Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

DEFF Research Database (Denmark)

Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

2012-01-01

To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

Science.gov (United States)

Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

2011-12-01

Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

Science.gov (United States)

Mo, Yiqun; Wan, Rong; Zhang, Qunwei

2012-01-01

Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

Directory of Open Access Journals (Sweden)

Ji Yeon Kwon

2013-09-01

Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

Reference genes for reverse transcription quantitative PCR in canine brain tissue

NARCIS (Netherlands)

Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

2015-01-01

BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Cesare Bonacina

2010-01-01

Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

Science.gov (United States)

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Semi-Nested Real-Time Reverse Transcription Polymerase Chain Reaction Methods for the Successful Quantitation of Cytokeratin mRNA Expression Levels for the Subtyping of Non-Small-Cell Lung Carcinoma Using Paraffin-Embedded and Microdissected Lung Biopsy Specimens

International Nuclear Information System (INIS)

Nakanishi, Yoko; Shimizu, Tetsuo; Tsujino, Ichiro; Obana, Yukari; Seki, Toshimi; Fuchinoue, Fumi; Ohni, Sumie; Oinuma, Toshinori; Kusumi, Yoshiaki; Yamada, Tsutomu; Takahashi, Noriaki; Hashimoto, Shu; Nemoto, Norimichi

2013-01-01

In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC

Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR.

Science.gov (United States)

Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W Ian; Kabuusu, Richard M; Ferguson, Hugh; Del Pozo, Jorge; Eldar, Avi; Bacharach, Eran

2017-03-01

Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. Copyright © 2017 American Society for Microbiology.

Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR

Science.gov (United States)

Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W. Ian; Kabuusu, Richard M.; Ferguson, Hugh; del Pozo, Jorge

2016-01-01

ABSTRACT Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. PMID:27974544

Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

Directory of Open Access Journals (Sweden)

U. Pagnini

2010-02-01

Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

Directory of Open Access Journals (Sweden)

Raden Wasito

2015-05-01

Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

International Nuclear Information System (INIS)

Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

2006-01-01

RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

CDK9-dependent RNA polymerase II pausing controls transcription initiation.

Science.gov (United States)

Gressel, Saskia; Schwalb, Björn; Decker, Tim Michael; Qin, Weihua; Leonhardt, Heinrich; Eick, Dirk; Cramer, Patrick

2017-10-10

Gene transcription can be activated by decreasing the duration of RNA polymerase II pausing in the promoter-proximal region, but how this is achieved remains unclear. Here we use a 'multi-omics' approach to demonstrate that the duration of polymerase pausing generally limits the productive frequency of transcription initiation in human cells ('pause-initiation limit'). We further engineer a human cell line to allow for specific and rapid inhibition of the P-TEFb kinase CDK9, which is implicated in polymerase pause release. CDK9 activity decreases the pause duration but also increases the productive initiation frequency. This shows that CDK9 stimulates release of paused polymerase and activates transcription by increasing the number of transcribing polymerases and thus the amount of mRNA synthesized per time. CDK9 activity is also associated with long-range chromatin interactions, suggesting that enhancers can influence the pause-initiation limit to regulate transcription.

Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

Science.gov (United States)

Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

2015-08-01

This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

RNA polymerase II collision interrupts convergent transcription

DEFF Research Database (Denmark)

Hobson, David J; Wei, Wu; Steinmetz, Lars M

2012-01-01

Antisense noncoding transcripts, genes-within-genes, and convergent gene pairs are prevalent among eukaryotes. The existence of such transcription units raises the question of what happens when RNA polymerase II (RNAPII) molecules collide head-to-head. Here we use a combination of biochemical...

Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

Directory of Open Access Journals (Sweden)

Boissière-Michot Florence

2009-04-01

Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.

Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

Directory of Open Access Journals (Sweden)

Trioso Purnawarman

2014-04-01

Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

International Nuclear Information System (INIS)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

1994-01-01

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

Energy Technology Data Exchange (ETDEWEB)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

1994-07-15

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Directory of Open Access Journals (Sweden)

Laurent Dacheux

2016-07-01

Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Science.gov (United States)

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

Science.gov (United States)

Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior

Science.gov (United States)

Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

2011-01-01

Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

Directory of Open Access Journals (Sweden)

C Coelho

2003-06-01

Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

RNA Polymerase II–The Transcription Machine

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 3. RNA Polymerase II – The Transcription Machine - Nobel Prize in Chemistry 2006. Jiyoti Verma Aruna Naorem Anand Kumar Manimala Sen Parag Sadhale. General Article Volume 12 Issue 3 March 2007 pp 47-53 ...

Noncoding transcription by alternative rna polymerases dynamically regulates an auxin-driven chromatin loop

KAUST Repository

Ariel, Federico D.; Jé gu, Teddy; Latrasse, David; Romero-Barrios, Natali; Christ, Auré lie; Benhamed, Moussa; Crespi, Martí n D.

2014-01-01

The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.

Noncoding transcription by alternative rna polymerases dynamically regulates an auxin-driven chromatin loop

KAUST Repository

Ariel, Federico D.

2014-08-01

The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.

Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

Science.gov (United States)

Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

2001-06-01

A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

Science.gov (United States)

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay.

Science.gov (United States)

Babu, Binoy; Washburn, Brian K; Ertek, Tülin Sarigül; Miller, Steven H; Riddle, Charles B; Knox, Gary W; Ochoa-Corona, Francisco M; Olson, Jennifer; Katırcıoğlu, Yakup Zekai; Paret, Mathews L

2017-09-01

Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (rose varieties, collected from different states in the U.S. The entire process, including the extraction can be completed in 25min, with less sophisticated equipments. The developed assay can be used with high efficiency in large scale field testing for rapid detection of RRV in commercial nurseries and landscapes. Copyright © 2017 Elsevier B.V. All rights reserved.

Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

Science.gov (United States)

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

Properties of the reverse transcription reaction in mRNA quantification

DEFF Research Database (Denmark)

Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie

2004-01-01

BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...

Real-time observation of the initiation of RNA polymerase II transcription.

Science.gov (United States)

Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M

2015-09-10

Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.

New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

Science.gov (United States)

Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

2014-01-01

Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

2011-11-01

Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

Science.gov (United States)

Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

2015-10-01

The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

Chromosomal loop/nuclear matrix organization of transcriptionally active and inactive RNA polymerases in HeLa nuclei.

Science.gov (United States)

Roberge, M; Dahmus, M E; Bradbury, E M

1988-06-05

The relative distribution of transcriptionally active and inactive RNA polymerases I and II between the nuclear matrix/scaffold and chromosomal loops of HeLa cells was determined. Total RNA polymerase was assessed by immunoblotting and transcribing RNA polymerase by a photoaffinity labeling technique in isolated nuclei. Nuclear matrix/scaffold was isolated by three methods using high-salt, intermediate-salt or low-salt extraction. The distribution of RNA polymerases I and II were very similar within each of the methods, but considerable differences in distributions were found between the different preparation methods. Either intermediate-salt or high-salt treatment of DNase I-digested nuclei showed significant association of RNA polymerases with the nuclear matrix. However, intermediate-salt followed by high-salt treatment released all transcribing and non-transcribing RNA polymerases. Nuclear scaffolds isolated with lithium diiodosalicylate (low-salt) contained very little of the RNA polymerases. This treatment, however, caused the dissociation of RNA polymerase II transcription complexes. These results show unambiguously that RNA polymerases, both in their active and inactive forms, are not nuclear matrix proteins. The data support models in which the transcriptional machinery moves around DNA loops during transcription.

Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle

DEFF Research Database (Denmark)

Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

1999-01-01

A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...

Fixing the model for transcription: the DNA moves, not the polymerase.

Science.gov (United States)

Papantonis, Argyris; Cook, Peter R

2011-01-01

The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.

Rapid detection of Prunus necrotic ringspot virus using magnetic nanoparticle-assisted reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Zong, Xiaojuan; Wang, Wenwen; Wei, Hairong; Wang, Jiawei; Chen, Xin; Xu, Li; Zhu, Dongzi; Tan, Yue; Liu, Qingzhong

2014-11-01

Prunus necrotic ringspot virus (PNRSV) has seriously reduced the yield of Prunus species worldwide. In this study, a highly efficient and specific two-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed to detect PNRSV. Total RNA was extracted from sweet cherry leaf samples using a commercial kit based on a magnetic nanoparticle technique. Transcripts were used as the templates for the assay. The results of this assay can be detected using agarose gel electrophoresis or by assessing in-tube fluorescence after adding SYBR Green I. The assay is highly specific for PNRSV, and it is more sensitive than reverse-transcription polymerase chain reaction (RT-PCR). Restriction enzyme digestion verified further the reliability of this RT-LAMP assay. To our knowledge, this is the first report of the application of RT-LAMP to PNRSV detection in Prunus species. Copyright © 2014 Elsevier B.V. All rights reserved.

Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

Science.gov (United States)

Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

2015-05-26

DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

DEFF Research Database (Denmark)

Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo

2011-01-01

and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without modifications......The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT...

Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India

Directory of Open Access Journals (Sweden)

Partha Sarathi Mandal

2017-03-01

Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.

Identification of a conserved archaeal RNA polymerase subunit contacted by the basal transcription factor TFB.

Science.gov (United States)

Magill, C P; Jackson, S P; Bell, S D

2001-12-14

Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).

Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus

DEFF Research Database (Denmark)

Dukes, J.P.; King, D.P.; Alexandersen, Søren

2006-01-01

Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...

Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

International Nuclear Information System (INIS)

Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

1987-01-01

The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

Development of mRNA-based body fluid identification using reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Satoh, Tetsuya; Kouroki, Seiya; Ogawa, Keita; Tanaka, Yorika; Matsumura, Kazutoshi; Iwase, Susumu

2018-04-25

Identifying body fluids from forensic samples can provide valuable evidence for criminal investigations. Messenger RNA (mRNA)-based body fluid identification was recently developed, and highly sensitive parallel identification using reverse transcription polymerase chain reaction (RT-PCR) has been described. In this study, we developed reverse transcription loop-mediated isothermal amplification (RT-LAMP) as a simple, rapid assay for identifying three common forensic body fluids, namely blood, semen, and saliva, and evaluated its specificity and sensitivity. Hemoglobin beta (HBB), transglutaminase 4 (TGM4), and statherin (STATH) were selected as marker genes for blood, semen, and saliva, respectively. RT-LAMP could be performed in a single step including both reverse transcription and DNA amplification under an isothermal condition within 60 min, and detection could be conveniently performed via visual fluorescence. Marker-specific amplification was performed in each assay, and no cross-reaction was observed among five representative forensically relevant body fluids. The detection limits of the assays were 0.3 nL, 30 nL, and 0.3 μL for blood, semen, and saliva, respectively, and their sensitivities were comparable with those of RT-PCR. Furthermore, RT-LAMP assays were applicable to forensic casework samples. It is considered that RT-LAMP is useful for body fluid identification.

Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

Directory of Open Access Journals (Sweden)

Hamed Rezaeejam

2015-01-01

Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

Science.gov (United States)

Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

2017-08-15

Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

Science.gov (United States)

Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

2013-12-01

Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

NARCIS (Netherlands)

Hatta, Mochammad; Smits, Henk L.

2007-01-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

Archaeal RNA polymerase arrests transcription at DNA lesions.

Science.gov (United States)

Gehring, Alexandra M; Santangelo, Thomas J

2017-01-01

Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.

Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

Science.gov (United States)

Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

2003-01-01

Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

Directory of Open Access Journals (Sweden)

FIGUEIREDO Luiz Tadeu Moraes

1997-01-01

Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure.

OpenAIRE

Campbell, J; Lowe, J; Walz, S; Ezzell, J

1993-01-01

We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.

Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

Science.gov (United States)

Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

2012-02-01

Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

The Mediator Complex: At the Nexus of RNA Polymerase II Transcription.

Science.gov (United States)

Jeronimo, Célia; Robert, François

2017-10-01

Mediator is an essential, large, multisubunit, transcriptional co-activator highly conserved across eukaryotes. Mediator interacts with gene-specific transcription factors at enhancers as well as with the RNA polymerase II (RNAPII) transcription machinery bound at promoters. It also interacts with several other factors involved in various aspects of transcription, chromatin regulation, and mRNA processing. Hence, Mediator is at the nexus of RNAPII transcription, regulating its many steps and connecting transcription with co-transcriptional events. To achieve this flexible role, Mediator, which is divided into several functional modules, reorganizes its conformation and composition while making transient contacts with other components. Here, we review the mechanisms of action of Mediator and propose a unifying model for its function. Copyright © 2017 Elsevier Ltd. All rights reserved.

Intronic L1 retrotransposons and nested genes cause transcriptional interference by inducing intron retention, exonization and cryptic polyadenylation.

Directory of Open Access Journals (Sweden)

Kristel Kaer

Full Text Available Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown.Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3' ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals.Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression.

Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Faggioli, F; Pasquini, G; Barba, M

1998-09-01

The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

Transcription elongation. Heterogeneous tracking of RNA polymerase and its biological implications.

Science.gov (United States)

Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail

2014-01-01

Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

Science.gov (United States)

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

Science.gov (United States)

Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

2011-07-01

Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

RNA polymerase II transcriptional fidelity control and its functional interplay with DNA modifications

Science.gov (United States)

Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong

2016-01-01

Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149

Transcription Profiling of Bacillus subtilis Cells Infected with AR9, a Giant Phage Encoding Two Multisubunit RNA Polymerases.

Science.gov (United States)

Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin

2017-02-14

Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.

Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II

NARCIS (Netherlands)

B. Steurer (Barbara); J.A. Marteijn (Jurgen)

2016-01-01

textabstractThe faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The

Regulation of nucleolus assembly by non-coding RNA polymerase II transcripts.

Science.gov (United States)

Caudron-Herger, Maïwen; Pankert, Teresa; Rippe, Karsten

2016-05-03

The nucleolus is a nuclear subcompartment for tightly regulated rRNA production and ribosome subunit biogenesis. It also acts as a cellular stress sensor and can release enriched factors in response to cellular stimuli. Accordingly, the content and structure of the nucleolus change dynamically, which is particularly evident during cell cycle progression: the nucleolus completely disassembles during mitosis and reassembles in interphase. Although the mechanisms that drive nucleolar (re)organization have been the subject of a number of studies, they are only partly understood. Recently, we identified Alu element-containing RNA polymerase II transcripts (aluRNAs) as important for nucleolar structure and rRNA synthesis. Integrating these findings with studies on the liquid droplet-like nature of the nucleolus leads us to propose a model on how RNA polymerase II transcripts could regulate the assembly of the nucleolus in response to external stimuli and during cell cycle progression.

The Transcription Bubble of the RNA Polymerase-Promoter Open Complex Exhibits Conformational Heterogeneity and Millisecond-Scale Dynamics : Implications for Transcription Start-Site Selection

NARCIS (Netherlands)

Robb, Nicole C.; Cordes, Thorben; Hwang, Ling Chin; Gryte, Kristofer; Duchi, Diego; Craggs, Timothy D.; Santoso, Yusdi; Weiss, Shimon; Ebright, Richard H.; Kapanidis, Achillefs N.

2013-01-01

Bacterial transcription is initiated after RNA polymerase (RNAP) binds to promoter DNA, melts similar to 14 bp around the transcription start site and forms a single-stranded "transcription bubble" within a catalytically active RNAP-DNA open complex (RPo). There is significant flexibility in the

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

Science.gov (United States)

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

Science.gov (United States)

Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

2016-01-01

Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

Science.gov (United States)

Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

2016-06-01

Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

Bakteri Legionella pneumophila Terdeteksi pada Air Kolam Renang di Kota Surabaya dengan Nested Polymerase Chain Reaction (LEGIONELLA PNEUMOPHILA BACTERIADETECTED IN SWIMMING POOL WATER OF SURABAYA BY USING NESTED POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Eduardus Bimo Aksono

2017-06-01

Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup

Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

Science.gov (United States)

Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

2014-10-01

Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops. Copyright © 2014 Elsevier B.V. All rights reserved.

Transcriptional analysis of left-sided colitis, pancolitis, and ulcerative colitis-associated dysplasia

DEFF Research Database (Denmark)

Bjerrum, Jacob T; Nielsen, Ole H; Riis, Lene B

2014-01-01

to identify potential biomarkers and transcripts of importance for the carcinogenic behavior of chronic inflammation. METHODS: The Affymetrix GeneChip Human Genome U133 Plus 2.0 was applied on colonic biopsies from UC patients with left-sided UC, pancolitis, dysplasia, and controls. Reverse transcription...... polymerase chain reaction and immunohistochemistry were performed for validating selected transcripts in the initial cohort and in 2 independent cohorts of patients with UC. Microarray data were analyzed by principal component analysis, and reverse transcription polymerase chain reaction...... and immunohistochemistry data by the Wilcoxon's rank-sum test. RESULTS: The principal component analysis results revealed separate clusters for left-sided UC, pancolitis, dysplasia, and controls. Close clustering of dysplastic and pancolitic samples indicated similarities in gene expression. Indeed, 101 and 656 parallel...

Comparison of multiplex reverse transcription-PCR-enzyme ...

African Journals Online (AJOL)

Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

Crowding-induced transcriptional bursts dictate polymerase and nucleosome density profiles along genes

NARCIS (Netherlands)

van den Berg, A.A.; Depken, S.M.

2017-01-01

During eukaryotic transcription, RNA polymerase (RNAP) translocates along DNA molecules covered with nucleosomes and other DNA binding proteins. Though the interactions between a single nucleosome and RNAP are by now fairly well understood, this understanding has not been synthesized into a

Requirements for DNA strand transfer during reverse transcription in mutant HIV-1 virions

NARCIS (Netherlands)

Berkhout, B.; van Wamel, J.; Klaver, B.

1995-01-01

Retroviruses convert their RNA genome into a DNA form by means of reverse transcription. According to the current model of reverse transcription, two strand transfer reactions are needed to synthesize a full-length DNA genome. Because reverse transcription is initiated close to the 5' end of the RNA

Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

Science.gov (United States)

Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

2016-09-01

Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

Detection of hepatitis A virus in shellfish by nested reverse transcription-PCR

NARCIS (Netherlands)

Croci, L.; Medici, de D.; Morace, G.; Fiore, A.; Scalfaro, C.; Beneduce, F.; Toti, L.

1999-01-01

A method for the detection of HAV in shellfish, based on the use of guanidinium isothiocyanate-contg. soln. for RNA extn. and purifn. steps, followed by nested PCR, is hereby proposed. Tests were carried out on mollusc samples spiked with HAV strain FG. Results showed that in samples subjected only

FACT facilitates chromatin transcription by RNA polymerases I and III

DEFF Research Database (Denmark)

Birch, Joanna L; Tan, Bertrand C-M; Panov, Kostya I

2009-01-01

Efficient transcription elongation from a chromatin template requires RNA polymerases (Pols) to negotiate nucleosomes. Our biochemical analyses demonstrate that RNA Pol I can transcribe through nucleosome templates and that this requires structural rearrangement of the nucleosomal core particle....... The subunits of the histone chaperone FACT (facilitates chromatin transcription), SSRP1 and Spt16, co-purify and co-immunoprecipitate with mammalian Pol I complexes. In cells, SSRP1 is detectable at the rRNA gene repeats. Crucially, siRNA-mediated repression of FACT subunit expression in cells results...... in a significant reduction in 47S pre-rRNA levels, whereas synthesis of the first 40 nt of the rRNA is not affected, implying that FACT is important for Pol I transcription elongation through chromatin. FACT also associates with RNA Pol III complexes, is present at the chromatin of genes transcribed by Pol III...

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

Science.gov (United States)

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Detection of enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification.

Science.gov (United States)

Wang, D; Wang, X; Geng, Y; An, C

2014-01-01

The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR) and real-time PCR. A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

Science.gov (United States)

Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

2016-11-22

Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

HIV-1 reverse transcription initiation: a potential target for novel antivirals?

NARCIS (Netherlands)

Abbink, Truus E. M.; Berkhout, Ben

2008-01-01

Reverse transcription is an essential step in the retroviral life cycle, as it converts the genomic RNA into DNA. In this review, we describe recent developments concerning the initiation step of this complex, multi-step reaction. During initiation of reverse transcription, a cellular tRNA primer is

Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

International Nuclear Information System (INIS)

Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

1987-01-01

DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

Development of a Rapid Detection Method for Potato virus X by Reverse Transcription Loop-Mediated Isothermal Amplification

Directory of Open Access Journals (Sweden)

Joojin Jeong

2015-09-01

Full Text Available The primary step for efficient control of viral diseases is the development of simple, rapid, and sensitive virus detection. Reverse transcription loop-mediated isothermal amplification (RT-LAMP has been used to detect viral RNA molecules because of its simplicity and high sensitivity for a number of viruses. RT-LAMP for the detection of Potato virus X (PVX was developed and compared with conventional reverse transcription polymerase chain reaction (RT-PCR to demonstrate its advantages over RT-PCR. RT-LAMP reactions were conducted with or without a set of loop primers since one out of six primers showed PVX specificity. Based on real-time monitoring, RT-LAMP detected PVX around 30 min, compared to 120 min for RT-PCR. By adding a fluorescent reagent during the reaction, the extra step of visualization by gel electrophoresis was not necessary. RT-LAMP was conducted using simple inexpensive instruments and a regular incubator to evaluate whether RNA could be amplified at a constant temperature instead of using an expensive thermal cycler. This study shows the potential of RT-LAMP for the diagnosis of viral diseases and PVX epidemiology because of its simplicity and rapidness compared to RT-PCR.

SAF-A forms a complex with BRG1 and both components are required for RNA polymerase II mediated transcription.

Directory of Open Access Journals (Sweden)

Dzeneta Vizlin-Hodzic

Full Text Available BACKGROUND: Scaffold attachment factor A (SAF-A participates in the regulation of gene expression by organizing chromatin into transcriptionally active domains and by interacting directly with RNA polymerase II. METHODOLOGY: Here we use co-localization, co-immunoprecipitation (co-IP and in situ proximity ligation assay (PLA to identify Brahma Related Gene 1 (BRG1, the ATP-driven motor of the human SWI-SNF chromatin remodeling complex, as another SAF-A interaction partner in mouse embryonic stem (mES cells. We also employ RNA interference to investigate functional aspects of the SAF-A/BRG1 interaction. PRINCIPAL FINDINGS: We find that endogenous SAF-A protein interacts with endogenous BRG1 protein in mES cells, and that the interaction does not solely depend on the presence of mRNA. Moreover the interaction remains intact when cells are induced to differentiate. Functional analyses reveal that dual depletion of SAF-A and BRG1 abolishes global transcription by RNA polymerase II, while the nucleolar RNA polymerase I transcription machinery remains unaffected. CONCLUSIONS: We demonstrate that SAF-A interacts with BRG1 and that both components are required for RNA Polymerase II Mediated Transcription.

SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

Science.gov (United States)

Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.

2015-01-01

Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

Evaluation of nested polymerase chain reaction for the early detection of Leptospira spp. DNA in serum samples from patients with leptospirosis.

Science.gov (United States)

Blanco, Roberta Morozetti; Romero, Eliete Caló

2014-04-01

The aim of this study was to analyse the nested polymerase chain reaction (nested PCR) in human serum samples of patients with clinical manifestations of leptospirosis. The cases of leptospirosis were defined by the microagglutination test (MAT). The samples were collected in 2010. Of 1042 serum samples collected from 521 patients, 28 (5.4%) were considered positive cases of leptospirosis, and 493 (94.6%) were negative. Twenty-three confirmed cases had no MAT-detectable antibodies in the acute sample (mean of 5.6 days after onset). Nested PCR was positive in 22/23 (95.7%) patients during the acute phase of the disease, with negative results by MAT. Nested PCR was negative in all convalescent serum samples with positive results by MAT. All negative cases of leptospirosis were negative by nested PCR. The nested PCR is an alternative diagnostic tool for early detection of leptospires in sera during the first 7 days of the disease. Copyright © 2014 Elsevier Inc. All rights reserved.

Detection of Enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification

Directory of Open Access Journals (Sweden)

D Wang

2014-01-01

Full Text Available Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD for an early treatment by using loop-mediated isothermal amplification (LAMP technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR and real-time PCR. Results : A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. Conclusions : The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

Science.gov (United States)

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Strand transfer and elongation of HIV-1 reverse transcription is facilitated by cell factors in vitro.

Directory of Open Access Journals (Sweden)

David Warrilow

Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.

Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

Science.gov (United States)

Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

2016-04-01

Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

Influenza Virus Mounts a Two-Pronged Attack on Host RNA Polymerase II Transcription.

Science.gov (United States)

Bauer, David L V; Tellier, Michael; Martínez-Alonso, Mónica; Nojima, Takayuki; Proudfoot, Nick J; Murphy, Shona; Fodor, Ervin

2018-05-15

Influenza virus intimately associates with host RNA polymerase II (Pol II) and mRNA processing machinery. Here, we use mammalian native elongating transcript sequencing (mNET-seq) to examine Pol II behavior during viral infection. We show that influenza virus executes a two-pronged attack on host transcription. First, viral infection causes decreased Pol II gene occupancy downstream of transcription start sites. Second, virus-induced cellular stress leads to a catastrophic failure of Pol II termination at poly(A) sites, with transcription often continuing for tens of kilobases. Defective Pol II termination occurs independently of the ability of the viral NS1 protein to interfere with host mRNA processing. Instead, this termination defect is a common effect of diverse cellular stresses and underlies the production of previously reported downstream-of-gene transcripts (DoGs). Our work has implications for understanding not only host-virus interactions but also fundamental aspects of mammalian transcription. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Endoplasmic reticulum stress-responsive transcription factor ATF6α directs recruitment of the Mediator of RNA polymerase II transcription and multiple histone acetyltransferase complexes.

Science.gov (United States)

Sela, Dotan; Chen, Lu; Martin-Brown, Skylar; Washburn, Michael P; Florens, Laurence; Conaway, Joan Weliky; Conaway, Ronald C

2012-06-29

The basic leucine zipper transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. Previous studies have established that, in response to ER stress, ATF6α translocates to the nucleus and activates transcription of ER stress response genes upon binding sequence specifically to ER stress response enhancer elements in their promoters. In this study, we investigate the biochemical mechanism by which ATF6α activates transcription. By exploiting a combination of biochemical and multidimensional protein identification technology-based mass spectrometry approaches, we have obtained evidence that ATF6α functions at least in part by recruiting to the ER stress response enhancer elements of ER stress response genes a collection of RNA polymerase II coregulatory complexes, including the Mediator and multiple histone acetyltransferase complexes, among which are the Spt-Ada-Gcn5 acetyltransferase (SAGA) and Ada-Two-A-containing (ATAC) complexes. Our findings shed new light on the mechanism of action of ATF6α, and they outline a straightforward strategy for applying multidimensional protein identification technology mass spectrometry to determine which RNA polymerase II transcription factors and coregulators are recruited to promoters and other regulatory elements to control transcription.

Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II.

Science.gov (United States)

Steurer, Barbara; Marteijn, Jurgen A

2017-10-27

The faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The stalling of RNAP2 on a transcription-blocking lesion triggers a series of highly regulated events, including RNAP2 processing to make the lesion accessible for DNA repair, R-loop-mediated DNA damage signaling, and the initiation of transcription-coupled DNA repair. The correct execution and coordination of these processes is vital for resuming transcription following the successful repair of transcription-blocking lesions. Here, we outline recent insights into the molecular consequences of RNAP2 stalling on transcription-blocking DNA lesions and how these lesions are resolved to restore mRNA synthesis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

Science.gov (United States)

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

Design and optimization of reverse-transcription quantitative PCR experiments.

