounds are less stable than those of monofunctional ones. ► Alkynes are rather stable to “hot” fragmentation.

  6. Reverse Knowledge Transfer in MNEs

    DEFF Research Database (Denmark)

    Mudambi, Ram; Piscitello, Lucia; Rabbiosi, Larissa

    2014-01-01

    a positive correlation with the extent of reverse knowledge transfers to the parent MNE. Relying on the headquarters-subsidiary view of the MNE, we argue that, beyond a point, increasing subsidiary innovativeness will be associated with lower reverse knowledge transfers. Further, we argue......It is now well recognized that multinational enterprises (MNEs) are differentiated networks wherein subsidiaries vary in terms of their ability to create new knowledge and competencies for their parent groups. In much of this theory, it is taken for granted that subsidiary innovativeness has...... that this relationship is sensitive to the subsidiary entry mode. Using data from a sample of 293 Italian subsidiaries, we find strong support for our hypotheses. In particular, our results confirm that the effect of subsidiary innovativeness on reverse knowledge transfers displays an inverted-U shape...

  7. Ice ages and geomagnetic reversals

    Science.gov (United States)

    Wu, Patrick

    1992-01-01

    There have been speculations on the relationship between climatic cooling and polarity reversals of the earth's magnetic field during the Pleistocene. Two of the common criticisms on this relationship have been the reality of these short duration geomagnetic events and the accuracy of their dates. Champion et al. (1988) have reviewed recent progress in this area. They identified a total of 10 short-duration polarity events in the last 1 Ma and 6 of these events have been found in volcanic rocks, which also have K-Ar dates. Supposing that the speculated relationship between climatic cooling and geomagnetic reversals actually exist, two mechanisms that assume climatic cooling causes short period magnetic reversals will be investigated. These two methods are core-mantle boundary topography and transfer of the rotational energy to the core.

  8. Reverse innovation in maternal health.

    Science.gov (United States)

    Firoz, Tabassum; Makanga, Prestige Tatenda; Nathan, Hannah L; Payne, Beth; Magee, Laura A

    2017-09-01

    Reverse innovation, defined as the flow of ideas from low- to high-income settings, is gaining traction in healthcare. With an increasing focus on value, investing in low-cost but effective and innovative solutions can be of mutual benefit to both high- and low-income countries. Reverse innovation has a role in addressing maternal health challenges in high-income countries by harnessing these innovative solutions for vulnerable populations especially in rural and remote regions. In this paper, we present three examples of 'reverse innovation' for maternal health: a low-cost, easy-to-use blood pressure device (CRADLE), a diagnostic algorithm (mini PIERS) and accompanying mobile app (PIERS on the Move), and a novel method for mapping maternal outcomes (MOM).

  9. Reverse Transfection Using Gold Nanoparticles

    Science.gov (United States)

    Yamada, Shigeru; Fujita, Satoshi; Uchimura, Eiichiro; Miyake, Masato; Miyake, Jun

    Reverse transfection from a solid surface has the potential to deliver genes into various types of cell and tissue more effectively than conventional methods of transfection. We present a method for reverse transfection using a gold colloid (GC) as a nanoscaffold by generating nanoclusters of the DNA/reagentcomplex on a glass surface, which could then be used for the regulation of the particle size of the complex and delivery of DNA into nuclei. With this method, we have found that the conjugation of gold nanoparticles (20 nm in particle size) to the pEGFP-N1/Jet-PEI complex resulted in an increase in the intensity of fluorescence of enhanced green fluorescent protein (EGFP) (based on the efficiency of transfection) from human mesenchymal stem cells (hMSCs), as compared with the control without GC. In this manner, we constructed a method for reverse transfection using GC to deliver genes into the cells effectively.