Science.gov (United States)

Tichopad, Ales; Kitchen, Rob; Riedmaier, Irmgard; Becker, Christiane; Ståhlberg, Anders; Kubista, Mikael

2009-10-01

Quantitative PCR (qPCR) is a valuable technique for accurately and reliably profiling and quantifying gene expression. Typically, samples obtained from the organism of study have to be processed via several preparative steps before qPCR. We estimated the errors of sample withdrawal and extraction, reverse transcription (RT), and qPCR that are introduced into measurements of mRNA concentrations. We performed hierarchically arranged experiments with 3 animals, 3 samples, 3 RT reactions, and 3 qPCRs and quantified the expression of several genes in solid tissue, blood, cell culture, and single cells. A nested ANOVA design was used to model the experiments, and relative and absolute errors were calculated with this model for each processing level in the hierarchical design. We found that intersubject differences became easily confounded by sample heterogeneity for single cells and solid tissue. In cell cultures and blood, the noise from the RT and qPCR steps contributed substantially to the overall error because the sampling noise was less pronounced. We recommend the use of sample replicates preferentially to any other replicates when working with solid tissue, cell cultures, and single cells, and we recommend the use of RT replicates when working with blood. We show how an optimal sampling plan can be calculated for a limited budget. .

Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform.

Science.gov (United States)

Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K

2016-10-15

 The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV).  The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus.  The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%.  The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

Science.gov (United States)

Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

1998-02-01

A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

The role of RNA polymerase I transcription and embryonic genome activation in nucleolar development in bovine preimplantation embryos

DEFF Research Database (Denmark)

Østrup, Olga; Strejcek, F.; Petrovicova, I.

2008-01-01

The aim of the present study was to investigate the role of RNA polymerase I (RPI) transcription in nucleolar development during major transcriptional activation (MTA) in cattle. Late eight-cell embryos were cultured in the absence (control group) or presence of actinomycin D (AD) (RPI inhibition...

Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

Directory of Open Access Journals (Sweden)

Marilia Farignoli Romeiro

2016-06-01

Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.

Science.gov (United States)

Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel

2006-04-28

Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.

Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

Science.gov (United States)

Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

2000-05-01

We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

Science.gov (United States)

Nishiura, T; Abe, K

1999-01-01

The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

NARCIS (Netherlands)

Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

2002-01-01

A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

RNA polymerase III transcription - regulated by chromatin structure and regulator of nuclear chromatin organization.

Science.gov (United States)

Pascali, Chiara; Teichmann, Martin

2013-01-01

RNA polymerase III (Pol III) transcription is regulated by modifications of the chromatin. DNA methylation and post-translational modifications of histones, such as acetylation, phosphorylation and methylation have been linked to Pol III transcriptional activity. In addition to being regulated by modifications of DNA and histones, Pol III genes and its transcription factors have been implicated in the organization of nuclear chromatin in several organisms. In yeast, the ability of the Pol III transcription system to contribute to nuclear organization seems to be dependent on direct interactions of Pol III genes and/or its transcription factors TFIIIC and TFIIIB with the structural maintenance of chromatin (SMC) protein-containing complexes cohesin and condensin. In human cells, Pol III genes and transcription factors have also been shown to colocalize with cohesin and the transcription regulator and genome organizer CCCTC-binding factor (CTCF). Furthermore, chromosomal sites have been identified in yeast and humans that are bound by partial Pol III machineries (extra TFIIIC sites - ETC; chromosome organizing clamps - COC). These ETCs/COC as well as Pol III genes possess the ability to act as boundary elements that restrict spreading of heterochromatin.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

Directory of Open Access Journals (Sweden)

Zhao Jianjun

2011-02-01

Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

c-Jun binds the N terminus of human TAF(II)250 to derepress RNA polymerase II transcription in vitro.

Science.gov (United States)

Lively, T N; Ferguson, H A; Galasinski, S K; Seto, A G; Goodrich, J A

2001-07-06

c-Jun is an oncoprotein that activates transcription of many genes involved in cell growth and proliferation. We studied the mechanism of transcriptional activation by human c-Jun in a human RNA polymerase II transcription system composed of highly purified recombinant and native transcription factors. Transcriptional activation by c-Jun depends on the TATA-binding protein (TBP)-associated factor (TAF) subunits of transcription factor IID (TFIID). Protein-protein interaction assays revealed that c-Jun binds with high specificity to the largest subunit of human TFIID, TAF(II)250. The region of TAF(II)250 bound by c-Jun lies in the N-terminal 163 amino acids. This same region of TAF(II)250 binds to TBP and represses its interaction with TATA boxes, thereby decreasing DNA binding by TFIID. We hypothesized that c-Jun is capable of derepressing the effect of the TAF(II)250 N terminus on TFIID-driven transcription. In support of this hypothesis, we found that c-Jun increased levels of TFIID-driven transcription in vitro when added at high concentrations to a DNA template lacking activator protein 1 (AP-1) sites. Moreover, c-Jun blocked the repression of TBP DNA binding caused by the N terminus of TAF(II)250. In addition to revealing a mechanism by which c-Jun activates transcription, our studies provide the first evidence that an activator can bind directly to the N terminus of TAF(II)250 to derepress RNA polymerase II transcription in vitro.

The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.

Directory of Open Access Journals (Sweden)

Clément Monot

2013-05-01

Full Text Available L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP first uses its endonuclease (EN to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A tail, a process known as target-primed reverse transcription (TPRT. Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.

The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.

Science.gov (United States)

Monot, Clément; Kuciak, Monika; Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël

2013-05-01

L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.

Diagnostic efficacy of molecular assays for the viral haemorrhagic septicaemia virus isolates from the Czech Republic

Directory of Open Access Journals (Sweden)

Ľubomír Pojezdal

2017-01-01

Full Text Available The diagnostic properties of the one-step real-time reverse-transcription polymerase chain reaction assay for viral haemorrhagic septicaemia virus detection were compared to methods currently in use in the Czech Republic, namely, virus isolation using the cell culture and conventional reverse-transcription polymerase chain reaction followed by the nested polymerase chain reaction. The assays were tested on a panel of 25 archived viral haemorrhagic septicaemia isolates and 8 archived infectious haematopoietic necrosis isolates obtained from monitoring and/or outbreaks of the diseases among farmed salmonids in the Czech Republic. The ability to detect the presence of the virus in the tissues of fish was tested on additional 32 field samples collected from the rainbow trout (Oncorhynchus mykiss, brown trout (Salmo trutta and brook trout (Salvelinus fontinalis. The real-time assay showed the highest analytic sensitivity by detecting the presence of viral nucleic acid in samples with 10-7 dilution, whereas the sensitivity of the conventional polymerase chain reaction peaked at 10-5. Diagnostic specificity of both molecular assays was confirmed by absence of cross-reactivity with the infectious haematopoietic necrosis virus isolates. This, along with consistent results in the detection of the virus in the fish tissues, confirms that the one-step real-time reverse-transcription polymerase chain reaction is currently an optimal stand-alone diagnostic method for the detection of the viral haemorrhagic septicaemia virus.

Comparison of the diagnostic performance of microscopic examination with nested polymerase chain reaction for optimum malaria diagnosis in Upper Myanmar.

Science.gov (United States)

Kang, Jung-Mi; Cho, Pyo-Yun; Moe, Mya; Lee, Jinyoung; Jun, Hojong; Lee, Hyeong-Woo; Ahn, Seong Kyu; Kim, Tae Im; Pak, Jhang Ho; Myint, Moe Kyaw; Lin, Khin; Kim, Tong-Soo; Na, Byoung-Kuk

2017-03-16

Accurate diagnosis of Plasmodium infection is crucial for prompt malaria treatment and surveillance. Microscopic examination has been widely applied as the gold standard for malaria diagnosis in most part of malaria endemic areas, but its diagnostic value has been questioned, particularly in submicroscopic malaria. In this study, the diagnostic performance of microscopic examination and nested polymerase chain reaction (PCR) was evaluated to establish optimal malaria diagnosis method in Myanmar. A total of 1125 blood samples collected from residents in the villages and towns located in Naung Cho, Pyin Oo Lwin, Tha Beik Kyin townships and Mandalay of Upper Myanmar were screened by microscopic examination and species-specific nested PCR method. Among the 1125 blood samples, 261 samples were confirmed to be infected with malaria by microscopic examination. Evaluation of the 1125 samples by species-specific nested PCR analysis revealed that the agreement between microscopic examination and nested PCR was 87.3% (261/299). Nested PCR successfully detected 38 Plasmodium falciparum or Plasmodium vivax infections, which were missed in microscopic examination. Microscopic examinations also either misdiagnosed the infected Plasmodium species, or did not detect mixed infections with different Plasmodium species in 31 cases. The nested PCR method is more reliable than conventional microscopic examination for the diagnosis of malaria infections, and this is particularly true in cases of mixed infections and submicroscopic infections. Given the observed higher sensitivity and specificity of nested PCR, the molecular method holds enormous promise in malaria diagnosis and species differentiation, and can be applied as an effective monitoring tool for malaria surveillance, control and elimination in Myanmar.

Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

DEFF Research Database (Denmark)

Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

2006-01-01

oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

APOBEC3G inhibits elongation of HIV-1 reverse transcripts.

Directory of Open Access Journals (Sweden)

Kate N Bishop

2008-12-01

Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.

Transcriptional Regulation in Ebola Virus: Effects of Gene Border Structure and Regulatory Elements on Gene Expression and Polymerase Scanning Behavior.

Science.gov (United States)

Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke

2016-02-15

The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis

Comparison of the Diagnostic Value Between Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Histopathologic Examination in Sentinel Lymph Nodes for Patients With Gastric Carcinoma.

Science.gov (United States)

Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung

2016-05-01

Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

Science.gov (United States)

Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

2012-06-10

Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

International Nuclear Information System (INIS)

Voronin, Yegor A.; Pathak, Vinay K.

2003-01-01

Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

Transcription-factor occupancy at HOT regions quantitatively predicts RNA polymerase recruitment in five human cell lines.

KAUST Repository

Foley, Joseph W; Sidow, Arend

2013-01-01

BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF's direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF's motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.

Transcription-factor occupancy at HOT regions quantitatively predicts RNA polymerase recruitment in five human cell lines.

KAUST Repository

Foley, Joseph W

2013-10-20

BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF\\'s direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF\\'s motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.

Factor C*, the specific initiation component of the mouse RNA polymerase I holoenzyme, is inactivated early in the transcription process.

OpenAIRE

Brun, R P; Ryan, K; Sollner-Webb, B

1994-01-01

Factor C* is the component of the RNA polymerase I holoenzyme (factor C) that allows specific transcriptional initiation on a factor D (SL1)- and UBF-activated rRNA gene promoter. The in vitro transcriptional capacity of a preincubated rDNA promoter complex becomes exhausted very rapidly upon initiation of transcription. This is due to the rapid depletion of C* activity. In contrast, C* activity is not unstable in the absence of transcription, even in the presence of nucleoside triphosphates ...

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

OpenAIRE

Matsutani Sachiko

2004-01-01

Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA.

Science.gov (United States)

Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

2015-07-13

We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.

Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases.

Science.gov (United States)

Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal

2016-04-20

DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2'-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. colienzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India

Directory of Open Access Journals (Sweden)

K. Nithin Prabhu

2018-02-01

Full Text Available Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT, as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR, have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat and wild (leopard, wolf and jackal animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

Science.gov (United States)

Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

2018-02-28

Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes.

Science.gov (United States)

NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina

2016-12-27

Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.

Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill.

Science.gov (United States)

de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G

2010-09-20

Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression

Polymerase chain reaction amplification fails to detect aromatase cytochrome P450 transcripts in normal human endometrium or decidua.

Science.gov (United States)

Bulun, S E; Mahendroo, M S; Simpson, E R

1993-06-01

It has been proposed that the biosynthesis of estrogens by the human endometrium may be of physiological significance during the menstrual cycle. Local estrogen production was also suggested to be important in the development of endometrial cancer; however, the presence or absence of aromatase enzyme activity in normal human endometrium is controversial. To address this issue, we used a sensitive technique capable of detecting mRNA transcripts present in only very low copy number. The polymerase chain reaction linked to reverse transcription (RT-PCR) was used to evaluate the presence or absence of aromatase cytochrome P450 (P450arom) transcripts in endometrial tissues (n = 7) and endometrial stromal cells (n = 9) under various culture conditions. RNA was isolated from four proliferative and three secretory tissue samples and from cultured endometrial stromal cells isolated from seven proliferative and two secretory endometria. Five sets of cultures were treated with medroxyprogesterone acetate (MPA), estradiol (E2), and forskolin. Additionally, RNA was isolated from decidualized endometrium obtained from a patient with tubal pregnancy. A single stranded cDNA was synthesized from total RNA using Moloney murine leukemia virus reverse transcriptase and a P450arom-specific oligonucleotide. The single stranded cDNA was used as a template for PCR and was amplified for 20-35 cycles using P450arom-specific primers. RNA from adipose tissue and placenta was amplified to provide positive controls, whereas myometrial RNA was used as a negative control. In two experiments involving two endometrial tissues and three sets of cells in culture, a rat P450arom cRNA was coamplified in each sample as an internal control to demonstrate that the remote possibility of RT-PCR failures in individual test samples cannot account for our negative results. By Southern or slot blot hybridization of the amplified fragments using human and rat P450arom-specific probes, we found no evidence for

Normalization of Reverse Transcription Quantitative PCR Data During Ageing in Distinct Cerebral Structures.

Science.gov (United States)

Bruckert, G; Vivien, D; Docagne, F; Roussel, B D

2016-04-01

Reverse transcription quantitative-polymerase chain reaction (RT-qPCR) has become a routine method in many laboratories. Normalization of data from experimental conditions is critical for data processing and is usually achieved by the use of a single reference gene. Nevertheless, as pointed by the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines, several reference genes should be used for reliable normalization. Ageing is a physiological process that results in a decline of many expressed genes. Reliable normalization of RT-qPCR data becomes crucial when studying ageing. Here, we propose a RT-qPCR study from four mouse brain regions (cortex, hippocampus, striatum and cerebellum) at different ages (from 8 weeks to 22 months) in which we studied the expression of nine commonly used reference genes. With the use of two different algorithms, we found that all brain structures need at least two genes for a good normalization step. We propose specific pairs of gene for efficient data normalization in the four brain regions studied. These results underline the importance of reliable reference genes for specific brain regions in ageing.

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

Science.gov (United States)

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

Science.gov (United States)

Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

2014-01-01

Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

Science.gov (United States)

Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

2014-07-01

A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines.

Normalization with Corresponding Naïve Tissue Minimizes Bias Caused by Commercial Reverse Transcription Kits on Quantitative Real-Time PCR Results.

Directory of Open Access Journals (Sweden)

Andreas Garcia-Bardon

Full Text Available Real-time reverse transcription polymerase chain reaction (PCR is the gold standard for expression analysis. Designed to improve reproducibility and sensitivity, commercial kits are commonly used for the critical step of cDNA synthesis. The present study was designed to determine the impact of these kits. mRNA from mouse brains were pooled to create serial dilutions ranging from 0.0625 μg to 2 μg, which were transcribed into cDNA using four different commercial reverse-transcription kits. Next, we transcribed mRNA from brain tissue after acute brain injury and naïve mice into cDNA for qPCR. Depending on tested genes, some kits failed to show linear results in dilution series and revealed strong variations in cDNA yield. Absolute expression data in naïve and trauma settings varied substantially between these kits. Normalization with a housekeeping gene failed to reduce kit-dependent variations, whereas normalization eliminated differences when naïve samples from the same region were used. The study shows strong evidence that choice of commercial cDNA synthesis kit has a major impact on PCR results and, consequently, on comparability between studies. Additionally, it provides a solution to overcome this limitation by normalization with data from naïve samples. This simple step helps to compare mRNA expression data between different studies and groups.

Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

International Nuclear Information System (INIS)

Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

2006-01-01

Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

Science.gov (United States)

Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

2016-01-01

Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

External Quality Assessment for the Detection of Measles Virus by Reverse Transcription-PCR Using Armored RNA.

Directory of Open Access Journals (Sweden)

Dong Zhang

Full Text Available In recent years, nucleic acid tests for detection of measles virus RNA have been widely applied in laboratories belonging to the measles surveillance system of China. An external quality assessment program was established by the National Center for Clinical Laboratories to evaluate the performance of nucleic acid tests for measles virus. The external quality assessment panel, which consisted of 10 specimens, was prepared using armored RNAs, complex of noninfectious MS2 bacteriophage coat proteins encapsulated RNA of measles virus, as measles virus surrogate controls. Conserved sequences amplified from a circulating measles virus strain or from a vaccine strain were encapsulated into these armored RNAs. Forty-one participating laboratories from 15 provinces, municipalities, or autonomous regions that currently conduct molecular detection of measles virus enrolled in the external quality assessment program, including 40 measles surveillance system laboratories and one diagnostic reagent manufacturer. Forty laboratories used commercial reverse transcription-quantitative PCR kits, with only one laboratory applying a conventional PCR method developed in-house. The results indicated that most of the participants (38/41, 92.7% were able to accurately detect the panel with 100% sensitivity and 100% specificity. Although a wide range of commercially available kits for nucleic acid extraction and reverse transcription polymerase chain reaction were used by the participants, only two false-negative results and one false-positive result were generated; these were generated by three separate laboratories. Both false-negative results were obtained with tests performed on specimens with the lowest concentration (1.2 × 104 genomic equivalents/mL. In addition, all 18 participants from Beijing achieved 100% sensitivity and 100% specificity. Overall, we conclude that the majority of the laboratories evaluated have reliable diagnostic capacities for the detection

Inference of RNA polymerase II transcription dynamics from chromatin immunoprecipitation time course data.

Directory of Open Access Journals (Sweden)

Ciira wa Maina

2014-05-01

Full Text Available Gene transcription mediated by RNA polymerase II (pol-II is a key step in gene expression. The dynamics of pol-II moving along the transcribed region influence the rate and timing of gene expression. In this work, we present a probabilistic model of transcription dynamics which is fitted to pol-II occupancy time course data measured using ChIP-Seq. The model can be used to estimate transcription speed and to infer the temporal pol-II activity profile at the gene promoter. Model parameters are estimated using either maximum likelihood estimation or via Bayesian inference using Markov chain Monte Carlo sampling. The Bayesian approach provides confidence intervals for parameter estimates and allows the use of priors that capture domain knowledge, e.g. the expected range of transcription speeds, based on previous experiments. The model describes the movement of pol-II down the gene body and can be used to identify the time of induction for transcriptionally engaged genes. By clustering the inferred promoter activity time profiles, we are able to determine which genes respond quickly to stimuli and group genes that share activity profiles and may therefore be co-regulated. We apply our methodology to biological data obtained using ChIP-seq to measure pol-II occupancy genome-wide when MCF-7 human breast cancer cells are treated with estradiol (E2. The transcription speeds we obtain agree with those obtained previously for smaller numbers of genes with the advantage that our approach can be applied genome-wide. We validate the biological significance of the pol-II promoter activity clusters by investigating cluster-specific transcription factor binding patterns and determining canonical pathway enrichment. We find that rapidly induced genes are enriched for both estrogen receptor alpha (ERα and FOXA1 binding in their proximal promoter regions.

BRF1 mutations alter RNA polymerase III–dependent transcription and cause neurodevelopmental anomalies

Science.gov (United States)

Hög, Friederike; Dentici, Maria Lisa; Tan, Perciliz L.; Sowada, Nadine; Medeira, Ana; Gueneau, Lucie; Thiele, Holger; Kousi, Maria; Lepri, Francesca; Wenzeck, Larissa; Blumenthal, Ian; Radicioni, Antonio; Schwarzenberg, Tito Livio; Mandriani, Barbara; Fischetto, Rita; Morris-Rosendahl, Deborah J.; Altmüller, Janine; Reymond, Alexandre; Nürnberg, Peter; Merla, Giuseppe; Dallapiccola, Bruno; Katsanis, Nicholas; Cramer, Patrick; Kubisch, Christian

2015-01-01

RNA polymerase III (Pol III) synthesizes tRNAs and other small noncoding RNAs to regulate protein synthesis. Dysregulation of Pol III transcription has been linked to cancer, and germline mutations in genes encoding Pol III subunits or tRNA processing factors cause neurogenetic disorders in humans, such as hypomyelinating leukodystrophies and pontocerebellar hypoplasia. Here we describe an autosomal recessive disorder characterized by cerebellar hypoplasia and intellectual disability, as well as facial dysmorphic features, short stature, microcephaly, and dental anomalies. Whole-exome sequencing revealed biallelic missense alterations of BRF1 in three families. In support of the pathogenic potential of the discovered alleles, suppression or CRISPR-mediated deletion of brf1 in zebrafish embryos recapitulated key neurodevelopmental phenotypes; in vivo complementation showed all four candidate mutations to be pathogenic in an apparent isoform-specific context. BRF1 associates with BDP1 and TBP to form the transcription factor IIIB (TFIIIB), which recruits Pol III to target genes. We show that disease-causing mutations reduce Brf1 occupancy at tRNA target genes in Saccharomyces cerevisiae and impair cell growth. Moreover, BRF1 mutations reduce Pol III–related transcription activity in vitro. Taken together, our data show that BRF1 mutations that reduce protein activity cause neurodevelopmental anomalies, suggesting that BRF1-mediated Pol III transcription is required for normal cerebellar and cognitive development. PMID:25561519

Transcription pattern of UL131A-128 mRNA in clinical strains of ...

Indian Academy of Sciences (India)

Human cytomegalovirus (HCMV) mRNA was obtained from human embryonic lung fibroblast cells infected by HCMV clinical strains from urine samples of infants at different kinetic periods. The cDNA of UL131A-128 mRNAs was amplified using reverse transcription-polymerase chain reaction (RT-PCR) and analysed by ...

Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

Science.gov (United States)

Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

2015-03-01

African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. © 2015 The Author(s).

Development of real-time reverse transcription polymerase chain reaction assays to quantify insulin-like growth factor receptor and insulin receptor expression in equine tissue

Directory of Open Access Journals (Sweden)

Stephen B. Hughes

2013-08-01

Full Text Available The insulin-like growth factor system (insulin-like growth factor 1, insulin-like growth factor 2, insulin-like growth factor 1 receptor, insulin-like growth factor 2 receptor and six insulin-like growth factor-binding proteins and insulin are essential to muscle metabolism and most aspects of male and female reproduction. Insulin-like growth factor and insulin play important roles in the regulation of cell growth, differentiation and the maintenance of cell differentiation in mammals. In order to better understand the local factors that regulate equine physiology, such as muscle metabolism and reproduction (e.g., germ cell development and fertilisation, real-time reverse transcription polymerase chain reaction assays for quantification of equine insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were developed. The assays were sensitive: 192 copies/µLand 891 copies/µL for insulin-like growth factor 1 receptor, messenger ribonucleic acid and insulin receptor respectively (95%limit of detection, and efficient: 1.01 for the insulin-like growth factor 1 receptor assay and 0.95 for the insulin receptor assay. The assays had a broad linear range of detection (seven logs for insulin-like growth factor 1 receptor and six logs for insulin receptor. This allowed for analysis of very small amounts of messenger ribonucleic acid. Low concentrations of both insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were detected in endometrium, lung and spleen samples, whilst high concentrations were detected in heart, muscle and kidney samples, this was most likely due to the high level of glucose metabolism and glucose utilisation by these tissues. The assays developed for insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid expression have been shown to work on equine tissue and will contribute to the understanding of insulin and insulin-like growth factor 1

Intracytoplasmic maturation of the human immunodeficiency virus type 1 reverse transcription complexes determines their capacity to integrate into chromatin

Directory of Open Access Journals (Sweden)

Kashanchi Fatah

2006-01-01

Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their

A highly sensitive single-tube nested PCR assay for the detection of Pineapple mealybug wilt associated virus-2 (PMWaV-2)

Science.gov (United States)

An assay was developed for the detection of Pineapple mealybug wilt associated virus-2 (PMWaV-2), an important factor in the etiology of mealybug wilt of pineapple. The assay combines reverse transcription of RNA isolated from pineapple with a specific and very sensitive, single, closed-tube nested ...

Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

International Nuclear Information System (INIS)

Zhang, H.; Wang, J.C.; Liu, L.F.

1988-01-01

Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role

Backtracking dynamics of RNA polymerase: pausing and error correction

International Nuclear Information System (INIS)

Sahoo, Mamata; Klumpp, Stefan

2013-01-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield–Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates. (paper)

Backtracking dynamics of RNA polymerase: pausing and error correction

Science.gov (United States)

Sahoo, Mamata; Klumpp, Stefan

2013-09-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

Structures of RNA Polymerase Closed and Intermediate Complexes Reveal Mechanisms of DNA Opening and Transcription Initiation.

Science.gov (United States)

Glyde, Robert; Ye, Fuzhou; Darbari, Vidya Chandran; Zhang, Nan; Buck, Martin; Zhang, Xiaodong

2017-07-06

Gene transcription is carried out by RNA polymerases (RNAPs). For transcription to occur, the closed promoter complex (RPc), where DNA is double stranded, must isomerize into an open promoter complex (RPo), where the DNA is melted out into a transcription bubble and the single-stranded template DNA is delivered to the RNAP active site. Using a bacterial RNAP containing the alternative σ 54 factor and cryoelectron microscopy, we determined structures of RPc and the activator-bound intermediate complex en route to RPo at 3.8 and 5.8 Å. Our structures show how RNAP-σ 54 interacts with promoter DNA to initiate the DNA distortions required for transcription bubble formation, and how the activator interacts with RPc, leading to significant conformational changes in RNAP and σ 54 that promote RPo formation. We propose that DNA melting is an active process initiated in RPc and that the RNAP conformations of intermediates are significantly different from that of RPc and RPo. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

Directory of Open Access Journals (Sweden)

W. Ali

2017-06-01

Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants.

Science.gov (United States)

Shis, David L; Bennett, Matthew R

2013-03-26

The construction of synthetic gene circuits relies on our ability to engineer regulatory architectures that are orthogonal to the host's native regulatory pathways. However, as synthetic gene circuits become larger and more complicated, we are limited by the small number of parts, especially transcription factors, that work well in the context of the circuit. The current repertoire of transcription factors consists of a limited selection of activators and repressors, making the implementation of transcriptional logic a complicated and component-intensive process. To address this, we modified bacteriophage T7 RNA polymerase (T7 RNAP) to create a library of transcriptional AND gates for use in Escherichia coli by first splitting the protein and then mutating the DNA recognition domain of the C-terminal fragment to alter its promoter specificity. We first demonstrate that split T7 RNAP is active in vivo and compare it with full-length enzyme. We then create a library of mutant split T7 RNAPs that have a range of activities when used in combination with a complimentary set of altered T7-specific promoters. Finally, we assay the two-input function of both wild-type and mutant split T7 RNAPs and find that regulated expression of the N- and C-terminal fragments of the split T7 RNAPs creates AND logic in each case. This work demonstrates that mutant split T7 RNAP can be used as a transcriptional AND gate and introduces a unique library of components for use in synthetic gene circuits.

Evaluation of the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction assay and the INFINITI® Respiratory Viral Panel Plus assay for the detection of human metapneumovirus in Kuwait.

Science.gov (United States)

Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad

2012-04-01

Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.

Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

Directory of Open Access Journals (Sweden)

Ravi Prakash

2014-12-01

Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

Cdc15 Phosphorylates the C-terminal Domain of RNA Polymerase II for Transcription during Mitosis.

Science.gov (United States)

Singh, Amit Kumar; Rastogi, Shivangi; Shukla, Harish; Asalam, Mohd; Rath, Srikanta Kumar; Akhtar, Md Sohail

2017-03-31

In eukaryotes, the basal transcription in interphase is orchestrated through the regulation by kinases (Kin28, Bur1, and Ctk1) and phosphatases (Ssu72, Rtr1, and Fcp1), which act through the post-translational modification of the C-terminal domain (CTD) of the largest subunit of RNA polymerase II. The CTD comprises the repeated Tyr-Ser-Pro-Thr-Ser-Pro-Ser motif with potential epigenetic modification sites. Despite the observation of transcription and periodic expression of genes during mitosis with entailing CTD phosphorylation and dephosphorylation, the associated CTD specific kinase(s) and its role in transcription remains unknown. Here we have identified Cdc15 as a potential kinase phosphorylating Ser-2 and Ser-5 of CTD for transcription during mitosis in the budding yeast. The phosphorylation of CTD by Cdc15 is independent of any prior Ser phosphorylation(s). The inactivation of Cdc15 causes reduction of global CTD phosphorylation during mitosis and affects the expression of genes whose transcript levels peak during mitosis. Cdc15 also influences the complete transcription of clb2 gene and phosphorylates Ser-5 at the promoter and Ser-2 toward the 3' end of the gene. The observation that Cdc15 could phosphorylate Ser-5, as well as Ser-2, during transcription in mitosis is in contrast to the phosphorylation marks put by the kinases in interphase (G 1 , S, and G 2 ), where Cdck7/Kin28 phosphorylates Ser-5 at promoter and Bur1/Ctk1 phosphorylates Ser-2 at the 3' end of the genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

Science.gov (United States)

Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

2015-08-01

The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

Engineering of a DNA Polymerase for Direct m6 A Sequencing.

Science.gov (United States)

Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas

2018-01-08

Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Enhanced detection rate of typhoid fever among clinically suspected patients in a tertiary referral hospital in Dhaka, Bangladesh using nested polymerase chain reaction technology.

Science.gov (United States)

Khan, S; Miah, M R; Khatun, S

2015-12-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (Ptyphoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.

Reverse transcription quantitative real-time polymerase chain reaction reference genes in the spared nerve injury model of neuropathic pain: validation and literature search.

Science.gov (United States)

Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R

2013-07-10

The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process

The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

Directory of Open Access Journals (Sweden)

Gronenborn Angela M

2010-05-01

Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

KAUST Repository

Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay  A Amar; Zhu, Jian-Kang; Wohlschlegel, James  A A.; Jacobsen, Steven E.

2010-01-01

DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

KAUST Repository

Law, Julie A.

2010-05-01

DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

Science.gov (United States)

Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

2015-01-01

Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

Targeting miR-423-5p Reverses Exercise Training-Induced HCN4 Channel Remodeling and Sinus Bradycardia

DEFF Research Database (Denmark)

D'Souza, Alicia; Pearman, Charles M.; Wang, Yanwen

2017-01-01

-generation sequencing and quantitative real-time reverse transcription polymerase chain reaction showed remodeling of miRs in the sinus node of swim-trained mice. Computational predictions highlighted a prominent role for miR-423-5p. Interaction between miR-423-5p and HCN4 was confirmed by a dose-dependent reduction...

In situ reverse transcription-PCR for monitoring gene expression in individual Methanosarcina mazei S-6 cells

DEFF Research Database (Denmark)

Lange, Marianne; Tolker-Nielsen, Tim; Molin, Søren

2000-01-01

An in situ reverse transcription-PCR protocol for detecting specific mRNA in Methanosarcina mazei S-6 is described. This method allowed us to detect heat shock-induced increases in the intracellular levels of the transcript of the universal stress gene dnaK. The cell walls of paraformaldehyde...

Sensitivity and specificity of real-time reverse transcription polymerase chain reaction, histopathology, and immunohistochemical labeling for the detection of Rift Valley fever virus in naturally infected cattle and sheep.

Science.gov (United States)

Odendaal, Lieza; Fosgate, Geoffrey T; Romito, Marco; Coetzer, Jacobus A W; Clift, Sarah J

2014-01-01

Real-time reverse transcription polymerase chain reaction (real-time RT-PCR), histopathology, and immunohistochemical labeling (IHC) were performed on liver specimens from 380 naturally infected cattle and sheep necropsied during the 2010 Rift Valley fever (RVF) epidemic in South Africa. Sensitivity (Se) and specificity (Sp) of real-time RT-PCR, histopathology, and IHC were estimated in a latent-class model using a Bayesian framework. The Se and Sp of real-time RT-PCR were estimated as 97.4% (95% confidence interval [CI] = 95.2-98.8%) and 71.7% (95% CI = 65-77.9%) respectively. The Se and Sp of histopathology were estimated as 94.6% (95% CI = 91-97.2%) and 92.3% (95% CI = 87.6-95.8%), respectively. The Se and Sp of IHC were estimated as 97.6% (95% CI = 93.9-99.8%) and 99.4% (95% CI = 96.9-100%), respectively. Decreased Sp of real-time RT-PCR was ascribed to cross-contamination of samples. Stratified analysis of the data suggested variations in test accuracy with fetuses and severely autolyzed specimens. The Sp of histopathology in fetuses (83%) was 9.3% lower than the sample population (92.3%). The Se of IHC decreased from 97.6% to 81.5% in the presence of severe autolysis. The diagnostic Se and Sp of histopathology was higher than expected, confirming the value of routine postmortem examinations and histopathology of liver specimens. Aborted fetuses, however, should be screened using a variety of tests in areas endemic for RVF, and results from severely autolyzed specimens should be interpreted with caution. The most feasible testing option for countries lacking suitably equipped laboratories seems to be routine histology in combination with IHC.

Towards the molecular bases of polymerase dynamics

International Nuclear Information System (INIS)

Chela Flores, J.

1991-03-01

One aspect of the strong relationship that is known to exist between the processes of DNA replication and transcription is manifest in the coupling of the rates of movement of the replication fork (r f ) and RNA polymerase (r t ). We address two issues concerning the largely unexplored area of polymerase dynamics: (i) The validity of an approximate kinematic formula linking r f and r t suggested by experiments in which transcription is initiated in some prokaryotes with the antibiotic streptolydigin, and (ii) What are the molecular bases of the kinematic formula? An analysis of the available data suggests possible molecular bases for polymerase dynamics. In particular, we are led to a hypothesis: In active chromatin r t may depend on the length (λ t ) of the transcript of the primary messenger RNA (pre-mRNA). This new effect is subject to experimental verification. We discuss possible experiments that may be performed in order to test this prediction. (author). Refs, 6 tabs

The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells.

Science.gov (United States)

Froldi, Francesca; Szuperak, Milan; Weng, Chen-Fang; Shi, Wei; Papenfuss, Anthony T; Cheng, Louise Y

2015-01-15

Cellular dedifferentiation is the regression of a cell from a specialized state to a more multipotent state and is implicated in cancer. However, the transcriptional network that prevents differentiated cells from reacquiring stem cell fate is so far unclear. Neuroblasts (NBs), the Drosophila neural stem cells, are a model for the regulation of stem cell self-renewal and differentiation. Here we show that the Drosophila zinc finger transcription factor Nervous fingers 1 (Nerfin-1) locks neurons into differentiation, preventing their reversion into NBs. Following Prospero-dependent neuronal specification in the ganglion mother cell (GMC), a Nerfin-1-specific transcriptional program maintains differentiation in the post-mitotic neurons. The loss of Nerfin-1 causes reversion to multipotency and results in tumors in several neural lineages. Both the onset and rate of neuronal dedifferentiation in nerfin-1 mutant lineages are dependent on Myc- and target of rapamycin (Tor)-mediated cellular growth. In addition, Nerfin-1 is required for NB differentiation at the end of neurogenesis. RNA sequencing (RNA-seq) and chromatin immunoprecipitation (ChIP) analysis show that Nerfin-1 administers its function by repression of self-renewing-specific and activation of differentiation-specific genes. Our findings support the model of bidirectional interconvertibility between neural stem cells and their post-mitotic progeny and highlight the importance of the Nerfin-1-regulated transcriptional program in neuronal maintenance. © 2015 Froldi et al.; Published by Cold Spring Harbor Laboratory Press.

Active RNA polymerases: mobile or immobile molecular machines?

Directory of Open Access Journals (Sweden)

Argyris Papantonis

2010-07-01

Full Text Available It is widely assumed that active RNA polymerases track along their templates to produce a transcript. We test this using chromosome conformation capture and human genes switched on rapidly and synchronously by tumour necrosis factor alpha (TNFalpha; one is 221 kbp SAMD4A, which a polymerase takes more than 1 h to transcribe. Ten minutes after stimulation, the SAMD4A promoter comes together with other TNFalpha-responsive promoters. Subsequently, these contacts are lost as new downstream ones appear; contacts are invariably between sequences being transcribed. Super-resolution microscopy confirms that nascent transcripts (detected by RNA fluorescence in situ hybridization co-localize at relevant times. Results are consistent with an alternative view of transcription: polymerases fixed in factories reel in their respective templates, so different parts of the templates transiently lie together.

Reverse Transcription Errors and RNA-DNA Differences at Short Tandem Repeats.

Science.gov (United States)

Fungtammasan, Arkarachai; Tomaszkiewicz, Marta; Campos-Sánchez, Rebeca; Eckert, Kristin A; DeGiorgio, Michael; Makova, Kateryna D

2016-10-01

Transcript variation has important implications for organismal function in health and disease. Most transcriptome studies focus on assessing variation in gene expression levels and isoform representation. Variation at the level of transcript sequence is caused by RNA editing and transcription errors, and leads to nongenetically encoded transcript variants, or RNA-DNA differences (RDDs). Such variation has been understudied, in part because its detection is obscured by reverse transcription (RT) and sequencing errors. It has only been evaluated for intertranscript base substitution differences. Here, we investigated transcript sequence variation for short tandem repeats (STRs). We developed the first maximum-likelihood estimator (MLE) to infer RT error and RDD rates, taking next generation sequencing error rates into account. Using the MLE, we empirically evaluated RT error and RDD rates for STRs in a large-scale DNA and RNA replicated sequencing experiment conducted in a primate species. The RT error rates increased exponentially with STR length and were biased toward expansions. The RDD rates were approximately 1 order of magnitude lower than the RT error rates. The RT error rates estimated with the MLE from a primate data set were concordant with those estimated with an independent method, barcoded RNA sequencing, from a Caenorhabditis elegans data set. Our results have important implications for medical genomics, as STR allelic variation is associated with >40 diseases. STR nonallelic transcript variation can also contribute to disease phenotype. The MLE and empirical rates presented here can be used to evaluate the probability of disease-associated transcripts arising due to RDD. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

zino

2014-02-05

Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

Science.gov (United States)

E, Chao; Duan, Baogen; Yu, Jin

2017-04-20

Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

Visual detection of the human metapneumovirus using reverse transcription loop-mediated isothermal amplification with hydroxynaphthol blue dye

Directory of Open Access Journals (Sweden)

Wang Xiang

2012-07-01

Full Text Available Abstract Background Human metapneumovirus (hMPV is a major cause of acute respiratory infections ranging from wheezing to bronchiolitis and pneumonia in children worldwide. The objective of this study is to develop a visual reverse transcription loop-mediated isothermal amplification (RT-LAMP assay for the detection of hMPV and applied to the clinical samples. Results In this study, visual RT-LAMP assay for hMPV was performed in one step with the addition of hydroxynaphthol blue (HNB, and were used to detect respiratory samples. Six primers, including two outer primers (F3 and B3, two inner primers (FIP, BIP and two loop primers (LF and LB, were designed for hMPV N gene by the online software. Moreover, the RT-LAMP assay showed good specificity and no cross-reactivity was observed with human rhinovirus (HRV, human respiratory syncytial Virus (RSV, or influenza virus A/PR/8/34 (H1N1. The detection limit of the RT-LAMP assay was approximately ten viral RNA copies, lower than that of traditional reverse transcriptase polymerase chain reaction (RT-PCR 100 RNA copies. In the 176 nasopharyngeal samples, 23 (13.1% were conformed as hMPV positive by RT-LAMP, but 18 (10.2% positive by RT-PCR. Conclusion Compared with conventional RT-PCR, the visual hMPV RT-LAMP assay performed well in the aspect of detect time, sensitivity, specificity and visibility. It is anticipated that the RT-LAMP will be used for clinical tests in hospital or field testing during outbreaks and in emergency.

Ubiquitylation and degradation of elongating RNA polymerase II

DEFF Research Database (Denmark)

Wilson, Marcus D; Harreman, Michelle; Svejstrup, Jesper Q

2013-01-01

During its journey across a gene, RNA polymerase II has to contend with a number of obstacles to its progression, including nucleosomes, DNA-binding proteins, DNA damage, and sequences that are intrinsically difficult to transcribe. Not surprisingly, a large number of elongation factors have....... In this review, we describe the mechanisms and factors responsible for the last resort mechanism of transcriptional elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation....

Improved detection limit in rapid detection of human enterovirus 71 and coxsackievirus A16 by a novel reverse transcription-isothermal multiple-self-matching-initiated amplification assay.

Science.gov (United States)

Ding, Xiong; Nie, Kai; Shi, Lei; Zhang, Yong; Guan, Li; Zhang, Dan; Qi, Shunxiang; Ma, Xuejun

2014-06-01

Rapid detection of human enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) is important in the early phase of hand-foot-and-mouth disease (HFMD). In this study, we developed and evaluated a novel reverse transcription-isothermal multiple-self-matching-initiated amplification (RT-IMSA) assay for the rapid detection of EV71 and CVA16 by use of reverse transcriptase, together with a strand displacement DNA polymerase. Real-time RT-IMSA assays using a turbidimeter and visual RT-IMSA assays to detect EV71 and CVA16 were established and completed in 1 h, and the reported corresponding real-time reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assays targeting the same regions of the VP1 gene were adopted as parallel tests. Through testing VP1 RNAs transcribed in vitro, the real-time RT-IMSA assays exhibited better linearity of quantification, with R(2) values of 0.952 (for EV71) and 0.967 (for CVA16), than the real-time RT-LAMP assays, which had R(2) values of 0.803 (for EV71) and 0.904 (for CVA16). Additionally, the detection limits of the real-time RT-IMSA assays (approximately 937 for EV71 and 67 for CVA16 copies/reaction) were higher than those of real-time RT-LAMP assays (approximately 3,266 for EV71 and 430 for CVA16 copies/reaction), and similar results were observed in the visual RT-IMSA assays. The new approaches also possess high specificities for the corresponding targets, with no cross-reactivity observed. In clinical assessment, compared to commercial reverse transcription-quantitative PCR (qRT-PCR) kits, the diagnostic sensitivities of the real-time RT-IMSA assays (96.4% for EV71 and 94.6% for CVA16) were higher than those of the real-time RT-LAMP assays (91.1% for EV71 and 90.8% for CVA16). The visual RT-IMSA assays also exhibited the same results. In conclusion, this proof-of-concept study suggests that the novel RT-IMSA assay is superior to the RT-LAMP assay in terms of detection limit and has the potential to rapidly detect EV71

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

Science.gov (United States)

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

The role of pleural fluid MAGE RT-nested PCR in the diagnosis of malignant pleural effusion.

Science.gov (United States)

Jeon, Eun Ju; Park, Hye Kyeong; Jeon, Kyeongman; Koh, Won-Jung; Suh, Gee Young; Chung, Man Pyo; Kim, Hojoong; Kwon, O Jung; Ki, Chang-Seok; Kim, Jong-Won; Shim, Young Mog; Um, Sang-Won

2012-11-01

  Melanoma antigen (MAGE) genes are expressed in tumor cells, the testis and the placenta. The purpose of this prospective study was to investigate the sensitivity, specificity, and accuracy of the carcinoembryonic antigen (CEA), MAGE reverse transcriptase-nested polymerase chain reaction (RT-nested PCR), and cytology of pleural fluid in the diagnosis of malignant pleural effusion.   Patients in whom unilateral pleural effusion was identified on chest radiography from January to December 2009 were included in the study. MAGE genes were analyzed by RT-nested PCR using MAGE A1-6 common primers.   Of 81 enrolled patients, 46 were diagnosed as malignant pleural effusion, and 24 were diagnosed as benign pleural effusion. The diagnoses of 11 patients were not confirmed in this study. The diagnostic sensitivity, specificity, and accuracy of MAGE RT-nested PCR were 61.4%, 95.7%, and 73.1%, respectively. The diagnostic sensitivities of cytology and CEA (>5 ng/mL) were 61.4% and 75.0%, respectively. Among 17 patients with negative cytology who had malignant pleural effusion, 12 and 10 patients were positive for CEA (>5.0 ng/mL) and MAGE RT-nested PCR, respectively. However, of five patients with malignant pleural effusion that was not recognized by cytology and CEA, MAGE RT-nested PCR correctly predicted a malignant etiology in only one additional patient (20%).   MAGE RT-nested PCR seems to add little on the combination of conventional methods in the diagnosis of malignant effusion. © 2012 Tianjin Lung Cancer Institute and Wiley Publishing Asia Pty. Ltd.

Emerging Functions of Transcription Factors in Malaria Parasite

Directory of Open Access Journals (Sweden)

Renu Tuteja

2011-01-01

Full Text Available Transcription is a process by which the genetic information stored in DNA is converted into mRNA by enzymes known as RNA polymerase. Bacteria use only one RNA polymerase to transcribe all of its genes while eukaryotes contain three RNA polymerases to transcribe the variety of eukaryotic genes. RNA polymerase also requires other factors/proteins to produce the transcript. These factors generally termed as transcription factors (TFs are either associated directly with RNA polymerase or add in building the actual transcription apparatus. TFs are the most common tools that our cells use to control gene expression. Plasmodium falciparum is responsible for causing the most lethal form of malaria in humans. It shows most of its characteristics common to eukaryotic transcription but it is assumed that mechanisms of transcriptional control in P. falciparum somehow differ from those of other eukaryotes. In this article we describe the studies on the main TFs such as myb protein, high mobility group protein and ApiA2 family proteins from malaria parasite. These studies show that these TFs are slowly emerging to have defined roles in the regulation of gene expression in the parasite.

Generation and comprehensive analysis of an influenza virus polymerase cellular interaction network.

Science.gov (United States)

Tafforeau, Lionel; Chantier, Thibault; Pradezynski, Fabrine; Pellet, Johann; Mangeot, Philippe E; Vidalain, Pierre-Olivier; Andre, Patrice; Rabourdin-Combe, Chantal; Lotteau, Vincent

2011-12-01

The influenza virus transcribes and replicates its genome inside the nucleus of infected cells. Both activities are performed by the viral RNA-dependent RNA polymerase that is composed of the three subunits PA, PB1, and PB2, and recent studies have shown that it requires host cell factors to transcribe and replicate the viral genome. To identify these cellular partners, we generated a comprehensive physical interaction map between each polymerase subunit and the host cellular proteome. A total of 109 human interactors were identified by yeast two-hybrid screens, whereas 90 were retrieved by literature mining. We built the FluPol interactome network composed of the influenza virus polymerase (PA, PB1, and PB2) and the nucleoprotein NP and 234 human proteins that are connected through 279 viral-cellular protein interactions. Analysis of this interactome map revealed enriched cellular functions associated with the influenza virus polymerase, including host factors involved in RNA polymerase II-dependent transcription and mRNA processing. We confirmed that eight influenza virus polymerase-interacting proteins are required for virus replication and transcriptional activity of the viral polymerase. These are involved in cellular transcription (C14orf166, COPS5, MNAT1, NMI, and POLR2A), translation (EIF3S6IP), nuclear transport (NUP54), and DNA repair (FANCG). Conversely, we identified PRKRA, which acts as an inhibitor of the viral polymerase transcriptional activity and thus is required for the cellular antiviral response.

Actin is closely associated with RNA polymerase II and involved in activation of gene transcription

International Nuclear Information System (INIS)

Zhu Xiaojuan; Zeng Xianlu; Huang Baiqu; Hao, Shui

2004-01-01

Biochemical and morphological studies have demonstrated the presence of actin in the nucleus of different eukaryotic cells, whereas its role remains unclear. In this work, we studied the interaction and the functional relationship between nuclear actin and RNA polymerase II (RNAP II). The immunofluorescence study demonstrated a clear co-localization of nuclear actin with RNAP II in HeLa cells. Meanwhile, actin can be immunoprecipitated by anti-RNAP II antibody, indicating that they could interact with each other. Treatment of cells with α-amanitin induced the formation of actin bundle network in the nucleoplasm. Blocking of the formation of filamentous actin (F-actin) by cytochalasin B modified the distribution of actin. Although the actin content remained unchanged in resting and concanavalinA stimulated mouse lymphocytes, the actin content in the nuclei showed a progressive increase after stimulation. Furthermore, the antibody against actin blocked RNA synthesis in a eukaryotic in vitro transcription system. These observations implicate that nuclear actin interacts with RNAP II and may have function on the RNAP II-mediated transcription

Numeric definition of the clinical performance of the nested reverse transcription-PCR for detection of hematogenous epithelial cells and correction for specific mRNA of non-target cell origin as evaluated for prostate cancer cells

NARCIS (Netherlands)

Schamhart, Denis; Swinnen, Johannes; Kurth, Karl-Heinz; Westerhof, Alex; Kusters, Ron; Borchers, Holger; Sternberg, Cora

2003-01-01

Background: Inappropriate quality management,of reverse transcription-PCR (RT-PCR) assays for the detection of blood-borne prostate cancer (PCa) cells hampers clinical conclusions. Improvement of the RT-PCR-methodology for prostate-specific, antigen (PSA) mRNA should focus on an appropriate numeric.

Diagnosis of lymphoma in paraffin wax sections by nested PCR and immunohistochemistry.

OpenAIRE

Kitamura, Y; Nanba, E; Inui, S; Tanigawa, T; Ichihara, K

1996-01-01

AIMS: To investigate whether nested polymerase chain reaction (PCR) and immunohistochemistry can be used to diagnose malignant lymphoma. METHODS: Paraffin wax embedded tissue sections from 31 patients with malignant lymphoma were analysed by nested PCR and immunohistochemistry using standard protocols. RESULTS: Nested PCR amplification of 1 pg DNA confirmed monoclonality in B cell lymphoma; PCR amplification of 10 pg DNA confirmed monoclonality in T cell lymphoma. Twenty seven (87%) samples w...

Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

Directory of Open Access Journals (Sweden)

Lee Yeon-Su

2010-05-01

Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.

Inhibition of the 26S proteasome blocks progesterone receptor-dependent transcription through failed recruitment of RNA polymerase II.

Science.gov (United States)

Dennis, Andrew P; Lonard, David M; Nawaz, Zafar; O'Malley, Bert W

2005-03-01

In the present study, we investigated the involvement of protein degradation via the 26S proteasome during progesterone receptor (PR)-mediated transcription in T-47D cells containing a stably integrated MMTV-CAT reporter construct (CAT0 cells). Progesterone induced CAT and HSD11beta2 transcription while co-treatment with the proteasome inhibitor, MG132, blocked PR-induced transcription in a time-dependent fashion. MG132 treatment also inhibited transcription of beta-actin and cyclophilin, but not two proteasome subunit genes, PSMA1 and PSMC1, indicating that proteasome inhibition affects a subset of RNA polymerase II (RNAP(II))-regulated genes. Progesterone-mediated recruitment of RNAP(II) was blocked by MG132 treatment at time points later than 1 h that was not dependent on the continued presence of PR, associated cofactors, and components of the general transcription machinery, supporting the concept that proteasome-mediated degradation is needed for continued transcription. Surprisingly, progesterone-mediated acetylation of histone H4 was inhibited by MG132 with the concomitant recruitment of HDAC3, NCoR, and SMRT. We demonstrate that the steady-state protein levels of SMRT and NCoR are higher in the presence of MG132 in CAT0 cells, consistent with other reports that SMRT and NCoR are targets of the 26S proteasome. However, inhibition of histone deacetylation by trichostatin A (TSA) treatment or SMRT/NCoR knockdown by siRNA did not restore MG132-inhibited progesterone-dependent transcription. Therefore, events other than histone deacetylation and stability of SMRT and NCoR must also play a role in inhibition of PR-mediated transcription.

Do spotless starlings place feathers at their nests by ultraviolet color?

Science.gov (United States)

Avilés, Jesús M.; Parejo, Deseada; Pérez-Contreras, Tomás; Navarro, Carlos; Soler, Juan J.

2010-02-01

A considerable number of bird species carry feathers to their nests. Feathers’ presence in the nests has traditionally been explained by their insulating properties. Recently, however, it has been suggested that feathers carried to the nests by females of the spotted starling ( Sturnus unicolor L.) could have an ornamental function based on their ultraviolet (300-400 nm) and human-visible longer wavelength (400-700 nm) coloration. In our population, 95.7% of feathers found inside next-boxes occupied by nesting starlings were rock dove fly feathers. Of these feathers, 82.7% were naturally positioned with their reverse side oriented toward the entrance hole and 42.4% of all found feathers were situated within the nest-cup. Here we experimentally assess the signaling function of ultraviolet coloration of feathers in nests of spotless starlings by providing nests with a number of pigeon flight feathers that were respectively treated on their obverse, reverse, both, or neither side with a UV blocker. Starlings placed 42.5% of the experimental feathers in the nest-cup irrespective of the UV block treatment. Orientation of feathers toward the entrance hole was not related with their ultraviolet radiation. However, feathers placed within the nest-cup were more likely found with their reverse side oriented toward the entrance hole confirming our correlative findings. These results suggest a minor role of ultraviolet coloration on feather location by spotless starlings.

An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

Science.gov (United States)

Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

2016-04-01

A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

The Mediator complex: a central integrator of transcription

Science.gov (United States)

Allen, Benjamin L.; Taatjes, Dylan J.

2016-01-01

The RNA polymerase II (pol II) enzyme transcribes all protein-coding and most non-coding RNA genes and is globally regulated by Mediator, a large, conformationally flexible protein complex with variable subunit composition (for example, a four-subunit CDK8 module can reversibly associate). These biochemical characteristics are fundamentally important for Mediator's ability to control various processes important for transcription, including organization of chromatin architecture and regulation of pol II pre-initiation, initiation, re-initiation, pausing, and elongation. Although Mediator exists in all eukaryotes, a variety of Mediator functions appear to be specific to metazoans, indicative of more diverse regulatory requirements. PMID:25693131

Structural features in the HIV-1 repeat region facilitate strand transfer during reverse transcription

NARCIS (Netherlands)

Berkhout, B.; Vastenhouw, N. L.; Klasens, B. I.; Huthoff, H.

2001-01-01

Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer is facilitated by terminal repeat (R) elements in the viral genome. This strand-transfer reaction depends on base pairing between the cDNA of the 5'R and the 3'R. There

Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

Directory of Open Access Journals (Sweden)

Silvia Cristina Osaki

2013-06-01

Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

Expression of a splice variant of the platelet-activating factor receptor transcript 2 in various human cancer cell lines

Directory of Open Access Journals (Sweden)

Ibtissam Youlyouz

2002-01-01

Full Text Available Platelet-activating factor receptor (PAF-R transcripts were analysed by reverse transcriptase-polymerase chain reaction in five human cancer cell lines derived from the breast (BT20, SKBR3 and T47D cells, the pancreas (Miapaca cells and the bladder (5637 cells in order to confirm the existence of a splice variant of the PAF-R transcript 2. After cloning and sequencing, we confirmed its existence in all cell lines. It consisted of the PAF-R transcript 2 lengthening with 82 nucleotides from the 3' end of exon 1 of the PAF-R gene. The role of this elongated form of the tissue-type PAF-R transcript in cell physiology remains to be elucidated.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Development of Nested PCR-Based Specific Markers for Detection of Peach Rosette Mosaic Virus in Plant Quarantine.