  10. Designing the Reverse Supply Chain

    DEFF Research Database (Denmark)

    Gobbi, Chiara

    2011-01-01

    Purpose – The purpose of this paper is to explore the impact of the product residual value (PRV) and the loss of value over time of returned products in the reverse supply chain configuration. It also examines whether or not the distinction of Fisher's functional and innovative products holds...... that allows for recapturing most of the PRV. These notions have then been tested by analyzing two reverse supply chains with a case study research methodology. Findings – The findings show that low PRV is associated with second-class recovery options (recycling and energy recovery) and that high PRV...... is associated with first-class recovery options (reconditioning and remarketing). When the recovery option is recycling, time is not relevant, the primary objective is cost reduction (efficiency), the chain is centralized, and actors and phases of the reverse chain are determined by the specificity...

  11. O-GlcNAcase Fragment Discovery with Fluorescence Polarimetry.

    Science.gov (United States)

    Borodkin, Vladimir S; Rafie, Karim; Selvan, Nithya; Aristotelous, Tonia; Navratilova, Iva; Ferenbach, Andrew T; van Aalten, Daan M F

    2018-05-18

    The attachment of the sugar N-acetyl-D-glucosamine (GlcNAc) to specific serine and threonine residues on proteins is referred to as protein O-GlcNAcylation. O-GlcNAc transferase (OGT) is the enzyme responsible for carrying out the modification, while O-GlcNAcase (OGA) reverses it. Protein O-GlcNAcylation has been implicated in a wide range of cellular processes including transcription, proteostasis, and stress response. Dysregulation of O-GlcNAc has been linked to diabetes, cancer, and neurodegenerative and cardiovascular disease. OGA has been proposed to be a drug target for the treatment of Alzheimer's and cardiovascular disease given that increased O-GlcNAc levels appear to exert a protective effect. The search for specific, potent, and drug-like OGA inhibitors with bioavailability in the brain is therefore a field of active research, requiring orthogonal high-throughput assay platforms. Here, we describe the synthesis of a novel probe for use in a fluorescence polarization based assay for the discovery of inhibitors of OGA. We show that the probe is suitable for use with both human OGA, as well as the orthologous bacterial counterpart from Clostridium perfringens, CpOGA, and the lysosomal hexosaminidases HexA/B. We structurally characterize CpOGA in complex with a ligand identified from a fragment library screen using this assay. The versatile synthesis procedure could be adapted for making fluorescent probes for the assay of other glycoside hydrolases.

  12. Provenance studies of pottery fragments from medieval Cairo, Egypt

    International Nuclear Information System (INIS)

    Beal, J.W.; Olmez, I.

    1997-01-01

    In the analysis of archeological pottery fragments, instrumental neutron activation analysis has been utilized to establish the elemental concentrations of up to 37 chemical elements for each of 53 archeological pottery samples from medieval Cairo, Egypt, and one additional sample of Chinese porcelain. These elemental concentrations have been utilized in a statistical analysis procedure in order to determine similarities and correlations between the various samples. Multivariate analyses have been used to quantitatively determine these interrelationships. This methodology successfully separated the Egyptian samples into two broad categories: polychrome decorated ceramic ware and monochrome celadon ware. In addition the methodology successfully identified the one unique sample of Chinese porcelain. Several samples appeared to be either a mixture of categories or outliers in the data set and were not attributable to any distinct category. (author)

  13. Characterization of Tumor-Avid Antibody Fragments Genetically Engineered for Mono-Specific Radionuclide Chelation

    International Nuclear Information System (INIS)

    Quinn, T.P.