Science.gov (United States)

Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H

2016-03-01

The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.

Rapid Genome-wide Recruitment of RNA Polymerase II Drives Transcription, Splicing, and Translation Events during T Cell Responses

Directory of Open Access Journals (Sweden)

Kathrin Davari

2017-04-01

Full Text Available Summary: Activation of immune cells results in rapid functional changes, but how such fast changes are accomplished remains enigmatic. By combining time courses of 4sU-seq, RNA-seq, ribosome profiling (RP, and RNA polymerase II (RNA Pol II ChIP-seq during T cell activation, we illustrate genome-wide temporal dynamics for ∼10,000 genes. This approach reveals not only immediate-early and posttranscriptionally regulated genes but also coupled changes in transcription and translation for >90% of genes. Recruitment, rather than release of paused RNA Pol II, primarily mediates transcriptional changes. This coincides with a genome-wide temporary slowdown in cotranscriptional splicing, even for polyadenylated mRNAs that are localized at the chromatin. Subsequent splicing optimization correlates with increasing Ser-2 phosphorylation of the RNA Pol II carboxy-terminal domain (CTD and activation of the positive transcription elongation factor (pTEFb. Thus, rapid de novo recruitment of RNA Pol II dictates the course of events during T cell activation, particularly transcription, splicing, and consequently translation. : Davari et al. visualize global changes in RNA Pol II binding, transcription, splicing, and translation. T cells change their functional program by rapid de novo recruitment of RNA Pol II and coupled changes in transcription and translation. This coincides with fluctuations in RNA Pol II phosphorylation and a temporary reduction in cotranscriptional splicing. Keywords: RNA Pol II, cotranscriptional splicing, T cell activation, ribosome profiling, 4sU, H3K36, Ser-5 RNA Pol II, Ser-2 RNA Pol II, immune response, immediate-early genes

DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

Science.gov (United States)

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

Science.gov (United States)

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

Science.gov (United States)

Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

2016-07-01

The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

Science.gov (United States)

Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

2016-04-01

RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

Generation and Comprehensive Analysis of an Influenza Virus Polymerase Cellular Interaction Network▿†§

Science.gov (United States)

Tafforeau, Lionel; Chantier, Thibault; Pradezynski, Fabrine; Pellet, Johann; Mangeot, Philippe E.; Vidalain, Pierre-Olivier; Andre, Patrice; Rabourdin-Combe, Chantal; Lotteau, Vincent

2011-01-01

The influenza virus transcribes and replicates its genome inside the nucleus of infected cells. Both activities are performed by the viral RNA-dependent RNA polymerase that is composed of the three subunits PA, PB1, and PB2, and recent studies have shown that it requires host cell factors to transcribe and replicate the viral genome. To identify these cellular partners, we generated a comprehensive physical interaction map between each polymerase subunit and the host cellular proteome. A total of 109 human interactors were identified by yeast two-hybrid screens, whereas 90 were retrieved by literature mining. We built the FluPol interactome network composed of the influenza virus polymerase (PA, PB1, and PB2) and the nucleoprotein NP and 234 human proteins that are connected through 279 viral-cellular protein interactions. Analysis of this interactome map revealed enriched cellular functions associated with the influenza virus polymerase, including host factors involved in RNA polymerase II-dependent transcription and mRNA processing. We confirmed that eight influenza virus polymerase-interacting proteins are required for virus replication and transcriptional activity of the viral polymerase. These are involved in cellular transcription (C14orf166, COPS5, MNAT1, NMI, and POLR2A), translation (EIF3S6IP), nuclear transport (NUP54), and DNA repair (FANCG). Conversely, we identified PRKRA, which acts as an inhibitor of the viral polymerase transcriptional activity and thus is required for the cellular antiviral response. PMID:21994455

Regulation of RNA polymerase III transcription during transformation of human IMR90 fibroblasts with defined genetic elements.

Science.gov (United States)

Durrieu-Gaillard, Stéphanie; Dumay-Odelot, Hélène; Boldina, Galina; Tourasse, Nicolas J; Allard, Delphine; André, Fabrice; Macari, Françoise; Choquet, Armelle; Lagarde, Pauline; Drutel, Guillaume; Leste-Lasserre, Thierry; Petitet, Marion; Lesluyes, Tom; Lartigue-Faustin, Lydia; Dupuy, Jean-William; Chibon, Frédéric; Roeder, Robert G; Joubert, Dominique; Vagner, Stéphan; Teichmann, Martin

2018-01-01

RNA polymerase (Pol) III transcribes small untranslated RNAs that are essential for cellular homeostasis and growth. Its activity is regulated by inactivation of tumor suppressor proteins and overexpression of the oncogene c-MYC, but the concerted action of these tumor-promoting factors on Pol III transcription has not yet been assessed. In order to comprehensively analyse the regulation of Pol III transcription during tumorigenesis we employ a model system that relies on the expression of five genetic elements to achieve cellular transformation. Expression of these elements in six distinct transformation intermediate cell lines leads to the inactivation of TP53, RB1, and protein phosphatase 2A, as well as the activation of RAS and the protection of telomeres by TERT, thereby conducting to full tumoral transformation of IMR90 fibroblasts. Transformation is accompanied by moderately enhanced levels of a subset of Pol III-transcribed RNAs (7SK; MRP; H1). In addition, mRNA and/or protein levels of several Pol III subunits and transcription factors are upregulated, including increased protein levels of TFIIIB and TFIIIC subunits, of SNAPC1 and of Pol III subunits. Strikingly, the expression of POLR3G and of SNAPC1 is strongly enhanced during transformation in this cellular transformation model. Collectively, our data indicate that increased expression of several components of the Pol III transcription system accompanied by a 2-fold increase in steady state levels of a subset of Pol III RNAs is sufficient for sustaining tumor formation.

Nuclear entry of poliovirus protease-polymerase precursor 3CD: implications for host cell transcription shut-off

International Nuclear Information System (INIS)

Sharma, Rakhi; Raychaudhuri, Santanu; Dasgupta, Asim

2004-01-01

Host cell transcription mediated by all three RNA polymerases is rapidly inhibited after infection of mammalian cells with poliovirus (PV). Both genetic and biochemical studies have shown that the virus-encoded protease 3C cleaves the TATA-binding protein and other transcription factors at glutamine-glycine sites and is directly responsible for host cell transcription shut-off. PV replicates in the cytoplasm of infected cells. To shut-off host cell transcription, 3C or a precursor of 3C must enter the nucleus of infected cells. Although the 3C protease itself lacks a nuclear localization signal (NLS), amino acid sequence examination of 3D identified a potential single basic type NLS, KKKRD, spanning amino acids 125-129 within this polypeptide. Thus, a plausible scenario is that 3C enters the nucleus in the form of its precursor, 3CD, which then generates 3C by auto-proteolysis ultimately leading to cleavage of transcription factors in the nucleus. Using transient transfection of enhanced green fluorescent protein (EGFP) fusion polypeptides, we demonstrate here that both 3CD and 3D are capable of entering the nucleus in PV-infected cells. However, both polypeptides remain in the cytoplasm in uninfected HeLa cells. Mutagenesis of the NLS sequence in 3D prevents nuclear entry of 3D and 3CD in PV-infected cells. We also demonstrate that 3CD can be detected in the nuclear fraction from PV-infected HeLa cells as early as 2 h postinfection. Significant amount of 3CD is found associated with the nuclear fraction by 3-4 h of infection. Taken together, these results suggest that both the 3D NLS and PV infection are required for the entry of 3CD into the nucleus and that this may constitute a means by which viral protease 3C is delivered into the nucleus leading to host cell transcription shut-off

Loop-mediated Isothermal Amplification Assay to Rapidly Detect Wheat Streak Mosaic Virus in Quarantined Plants

Directory of Open Access Journals (Sweden)

Siwon Lee

2015-12-01

Full Text Available We developed a loop-mediated isothermal amplification (LAMP method to rapidly diagnose Wheat streak mosaic virus (WSMV during quarantine inspections of imported wheat, corn, oats, and millet. The LAMP method was developed as a plant quarantine inspection method for the first time, and its simplicity, quickness, specificity and sensitivity were verified compared to current reverse transcription-polymerase chain reaction (RT-PCR and nested PCR quarantine methods. We were able to quickly screen for WSMV at quarantine sites with many test samples; thus, this method is expected to contribute to plant quarantine inspections.

Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

Science.gov (United States)

Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa

2018-06-01

Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

Nest-like LiFePO4/C architectures for high performance lithium ion batteries

International Nuclear Information System (INIS)

Deng Honggui; Jin Shuangling; Zhan Liang; Qiao Wenming; Ling Licheng

2012-01-01

Highlights: ► Nest-like LiFePO 4 /C architectures (nest-like LPCs) were synthesized by solvothermal method. ► The microstructures of nest-like LPCs are very stable constructed by many nanosheets. ► The unique structures offer nest-like LPC electrode with high rate performance. ► The reversible capacity of nest-like LPCs electrode is as high as 120 mAh g −1 at 10 C. - Abstract: A novel kind of microsized nest-like LiFePO 4 /C architectures was synthesized by solvothermal method using inexpensive and stable Fe 3+ salt as iron source and ethylene glycol as mediate. A layer of carbon could be coated directly on the surface of LiFePO 4 crystals and the nest-like unique structures offer the cathode materials with high reversible capacity, excellent cycling stability and high rate performance. The reversible capacity can maintain 159 mAh g −1 at 0.1 C and 120 mAh g −1 at 10 C.

Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

NARCIS (Netherlands)

Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

2003-01-01

An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

Genome-wide mapping of boundary element-associated factor (BEAF) binding sites in Drosophila melanogaster links BEAF to transcription.

Science.gov (United States)

Jiang, Nan; Emberly, Eldon; Cuvier, Olivier; Hart, Craig M

2009-07-01

Insulator elements play a role in gene regulation that is potentially linked to nuclear organization. Boundary element-associated factors (BEAFs) 32A and 32B associate with hundreds of sites on Drosophila polytene chromosomes. We hybridized DNA isolated by chromatin immunoprecipitation to genome tiling microarrays to construct a genome-wide map of BEAF binding locations. A distinct difference in the association of 32A and 32B with chromatin was noted. We identified 1,820 BEAF peaks and found that more than 85% were less than 300 bp from transcription start sites. Half are between head-to-head gene pairs. BEAF-associated genes are transcriptionally active as judged by the presence of RNA polymerase II, dimethylated histone H3 K4, and the alternative histone H3.3. Forty percent of these genes are also associated with the polymerase negative elongation factor NELF. Like NELF-associated genes, most BEAF-associated genes are highly expressed. Using quantitative reverse transcription-PCR, we found that the expression levels of most BEAF-associated genes decrease in embryos and cultured cells lacking BEAF. These results provide an unexpected link between BEAF and transcription, suggesting that BEAF plays a role in maintaining most associated promoter regions in an environment that facilitates high transcription levels.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

Science.gov (United States)

Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

2013-01-01

Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Characterization of a Novel Class I Transcription Factor A (CITFA) Subunit That Is Indispensable for Transcription by the Multifunctional RNA Polymerase I of Trypanosoma brucei

KAUST Repository

Nguyen, T. N.

2012-10-26

Trypanosoma brucei is the only organism known to have evolved a multifunctional RNA polymerase I (pol I) system that is used to express the parasite\\'s ribosomal RNAs, as well as its major cell surface antigens, namely, the variant surface glycoprotein (VSG) and procyclin, which are vital for establishing successful infections in the mammalian host and the tsetse vector, respectively. Thus far, biochemical analyses of the T. brucei RNA pol I transcription machinery have elucidated the subunit structure of the enzyme and identified the class I transcription factor A (CITFA). CITFA binds to RNA pol I promoters, and its CITFA-2 subunit was shown to be absolutely essential for RNA pol I transcription in the parasite. Tandem affinity purification (TAP) of CITFA revealed the subunits CITFA-1 to -6, which are conserved only among kinetoplastid organisms, plus the dynein light chain DYNLL1. Here, by tagging CITFA-6 instead of CITFA-2, a complex was purified that contained all known CITFA subunits, as well as a novel proline-rich protein. Functional studies carried out in vivo and in vitro, as well as a colocalization study, unequivocally demonstrated that this protein is a bona fide CITFA subunit, essential for parasite viability and indispensable for RNA pol I transcription of ribosomal gene units and the active VSG expression site in the mammalian-infective life cycle stage of the parasite. Interestingly, CITFA-7 function appears to be species specific, because expression of an RNA interference (RNAi)-resistant CITFA-7 transgene from Trypanosoma cruzi could not rescue the lethal phenotype of silencing endogenous CITFA-7.

Cacipacore virus as an emergent mosquito-borne Flavivirus

Directory of Open Access Journals (Sweden)

Mario Luis Garcia de Figueiredo

Full Text Available Abstract INTRODUCTION: Cacipacore virus (CPCV, a possible bird-associated flavivirus, has yet to be detected in mosquitoes. Our purpose is examining CPCV in mosquitoes from the Amazon region of Brazil. METHODS: Approximately 3,253 Culicidae (grouped into 264 pools were collected from the Amazon region during 2002-2006 and analyzed using a Flavivirus genus-specific reverse transcription- polymerase chain reaction followed by nested polymerase chain reaction assay and by nucleotide sequencing of amplicons. RESULTS: Nucleotide sequences from five mosquito samples showed high similarity to the those of CPCV originally isolated in the Amazon region. CONCLUSIONS: This is the first report of CPCV-infected mosquitoes which has implications on the arbovirus maintenance in nature and transmission to man.

Targeted HIV-1 Latency Reversal Using CRISPR/Cas9-Derived Transcriptional Activator Systems.

Directory of Open Access Journals (Sweden)

Julia K Bialek

Full Text Available CRISPR/Cas9 technology is currently considered the most advanced tool for targeted genome engineering. Its sequence-dependent specificity has been explored for locus-directed transcriptional modulation. Such modulation, in particular transcriptional activation, has been proposed as key approach to overcome silencing of dormant HIV provirus in latently infected cellular reservoirs. Currently available agents for provirus activation, so-called latency reversing agents (LRAs, act indirectly through cellular pathways to induce viral transcription. However, their clinical performance remains suboptimal, possibly because reservoirs have diverse cellular identities and/or proviral DNA is intractable to the induced pathways. We have explored two CRISPR/Cas9-derived activator systems as targeted approaches to induce dormant HIV-1 proviral DNA. These systems recruit multiple transcriptional activation domains to the HIV 5' long terminal repeat (LTR, for which we have identified an optimal target region within the LTR U3 sequence. Using this target region, we demonstrate transcriptional activation of proviral genomes via the synergistic activation mediator complex in various in culture model systems for HIV latency. Observed levels of induction are comparable or indeed higher than treatment with established LRAs. Importantly, activation is complete, leading to production of infective viral particles. Our data demonstrate that CRISPR/Cas9-derived technologies can be applied to counteract HIV latency and may therefore represent promising novel approaches in the quest for HIV elimination.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

RNA polymerase activity of Ustilago maydis virus

Energy Technology Data Exchange (ETDEWEB)

Yie, S.W.

1986-01-01

Ustilago maydis virus has an RNA polymerase enzyme which is associated with virion capsids. In the presence of Mg/sup 2 +/ ion and ribonucleotide triphosphate, the enzyme catalyzes the in vitro synthesis of mRNA by using dsRNA as a template. The products of the UmV RNA polymerase were both ssRNA and dsRNA. The dsRNA was determined by characteristic mobilities in gel electrophoresis, lack of sensitivity to RNase, and specific hybridization tests. The ssRNAs were identified by elution from a CF-11 column and by their RNase sensitivity. On the basis of the size of ssRNAs, it was concluded that partial transcripts were produced from H dsRNA segments, and full length transcripts were produced from M and L dsRNA segments. The following observations indicates that transcription occurs by strand displacement; (1) Only the positive strand of M2 dsRNA was labeled by the in vitro reaction. (2) The M2 dsRNA which had been labeled with /sup 32/''P-UTP in vitro could be chased from dsRNA with unlabeled UTP. The transcription products of three UmV strains were compared, and the overall pattern of transcription was very similar among them.

Gene Expression and Metabolite Profiling of Developing Highbush Blueberry Fruit Indicates Transcriptional Regulation of Flavonoid Metabolism and Activation of Abscisic Acid Metabolism1[W][OA

Science.gov (United States)

Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A.; Zaharia, L. Irina; Schernthaner, Johann P.; Gesell, Andreas; Abrams, Suzanne R.; Kennedy, James A.; Constabel, C. Peter

2012-01-01

Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3′-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3′5′-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

Directory of Open Access Journals (Sweden)

Amanda de Faveri Pitz

2013-12-01

Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Genomic binding profiles of functionally distinct RNA polymerase III transcription complexes in human cells.

Science.gov (United States)

Moqtaderi, Zarmik; Wang, Jie; Raha, Debasish; White, Robert J; Snyder, Michael; Weng, Zhiping; Struhl, Kevin

2010-05-01

Genome-wide occupancy profiles of five components of the RNA polymerase III (Pol III) machinery in human cells identified the expected tRNA and noncoding RNA targets and revealed many additional Pol III-associated loci, mostly near short interspersed elements (SINEs). Several genes are targets of an alternative transcription factor IIIB (TFIIIB) containing Brf2 instead of Brf1 and have extremely low levels of TFIIIC. Strikingly, expressed Pol III genes, unlike nonexpressed Pol III genes, are situated in regions with a pattern of histone modifications associated with functional Pol II promoters. TFIIIC alone associates with numerous ETC loci, via the B box or a novel motif. ETCs are often near CTCF binding sites, suggesting a potential role in chromosome organization. Our results suggest that human Pol III complexes associate preferentially with regions near functional Pol II promoters and that TFIIIC-mediated recruitment of TFIIIB is regulated in a locus-specific manner.

Histone H1 phosphorylation is associated with transcription by RNA polymerases I and II

Science.gov (United States)

Zheng, Yupeng; John, Sam; Pesavento, James J.; Schultz-Norton, Jennifer R.; Schiltz, R. Louis; Baek, Sonjoon; Nardulli, Ann M.; Hager, Gordon L.; Kelleher, Neil L.

2010-01-01

Histone H1 phosphorylation affects chromatin condensation and function, but little is known about how specific phosphorylations impact the function of H1 variants in higher eukaryotes. In this study, we show that specific sites in H1.2 and H1.4 of human cells are phosphorylated only during mitosis or during both mitosis and interphase. Antisera generated to individual H1.2/H1.4 interphase phosphorylations reveal that they are distributed throughout nuclei and enriched in nucleoli. Moreover, interphase phosphorylated H1.4 is enriched at active 45S preribosomal RNA gene promoters and is rapidly induced at steroid hormone response elements by hormone treatment. Our results imply that site-specific interphase H1 phosphorylation facilitates transcription by RNA polymerases I and II and has an unanticipated function in ribosome biogenesis and control of cell growth. Differences in the numbers, structure, and locations of interphase phosphorylation sites may contribute to the functional diversity of H1 variants. PMID:20439994

Feathers at nests are potential female signals in the spotless starling.

Science.gov (United States)

Veiga, José P; Polo, Vicente

2005-09-22

Although the presence of feathers in the nest is widespread among birds, it has not been previously suggested that feathers can be used as sexual signals. Females of the spotless starling (Sturnus unicolor) regularly carry feathers to their nest, mostly during laying and incubation. We show that the arrangement of these feathers was non-random with respect to the side (obverse or reverse) placed upwards (which can be viewed from the nest entrance). Feathers of the wood pigeon (Columba palumbus) and the spotless starling, which exhibit higher ultraviolet and visible reflectance on their reverse side, were predominantly placed with this side upwards. On the contrary, feathers of the jay (Garrulus glandarius) were predominantly found exhibiting the obverse side, which possesses higher reflectance in this species. Feathers of the azure-winged magpie (Cyanopica cyana), with similar reflectance values on either side, were placed indiscriminately in obverse and reverse positions. The results suggest that feathers are arranged to maximize their conspicuousness within the nest and hence that they might be potentially used as intraspecific signals.

Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

Science.gov (United States)

Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

2004-01-30

A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

Factor requirements for transcription in the Archaeon Sulfolobus shibatae.

Science.gov (United States)

Qureshi, S A; Bell, S D; Jackson, S P

1997-05-15

Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is homologous to eukaryotic TFIIB. Here, we investigate the factor requirements for transcription of several promoters of the archaeon Sulfolobus shibatae and its associated virus SSV. Through in vitro transcription and immunodepletion, we demonstrate that S. shibatae TBP, TFB and RNA polymerase are not complexed tightly with one another and that each is required for efficient transcription of all promoters tested. Furthermore, full transcription is restored by supplementing respective depleted extracts with recombinant TBP or TFB, indicating that TBP-associated factors or TFB-associated factors are not required. Indeed, gel-filtration suggests that Sulfolobus TBP and TFB are not associated stably with other proteins. Finally, all promoters analysed are transcribed accurately and efficiently in an in vitro system comprising recombinant TBP and TFB, together with essentially homogeneous preparation of RNA polymerase. Transcription in Archaea is therefore fundamentally homologous to that in eukaryotes, although factor requirements appear to be much less complex.

Rapid and sensitive detection of potyvirus infecting tropical tuber ...

African Journals Online (AJOL)

A reverse transcription polymerase chain reaction assay using potyvirus specific primers designed from the core of the coat protein was carried out, and a cDNA fragment of 327 bp was obtained from most of the potyviruses infecting the tropical tuber crops. Reverse transcription polymerase chain reaction (RT-PCR) ...

Detection of Histoplasma capsulatum in Organic Fertilizers by Hc100 Nested Polymerase Chain Reaction and Its Correlation with the Physicochemical and Microbiological Characteristics of the Samples.

Science.gov (United States)

Gómez, Luisa F; Torres, Isaura P; Jiménez-A, María Del Pilar; McEwen, Juan Gmo; de Bedout, Catalina; Peláez, Carlos A; Acevedo, José M; Taylor, María L; Arango, Myrtha

2018-05-01

Histoplasma capsulatum is the causative agent of histoplasmosis and this fungus inhabits soils rich in phosphorus and nitrogen that are enriched with bird and bat manure. The replacement of organic matter in agroecosystems is necessary in the tropics, and the use of organic fertilizers has increased. Cases and outbreaks due to the presence of the fungus in these components have been reported. The Instituto Colombiano Agropecuario resolution 150 of 2003 contains the parameters set by the Colombian Technical Standard (NTC 5167) on the physicochemical and microbiological features of fertilizers, but it does not regulate the search for H. capsulatum . The aim of this study was to demonstrate H. capsulatum presence in organic fertilizers by nested polymerase chain reaction (PCR). A total of 239 samples were collected: 201 (84.1%) corresponded to organic fertilizers, 30 (12.5%) to bird excrement, and 8 (3.4%) to cave soils. The Hc100 nested PCR had a detection limit of 0.1 pg/µL and a specificity of 100%. A total of 25 (10.5%) samples were positive and validated by sequencing. Seven of the positive samples represented locations where H. capsulatum was previously detected, suggesting the persistence of the fungus. No significant correlations were detected between the physicochemical and microbiological parameters with the presence of H. capsulatum by nested PCR, indicating the fungus existence in organic fertilizers that complied with the NTC 5167. The Hc100 nested PCR targeting H. capsulatum standardized in this work will improve the evaluation of organic fertilizers and ensure the prevention of outbreaks and cases due to manufacturing, marketing, and use of fertilizers contaminated with H. capsulatum .

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

Science.gov (United States)

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney

Science.gov (United States)

Chase, D.M.; Pascho, R.J.

1998-01-01

Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.

Detection of AR-V7 mRNA in whole blood may not predict the effectiveness of novel endocrine drugs for castration-resistant prostate cancer.

Science.gov (United States)

Takeuchi, Takumi; Okuno, Yumiko; Hattori-Kato, Mami; Zaitsu, Masayoshi; Mikami, Koji

2016-01-01

A splice variant of androgen receptor (AR), AR-V7, lacks in androgen-binding portion and leads to aggressive cancer characteristics. Reverse transcription-polymerase chain reactions (PCRs) and subsequent nested PCRs for the amplification of AR-V7 and prostate-specific antigen (PSA) transcripts were done for whole blood of patients with prostate cancer and male controls. With primary reverse transcription PCRs, AR-V7 and PSA were detected in 4.5% and 4.7% of prostate cancer, respectively. With nested PCRs, AR-V7 messenger RNA (mRNA) was positive in 43.8% of castration-sensitive prostate cancer and 48.1% of castration-resistant prostate cancer (CRPC), while PSA mRNA was positive in 6.3% of castration-sensitive prostate cancer and 18.5% of CRPC. Whole-blood samples of controls showed AR-V7 mRNA expression by nested PCR. Based on multivariate analysis, expression of AR-V7 mRNA in whole blood was not significantly correlated with clinical parameters and PSA mRNA in blood, while univariate analysis showed a correlation between AR-V7 mRNA and metastasis at initial diagnosis. Detection of AR-V7 mRNA did not predict the reduction of serum PSA in patients with CRPC following abiraterone and enzalutamide administration. In conclusion, AR-V7 mRNA expression in normal hematopoietic cells may have annihilated the manifestation of aggressiveness of prostate cancer and the prediction of the effectiveness of abiraterone and enzalutamide by the assessment of AR-V7 mRNA in blood.

Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

International Nuclear Information System (INIS)

Freeman-Wittig, M.J.B.

1986-01-01

The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

Transcription factor-based biosensor

Science.gov (United States)

Dietrich, Jeffrey A; Keasling, Jay D

2013-10-08

The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

Genome-wide RNA polymerase II profiles and RNA accumulation reveal kinetics of transcription and associated epigenetic changes during diurnal cycles.

Directory of Open Access Journals (Sweden)

Gwendal Le Martelot

Full Text Available Interactions of cell-autonomous circadian oscillators with diurnal cycles govern the temporal compartmentalization of cell physiology in mammals. To understand the transcriptional and epigenetic basis of diurnal rhythms in mouse liver genome-wide, we generated temporal DNA occupancy profiles by RNA polymerase II (Pol II as well as profiles of the histone modifications H3K4me3 and H3K36me3. We used these data to quantify the relationships of phases and amplitudes between different marks. We found that rhythmic Pol II recruitment at promoters rather than rhythmic transition from paused to productive elongation underlies diurnal gene transcription, a conclusion further supported by modeling. Moreover, Pol II occupancy preceded mRNA accumulation by 3 hours, consistent with mRNA half-lives. Both methylation marks showed that the epigenetic landscape is highly dynamic and globally remodeled during the 24-hour cycle. While promoters of transcribed genes had tri-methylated H3K4 even at their trough activity times, tri-methylation levels reached their peak, on average, 1 hour after Pol II. Meanwhile, rhythms in tri-methylation of H3K36 lagged transcription by 3 hours. Finally, modeling profiles of Pol II occupancy and mRNA accumulation identified three classes of genes: one showing rhythmicity both in transcriptional and mRNA accumulation, a second class with rhythmic transcription but flat mRNA levels, and a third with constant transcription but rhythmic mRNAs. The latter class emphasizes widespread temporally gated posttranscriptional regulation in the mouse liver.

TAF(II)250: a transcription toolbox.

Science.gov (United States)

Wassarman, D A; Sauer, F

2001-08-01

Activation of RNA-polymerase-II-dependent transcription involves conversion of signals provided by gene-specific activator proteins into the synthesis of messenger RNA. This conversion requires dynamic structural changes in chromatin and assembly of general transcription factors (GTFs) and RNA polymerase II at core promoter sequence elements surrounding the transcription start site of genes. One hallmark of transcriptional activation is the interaction of DNA-bound activators with coactivators such as the TATA-box binding protein (TBP)-associated factors (TAF(II)s) within the GTF TFIID. TAF(II)250 possesses a variety of activities that are likely to contribute to the initial steps of RNA polymerase II transcription. TAF(II)250 is a scaffold for assembly of other TAF(II)s and TBP into TFIID, TAF(II)250 binds activators to recruit TFIID to particular promoters, TAF(II)250 regulates binding of TBP to DNA, TAF(II)250 binds core promoter initiator elements, TAF(II)250 binds acetylated lysine residues in core histones, and TAF(II)250 possesses protein kinase, ubiquitin-activating/conjugating and acetylase activities that modify histones and GTFs. We speculate that these activities achieve two goals--(1) they aid in positioning and stabilizing TFIID at particular promoters, and (2) they alter chromatin structure at the promoter to allow assembly of GTFs--and we propose a model for how TAF(II)250 converts activation signals into active transcription.

Ultraviolet irradiation of herpes simplex virus (type 1): delayed transcription and comparative sensitivites of virus functions.

Science.gov (United States)

Eglin, R P; Gugerli, P; Wildy, P

1980-07-01

The delay in the replication of herpes simplex virus surviving u.v. irradiation occurs after the uncoating of virus, as judged by sensitivity to DNase. It occurs before translation, judged by the kinetics of appearance of various virus-specific proteins, and before transcription, judged by the detection of virus-specific RNA by in situ hybridization. Since the delays in both transcription and translation are reversed by photoreactivation, the simplest hypothesis is that pyrimidine dimers directly obstruct transcription;unless these are broken by photoreactivating enzymes, there will be transcriptional delay until reactivating processes have repaired the lesion. The u.v. sensitivities of the abilities to induce various enzymes (thymidine kinase, DNase and DNA polymerase) were only about four times less than that of infectivity. The The ability to induce the three enzymes was three times less sensitive than that of the structural antigen (Band II).

Ultraviolet irradiation of herpes simplex virus (type 1): delayed transcription and comparative sensitivities of virus functions

International Nuclear Information System (INIS)

Eglin, R.P.; Gugerli, P.; Wildy, P.

1980-01-01

The delay in the replication of herpes simplex virus surviving u.v. irradiation occurs after the uncoating of virus, as judged by sensitivity to DNase. It occurs before translation, judged by the kinetics of appearance of various virus-specific proteins, and before transcription, judged by the detection of virus-specific RNA by in situ hybridization. Since the delays in both transcription and translation are reversed by photoreactivation, the simplest hypothesis is that pyrimidine dimers directly obstruct transcription; unless these are broken by photoreactivating enzymes, there will be transcriptional delay until reactivating processes have repaired the lesion. The u.v. sensitivities of the abilities to induce various enzymes (thymidine kinase, DNase and DNA polymerase) were only about four times less than that of infectivity. The ability to induce the three enzymes was three times less sensitive than that of the structural antigen (Band II). (U.K.)

PRMT5 restricts hepatitis B virus replication through epigenetic repression of covalently closed circular DNA transcription and interference with pregenomic RNA encapsidation.

Science.gov (United States)

Zhang, Wen; Chen, Jieliang; Wu, Min; Zhang, Xiaonan; Zhang, Min; Yue, Lei; Li, Yaming; Liu, Jiangxia; Li, Baocun; Shen, Fang; Wang, Yang; Bai, Lu; Protzer, Ulrike; Levrero, Massimo; Yuan, Zhenghong

2017-08-01

Chronic hepatitis B virus (HBV) infection remains a major health problem worldwide. The covalently closed circular DNA (cccDNA) minichromosome, which serves as the template for the transcription of viral RNAs, plays a key role in viral persistence. While accumulating evidence suggests that cccDNA transcription is regulated by epigenetic machinery, particularly the acetylation of cccDNA-bound histone 3 (H3) and H4, the potential contributions of histone methylation and related host factors remain obscure. Here, by screening a series of methyltransferases and demethylases, we identified protein arginine methyltransferase 5 (PRMT5) as an effective restrictor of HBV transcription and replication. In cell culture-based models for HBV infection and in liver tissues of patients with chronic HBV infection, we found that symmetric dimethylation of arginine 3 on H4 on cccDNA was a repressive marker of cccDNA transcription and was regulated by PRMT5 depending on its methyltransferase domain. Moreover, PRMT5-triggered symmetric dimethylation of arginine 3 on H4 on the cccDNA minichromosome involved an interaction with the HBV core protein and the Brg1-based human SWI/SNF chromatin remodeler, which resulted in down-regulation of the binding of RNA polymerase II to cccDNA. In addition to the inhibitory effect on cccDNA transcription, PRMT5 inhibited HBV core particle DNA production independently of its methyltransferase activity. Further study revealed that PRMT5 interfered with pregenomic RNA encapsidation by preventing its interaction with viral polymerase protein through binding to the reverse transcriptase-ribonuclease H region of polymerase, which is crucial for the polymerase-pregenomic RNA interaction. PRMT5 restricts HBV replication through a two-part mechanism including epigenetic suppression of cccDNA transcription and interference with pregenomic RNA encapsidation; these findings improve the understanding of epigenetic regulation of HBV transcription and host

Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology

Science.gov (United States)

Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda

2011-01-01

The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

DEFF Research Database (Denmark)

Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

2011-01-01

of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

First detection of West Nile virus in domestic pigeon in Korea.

Science.gov (United States)

Kim, C-Yoon; Oh, Hanseul; Song, Juha; Hur, Moonsuk; Suh, Jae-Hwa; Jheong, Weon-Hwa; Kim, Jong-Taek; Oh, Hong-Shik; Park, Jae-Hak

2016-12-30

West Nile virus (WNV) is a mosquito-borne zoonotic pathogen that has spread throughout Europe and the United States. Recently, WNV spread to East and Southeast Asia, and great efforts have been made in South Korea to prevent the spread of WNV from neighboring countries. In this study, we diagnosed the first case of WNV in pigeons ( Columba livia domestica ) residing in cities using a competitive enzyme-linked immunosorbent assay and confirmed it with nested reverse transcription polymerase chain reaction analysis and sequencing. This is the first report to provide convincing evidence that WNV is present within South Korea.

Relationship between human cytomegalovirus transcription and symptomatic apical periodontitis in Iran.

Science.gov (United States)

Yazdi, K A; Sabeti, M; Jabalameli, F; Eman eini, M; Kolahdouzan, S A; Slots, J

2008-12-01

Apical periodontitis of endodontic origin may develop as a result of cooperative interactions among herpesviruses, specific pathogenic bacteria and tissue-destructive inflammatory mediators. This study sought to identify the presence of Epstein-Barr virus (EBV) and human cytomegalovirus (HCMV) transcripts in symptomatic and asymptomatic periapical lesions of individuals living in Iran. Fifty endodontic patients (28 with symptomatic periapical lesions and 22 with asymptomatic periapical lesions) were included in the study. In each study subject, a microbiological periapical sample was collected using a curette in conjunction with periapical surgery. A reverse transcription-polymerase chain reaction assay was used to identify transcripts of EBV and HCMV. Human cytomegalovirus transcript was detected in 15 of the 28 (53.6%) symptomatic and in six of the 22 (27.3%) asymptomatic periapical study lesions (significant difference between symptomatic and asymptomatic lesions; P = 0.03, chi-square test). Epstein-Barr virus transcript was identified in one symptomatic and in two asymptomatic periapical lesions. This study establishes that HCMV transcription is common in apical periodontitis and is most frequent in symptomatic lesions. The high frequency of active herpesvirus infections in severe apical periodontitis changes the pathogenic paradigm of the disease and may also have preventive and therapeutic implications.

Transcription-based model for the induction of chromosomal exchange events by ionising radiation

International Nuclear Information System (INIS)

Radford, I.A.

2003-01-01

The mechanistic basis for chromosomal aberration formation, following exposure of mammalian cells to ionising radiation, has long been debated. Although chromosomal aberrations are probably initiated by DNA double-strand breaks (DSB), little is understood about the mechanisms that generate and modulate DNA rearrangement. Based on results from our laboratory and data from the literature, a novel model of chromosomal aberration formation has been suggested (Radford 2002). The basic postulates of this model are that: (1) DSB, primarily those involving multiple individual damage sites (i.e. complex DSB), are the critical initiating lesion; (2) only those DSB occurring in transcription units that are associated with transcription 'factories' (complexes containing multiple transcription units) induce chromosomal exchange events; (3) such DSB are brought into contact with a DNA topoisomerase I molecule through RNA polymerase II catalysed transcription and give rise to trapped DNA-topo I cleavage complexes; and (4) trapped complexes interact with another topo I molecule on a temporarily inactive transcription unit at the same transcription factory leading to DNA cleavage and subsequent strand exchange between the cleavage complexes. We have developed a method using inverse PCR that allows the detection and sequencing of putative ionising radiation-induced DNA rearrangements involving different regions of the human genome (Forrester and Radford 1998). The sequences detected by inverse PCR can provide a test of the prediction of the transcription-based model that ionising radiation-induced DNA rearrangements occur between sequences in active transcription units. Accordingly, reverse transcriptase PCR was used to determine if sequences involved in rearrangements were transcribed in the test cells. Consistent with the transcription-based model, nearly all of the sequences examined gave a positive result to reverse transcriptase PCR (Forrester and Radford unpublished)

COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

Directory of Open Access Journals (Sweden)

Masashi Miura

2013-12-01

Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

Reverse engineering a mouse embryonic stem cell-specific transcriptional network reveals a new modulator of neuronal differentiation.

Science.gov (United States)

De Cegli, Rossella; Iacobacci, Simona; Flore, Gemma; Gambardella, Gennaro; Mao, Lei; Cutillo, Luisa; Lauria, Mario; Klose, Joachim; Illingworth, Elizabeth; Banfi, Sandro; di Bernardo, Diego

2013-01-01

Gene expression profiles can be used to infer previously unknown transcriptional regulatory interaction among thousands of genes, via systems biology 'reverse engineering' approaches. We 'reverse engineered' an embryonic stem (ES)-specific transcriptional network from 171 gene expression profiles, measured in ES cells, to identify master regulators of gene expression ('hubs'). We discovered that E130012A19Rik (E13), highly expressed in mouse ES cells as compared with differentiated cells, was a central 'hub' of the network. We demonstrated that E13 is a protein-coding gene implicated in regulating the commitment towards the different neuronal subtypes and glia cells. The overexpression and knock-down of E13 in ES cell lines, undergoing differentiation into neurons and glia cells, caused a strong up-regulation of the glutamatergic neurons marker Vglut2 and a strong down-regulation of the GABAergic neurons marker GAD65 and of the radial glia marker Blbp. We confirmed E13 expression in the cerebral cortex of adult mice and during development. By immuno-based affinity purification, we characterized protein partners of E13, involved in the Polycomb complex. Our results suggest a role of E13 in regulating the division between glutamatergic projection neurons and GABAergic interneurons and glia cells possibly by epigenetic-mediated transcriptional regulation.

Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo.

Directory of Open Access Journals (Sweden)

Keshab Rijal

2016-08-01

Full Text Available The ability of RNA polymerase (RNAP III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC; they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease.

The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

Science.gov (United States)

Leem, S H; Ropp, P A; Sugino, A

1994-08-11

We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

The transcription fidelity factor GreA impedes DNA break repair.

Science.gov (United States)

Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe

2017-10-12

Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.

The chemical structure of DNA sequence signals for RNA transcription

Science.gov (United States)

George, D. G.; Dayhoff, M. O.

1982-01-01

The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation.

Science.gov (United States)

Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

2015-03-31

Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

A rapid and sensitive diagnosis of bovine leukaemia virus infection using the nested shuttle polymerase chain reaction Diagnóstico rápido e sensível da infecção com o vírus da Leucemia Bovina através de Shuttle Nested Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Ester T. González

1999-04-01

Full Text Available Bovine leukaemia virus (BLV is the causative agent of enzootic bovine leukosis (EBL. In Argentina, where a program to eradicate EBL has been introduced, sensitive and reliable diagnosis has attained high priority. Although the importance of the agar gel immunodiffusion test remains unchanged for routine work, an additional diagnostic technique is necessary to confirm cases of sera with equivocal results or of calves carrying maternal antibodies.Utilizing a nested shuttle polymerase chain reaction, the proviral DNA was detected from cows experimentally infected with as little as 5 ml of whole blood from BLV seropositive cows that were nonetheless normal in haematological terms. It proved to be a very sensitive technique, since it rapidly revealed the presence of the provirus, frequently at 2 weeks postinoculation and using a two-round procedure of nested PCR taking only 3 hours. Additionally, the primers used flanked a portion of the viral genome often employed to differentiate BLV type applying BamHI digestion. It is concluded that this method might offer a highly promising diagnostic tool for BLV infection.O Vírus da leucemia bovina (BLV é o agente causal da Leucose Enzoótica Bovina (EBL. Na Argentina, iniciou-se um programa de erradicação da EBL. Neste estágio, é prioritário possuir uma ferramenta de diagnóstico confiável. Embora seja indiscutível a importância do teste de agar gel imunodifusão, empregado rotineiramente no diagnóstico serológico da EBL, faz-se necessária uma técnica de diagnóstico adicional capaz de confirmar os resultados duvidosos. Foi possivel detectar ADN proviral aplicando Nested-PCR em novilhos experimentalmente infectados com pequenas doses de sangue total (5ml obtidas de um bovino BLV soropositivo. Esta técnica, cujo procedimento leva 3 horas, demonstrou ser muito sensível, uma vez que foi capaz de detectar a presença do provirus duas semanas após a inoculação. Os primers utilizados são os que

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

Reverse engineering of TLX oncogenic transcriptional networks identifies RUNX1 as tumor suppressor in T-ALL.

Science.gov (United States)

Della Gatta, Giusy; Palomero, Teresa; Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Bansal, Mukesh; Carpenter, Zachary W; De Keersmaecker, Kim; Sole, Xavier; Xu, Luyao; Paietta, Elisabeth; Racevskis, Janis; Wiernik, Peter H; Rowe, Jacob M; Meijerink, Jules P; Califano, Andrea; Ferrando, Adolfo A

2012-02-26

The TLX1 and TLX3 transcription factor oncogenes have a key role in the pathogenesis of T cell acute lymphoblastic leukemia (T-ALL). Here we used reverse engineering of global transcriptional networks to decipher the oncogenic regulatory circuit controlled by TLX1 and TLX3. This systems biology analysis defined T cell leukemia homeobox 1 (TLX1) and TLX3 as master regulators of an oncogenic transcriptional circuit governing T-ALL. Notably, a network structure analysis of this hierarchical network identified RUNX1 as a key mediator of the T-ALL induced by TLX1 and TLX3 and predicted a tumor-suppressor role for RUNX1 in T cell transformation. Consistent with these results, we identified recurrent somatic loss-of-function mutations in RUNX1 in human T-ALL. Overall, these results place TLX1 and TLX3 at the top of an oncogenic transcriptional network controlling leukemia development, show the power of network analyses to identify key elements in the regulatory circuits governing human cancer and identify RUNX1 as a tumor-suppressor gene in T-ALL.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

Energy Technology Data Exchange (ETDEWEB)

Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)

2011-10-25

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

International Nuclear Information System (INIS)

Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David

2011-01-01

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Recruitment of TREX to the transcription machinery by its direct binding to the phospho-CTD of RNA polymerase II.

Directory of Open Access Journals (Sweden)

Dominik M Meinel

2013-11-01

Full Text Available Messenger RNA (mRNA synthesis and export are tightly linked, but the molecular mechanisms of this coupling are largely unknown. In Saccharomyces cerevisiae, the conserved TREX complex couples transcription to mRNA export and mediates mRNP formation. Here, we show that TREX is recruited to the transcription machinery by direct interaction of its subcomplex THO with the serine 2-serine 5 (S2/S5 diphosphorylated CTD of RNA polymerase II. S2 and/or tyrosine 1 (Y1 phosphorylation of the CTD is required for TREX occupancy in vivo, establishing a second interaction platform necessary for TREX recruitment in addition to RNA. Genome-wide analyses show that the occupancy of THO and the TREX components Sub2 and Yra1 increases from the 5' to the 3' end of the gene in accordance with the CTD S2 phosphorylation pattern. Importantly, in a mutant strain, in which TREX is recruited to genes but does not increase towards the 3' end, the expression of long transcripts is specifically impaired. Thus, we show for the first time that a 5'-3' increase of a protein complex is essential for correct expression of the genome. In summary, we provide insight into how the phospho-code of the CTD directs mRNP formation and export through TREX recruitment.

Recruitment of TREX to the transcription machinery by its direct binding to the phospho-CTD of RNA polymerase II.

Science.gov (United States)

Meinel, Dominik M; Burkert-Kautzsch, Cornelia; Kieser, Anja; O'Duibhir, Eoghan; Siebert, Matthias; Mayer, Andreas; Cramer, Patrick; Söding, Johannes; Holstege, Frank C P; Sträßer, Katja

2013-11-01

Messenger RNA (mRNA) synthesis and export are tightly linked, but the molecular mechanisms of this coupling are largely unknown. In Saccharomyces cerevisiae, the conserved TREX complex couples transcription to mRNA export and mediates mRNP formation. Here, we show that TREX is recruited to the transcription machinery by direct interaction of its subcomplex THO with the serine 2-serine 5 (S2/S5) diphosphorylated CTD of RNA polymerase II. S2 and/or tyrosine 1 (Y1) phosphorylation of the CTD is required for TREX occupancy in vivo, establishing a second interaction platform necessary for TREX recruitment in addition to RNA. Genome-wide analyses show that the occupancy of THO and the TREX components Sub2 and Yra1 increases from the 5' to the 3' end of the gene in accordance with the CTD S2 phosphorylation pattern. Importantly, in a mutant strain, in which TREX is recruited to genes but does not increase towards the 3' end, the expression of long transcripts is specifically impaired. Thus, we show for the first time that a 5'-3' increase of a protein complex is essential for correct expression of the genome. In summary, we provide insight into how the phospho-code of the CTD directs mRNP formation and export through TREX recruitment.

Transcription-induced DNA supercoiling: New roles of intranucleosomal DNA loops in DNA repair and transcription.

Science.gov (United States)

Gerasimova, N S; Pestov, N A; Kulaeva, O I; Clark, D J; Studitsky, V M

2016-05-26

RNA polymerase II (Pol II) transcription through chromatin is accompanied by formation of small intranucleosomal DNA loops. Pol II captured within a small loop drives accumulation of DNA supercoiling, facilitating further transcription. DNA breaks relieve supercoiling and induce Pol II arrest, allowing detection of DNA damage hidden in chromatin structure.

Characterization of human mesothelin transcripts in ovarian and pancreatic cancer

International Nuclear Information System (INIS)

Muminova, Zhanat E; Strong, Theresa V; Shaw, Denise R

2004-01-01

Mesothelin is an attractive target for cancer immunotherapy due to its restricted expression in normal tissues and high level expression in several tumor types including ovarian and pancreatic adenocarcinomas. Three mesothelin transcript variants have been reported, but their relative expression in normal tissues and tumors has been poorly characterized. The goal of the present study was to clarify which mesothelin transcript variants are commonly expressed in human tumors. Human genomic and EST nucleotide sequences in the public databases were used to evaluate sequences reported for the three mesothelin transcript variants in silico. Subsequently, RNA samples from normal ovary, ovarian and pancreatic carcinoma cell lines, and primary ovarian tumors were analyzed by reverse transcription-polymerase chain reaction (RT-PCR) and nucleotide sequencing to directly identify expressed transcripts. In silico comparisons of genomic DNA sequences with available EST sequences supported expression of mesothelin transcript variants 1 and 3, but there were no sequence matches for transcript variant 2. Newly-derived nucleotide sequences of RT-PCR products from tissues and cell lines corresponded to mesothelin transcript variant 1. Mesothelin transcript variant 2 was not detected. Transcript variant 3 was observed as a small percentage of total mesothelin amplification products from all studied cell lines and tissues. Fractionation of nuclear and cytoplasmic RNA indicated that variant 3 was present primarily in the nuclear fraction. Thus, mesothelin transcript variant 3 may represent incompletely processed hnRNA. Mesothelin transcript variant 1 represents the predominant mature mRNA species expressed by both normal and tumor cells. This conclusion should be important for future development of cancer immunotherapies, diagnostic tests, and gene microarray studies targeting mesothelin

Transcription regulation by the Mediator complex.

Science.gov (United States)

Soutourina, Julie

2018-04-01

Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

RNA binding and replication by the poliovirus RNA polymerase

International Nuclear Information System (INIS)

Oberste, M.S.

1988-01-01

RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region

Inhibition of both HIV-1 reverse transcription and gene expression by a cyclic peptide that binds the Tat-transactivating response element (TAR RNA.

Directory of Open Access Journals (Sweden)

Matthew S Lalonde

2011-05-01

Full Text Available The RNA response element TAR plays a critical role in HIV replication by providing a binding site for the recruitment of the viral transactivator protein Tat. Using a structure-guided approach, we have developed a series of conformationally-constrained cyclic peptides that act as structural mimics of the Tat RNA binding region and block Tat-TAR interactions at nanomolar concentrations in vitro. Here we show that these compounds block Tat-dependent transcription in cell-free systems and in cell-based reporter assays. The compounds are also cell permeable, have low toxicity, and inhibit replication of diverse HIV-1 strains, including both CXCR4-tropic and CCR5-tropic primary HIV-1 isolates of the divergent subtypes A, B, C, D and CRF01_AE. In human peripheral blood mononuclear cells, the cyclic peptidomimetic L50 exhibited an IC(50 ∼250 nM. Surprisingly, inhibition of LTR-driven HIV-1 transcription could not account for the full antiviral activity. Timed drug-addition experiments revealed that L-50 has a bi-phasic inhibition curve with the first phase occurring after HIV-1 entry into the host cell and during the initiation of HIV-1 reverse transcription. The second phase coincides with inhibition of HIV-1 transcription. Reconstituted reverse transcription assays confirm that HIV-1 (- strand strong stop DNA synthesis is blocked by L50-TAR RNA interactions in-vitro. These findings are consistent with genetic evidence that TAR plays critical roles both during reverse transcription and during HIV gene expression. Our results suggest that antiviral drugs targeting TAR RNA might be highly effective due to a dual inhibitory mechanism.

Interplay between DNA supercoiling and transcription elongation.

Science.gov (United States)

Ma, Jie; Wang, Michelle

2014-01-01

Transcription-coupled DNA supercoiling has been shown to be an important regulator of transcription that is broadly present in the cell. Here we review experimental work which shows that RNA polymerase is a powerful torsional motor that can alter DNA topology and structure, and DNA supercoiling in turn directly affects transcription elongation.

The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

International Nuclear Information System (INIS)

Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

2007-01-01

Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

DNA intercalator stimulates influenza transcription and virus replication

Directory of Open Access Journals (Sweden)

Poon Leo LM

2011-03-01

Full Text Available Abstract Influenza A virus uses its host transcription machinery to facilitate viral RNA synthesis, an event that is associated with cellular RNA polymerase II (RNAPII. In this study, various RNAPII transcription inhibitors were used to investigate the effect of RNAPII phosphorylation status on viral RNA transcription. A low concentration of DNA intercalators, such as actinomycin D (ActD, was found to stimulate viral polymerase activity and virus replication. This effect was not observed in cells treated with RNAPII kinase inhibitors. In addition, the loss of RNAPIIa in infected cells was due to the shift of nonphosphorylated RNAPII (RNAPIIa to hyperphosphorylated RNAPII (RNAPIIo.

Interplay Among Constitutes of Ebola Virus: Nucleoprotein, Polymerase L, Viral Proteins

Science.gov (United States)

Zhang, Minchuan; He, Peiming; Su, Jing; Singh, Dadabhai T.; Su, Hailei; Su, Haibin

Ebola virus is a highly lethal filovirus, claimed thousands of people in its recent outbreak. Seven viral proteins constitute ebola viral structure, and four of them (nucleoprotein (NP), polymerase L, VP35 and VP30) participate majorly in viral replication and transcription. We have elucidated a conformation change of NP cleft by VP35 NP-binding protein domains through superimposing two experimental NP structure images and discussed the function of this conformation change in the replication and transcription with polymerase complex (L, VP35 and VP30). The important roles of VP30 in viral RNA synthesis have also been discussed. A “tapping” model has been proposed in this paper for a better understanding of the interplay among the four viral proteins (NP, polymerase L, VP35 and VP30). Moreover, we have pinpointed some key residue changes on NP (both NP N- and C-terminal) and L between Reston and Zaire by computational studies. Together, this paper provides a description of interactions among ebola viral proteins (NP, L, VP35, VP30 and VP40) in viral replication and transcription, and sheds light on the complex system of viral reproduction.

Structural Basis of Mitochondrial Transcription Initiation.

Science.gov (United States)

Hillen, Hauke S; Morozov, Yaroslav I; Sarfallah, Azadeh; Temiakov, Dmitry; Cramer, Patrick

2017-11-16

Transcription in human mitochondria is driven by a single-subunit, factor-dependent RNA polymerase (mtRNAP). Despite its critical role in both expression and replication of the mitochondrial genome, transcription initiation by mtRNAP remains poorly understood. Here, we report crystal structures of human mitochondrial transcription initiation complexes assembled on both light and heavy strand promoters. The structures reveal how transcription factors TFAM and TFB2M assist mtRNAP to achieve promoter-dependent initiation. TFAM tethers the N-terminal region of mtRNAP to recruit the polymerase to the promoter whereas TFB2M induces structural changes in mtRNAP to enable promoter opening and trapping of the DNA non-template strand. Structural comparisons demonstrate that the initiation mechanism in mitochondria is distinct from that in the well-studied nuclear, bacterial, or bacteriophage transcription systems but that similarities are found on the topological and conceptual level. These results provide a framework for studying the regulation of gene expression and DNA replication in mitochondria. Copyright © 2017 Elsevier Inc. All rights reserved.

Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

Science.gov (United States)

Rosner, A; Maslenin, L; Spiegel, S

1998-09-01

A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

DNA damage mediated transcription arrest: Step back to go forward.

Science.gov (United States)

Mullenders, Leon

2015-12-01

The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.

Factor requirements for transcription in the Archaeon Sulfolobus shibatae.

OpenAIRE

Qureshi, S A; Bell, S D; Jackson, S P

1997-01-01

Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is h...

Repression of RNA polymerase by the archaeo-viral regulator ORF145/RIP

DEFF Research Database (Denmark)

Sheppard, Carol; Blombach, Fabian; Belsom, Adam

2016-01-01

Little is known about how archaeal viruses perturb the transcription machinery of their hosts. Here we provide the first example of an archaeo-viral transcription factor that directly targets the host RNA polymerase (RNAP) and efficiently represses its activity. ORF145 from the temperate Acidianus...

Detection of Enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification

OpenAIRE

D Wang; X Wang; Y Geng; C An

2014-01-01

Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conven...

High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

Science.gov (United States)

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

RNA polymerase of the killer virus of yeast

International Nuclear Information System (INIS)

Georgopoulos, D.E.; Leibowitz, M.J.