    2003-01-01

    The successful clinical application of targeted-radiopharmaceuticals depends on the development of molecules that optimize tumor specific radionuclide deposition and minimize non-specific organ irradiation. To this end, this proposal outlines a research effort to identify and evaluate novel antibodies and antibody fragments that bind breast tumors. The tumor-avid antibodies will be investigated for as imaging and therapeutic agents and to gain a better understanding of the pharmacokinetics and metabolism of radiolabeled tumor-avid antibody fragments through the use of site-specifically labeled molecules. Antibodies or antibody fragments, that bind breast carcinoma carbohydrate antigens, will be obtained from hybridoma or bacteriophage library screening. More specifically, antibody fragments that bind the carcinoma-associated Thomsen-Friedenreich (T) antigen will be radiolabeled with 99m Tc and 188 Re at a natural amino acid chelation site and will be investigated in vivo for their abilities to target human breast tumors. In addition, site-specific radiolabeled antibody fragments will be biosynthesized using misacylated suppressor tRNAs. Homogeneously radiolabeled populations of antibody fragments will be used to investigate the effects of radionuclide location and chelation chemistries on their biodistribution and metabolism. It is hypothesized that site-specifically radiolabeled antibody fragments will possess enhanced tumor imaging and therapeutic properties due to optimal label location and conjugation chemistries. New insights into the factors that govern antibody metabolism in vivo are also expected from this work. Results from these studies should enhance our ability to design and synthesize radiolabeled antibody fragments that have improved pharmacokinetic properties. The studies in this proposal involve basic research into the development of antibody-based radiopharmaceuticals, with the ultimate goal of application in humans. This type of basic nuclear

  14. Novel approach of fragment-based lead discovery applied to renin inhibitors.

    Science.gov (United States)

    Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki

    2016-11-15

    A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

    Science.gov (United States)

    Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

    2012-01-01

    A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

  16. Prediction of Protein-Protein Interactions by NanoLuc-Based Protein-Fragment Complementation Assay | Office of Cancer Genomics

    Science.gov (United States)

    The CTD2 Center at Emory has developed a new NanoLuc®-based protein-fragment complementation assay (NanoPCA) which allows the detection of novel protein-protein interactions (PPI). NanoPCA allows the study of PPI dynamics with reversible interactions.  Read the abstract. Experimental Approaches Read the detailed Experimetnal Approaches. 

  17. Marburg Virus Reverse Genetics Systems

    Directory of Open Access Journals (Sweden)

    Kristina Maria Schmidt

    2016-06-01

    Full Text Available The highly pathogenic Marburg virus (MARV is a member of the Filoviridae family and belongs to the group of nonsegmented negative-strand RNA viruses. Reverse genetics systems established for MARV have been used to study various aspects of the viral replication cycle, analyze host responses, image viral infection, and screen for antivirals. This article provides an overview of the currently established MARV reverse genetic systems based on minigenomes, infectious virus-like particles and full-length clones, and the research that has been conducted using these systems.

  18. Reverse Zymography: Overview and Pitfalls.

    Science.gov (United States)

    Sharma, Kanika; Bhattacharyya, Debasish

    2017-01-01

    Reverse zymography is a technique by which protease inhibitor(s) in a sample could be electrophoretically separated in a substrate-impregnated acrylamide gel and their relative abundance could be semi-quantified. The gel after electrophoresis is incubated with a protease when the impregnated substrate and all other proteins of the sample are degraded into small peptides except the inhibitor(s) that show clear bands against a white background. Since reverse zymography cannot distinguish between a protease inhibitor and a protein that is resistant against proteolysis, the results should be confirmed from inhibition of protease activity by solution state assay.

  19. Reverse hybrid total hip arthroplasty

    DEFF Research Database (Denmark)

    Wangen, Helge; Havelin, Leif I.; Fenstad, Anne M

    2017-01-01

    Background and purpose - The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty....... Patients and methods - From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk...

  20. Reference counting for reversible languages

    DEFF Research Database (Denmark)

    Mogensen, Torben Ægidius

    2014-01-01

    inverses: Freeing a block of memory is done by running the allocation procedure backwards. Axelsen and Glück use this heap manager to sketch implementation of a simple reversible functional language where pattern matching a constructor is the inverse of construction, so pattern-matching implies......Modern programming languages and operating systems use heap memory that allows allocation and deallocation of memory to be decoupled, so they don't follow a stack discipline. Axelsen and Glück have presented a reversible heap manager where allocation and deallocation are each other's logical...