1984-01-01

The L/sub A/ and M double-stranded (ds) RNA segments of the cytoplasmically inherited killer virus of Saccharomyces cerevisiae are encapsidated in virions that contain a DNA-independent transcriptase activity. This enzyme catalyzes the synthesis of full-length (+) stranded copies of the genomic dsRNA segments, denoted l/sub A/ and m. The L/sub A/ dsRNA segment appears to encode the major capsid protein in which both dsRNA molecules are encapsidated, while M dsRNA encodes products responsible for the two killer phenotypes of toxin production and resistance to toxin. Proteins extracted from transcriptionally active virions fail to cross-react with antibody to yeast DNA-dependent RNA polymerases, suggesting that none of the subunits of the host cell polymerases are active in viral transcription. Sequence analysis of the in vitro transcripts reveals neither to be 3'-terminally polyadenylated, although m contains an apparent internal polyA-like tract. In the presence of any three ribonucleoside triphosphates (0.5 mM), the fourth ribonucleoside triphosphate shows an optimal rate of incorporation into transcript at a concentration of 20 μM. However, in a 3-hour reaction, the yield of a product RNA increases with the concentration of the limiting ribonucleotide up to 0.5 mM. Gel electrophoresis of the reaction products reveals that increasing the substrate concentration accelerates the appearance of radioactivity in full-length l/sub A/ and m transcripts

Battles and hijacks: Noncoding transcription in plants

KAUST Repository

Ariel, Federico

2015-06-01

Noncoding RNAs have emerged as major components of the eukaryotic transcriptome. Genome-wide analyses revealed the existence of thousands of long noncoding RNAs (lncRNAs) in several plant species. Plant lncRNAs are transcribed by the plant-specific RNA polymerases Pol IV and Pol V, leading to transcriptional gene silencing, as well as by Pol II. They are involved in a wide range of regulatory mechanisms impacting on gene expression, including chromatin remodeling, modulation of alternative splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates the current knowledge on the regulatory mechanisms acting through plant noncoding transcription. © 2015 Elsevier Ltd.

Dengue virus type 3 isolation from Aedes aegypti in the municipality of Nova Iguaçu, State of Rio de Janeiro

Directory of Open Access Journals (Sweden)

Ricardo Lourenço-de-Oliveira

2002-09-01

Full Text Available In a prospective field study conducted from July 2000 to June 2001, adult Aedes aegypti and Ae. albopictus mosquitoes were caught from the municipality of Nova Iguaçu, State of Rio de Janeiro, Brazil. Virus isolation in Ae. albopictus clone C6/36 cell line and a semi-nested reverse transcription-polymerase chain reaction detected only dengue virus type 3 in three pools of Ae. aegypti, despite the co-circulation of DEN-1, DEN-2 and DEN-3 serotypes in that area. No viruses were detected in Ae. albopictus mosquitoes. This virological surveillance consists in a sentinel system alerting for dengue outbreaks.

Non-canonical transcription initiation: the expanding universe of transcription initiating substrates

Czech Academy of Sciences Publication Activity Database

Barvík, I.; Rejman, Dominik; Panova, Natalya; Šanderová, Hana; Krásný, Libor

2017-01-01

Roč. 41, č. 2 (2017), s. 131-138 ISSN 0168-6445 R&D Projects: GA ČR GA15-05228S; GA ČR GA15-11711S Institutional support: RVO:61388963 ; RVO:61388971 Keywords : RNA polymerase * non-canonical transcription initiation * transcription initiating substrate * nicotinamide adenine dinucleotide (NAD(+)) * coenzymes * RNA stability Subject RIV: EB - Genetics ; Molecular Biology; EE - Microbiology, Virology (MBU-M) OBOR OECD: Biochemistry and molecular biology; Microbiology (MBU-M) Impact factor: 12.198, year: 2016

Detection of very low level Plasmodium falciparum infections using the nested polymerase chain reaction and a reassessment of the epidemiology of unstable malaria in Sudan

DEFF Research Database (Denmark)

Roper, C; Elhassan, I M; Hviid, L

1996-01-01

We have used the nested polymerase chain reaction (PCR) to assay for low level Plasmodium falciparum infections that were below the threshold of detection of blood film examination. This revealed a substantial group of asymptomatic, submicroscopically patent infections within the population...... of a Sudanese village present throughout the year although clinical malaria episodes were almost entirely confined to the transmission season. In our September, January, April, and June surveys, the PCR-detected prevalences were 13%, 19%, 24%, and 19%, respectively. These figures reveal a much higher prevalence...... of dry season infection than previous microscopic surveys have indicated. Furthermore, 20% of a cohort of 79 individuals were healthy throughout the September to November transmission season but were PCR-positive for P. falciparum in a least one of a series of samples taken in the ensuing months. Levels...

Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis.

Science.gov (United States)

Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan

2013-05-01

This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.

Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

OpenAIRE

Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L

1993-01-01

We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

Science.gov (United States)

Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

2017-06-16

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Model of transcriptional activation by MarA in Escherichia coli.

Science.gov (United States)

Wall, Michael E; Markowitz, David A; Rosner, Judah L; Martin, Robert G

2009-12-01

The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

Model of transcriptional activation by MarA in Escherichia coli.

Directory of Open Access Journals (Sweden)

Michael E Wall

2009-12-01

Full Text Available The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

Novel functions of prototype foamy virus Gag glycine- arginine-rich boxes in reverse transcription and particle morphogenesis.

Science.gov (United States)

Müllers, Erik; Uhlig, Tobias; Stirnnagel, Kristin; Fiebig, Uwe; Zentgraf, Hanswalter; Lindemann, Dirk

2011-02-01

Prototype foamy virus (PFV) Gag lacks the characteristic orthoretroviral Cys-His motifs that are essential for various steps of the orthoretroviral replication cycle, such as RNA packaging, reverse transcription, infectivity, integration, and viral assembly. Instead, it contains three glycine-arginine-rich boxes (GR boxes) in its C terminus that putatively represent a functional equivalent. We used a four-plasmid replication-deficient PFV vector system, with uncoupled RNA genome packaging and structural protein translation, to analyze the effects of deletion and various substitution mutations within each GR box on particle release, particle-associated protein composition, RNA packaging, DNA content, infectivity, particle morphology, and intracellular localization. The degree of viral particle release by all mutants was similar to that of the wild type. Only minimal effects on Pol encapsidation, exogenous reverse transcriptase (RT) activity, and genomic viral RNA packaging were observed. In contrast, particle-associated DNA content and infectivity were drastically reduced for all deletion mutants and were undetectable for all alanine substitution mutants. Furthermore, GR box I mutants had significant changes in particle morphology, and GR box II mutants lacked the typical nuclear localization pattern of PFV Gag. Finally, it could be shown that GR boxes I and III, but not GR box II, can functionally complement each other. It therefore appears that, similar to the orthoretroviral Cys-His motifs, the PFV Gag GR boxes are important for RNA encapsidation, genome reverse transcription, and virion infectivity as well as for particle morphogenesis.

Human RNA polymerase II associated factor 1 complex promotes tumorigenesis by activating c-MYC transcription in non-small cell lung cancer

International Nuclear Information System (INIS)

Zhi, Xiuyi; Giroux-Leprieur, Etienne; Wislez, Marie; Hu, Mu; Zhang, Yi; Shi, Huaiyin; Du, Kaiqi; Wang, Lei

2015-01-01

Human RNA polymerase II (RNAPII)-associated factor 1 complex (hPAF1C) plays a crucial role in protein-coding gene transcription. Overexpression of hPAF1C has been implicated in the initiation and progression of various human cancers. However, the molecular pathways involved in tumorigenesis through hPAF1C remain to be elucidated. The current study suggested hPAF1C expression as a prognostic biomarker for early stage non-small cell lung cancer (NSCLC) and patients with low hPAF1C expression levels had significantly better overall survival. Furthermore, the expression of hPAF1C was found to be positively correlated with c-MYC expression in patient tumor samples and in cancer cell lines. Mechanistic studies indicated that hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription. These results demonstrated the prognostic value of hPAF1C in early-stage NSCLC and the role of hPAF1C in the transcriptional regulation of c-MYC oncogene during NSCLC tumorigenesis. - Highlights: • hPAF1C expression is a prognostic biomarker for early stage non-small cell lung cancer. • The expression of hPAF1C was positively correlated with c-MYC in tumor samples of patients and in several NSCLC cell lines. • hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription.

Establishment of reverse transcription loop-mediated isothermal amplification for rapid detection and differentiation of canine distemper virus infected and vaccinated animals.

Science.gov (United States)

Liu, Da-Fei; Liu, Chun-Guo; Tian, Jin; Jiang, Yi-Tong; Zhang, Xiao-Zhan; Chai, Hong-Liang; Yang, Tian-Kuo; Yin, Xiu-Chen; Zhang, Hong-Ying; Liu, Ming; Hua, Yu-Ping; Qu, Lian-Dong

2015-06-01

Although widespread vaccination against canine distemper virus (CDV) has been conducted for many decades, several canine distemper outbreaks in vaccinated animals have been reported frequently. In order to detect and differentiate the wild-type and vaccine strains of the CDV from the vaccinated animals, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed. A set of four primers-two internal and two external-were designed to target the H gene for the specific detection of wild-type CDV variants. The CDV-H RT-LAMP assay rapidly amplified the target gene, within 60 min, using a water bath held at a constant temperature of 65°C. The assay was 100-fold more sensitive than conventional RT-PCR, with a detection limit of 10(-1)TCID50ml(-1). The system showed a preference for wild-type CDV, and exhibited less sensitivity to canine parvovirus, canine adenovirus type 1 and type 2, canine coronavirus, and canine parainfluenza virus. The assay was validated using 102 clinical samples obtained from vaccinated dog farms, and the results were comparable to a multiplex nested RT-PCR assay. The specific CDV-H RT-LAMP assay provides a simple, rapid, and sensitive tool for the detection of canines infected with wild-type CDV from canines vaccinated with attenuated vaccine. Copyright © 2015 Elsevier B.V. All rights reserved.

Microphthalmia-associated transcription factor (MITF – from Waardenburg syndrome genetics to melanoma therapy

Directory of Open Access Journals (Sweden)

Ivan Šamija

2010-11-01

Full Text Available Microphthalmia-associated transcription factor (MITF was first discovered as protein coded by gene whose mutations are associated with Waardenburg syndrome. Later, MITF was shown to be key transcription factor regulating melanogenesis. Further studies have shown that in addition to regulating melanogenesis MITF also plays central role in regulation of melanocyte development and survival. MITF gene is amplified in a proportion of melanomas and ectopic MITF expression can transform melanocytes so MITF can function as melanoma “lineage survival” oncogene. Different studies have further revealed MITF’s important but complex role in tumorigenesis and progression of melanoma. As expected from its important role in melanocytes and melanoma MITF is intricately regulated on all the levels from transcription to post-translational modifications. Although complex mechanisms of MITF functioning are still being revealed, MITF already has a valuable role in managing melanoma patients. Immunohistochemical analysis of MITF has shown both diagnostic and prognostic value in patients with melanoma. MITF is also a valuable specific marker for detection of circulating melanoma cells by reverse-transcription – polymerase chain reaction. MITF has recently been investigated as a potential target for melanoma therapy.

Separation of replication and transcription domains in nucleoli.

Science.gov (United States)

Smirnov, E; Borkovec, J; Kováčik, L; Svidenská, S; Schröfel, A; Skalníková, M; Švindrych, Z; Křížek, P; Ovesný, M; Hagen, G M; Juda, P; Michalová, K; Cardoso, M C; Cmarko, D; Raška, I

2014-12-01

In mammalian cells, active ribosomal genes produce the 18S, 5.8S and 28S RNAs of ribosomal particles. Transcription levels of these genes are very high throughout interphase, and the cell needs a special strategy to avoid collision of the DNA polymerase and RNA polymerase machineries. To investigate this problem, we measured the correlation of various replication and transcription signals in the nucleoli of HeLa, HT-1080 and NIH 3T3 cells using a specially devised software for analysis of confocal images. Additionally, to follow the relationship between nucleolar replication and transcription in living cells, we produced a stable cell line expressing GFP-RPA43 (subunit of RNA polymerase I, pol I) and RFP-PCNA (the sliding clamp protein) based on human fibrosarcoma HT-1080 cells. We found that replication and transcription signals are more efficiently separated in nucleoli than in the nucleoplasm. In the course of S phase, separation of PCNA and pol I signals gradually increased. During the same period, separation of pol I and incorporated Cy5-dUTP signals decreased. Analysis of single molecule localization microscopy (SMLM) images indicated that transcriptionally active FC/DFC units (i.e. fibrillar centers with adjacent dense fibrillar components) did not incorporate DNA nucleotides. Taken together, our data show that replication of the ribosomal genes is spatially separated from their transcription, and FC/DFC units may provide a structural basis for that separation. Copyright © 2014 Elsevier Inc. All rights reserved.

Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction

DEFF Research Database (Denmark)

Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias

2015-01-01

Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...

Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

2010-03-26

The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

NARCIS (Netherlands)

Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

1994-01-01

Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

International Nuclear Information System (INIS)

Bavand, M.R.; Laub, O.

1988-01-01

Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

Diagnosis of hepatitis C virus in Brazilian blood donors using a reverse transcriptase nested polymerase chain reaction: comparison with enzyme immunoassay and recombinant protein immunoblot assay Diagnóstico da hepatite por vírus C em doadores de sangue brasileiros, usando a reação de transcrição reversa e a reação em cadeia da polimerase "nested": comparação com os ensaios imunoenzimáticos e imunoblot recombinante

Directory of Open Access Journals (Sweden)

Neiva S. L. GONÇALES

2000-10-01

Full Text Available Screening blood donations for anti-HCV antibodies and alanine aminotransferase (ALT serum levels generally prevents the transmission of hepatitis C virus (HCV by transfusion. The aim of the present study was to evaluate the efficiency of the enzyme immunoassay (EIA screening policy in identifying potentially infectious blood donors capable to transmit hepatitis C through blood transfusion. We have used a reverse transcriptase (RT-nested polymerase chain reaction (PCR to investigate the presence of HCV-RNA in blood donors. The prevalence of HCV-RNA positive individuals was compared with the recombinant immunoblot assay (RIBA-2 results in order to assess the usefulness of both tests as confirmatory assays. Both tests results were also compared with the EIA-2 OD/C ratio (optical densities of the samples divided by the cut off value. ALT results were expressed as the ALT quotient (qALT, calculated dividing the ALT value of the samples by the maximum normal value (53UI/l for the method. Donors (n=178 were divided into five groups according to their EIA anti-HCV status and qALT: group A (EIA > or = 3, ALT or = 3, ALT>1, group C (11 and group E (EIA or = 3 and detectable HCV-RNA by RT-nested PCR. We have also noted that blood donors with RIBA-2 indeterminate presented a high degree of detectable HCV-RNA using RT-nested PCR (75%, especially when the c22.3 band was detected.Na prevenção da transmissão de Hepatite por Vírus C (HCV em transfusões de hemocomponentes, utiliza-se rotineiramente, como testes de triagem de doadores de sangue, ensaios que detectam anticorpos anti-HCV e dosagens da enzima alanina-aminotransferase (ALT. O presente estudo tem como objetivo principal avaliar a eficiência do ensaio imunoenzimático de segunda geração (EIA-2 como teste de triagem, na identificação de doadores de sangue potencialmente infectados, e portanto, capazes de transmitir hepatite C pelos hemocomponentes. Nós utilizamos o ensaio de transcri

The transcript release factor PTRF augments ribosomal gene transcription by facilitating reinitiation of RNA polymerase I

Czech Academy of Sciences Publication Activity Database

Jansa, Petr; Burek, C.; Sander, E. E.; Grummt, I.

2001-01-01

Roč. 29, č. 2 (2001), s. 423-429 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z5052915 Keywords : rDNA transcription * PTRF * transcription reinitiation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.373, year: 2001

Visual Detection of Potato leafroll virus by One-step Reverse Transcription Loop-Mediated Isothermal Amplification of DNA with Hydroxynaphthol Blue Dye

NARCIS (Netherlands)

Ahmadi, S.; Almasi, A.M.; Fatehi, F.; Struik, P.C.; Moradi, A.

2013-01-01

Loop-mediated isothermal amplification (LAMP) assay is a novel technique for amplifying DNA under constant temperature, with high specificity, sensitivity, rapidity and efficiency. We applied reverse transcription loop-mediated isothermal amplification (RT-LAMP) to visually detect Potato leafroll

A comparative study of microbial diversity and community structure in marine sediments using poly(A tailing and reverse transcription PCR

Directory of Open Access Journals (Sweden)

Tatsuhiko eHoshino

2013-06-01

Full Text Available To obtain a better understanding of metabolically active microbial communities, we tested a molecular ecological approach using poly(A tailing of environmental 16S rRNA, followed by full-length complementary DNA (cDNA synthesis and sequencing to eliminate potential biases caused by mismatching of PCR primer sequences. The RNA pool tested was extracted from marine sediments of the Yonaguni Knoll IV hydrothermal field in the southern Okinawa Trough. The sequences obtained using the ploy(A tailing method were compared statistically and phylogenetically with those obtained using conventional reverse transcription-polymerase chain reaction (RT-PCR with published domain-specific primers. Both methods indicated that Deltaproteobacteria are predominant in sediment (>85% of the total sequence read. The poly(A tailing method indicated that Desulfobacterales were the predominant deltaproteobacteria, while most of the sequences in libraries constructed using RT-PCR were derived from Desulfuromonadales. This discrepancy may have been due to low coverage of Desulfobacterales by the primers used. A comparison of library diversity indices indicated that the poly(A tailing method retrieves more phylogenetically diverse sequences from the environment. The four archaeal 16S rRNA sequences that were obtained using the poly(A tailing method formed deeply branching lineages that were related to Candidatus Parvarchaeum and the Ancient Archaeal Group. These results clearly demonstrate that poly(A tailing followed by cDNA sequencing is a powerful and less biased molecular ecological approach for the study of metabolically active microbial communities.

Basal transcription machinery

Indian Academy of Sciences (India)

2007-03-29

Mar 29, 2007 ... The holoenzyme of prokaryotic RNA polymerase consists of the core enzyme, made of two , , ' and subunits, which lacks promoter selectivity and a sigma () subunit which enables the core enzyme to initiate transcription in a promoter dependent fashion. A stress sigma factor s, in prokaryotes ...

RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

International Nuclear Information System (INIS)

Gilmour, D.S.; Lis, J.T.

1986-01-01

By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

Effect of uv irradiation on lambda DNA transcription

Energy Technology Data Exchange (ETDEWEB)

Ranade, S S [Cancer Research Inst., Bombay (India)

1977-05-01

The effect of uv irradiation of template DNA has been studied in vitro in the E.coli RNA polymerase system with native and uv treated lambda DNA. Lambda DNA was more susceptible to uv than was calf-thymus DNA, yet a residual activity was observed at a uv dose of 0.5 x 10/sup 4/ erg/mm/sup 2/. From the kinetic analysis of the reaction and the incorporation of lambda /sup 32/P-labelled nucleoside triphosphates, it seems reasonable to conclude that uv irradiation probably did not affect the DNA initiation sites, recognizable by RNA polymerase. The transcription products made with uv irradiated lambda DNA were asymmetrical, and hybridized to the right half (R) and the left half (L) of lambda DNA with the ratio of R/L=4/1, and they showed a lower hybridizability than the transcripts with native lambda DNA. The initiation sites recognizable by RNA polymerase seemed to be the same on both native and uv irradiated lambda DNA, though the transcription of uv treated lambda DNA appeared to terminate with rather short RNA chains.

In depth analysis of the Sox4 gene locus that consists of sense and natural antisense transcripts

Science.gov (United States)

Ling, King-Hwa; Brautigan, Peter J.; Moore, Sarah; Fraser, Rachel; Leong, Melody Pui-Yee; Leong, Jia-Wen; Zainal Abidin, Shahidee; Lee, Han-Chung; Cheah, Pike-See; Raison, Joy M.; Babic, Milena; Lee, Young Kyung; Daish, Tasman; Mattiske, Deidre M.; Mann, Jeffrey R.; Adelson, David L.; Thomas, Paul Q.; Hahn, Christopher N.; Scott, Hamish S.

2016-01-01

SRY (Sex Determining Region Y)-Box 4 or Sox4 is an important regulator of the pan-neuronal gene expression during post-mitotic cell differentiation within the mammalian brain. Sox4 gene locus has been previously characterized with multiple sense and overlapping natural antisense transcripts [1], [2]. Here we provide accompanying data on various analyses performed and described in Ling et al. [2]. The data include a detail description of various features found at Sox4 gene locus, additional experimental data derived from RNA-Fluorescence in situ Hybridization (RNA-FISH), Western blotting, strand-specific reverse-transcription quantitative polymerase chain reaction (RT-qPCR), gain-of-function and in situ hybridization (ISH) experiments. All the additional data provided here support the existence of an endogenous small interfering- or PIWI interacting-like small RNA known as Sox4_sir3, which origin was found within the overlapping region consisting of a sense and a natural antisense transcript known as Sox4ot1. PMID:26958646

In depth analysis of the Sox4 gene locus that consists of sense and natural antisense transcripts

Directory of Open Access Journals (Sweden)

King-Hwa Ling

2016-06-01

Full Text Available SRY (Sex Determining Region Y-Box 4 or Sox4 is an important regulator of the pan-neuronal gene expression during post-mitotic cell differentiation within the mammalian brain. Sox4 gene locus has been previously characterized with multiple sense and overlapping natural antisense transcripts [1,2]. Here we provide accompanying data on various analyses performed and described in Ling et al. [2]. The data include a detail description of various features found at Sox4 gene locus, additional experimental data derived from RNA-Fluorescence in situ Hybridization (RNA-FISH, Western blotting, strand-specific reverse-transcription quantitative polymerase chain reaction (RT-qPCR, gain-of-function and in situ hybridization (ISH experiments. All the additional data provided here support the existence of an endogenous small interfering- or PIWI interacting-like small RNA known as Sox4_sir3, which origin was found within the overlapping region consisting of a sense and a natural antisense transcript known as Sox4ot1.

Diagnostic value of nested-PCR for identification of Malassezia species in dandruff

Science.gov (United States)

Jusuf, N. K.; Nasution, T. A.; Ullyana, S.

2018-03-01

Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.

Sensitivity and specificity of a nested polymerase chain reaction for detection of lentivirus infection in lions (Panthera leo).

Science.gov (United States)

Adams, Hayley; van Vuuren, Moritz; Kania, Stephen; Bosman, Anna-Mari; Keet, Dewald; New, John; Kennedy, Melissa

2010-12-01

Feline immunodeficiency virus (FIV) is a lentivirus in the Retroviridae family that causes lifelong infection in domestic cats. The lentivirus of African lions (Panthera leo), referred to as FIVple, is endemic in certain lion populations in eastern and southern Africa. Lentivirus infection leads to immunologic dysfunction and immunosuppressive disease in domestic cats; however, little is known about the pathogenic effects of infection in lions, nor about the epidemiologic impact on free-ranging and captive populations. Whole blood and serum samples were collected opportunistically from free-ranging lions in Kruger National Park, Republic of South Africa (RSA). Whole blood and serum samples were also collected from captive wild lions in the RSA. A nested polymerase chain reaction (PCR) assay for detection of FIV was performed on all whole blood samples. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and puma lentivirus synthetic envelope peptide antigen. The PCR assay successfully amplified the lion lentivirus from African lions. The relative sensitivity and relative specificity were 79% and 100%, respectively, and the positive and negative predictive values were 100% and 67%, respectively. This research represents the first study to compare genetic material with antibody-based methods of lentivirus detection on lions in RSA. Using PCR as an additional diagnostic test for FIV in lions will increase screening sensitivity and will allow viral characterization among circulating isolates and monitoring of changes in the viral epidemiology within geographic regions and populations over time.

Uncovering layers of human RNA polymerase II transcription

DEFF Research Database (Denmark)

Jensen, Torben Heick

In recent years DNA microarray and high-throughput sequencing technologies have challenged the “gene-centric” view that pre-mRNA is the only RNA species transcribed off protein-coding genes. Instead unorthodox transcription from within genic- and intergenic regions has been demonstrated to occur...

Evidence of simian retrovirus type D by polymerase chain reaction.

Science.gov (United States)

Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

2017-06-01

Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Transcription of potato spindle tuber viroid by RNA polymerase II starts in the left terminal loop

International Nuclear Information System (INIS)

Kolonko, Nadine; Bannach, Oliver; Aschermann, Katja; Hu, Kang-Hong; Moors, Michaela; Schmitz, Michael; Steger, Gerhard; Riesner, Detlev

2006-01-01

Viroids are single-stranded, circular RNAs of 250 to 400 bases, that replicate autonomously in their host plants but do not code for a protein. Viroids of the family Pospiviroidae, of which potato spindle tuber viroid (PSTVd) is the type strain, are replicated by the host's DNA-dependent RNA polymerase II in the nucleus. To analyze the initiation site of transcription from the (+)-stranded circles into (-)-stranded replication intermediates, we used a nuclear extract from a non-infected cell culture of the host plant S. tuberosum. The (-)-strands, which were de novo-synthesized in the extract upon addition of circular (+)-PSTVd, were purified by affinity chromatography. This purification avoided contamination by host nucleic acids that had resulted in a misassignment of the start site in an earlier study. Primer-extension analysis of the de novo-synthesized (-)-strands revealed a single start site located in the hairpin loop of the left terminal region in circular PSTVd's secondary structure. This start site is supported further by analysis of the infectivity and replication behavior of site-directed mutants in planta

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Trans-activation of the 5' to 3' viral DNA strand transfer by nucleocapsid protein during reverse transcription of HIV1 RNA.

Science.gov (United States)

Darlix, J L; Vincent, A; Gabus, C; de Rocquigny, H; Roques, B

1993-08-01

Two DNA strand transfer reactions take place during reverse transcription of the retroviral genome. The first transfer, that of the minus-strand strong stop DNA from the 5' end of the viral RNA to the 3' end, has been studied in vitro with two RNAs mimicking the 5' and 3' regions of the HIV1 genome and with nucleocapsid protein, NCp7, and reverse transcriptase. The results show that NCp7 strongly activates the 5' to 3' DNA strand transfer during reverse transcription while a basic peptide resembling NCp7 is inactive. Activation of the first transfer by several NCp7 derived peptides and the influence of the terminal redundancies (R) present at the 5' and 3' ends of HIV1 RNA were also examined. The first transfer is optimal in the presence of intact NCp7 and necessitates R on both the 5' and 3' RNAs. Sequencing of full length viral DNA products reveals approximately 40% misincorporations at the first nucleotide beyond the transfer point. If such base misincorporations occur during proviral DNA synthesis with possible homologous recombinations it may well contribute to the high level of genetic variability of HIV.

Mutual interdependence of splicing and transcription elongation.

Science.gov (United States)

Brzyżek, Grzegorz; Świeżewski, Szymon

2015-01-01

Transcription and splicing are intrinsically linked, as splicing needs a pre-mRNA substrate to commence. The more nuanced view is that the rate of transcription contributes to splicing regulation. On the other hand there is accumulating evidence that splicing has an active role in controlling transcription elongation by DNA-dependent RNA polymerase II (RNAP II). We briefly review those mechanisms and propose a unifying model where splicing controls transcription elongation to provide an optimal timing for successive rounds of splicing.

In vitro fluorescence studies of transcription factor IIB-DNA interaction.

Science.gov (United States)

Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

2015-01-01

General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

Real-time dynamics of RNA Polymerase II clustering in live human cells

Science.gov (United States)

Cisse, Ibrahim

2014-03-01

Transcription is the first step in the central dogma of molecular biology, when genetic information encoded on DNA is made into messenger RNA. How this fundamental process occurs within living cells (in vivo) is poorly understood,[1] despite extensive biochemical characterizations with isolated biomolecules (in vitro). For high-order organisms, like humans, transcription is reported to be spatially compartmentalized in nuclear foci consisting of clusters of RNA Polymerase II, the enzyme responsible for synthesizing all messenger RNAs. However, little is known of when these foci assemble or their relative stability. We developed an approach based on photo-activation localization microscopy (PALM) combined with a temporal correlation analysis, which we refer to as tcPALM. The tcPALM method enables the real-time characterization of biomolecular spatiotemporal organization, with single-molecule sensitivity, directly in living cells.[2] Using tcPALM, we observed that RNA Polymerase II clusters form transiently, with an average lifetime of 5.1 (+/- 0.4) seconds. Stimuli affecting transcription regulation yielded orders of magnitude changes in the dynamics of the polymerase clusters, implying that clustering is regulated and plays a role in the cells ability to effect rapid response to external signals. Our results suggest that the transient crowding of enzymes may aid in rate-limiting steps of genome regulation.

Varicella zoster virus myelitis in two elderly patients: diagnostic value of nested polymerase chain reaction assay and antibody index for cerebrospinal fluid specimens.

Science.gov (United States)

Takahashi, Teruyuki; Tamura, Masato; Miki, Kenji; Yamaguchi, Mai; Kanno, Akira; Nunomura, Satoshi; Ra, Chisei; Tamiya, Takashi; Kamei, Satoshi; Takasu, Toshiaki

2013-01-01

Myelitis is one of the rarest neurological complications of the varicella zoster virus (VZV) infection. Focal muscle weakness with or without sensory disturbance occurs in approximately 5% of the cases after acute VZV infection, with complete recovery in 50-70%. This report describes two rare cases of elderly patients with VZV myelitis secondary to dermatomal zoster rash. Patient 1 was a 79-year-old woman who developed paraplegia, numbness and decreased sensation in the left arm and below thoracic (Th)-10 after sacral zoster. Spinal cord MRI showed a high-signal-intensity lesion at the cervical spinal nerve 2 on a T2-weighted image. Patient 2 was a 73-year-old man who developed right flaccid leg weakness and urinary retention after right dorsal Th 5-8 zoster. Spinal cord MRI showed a high-signal-intensity lesion at Th 3-4 on a T2-weighted image. In both cases, although the conventional single polymerase chain reaction (PCR) assays all showed negative results, the original nested PCR assay detected VZV DNA in the cerebrospinal fluid (CSF) specimen collected on admission. In addition, the anti-VZV IgG antibody by enzyme immunoassay and antibody index were elevated in the CSF specimens during the clinical courses of both patients. On the basis of these findings, both patients were diagnosed with VZV myelitis and were treated with high-dose acyclovir and corticosteroid. This combined treatment was appropriate and effective for the improvement of their functional outcomes. The detection of VZV DNA in CSF by nested PCR assay and the evaluation of the antibody index to VZV had significant diagnostic value.

Distinct Mechanism Evolved for Mycobacterial RNA Polymerase and Topoisomerase I Protein-Protein Interaction.

Science.gov (United States)

Banda, Srikanth; Cao, Nan; Tse-Dinh, Yuk-Ching

2017-09-15

We report here a distinct mechanism of interaction between topoisomerase I and RNA polymerase in Mycobacterium tuberculosis and Mycobacterium smegmatis that has evolved independently from the previously characterized interaction between bacterial topoisomerase I and RNA polymerase. Bacterial DNA topoisomerase I is responsible for preventing the hyper-negative supercoiling of genomic DNA. The association of topoisomerase I with RNA polymerase during transcription elongation could efficiently relieve transcription-driven negative supercoiling. Our results demonstrate a direct physical interaction between the C-terminal domains of topoisomerase I (TopoI-CTDs) and the β' subunit of RNA polymerase of M. smegmatis in the absence of DNA. The TopoI-CTDs in mycobacteria are evolutionarily unrelated in amino acid sequence and three-dimensional structure to the TopoI-CTD found in the majority of bacterial species outside Actinobacteria, including Escherichia coli. The functional interaction between topoisomerase I and RNA polymerase has evolved independently in mycobacteria and E. coli, with distinctively different structural elements of TopoI-CTD utilized for this protein-protein interaction. Zinc ribbon motifs in E. coli TopoI-CTD are involved in the interaction with RNA polymerase. For M. smegmatis TopoI-CTD, a 27-amino-acid tail that is rich in basic residues at the C-terminal end is responsible for the interaction with RNA polymerase. Overexpression of recombinant TopoI-CTD in M. smegmatis competed with the endogenous topoisomerase I for protein-protein interactions with RNA polymerase. The TopoI-CTD overexpression resulted in decreased survival following treatment with antibiotics and hydrogen peroxide, supporting the importance of the protein-protein interaction between topoisomerase I and RNA polymerase during stress response of mycobacteria. Copyright © 2017 Elsevier Ltd. All rights reserved.

Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

NARCIS (Netherlands)

Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

2004-01-01

Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

Construction of a recombinant viral vector containing part of the nucleocapsid protein gene of newcastle disease virus

Energy Technology Data Exchange (ETDEWEB)

Bader, D.E.

1995-09-01

This report describes the procedures used to clone a 673 base pair gene fragment of the major nucleocapsid protein gene of Newcastle disease virus into a viral vector molecule for the purpose of maintaining a stable, long-term, renewable source of this target sequence for gene probe studies. The gene fragment was prepared by reverse-transcription polymerase chain reaction of Newcastle disease virus RNA and was cloned into the viral DNA vector Ml3mp18 RF to produce a recombinant DNA molecule. The cloned fragment was shown to be present in the recombinant clones based on (i) clonal selection on indicator plates; (ii) restriction enzyme analysis; (iii) gene probe analysis and (iv) nested PCR amplification.

From reverse transcription to human brain tumors

Directory of Open Access Journals (Sweden)

Dmitrenko V. V.

2013-05-01

Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line

Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics.

Science.gov (United States)

Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio

2017-05-01

Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.

Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics

Directory of Open Access Journals (Sweden)

Miriam Ribas Zambenedetti

Full Text Available BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV, hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+ plasmid, generating pET47b(+-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.

The reverse transcription inhibitor abacavir shows anticancer activity in prostate cancer cell lines.

Directory of Open Access Journals (Sweden)

Francesca Carlini

Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.

Sequence-specific inhibition of duck hepatitis B virus reverse transcription by peptide nucleic acids (PNA)

DEFF Research Database (Denmark)

Robaczewska, Magdalena; Narayan, Ramamurthy; Seigneres, Beatrice

2005-01-01

BACKGROUND/AIMS: Peptide nucleic acids (PNAs) appear as promising new antisense agents, that have not yet been examined as hepatitis B virus (HBV) inhibitors. Our aim was to study the ability of PNAs targeting the duck HBV (DHBV) encapsidation signal epsilon to inhibit reverse transcription (RT...... in primary duck hepatocytes (PDH). RESULTS: Both PNAs reproducibly inhibited DHBV RT in a dose-dependent manner with IC(50) of 10nM, whereas up to 600-fold higher concentration of S-ODNs was required for similar inhibition. The PNA targeting the bulge and upper stem of epsilon appeared as more efficient RT...

Mitotic Transcriptional Activation: Clearance of Actively Engaged Pol II via Transcriptional Elongation Control in Mitosis.

Science.gov (United States)

Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali

2015-11-05

Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division. Copyright © 2015 Elsevier Inc. All rights reserved.

RNA Pol II promotes transcription of centromeric satellite DNA in beetles.

Directory of Open Access Journals (Sweden)

Zeljka Pezer

Full Text Available Transcripts of centromeric satellite DNAs are known to play a role in heterochromatin formation as well as in establishment of the kinetochore. However, little is known about basic mechanisms of satellite DNA expression within constitutive heterochromatin and its regulation. Here we present comprehensive analysis of transcription of abundant centromeric satellite DNA, PRAT from beetle Palorus ratzeburgii (Coleoptera. This satellite is characterized by preservation and extreme sequence conservation among evolutionarily distant insect species. PRAT is expressed in all three developmental stages: larvae, pupae and adults at similar level. Transcripts are abundant comprising 0.033% of total RNA and are heterogeneous in size ranging from 0.5 kb up to more than 5 kb. Transcription proceeds from both strands but with 10 fold different expression intensity and transcripts are not processed into siRNAs. Most of the transcripts (80% are not polyadenylated and remain in the nucleus while a small portion is exported to the cytoplasm. Multiple, irregularly distributed transcription initiation sites as well as termination sites have been mapped within the PRAT sequence using primer extension and RLM-RACE. The presence of cap structure as well as poly(A tails in a portion of the transcripts indicate RNA polymerase II-dependent transcription and a putative polymerase II promoter site overlaps the most conserved part of the PRAT sequence. The treatment of larvae with alpha-amanitin decreases the level of PRAT transcripts at concentrations that selectively inhibit pol II activity. In conclusion, stable, RNA polymerase II dependant transcripts of abundant centromeric satellite DNA, not regulated by RNAi, have been identified and characterized. This study offers a basic understanding of expression of highly abundant heterochromatic DNA which in beetle species constitutes up to 50% of the genome.

New discoveries linking transcription to DNA repair and damage tolerance pathways.

Science.gov (United States)

Cohen, Susan E; Walker, Graham C

2011-01-01

In Escherichia coli, the transcription elongation factor NusA is associated with all elongating RNA polymerases where it functions in transcription termination and antitermination. Here, we review our recent results implicating NusA in the recruitment of DNA repair and damage tolerance mechanisms to sites of stalled transcription complexes.

Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

DEFF Research Database (Denmark)

Helbo, Alexandra Søgaard; Lay, Fides D; Jones, Peter A

2017-01-01

Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high...

Studies on Transcriptional Incorporation of 5'-N-Triphosphates of 5'-Amino-5'-Deoxyribonucleosides.

Directory of Open Access Journals (Sweden)

Weronika Kotkowiak

Full Text Available In this study, several RNA polymerases were used for the first time to examine the possibility of transcriptional incorporation of 5'-N-triphosphates of 5'-amino-5'-deoxyribonucleosides (5'NH NTPs. The T3, T7, Sp6 and T7 Y639F RNA polymerases were employed to show that the full-length transcript cannot be synthesized. The results suggest that the application of 5'NH NTPs could decrease transcription reaction rates. What is more, the modification of transcription conditions had no influence on the rate of 5'NH NTPs incorporation. Based on experimental data it is postulated that 5'NH NTPs can be used as potential transcription inhibitors. Our findings expand the knowledge on suitable uses of the 5'-N-triphosphates of 5'-amino-5'-deoxyribonucleoside and the exact mechanism of transcriptional inhibition.

Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

Science.gov (United States)

Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

2007-10-01

Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus.

Science.gov (United States)

Pierce, K E; Mistry, R; Reid, S M; Bharya, S; Dukes, J P; Hartshorn, C; King, D P; Wangh, L J

2010-07-01

A novel molecular assay for the detection of foot-and-mouth disease virus (FMDV) was developed using linear-after-the-exponential polymerase chain reaction (LATE-PCR). Pilot experiments using synthetic DNA targets demonstrated the ability of LATE-PCR to quantify initial target concentration through endpoint detection. A two-step protocol involving reverse transcription (RT) followed by LATE-PCR was then used to confirm the ability of the assay to detect FMDV RNA. Finally, RT and LATE-PCR were combined in a one-step duplex assay for co-amplification of an FMDV RNA segment and an internal control comprised of an Armored RNA. In that form, each of the excess primers in the reaction mixture hybridize to their respective RNA targets during a short pre-incubation, then generate cDNA strands during a 3-min RT step at 60°C, and the resulting cDNA is amplified by LATE-PCR without intervening sample processing. The RT-LATE-PCR assay generates fluorescent signals at endpoint that are proportional to the starting number of RNA targets and can detect a range of sequence variants using a single mismatch-tolerant probe. In addition to offering improvements over current laboratory-based molecular diagnostic assays for FMDV, this new assay is compatible with a novel portable ('point-of-care') device, the BioSeeq II, designed for the rapid diagnosis of FMD in the field. © 2009 The Authors. Journal compilation © 2009 The Society for Applied Microbiology.

Inhibition of post-transcriptional RNA processing by CDK inhibitors and its implication in anti-viral therapy.

Directory of Open Access Journals (Sweden)

Jitka Holcakova

Full Text Available Cyclin-dependent kinases (CDKs are key regulators of the cell cycle and RNA polymerase II mediated transcription. Several pharmacological CDK inhibitors are currently in clinical trials as potential cancer therapeutics and some of them also exhibit antiviral effects. Olomoucine II and roscovitine, purine-based inhibitors of CDKs, were described as effective antiviral agents that inhibit replication of a broad range of wild type human viruses. Olomoucine II and roscovitine show high selectivity for CDK7 and CDK9, with important functions in the regulation of RNA polymerase II transcription. RNA polymerase II is necessary for viral transcription and following replication in cells. We analyzed the effect of inhibition of CDKs by olomoucine II on gene expression from viral promoters and compared its effect to widely-used roscovitine. We found that both roscovitine and olomoucine II blocked the phosphorylation of RNA polymerase II C-terminal domain. However the repression of genes regulated by viral promoters was strongly dependent on gene localization. Both roscovitine and olomoucine II inhibited expression only when the viral promoter was not integrated into chromosomal DNA. In contrast, treatment of cells with genome-integrated viral promoters increased their expression even though there was decreased phosphorylation of the C-terminal domain of RNA polymerase II. To define the mechanism responsible for decreased gene expression after pharmacological CDK inhibitor treatment, the level of mRNA transcription from extrachromosomal DNA was determined. Interestingly, our results showed that inhibition of RNA polymerase II C-terminal domain phosphorylation increased the number of transcribed mRNAs. However, some of these mRNAs were truncated and lacked polyadenylation, which resulted in decreased translation. These results suggest that phosphorylation of RNA polymerase II C-terminal domain is critical for linking transcription and posttrancriptional

Coordination of genomic structure and transcription by the main bacterial nucleoid-associated protein HU

Science.gov (United States)

Berger, Michael; Farcas, Anca; Geertz, Marcel; Zhelyazkova, Petya; Brix, Klaudia; Travers, Andrew; Muskhelishvili, Georgi

2010-01-01

The histone-like protein HU is a highly abundant DNA architectural protein that is involved in compacting the DNA of the bacterial nucleoid and in regulating the main DNA transactions, including gene transcription. However, the coordination of the genomic structure and function by HU is poorly understood. Here, we address this question by comparing transcript patterns and spatial distributions of RNA polymerase in Escherichia coli wild-type and hupA/B mutant cells. We demonstrate that, in mutant cells, upregulated genes are preferentially clustered in a large chromosomal domain comprising the ribosomal RNA operons organized on both sides of OriC. Furthermore, we show that, in parallel to this transcription asymmetry, mutant cells are also impaired in forming the transcription foci—spatially confined aggregations of RNA polymerase molecules transcribing strong ribosomal RNA operons. Our data thus implicate HU in coordinating the global genomic structure and function by regulating the spatial distribution of RNA polymerase in the nucleoid. PMID:20010798

Transcriptional mutagenesis: causes and involvement in tumor development

Science.gov (United States)

Brégeon, Damien; Doetsch, Paul W.

2013-01-01

The majority of normal cells in a human do not multiply continuously but are quiescent and devote most of their energy to gene transcription. When DNA damages in the transcribed strand of an active gene are bypassed by an RNA polymerase, they can miscode at the damaged site and produce mutant transcripts. This process known as transcriptional mutagenesis can lead to the production of mutant proteins that could be important in tumor development. PMID:21346784

New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

Science.gov (United States)

Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

2014-01-01

The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

Reverse transcription and polymerase chain reaction: principles and applications in dentistry Transcrição reversa e reação em cadeia da polimerase: princípios e aplicações em odontologia

Directory of Open Access Journals (Sweden)

Carlos Ferreira dos Santos

2004-03-01

Full Text Available Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR, which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT reaction in order to produce cDNA from RNA (RT-PCR. RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer. Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.Várias técnicas de biologia molecular têm sido disponibilizadas nos últimos anos. Uma que revolucionou a análise de ácidos nucléicos foi a reação em cadeia da polimerase (PCR, descrita pela primeira vez em 1985. Esta técnica baseia-se na possibilidade de amplificação exponencial de fragmentos específicos de DNA, com a criação de milhões de cópias que servirão como matéria-prima para diferentes tipos de análises. A PCR pode ser precedida por uma reação de transcrição reversa (RT para a obtenção de cDNA a partir de RNA (RT-PCR, representando, por exemplo, uma possibilidade de análise de expressão gênica em células ou tecidos. As técnicas de PCR e RT-PCR têm sido utilizadas em pesquisas odontológicas como

Affinity isolation and I-DIRT mass spectrometric analysis of the Escherichia coli O157:H7 Sakai RNA polymerase complex.

Science.gov (United States)

Lee, David J; Busby, Stephen J W; Westblade, Lars F; Chait, Brian T

2008-02-01

Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the "core" E. coli genome.

Architecture of the RNA polymerase II-Mediator core initiation complex.

Science.gov (United States)

Plaschka, C; Larivière, L; Wenzeck, L; Seizl, M; Hemann, M; Tegunov, D; Petrotchenko, E V; Borchers, C H; Baumeister, W; Herzog, F; Villa, E; Cramer, P

2015-02-19

The conserved co-activator complex Mediator enables regulated transcription initiation by RNA polymerase (Pol) II. Here we reconstitute an active 15-subunit core Mediator (cMed) comprising all essential Mediator subunits from Saccharomyces cerevisiae. The cryo-electron microscopic structure of cMed bound to a core initiation complex was determined at 9.7 Å resolution. cMed binds Pol II around the Rpb4-Rpb7 stalk near the carboxy-terminal domain (CTD). The Mediator head module binds the Pol II dock and the TFIIB ribbon and stabilizes the initiation complex. The Mediator middle module extends to the Pol II foot with a 'plank' that may influence polymerase conformation. The Mediator subunit Med14 forms a 'beam' between the head and middle modules and connects to the tail module that is predicted to bind transcription activators located on upstream DNA. The Mediator 'arm' and 'hook' domains contribute to a 'cradle' that may position the CTD and TFIIH kinase to stimulate Pol II phosphorylation.

Non-canonical transcription initiation: the expanding universe of transcription initiating substrates.

Science.gov (United States)

Barvík, Ivan; Rejman, Dominik; Panova, Natalya; Šanderová, Hana; Krásný, Libor

2017-03-01

RNA polymerase (RNAP) is the central enzyme of transcription of the genetic information from DNA into RNA. RNAP recognizes four main substrates: ATP, CTP, GTP and UTP. Experimental evidence from the past several years suggests that, besides these four NTPs, other molecules can be used to initiate transcription: (i) ribooligonucleotides (nanoRNAs) and (ii) coenzymes such as NAD+, NADH, dephospho-CoA and FAD. The presence of these molecules at the 5΄ ends of RNAs affects the properties of the RNA. Here, we discuss the expanding portfolio of molecules that can initiate transcription, their mechanism of incorporation, effects on RNA and cellular processes, and we present an outlook toward other possible initiation substrates. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Improved Detection of Lassa Virus by Reverse Transcription-PCR Targeting the 5′ Region of S RNA▿

OpenAIRE

Ölschläger, Stephan; Lelke, Michaela; Emmerich, Petra; Panning, Marcus; Drosten, Christian; Hass, Meike; Asogun, Danny; Ehichioya, Deborah; Omilabu, Sunday; Günther, Stephan

2010-01-01

The method of choice for the detection of Lassa virus is reverse transcription (RT)-PCR. However, the high degree of genetic variability of the virus poses a problem with the design of RT-PCR assays that will reliably detect all strains. Recently, we encountered difficulties in detecting some strains from Liberia and Nigeria in a commonly used glycoprotein precursor (GPC) gene-specific RT-PCR assay (A. H. Demby, J. Chamberlain, D. W. Brown, and C. S. Clegg, J. Clin. Microbiol. 32:2898-2903, 1...

Extreme reversed sexual dichromatism in a bird without sex role reversal.

Science.gov (United States)

Heinsohn, Robert; Legge, Sarah; Endler, John A

2005-07-22

Brilliant plumage is typical of male birds, reflecting differential enhancement of male traits when females are the limiting sex. Brighter females are thought to evolve exclusively in response to sex role reversal. The striking reversed plumage dichromatism of Eclectus roratus parrots does not fit this pattern. We quantify plumage color in this species and show that very different selection pressures are acting on males and females. Male plumage reflects a compromise between the conflicting requirements for camouflage from predators while foraging and conspicuousness during display. Females are liberated from the need for camouflage but compete for rare nest hollows.

Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

Science.gov (United States)

2007-05-08

deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

The Diagnostic Utility of Bact/ALERT and Nested PCR in the Diagnosis of Tuberculous Meningitis.

Science.gov (United States)

Sastry, Apurba Sankar; Bhat K, Sandhya; Kumudavathi

2013-01-01

The early laboratory diagnosis of Tuberculous Meningitis (TBM) is crucial, to start the antitubercular chemotherapy and to prevent its complications. However, the conventional methods are either less sensitive or time consuming. Hence, the diagnostic potentials of BacT/ALERT and Polymerase Chain Reaction (PCR) was evaluated in this study. The study group comprised of 62 cases and 33 controls. The cases were divided according to Ahuja's criteria into the confirmed (two cases), highly probable (19 cases), probable (26 cases) and the possible (15 cases) subgroups. Ziehl Neelsen's (ZN) and Auramine Phenol (AP) staining, Lowenstein Jensen (LJ) medium culture, BacT/ALERT and nested Polymerase Chain Reaction (PCR) which targeted IS6110 were carried out on all the patients. The sensitivity of the LJ culture was 3.22%. BacT/ALERT showed a sensitivity and a specificity of 25.80% and 100% and those of nested PCR were found to be 40.32% and 96.97% respectively. The mean detection time of growth of the LJ culture was 31.28 days, whereas that of BacT/ALERT was 20.68 days. The contamination rate in the LJ culture and BacT/ALERT were 7.2% and 5.8% respectively. Nested PCR was found to be more sensitive, followed by BacT/ALERT as compared to the LJ culture and smear microscopy. As both false negative and false positive results have been reported for nested PCR, so it should not be used alone as a criterion for initiating or terminating the therapy, but it should be supported by clinical, radiological, cytological and other microbiological findings.

In situ hybridization detection methods for HPV16 E6/E7 mRNA in identifying transcriptionally active HPV infection of oropharyngeal carcinoma: an updating.

Science.gov (United States)

Volpi, Chiara C; Ciniselli, Chiara M; Gualeni, Ambra V; Plebani, Maddalena; Alfieri, Salvatore; Verderio, Paolo; Locati, Laura; Perrone, Federica; Quattrone, Pasquale; Carbone, Antonino; Pilotti, Silvana; Gloghini, Annunziata

2018-04-01

The aim of this study is to compare 2 in situ hybridization (ISH) detection methods for human papilloma virus (HPV) 16 E6/E7 mRNA, that is, the RNAscope 2.0 High Definition (HD) and the upgraded RNAscope 2.5 HD version. The RNAscope 2.5 HD has recently replaced the RNAscope 2.0 HD detection kit. Therefore, this investigation starts from the need to analytically validate the new mRNA ISH assay and, possibly, to refine the current algorithm for HPV detection in oropharyngeal squamous cell carcinoma with the final goal of applying it to daily laboratory practice. The study was based on HPV status and on generated data, interpreted by a scoring algorithm. The results highlighted that the compared RNAscope HPV tests had a good level of interchangeability and enabled to identify oropharyngeal squamous cell carcinoma that are truly driven by high-risk HPV infection. This was also supported by the comparison of the RNAscope HPV test with HPV E6/E7 mRNA real-time reverse-transcription polymerase chain reaction in a fraction of cases where material for HPV E6/E7 mRNA real-time reverse-transcription polymerase chain reaction was available. Furthermore, the algorithm that associates p16 immunohistochemistry with the identification of HPV mRNA by RNAscope was more effective than the one that associated p16 immunohistochemistry with the identification of HPV DNA by ISH. Copyright © 2017 Elsevier Inc. All rights reserved.

The importance of illumination in nest site choice and nest characteristics of cavity nesting birds.

Science.gov (United States)

Podkowa, Paweł; Surmacki, Adrian

2017-05-02

Light has a significant impact on many aspects of avian biology, physiology and behaviour. An increasing number of studies show that illumination may positively influences birds' offspring fitness by e.g. acceleration of embryo development, stimulation of skeleton growth or regulation of circadian rhythm. Because nest cavities have especially low illumination, suitable light levels may be especially important for species which nest there. We may therefore expect that birds breeding in relatively dim conditions should prefer brighter nest sites and/or evolve behavioral mechanisms to secure sufficient light levels in the nest. Using nest boxes with modified internal illumination, we experimentally tested whether light regime is a cue for nest site selection of secondary cavity-nesting species. Additionally, we investigated whether nest building strategies are tuned to internal illumination. Our results demonstrate that, nest boxes with elevated illumination were chosen twice as often as dark nest boxes. Moreover, birds built higher nests in dark nest boxes than birds in boxes with elevated illumination, which suggests a mechanism of compensating for low light conditions. Our results provide the first experimental support for the idea that nest site choice and nest building behaviour in cavity-nesting birds are influenced by ambient illumination.

Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.

Science.gov (United States)

Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth

2009-06-01

Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

Genome-wide analysis of KAP1, the 7SK snRNP complex, and RNA polymerase II

Directory of Open Access Journals (Sweden)

Ryan P. McNamara

2016-03-01

Full Text Available The transition of RNA polymerase II (Pol II from transcription initiation into productive elongation in eukaryotic cells is regulated by the P-TEFb kinase, which phosphorylates the C-terminal domain of paused Pol II at promoter-proximal regions. Our recent study found that P-TEFb (in an inhibited state bound to the 7SK snRNP complex interacts with the KAP1/TRIM28 transcriptional regulator, and that KAP1 and the 7SK snRNP co-occupy most gene promoters containing paused Pol II. Here we provide a detailed experimental description and analysis of the ChIP-seq datasets that have been deposited into Gene Expression Omnibus (GEO: GS72622, so that independent groups can replicate and expand upon these findings. We propose these datasets would provide valuable information for researchers studying mechanisms of transcriptional regulation including Pol II pausing and pause release. Keywords: P-TEFb/7SK snRNP, KAP1, RNA polymerase II, ChIP-seq, Transcription elongation

The interplay between polymerase organization and nucleosome occupancy along DNA : How dynamic roadblocks on the DNA induce the formation of RNA polymerase pelotons

NARCIS (Netherlands)

van den Berg, A.A.

2017-01-01

During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and

Human herpesvirus 8 (HHV-8 detected by nested polymerase chain reaction (PCR in HIV patients with or without Kaposi's sarcoma. An analytic cross-sectional study

Directory of Open Access Journals (Sweden)

Paula Renata Lima Machado

Full Text Available CONTEXT AND OBJECTIVE: Kaposi's sarcoma (KS is a common neoplastic disease in AIDS patients. The aim of this study was to evaluate the frequency of human herpesvirus 8 (HHV-8 infection in human immunodeficiency virus (HIV-infected patients, with or without KS manifestations and correlate HHV-8 detection with KS staging. DESIGN AND SETTING: Analytic cross-sectional study conducted in a public tertiary-level university hospital in Ribeirão Preto, São Paulo, Brazil. METHODS: Antibodies against HHV-8 lytic-phase antigens were detected by means of the immunofluorescence assay. HHV-8 DNA was detected in the patient samples through a nested polymerase chain reaction (nested PCR that amplified a region of open reading frame (ORF-26 of HHV-8. RESULTS: Anti-HHV-8 antibodies were detected in 30% of non-KS patients and 100% of patients with KS. Furthermore, the HHV-8 DNA detection rates observed in HIV-positive patients with KS were 42.8% in serum, 95.4% in blood samples and 100% in skin biopsies; and in patients without KS, the detection rate was 4% in serum. Out of the 16 serum samples from patients with KS-AIDS who were classified as stage II, two were positive (12.5%; and out of the 33 samples from patients in stage IV, 19 (57.6% were positive. CONCLUSION: We observed an association between HHV-8 detection and disease staging, which was higher in the serum of patients in stage IV. This suggests that detection of HHV-8 DNA in serum could be very useful for clinical assessment of patients with KS and for monitoring disease progression.

Characterization of DNA polymerase. beta. mRNA: cell-cycle growth response in cultured human cells

Energy Technology Data Exchange (ETDEWEB)

Zmudzka, B Z; Fornace, A; Collins, J; Wilson, S H

1988-10-25

DNA polymerase ..beta.. (..beta..-polymerase) is a housekeeping enzyme involved in DNA repair in vertebrate cells. The authors used a cDNA probe to study abundance of ..beta..-polymerase mRNA in cultured human cells. The mRNA level in synchronized HeLa cells, representing different stages of the cell-cycle, varied only slightly. Contact inhibited fibroblasts AG-1522 contained the same level of mRNA as growing cells. The steady-state level of mRNA in fibroblasts is equivalent to 6 molecules per cell. The results indicate that the ..beta..-polymerase transcript is low abundance and is neither cell-cycles nor growth phase responsive.

Structure of a Complete Mediator-RNA Polymerase II Pre-Initiation Complex.

Science.gov (United States)

Robinson, Philip J; Trnka, Michael J; Bushnell, David A; Davis, Ralph E; Mattei, Pierre-Jean; Burlingame, Alma L; Kornberg, Roger D

2016-09-08

A complete, 52-protein, 2.5 million dalton, Mediator-RNA polymerase II pre-initiation complex (Med-PIC) was assembled and analyzed by cryo-electron microscopy and by chemical cross-linking and mass spectrometry. The resulting complete Med-PIC structure reveals two components of functional significance, absent from previous structures, a protein kinase complex and the Mediator-activator interaction region. It thereby shows how the kinase and its target, the C-terminal domain of the polymerase, control Med-PIC interaction and transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

Role of the polymerase 3 in mutagenesis in the yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Zaborowska, D.; Baranowska, H.; Zuk, J.

1994-01-01

UV induction of cdc + revertants in thermosensitive cdc2 mutants (polymerase III) in the restrictive conditions (37 C) and after preincubation 4 h in permissive condition (23 C) has showed, that preincubation in permissive temperature, when polymerase III (CDC2 gene) is active, the frequency and mutation yield is lower. In HB75 (cdc2-1/cdc2-1) strain at the restrictive conditions the increase in the frequency of reversion in the meth his and trp mutants was observed after UV treatment. These data suggest, that cdc2 mutants lacked proofreading 3'-5' exonuclease activity besides the polymerase activity. (author). 11 refs, 3 tabs

Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

International Nuclear Information System (INIS)

Rho, Hyun-Wook; Lee, Byoung-Chan; Choi, Eun-Seok; Choi, Il-Ju; Lee, Yeon-Su; Goh, Sung-Ho

2010-01-01

Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. We assessed the suitability of six possible reference genes, beta-actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1 (HPRT1), beta-2-microglobulin (B2M), ribosomal subunit L29 (RPL29) and 18S ribosomal RNA (18S rRNA) in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. This RT-qPCR study showed that there are statistically significant (p < 0.05) differences in the expression levels of HPRT1 and 18S rRNA in 'normal-' versus 'tumor stomach tissues'. The stability analyses by geNorm suggest B2M-GAPDH, as best reference gene combination for 'stomach cancer cell lines'; RPL29-HPRT1, for 'all stomach tissues'; and ACTB-18S rRNA, for 'all stomach cell lines and tissues'. NormFinder also identified B2M as the best reference gene for 'stomach cancer cell lines', RPL29-B2M for 'all stomach tissues', and 18S rRNA-ACTB for 'all stomach cell lines and tissues'. The comparisons of normalized expression of the target gene, GPNMB, showed different interpretation of target gene expression depend on best single reference gene or combination. This study validated RPL29 and RPL29-B2M as the best single reference

Enclosed nests may provide greater thermal than nest predation benefits compared with open nests across latitudes

Science.gov (United States)

Martin, Thomas E.; Boyce, Andy J.; Fierro-Calderon, Karolina; Mitchell, Adam E.; Armstad, Connor E.; Mouton, James C.; Bin Soudi, Evertius E.

2017-01-01

Nest structure is thought to provide benefits that have fitness consequences for several taxa. Traditionally, reduced nest predation has been considered the primary benefit underlying evolution of nest structure, whereas thermal benefits have been considered a secondary or even non-existent factor. Yet, the relative roles of these factors on nest structures remain largely unexplored.Enclosed nests have a constructed or natural roof connected to sides that allow a restricted opening or tube entrance that provides cover in all directions except the entrance, whereas open nests are cups or platforms that are open above. We show that construction of enclosed nests is more common among songbirds (Passeriformes) in tropical and southern hemisphere regions than in north temperate regions. This geographic pattern may reflect selection from predation risk, under long-standing assumptions that nest predation rates are higher in southern regions and that enclosed nests reduce predation risk compared with open cup nests. We therefore compared nest predation rates between enclosed vs. open nests in 114 songbird species that do not nest in tree holes among five communities of coexisting birds, and for 205 non-hole-nesting species from the literature, across northern temperate, tropical, and southern hemisphere regions.Among coexisting species, enclosed nests had lower nest predation rates than open nests in two south temperate sites, but not in either of two tropical sites or a north temperate site. Nest predation did not differ between nest types at any latitude based on literature data. Among 319 species from both our field studies and the literature, enclosed nests did not show consistent benefits of reduced predation and, in fact, predation was not consistently higher in the tropics, contrary to long-standing perspectives.Thermal benefits of enclosed nests were indicated based on three indirect results. First, species that built enclosed nests were smaller than species using

Battles and hijacks: Noncoding transcription in plants

KAUST Repository

Ariel, Federico; Romero-Barrios, Natali; Jé gu, Teddy; Benhamed, Moussa; Crespi, Martin

2015-01-01

splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates

Affinity Isolation and I-DIRT Mass Spectrometric Analysis of the Escherichia coli O157:H7 Sakai RNA Polymerase Complex▿

Science.gov (United States)

Lee, David J.; Busby, Stephen J. W.; Westblade, Lars F.; Chait, Brian T.

2008-01-01

Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the “core” E. coli genome. PMID:18083804

The Mediator complex: a master coordinator of transcription and cell lineage development.

Science.gov (United States)

Yin, Jing-wen; Wang, Gang

2014-03-01

Mediator is a multiprotein complex that is required for gene transcription by RNA polymerase II. Multiple subunits of the complex show specificity in relaying information from signals and transcription factors to the RNA polymerase II machinery, thus enabling control of the expression of specific genes. Recent studies have also provided novel mechanistic insights into the roles of Mediator in epigenetic regulation, transcriptional elongation, termination, mRNA processing, noncoding RNA activation and super enhancer formation. Based on these specific roles in gene regulation, Mediator has emerged as a master coordinator of development and cell lineage determination. Here, we describe the most recent advances in understanding the mechanisms of Mediator function, with an emphasis on its role during development and disease.

Edible bird’s nest attenuates procoagulation effects of high-fat diet in rats

Directory of Open Access Journals (Sweden)

Yida Z

2015-07-01

Full Text Available Zhang Yida,1,2 Mustapha Umar Imam,1 Maznah Ismail,1,3 Norsharina Ismail,1 Zhiping Hou1 1Laboratory of Molecular Biomedicine, Institute of Bioscience, Universiti Putra Malaysia, Serdang, Selangor, Malaysia; 2Cardiology Department, Affiliated Hospital of Chengde Medical University, Chengde, Hebei, People’s Republic of China; 3Faculty of Medicine and Health Sciences, Department of Nutrition and Dietetics, Universiti Putra Malaysia, Serdang, Selangor, Malaysia Abstract: Edible bird’s nest (EBN is popular in Asia, and has long been used traditionally as a supplement. There are, however, limited evidence-based studies on its efficacy. EBN has been reported to improve dyslipidemia, which is closely linked to hypercoagulation states. In the present study, the effects of EBN on high-fat diet- (HFD- induced coagulation in rats were evaluated. Rats were fed for 12 weeks with HFD alone or in combination with simvastatin or EBN. Food intake was estimated, and weight measurements were made during the experimental period. After sacrifice, serum oxidized low-density lipo­protein (oxLDL, adiponectin, leptin, von willibrand factor, prostacyclin, thromboxane and lipid profile, and whole blood coagulation indices (bleeding time, prothrombin time, activated partial thromboplastin time, red blood count count, and platelet count were estimated. Furthermore, hepatic expression of coagulation-related genes was evaluated using multiplex polymerase chain reaction. The results indicated that EBN could attenuate HFD-induced hypercholesterolemia and coagulation similar to simvastatin, partly through transcriptional regulation of coagulation-related genes. The results suggested that EBN has the potential for lowering the risk of cardiovascular disease-related hypercoagulation due to hypercholesterolemia. Keywords: edible bird’s nest, coagulation, high-fat diet, hypercholesterolemia, nutrigeno­mics

Molecular analysis of alternative transcripts of equine AXL receptor tyrosine kinase gene.

Science.gov (United States)

Park, Jeong-Woong; Song, Ki-Duk; Kim, Nam Young; Choi, Jae-Young; Hong, Seul A; Oh, Jin Hyeog; Kim, Si Won; Lee, Jeong Hyo; Park, Tae Sub; Kim, Jin-Kyoo; Kim, Jong Geun; Cho, Byung-Wook

2017-10-01

Since athletic performance is a most importance trait in horses, most research focused on physiological and physical studies of horse athletic abilities. In contrast, the molecular analysis as well as the regulatory pathway studies remain insufficient for evaluation and prediction of horse athletic abilities. In our previous study, we identified AXL receptor tyrosine kinase ( AXL ) gene which was expressed as alternative spliced isoforms in skeletal muscle during exercise. In the present study, we validated two AXL alternative splicing transcripts (named as AXLa for long form and AXLb for short form) in equine skeletal muscle to gain insight(s) into the role of each alternative transcript during exercise. We validated two isoforms of AXL transcripts in horse tissues by reverse transcriptase polymerase chain reaction (RT-PCR), and then cloned the transcripts to confirm the alternative locus and its sequences. Additionally, we examined the expression patterns of AXLa and AXLb transcripts in horse tissues by quantitative RT-PCR (qRT-PCR). Both of AXLa and AXLb transcripts were expressed in horse skeletal muscle and the expression levels were significantly increased after exercise. The sequencing analysis showed that there was an alternative splicing event at exon 11 between AXLa and AXLb transcripts. 3-dimentional (3D) prediction of the alternative protein structures revealed that the structural distance of the connective region between fibronectin type 3 (FN3) and immunoglobin (Ig) domain was different between two alternative isoforms. It is assumed that the expression patterns of AXLa and AXLb transcripts would be involved in regulation of exercise-induced stress in horse muscle possibly through an NF-κB signaling pathway. Further study is necessary to uncover biological function(s) and significance of the alternative splicing isoforms in race horse skeletal muscle.

Molecular analysis of alternative transcripts of equine AXL receptor tyrosine kinase gene

Directory of Open Access Journals (Sweden)

Jeong-Woong Park

2017-10-01

Full Text Available Objective Since athletic performance is a most importance trait in horses, most research focused on physiological and physical studies of horse athletic abilities. In contrast, the molecular analysis as well as the regulatory pathway studies remain insufficient for evaluation and prediction of horse athletic abilities. In our previous study, we identified AXL receptor tyrosine kinase (AXL gene which was expressed as alternative spliced isoforms in skeletal muscle during exercise. In the present study, we validated two AXL alternative splicing transcripts (named as AXLa for long form and AXLb for short form in equine skeletal muscle to gain insight(s into the role of each alternative transcript during exercise. Methods We validated two isoforms of AXL transcripts in horse tissues by reverse transcriptase polymerase chain reaction (RT-PCR, and then cloned the transcripts to confirm the alternative locus and its sequences. Additionally, we examined the expression patterns of AXLa and AXLb transcripts in horse tissues by quantitative RT-PCR (qRT-PCR. Results Both of AXLa and AXLb transcripts were expressed in horse skeletal muscle and the expression levels were significantly increased after exercise. The sequencing analysis showed that there was an alternative splicing event at exon 11 between AXLa and AXLb transcripts. 3-dimentional (3D prediction of the alternative protein structures revealed that the structural distance of the connective region between fibronectin type 3 (FN3 and immunoglobin (Ig domain was different between two alternative isoforms. Conclusion It is assumed that the expression patterns of AXLa and AXLb transcripts would be involved in regulation of exercise-induced stress in horse muscle possibly through an NF-κB signaling pathway. Further study is necessary to uncover biological function(s and significance of the alternative splicing isoforms in race horse skeletal muscle.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

International Nuclear Information System (INIS)

Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z.

1990-01-01

We have synthesized 32 P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

Energy Technology Data Exchange (ETDEWEB)

Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z. (National Institutes of Health, Bethesda, MD (USA))

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies.

A Two-Way Street: Regulatory Interplay between RNA Polymerase and Nascent RNA Structure.

Science.gov (United States)

Zhang, Jinwei; Landick, Robert

2016-04-01

The vectorial (5'-to-3' at varying velocity) synthesis of RNA by cellular RNA polymerases (RNAPs) creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived, pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here, we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNAP and nascent RNA structure. We categorize and rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

The replisome uses mRNA as a primer after colliding with RNA polymerase.

Science.gov (United States)

Pomerantz, Richard T; O'Donnell, Mike

2008-12-11

Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

Mammalian RNA polymerase II core promoters: insights from genome-wide studies

DEFF Research Database (Denmark)

Sandelin, Albin; Carninci, Piero; Lenhard, Boris

2007-01-01

The identification and characterization of mammalian core promoters and transcription start sites is a prerequisite to understanding how RNA polymerase II transcription is controlled. New experimental technologies have enabled genome-wide discovery and characterization of core promoters, revealing...... in the mammalian transcriptome and proteome. Promoters can be described by their start site usage distribution, which is coupled to the occurrence of cis-regulatory elements, gene function and evolutionary constraints. A comprehensive survey of mammalian promoters is a major step towards describing...

Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

Science.gov (United States)

Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

2004-01-01

Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

The effect of U.V.-irradiation on lambda DNA transcription

International Nuclear Information System (INIS)

Ranade, S.S.

1977-01-01

The effect of U.V.-irradiation of template DNA has been studied in vitro in the E.coli RNA polymerase system with native and U.V.-treated lambda DNA. Lambda DNA was more susceptible to U.V. than was calf-thymus DNA, yet a residual activity was observed at a U.V. dose of 0.5 x 10 4 erg/mm 2 . From the kinetic analysis of the reaction and the incorporation of lambda 32 P-labelled nucleoside triphosphates, it seems reasonable to conclude that U.V.-irradiation probably did not affect the DNA initiation sites, recognizable by RNA polymerase. The transcription products made with U.V.-irradiated lambda DNA were asymmetrical, and hybridized to the right half (R) and the left half (L) of lambda DNA with the ratio of R/L=4/1, and they showed a lower hybridizability than the transcripts with native lambda DNA. The initiation sites recognizable by RNA polymerase seemed to be the same on both native and U.V.-irradiated lambda DNA, though the transcription of U.V.-treated lambda DNA appeared to terminate with rather short RNA chains. (author)

Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

Science.gov (United States)

Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

2013-12-23

At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

High-Resolution Phenotypic Landscape of the RNA Polymerase II Trigger Loop.

Directory of Open Access Journals (Sweden)

Chenxi Qiu

2016-11-01

Full Text Available The active sites of multisubunit RNA polymerases have a "trigger loop" (TL that multitasks in substrate selection, catalysis, and translocation. To dissect the Saccharomyces cerevisiae RNA polymerase II TL at individual-residue resolution, we quantitatively phenotyped nearly all TL single variants en masse. Three mutant classes, revealed by phenotypes linked to transcription defects or various stresses, have distinct distributions among TL residues. We find that mutations disrupting an intra-TL hydrophobic pocket, proposed to provide a mechanism for substrate-triggered TL folding through destabilization of a catalytically inactive TL state, confer phenotypes consistent with pocket disruption and increased catalysis. Furthermore, allele-specific genetic interactions among TL and TL-proximal domain residues support the contribution of the funnel and bridge helices (BH to TL dynamics. Our structural genetics approach incorporates structural and phenotypic data for high-resolution dissection of transcription mechanisms and their evolution, and is readily applicable to other essential yeast proteins.

Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus.

Science.gov (United States)

Guionie, O; Toquin, D; Sellal, E; Bouley, S; Zwingelstein, F; Allée, C; Bougeard, S; Lemière, S; Eterradossi, N

2007-02-01

Avian metapneumovirus (AMPV) is an important pathogen causing respiratory diseases and egg drops in several avian species. Four AMPV subgroups have been identified. The laboratory diagnosis of AMPV infections relies on serological methods, on labour-intensive virus isolation procedures, and on recently developed subgroup specific reverse transcription PCR (RT-PCR) protocols. In the present study, both the specificity and sensitivity of a commercial real-time reverse transcription PCR (RRT-PCR) for the detection and identification of the four AMPV subgroups were evaluated. Fifteen non-AMPV avian viruses belonging to 7 genera and 32 AMPV belonging to the 4 subgroups were tested. No non-AMPV virus was detected, whereas all AMPV viruses were identified in agreement with their previous molecular and antigenic subgroup assignment. The sensitivity and quantitating ability of the RRT-PCR assay were determined using serial dilutions of RNA derived either from AMPV virus stocks or from runoff transcripts. In all cases, linear dose/responses were observed. The detection limits of the different subgroups ranged from 500 to 5000 RNA copies and from 0.03 to 3.16TCID50/ml. The results were reproducible under laboratory conditions, thus showing that quantitative RRT-PCR is a new and powerful tool for the rapid and sensitive detection, identification and quantitation of AMPVs.

Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

Science.gov (United States)

Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

2008-05-20

Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection.

Directory of Open Access Journals (Sweden)

Ahmed Abd El Wahed

Full Text Available Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF. Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR are the standard method for molecular detection of the dengue virus (DENV. Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA assays were developed to detect DENV1-4.Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4 to 241 (DENV1-3 RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal and in Bangkok (Thailand. In Kedougou, the RT-RPA was operated at an ambient temperature of 38 °C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31 and 100% (n=23, respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90 and 100%(n=41, respectively.During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations.

Structural Basis for Recognition and Sequestration of UUUOH 3 ' Temini of Nascent RNA Polymerase III Transcripts by La, a Rheumatic Disease Autoantigen

Energy Technology Data Exchange (ETDEWEB)

Teplova,M.; Yuan, Y.; Phan, A.; Malinina, L.; Ilin, S.; Teplov, A.; Patel, D.

2006-01-01

The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUUOH 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the {beta} sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.

Versatility of cooperative transcriptional activation: a thermodynamical modeling analysis for greater-than-additive and less-than-additive effects.

Directory of Open Access Journals (Sweden)

Till D Frank

Full Text Available We derive a statistical model of transcriptional activation using equilibrium thermodynamics of chemical reactions. We examine to what extent this statistical model predicts synergy effects of cooperative activation of gene expression. We determine parameter domains in which greater-than-additive and less-than-additive effects are predicted for cooperative regulation by two activators. We show that the statistical approach can be used to identify different causes of synergistic greater-than-additive effects: nonlinearities of the thermostatistical transcriptional machinery and three-body interactions between RNA polymerase and two activators. In particular, our model-based analysis suggests that at low transcription factor concentrations cooperative activation cannot yield synergistic greater-than-additive effects, i.e., DNA transcription can only exhibit less-than-additive effects. Accordingly, transcriptional activity turns from synergistic greater-than-additive responses at relatively high transcription factor concentrations into less-than-additive responses at relatively low concentrations. In addition, two types of re-entrant phenomena are predicted. First, our analysis predicts that under particular circumstances transcriptional activity will feature a sequence of less-than-additive, greater-than-additive, and eventually less-than-additive effects when for fixed activator concentrations the regulatory impact of activators on the binding of RNA polymerase to the promoter increases from weak, to moderate, to strong. Second, for appropriate promoter conditions when activator concentrations are increased then the aforementioned re-entrant sequence of less-than-additive, greater-than-additive, and less-than-additive effects is predicted as well. Finally, our model-based analysis suggests that even for weak activators that individually induce only negligible increases in promoter activity, promoter activity can exhibit greater

Poly(adenosine 5'-diphosphate) ribose polymerase activation as a cause of metabolic dysfunction in critical illness.

Science.gov (United States)

Liaudet, Lucas

2002-03-01

Poly(adenosine 5'-diphosphate) ribose polymerase is a nuclear enzyme activated in response to genotoxic stress induced by a variety of DNA damaging agents. Several oxygen and nitrogen-centered free radicals, notably peroxynitrite, are strong inducers of DNA damage and poly(adenosine 5'-diphosphate) ribose polymerase activation in vitro and in vivo. Activation of this nuclear enzyme depletes the intracellular stores of its substrate nicotinamide adenine dinucleotide, slowing the rate of glycolysis, mitochondrial electron transport and adenosine triphosphate formation. This process triggers a severe energetic crisis within the cell, leading to acute cell dysfunction and cell necrosis. Poly(adenosine 5'-diphosphate) ribose polymerase also plays an important role in the regulation of inflammatory cascades, through a functional association with various transcription factors and transcription co-activators. Recent works identified this enzyme as a critical mediator of cellular metabolic dysfunction, inflammatory injury, and organ damage in conditions associated with overwhelming oxidative stress, including systemic inflammation, circulatory shock, and ischemia-reperfusion. Accordingly, pharmacological inhibitors of poly(adenosine 5'-diphosphate) ribose polymerase protect against cell death and tissue injury in such conditions, and may therefore represent novel therapeutic tools to limit multiple organ damage and dysfunction in critically ill patients.

Influence of olfactory and visual cover on nest site selection and nest success for grassland-nesting birds.

Science.gov (United States)

Fogarty, Dillon T; Elmore, R Dwayne; Fuhlendorf, Samuel D; Loss, Scott R

2017-08-01

Habitat selection by animals is influenced by and mitigates the effects of predation and environmental extremes. For birds, nest site selection is crucial to offspring production because nests are exposed to extreme weather and predation pressure. Predators that forage using olfaction often dominate nest predator communities; therefore, factors that influence olfactory detection (e.g., airflow and weather variables, including turbulence and moisture) should influence nest site selection and survival. However, few studies have assessed the importance of olfactory cover for habitat selection and survival. We assessed whether ground-nesting birds select nest sites based on visual and/or olfactory cover. Additionally, we assessed the importance of visual cover and airflow and weather variables associated with olfactory cover in influencing nest survival. In managed grasslands in Oklahoma, USA, we monitored nests of Northern Bobwhite ( Colinus virginianus ), Eastern Meadowlark ( Sturnella magna ), and Grasshopper Sparrow ( Ammodramus savannarum ) during 2015 and 2016. To assess nest site selection, we compared cover variables between nests and random points. To assess factors influencing nest survival, we used visual cover and olfactory-related measurements (i.e., airflow and weather variables) to model daily nest survival. For nest site selection, nest sites had greater overhead visual cover than random points, but no other significant differences were found. Weather variables hypothesized to influence olfactory detection, specifically precipitation and relative humidity, were the best predictors of and were positively related to daily nest survival. Selection for overhead cover likely contributed to mitigation of thermal extremes and possibly reduced detectability of nests. For daily nest survival, we hypothesize that major nest predators focused on prey other than the monitored species' nests during high moisture conditions, thus increasing nest survival on these

Low prevalence of transcriptionally active human papilloma virus in Indian patients with HNSCC and leukoplakia.

Science.gov (United States)

Bhosale, Priyanka G; Pandey, Manishkumar; Desai, Rajiv S; Patil, Asawari; Kane, Shubhada; Prabhash, Kumar; Mahimkar, Manoj B

2016-11-01

In the present study, we comprehensively analyzed the prevalence of transcriptionally active human papilloma virus (HPV) in tissue samples of Indian patients with leukoplakia, predominantly hyperplastic lesions and head and neck squamous cell carcinoma (HNSCC). In addition, saliva samples from patients with HNSCC were screened for HPV detection. P16 overexpression was analyzed by immunohistochemistry. Tissue samples of leukoplakia (n = 121) and HNSCC (n = 427) and saliva from patients with HNSCC (n = 215) were tested for HPV using nested polymerase chain reaction. Positive samples were sequenced for subtyping. The presence of HPV E6/E7 mRNA was confirmed by RNA in situ hybridization. P16 expression and HPV DNA were not detected in any of the leukoplakia specimens. Of the 427 HNSCC tumors, 9 showed p16 overexpression and 7/427 cases were positive for HPV16 DNA, in saliva or tissue. E6/E7 mRNA positivity was observed in 8 HNSCC samples, primarily from patients with no habit of tobacco consumption. The prevalence of high-risk HPV was restricted to oropharynx and larynx, with very little concordance between p16 overexpression and HPV positivity. All patients with HPV-positive saliva samples had transcriptionally active HPV present in their tumors. The presence of HPV DNA does not necessarily reflect transcriptionally active virus in tumors; hence, it is important to consider this fact while categorizing HPV-associated tumors. Copyright © 2016 Elsevier Inc. All rights reserved.

Rapid detection of genetically diverse tomato black ring virus isolates using reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Hasiów-Jaroszewska, Beata; Budzyńska, Daria; Borodynko, Natasza; Pospieszny, Henryk

2015-12-01

A reverse transcription loop-mediated isothermal amplification assay (RT-LAMP) has been developed for detection of tomato black ring virus (TBRV) isolates collected from different hosts. One-step RT-LAMP was performed with a set of four primers, the design of which was based on the coat protein gene. Results of RT-LAMP were visualized by direct staining of products with fluorescent dyes, agarose gel electrophoresis, and analysis of amplification curves. The sensitivity of RT-LAMP was 100-fold greater than that of RT-PCR. The RT-LAMP assay developed here is a useful and practical method for diagnosis of TBRV.

Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

Directory of Open Access Journals (Sweden)

Turyadi Turyadi

2018-01-01

Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

Reproductive potential and nesting effects of Osmia rufa (syn. bicornis female (Hymenoptera: Megachilidae

Directory of Open Access Journals (Sweden)

Giejdasz Karol

2016-06-01

Full Text Available The red mason bee Osmia rufa is a solitary bee belonging to the family Megachilidae, and is prone to nest in aggregations. Each female builds a nest separately in pre-existing cavities such as holes in wood and walls or empty plant stems. This is done by successively setting the cells in a linear series. In this study, we elucidate the nesting behavior and the reproductive potential of a single O. rufa female. The reproductive potential of nesting females was evaluated after the offspring finished development. We observed that an individual female may colonize up to five nest tubes and build 5-34 cells in them (16 on an average. During the nesting time the number of cells decreased with the sequence of nest tubes colonized by one female, which built a maximum of 11 cells in the first occupied nest and 5 cells in the last (fifth nest. Our observations indicated that 40% of nesting females colonized one nest tube as compared to 7% colonizing five nest tubes. Furthermore, in subsequent nest tubes the number of cells with freshly emerged females gradually decreased which was the reverse with males. Thus, the sex ratio (proportion of male and female offspring may change during the nesting period. The female offspring predominated in the first two nesting tubes, while in the subsequent three tubes male offspring dominated. We also cataloged different causes of reduction in abundance of offspring in O. rufa females such as parasitization or problem associated with moulting.

[Participation of the piRNA pathway in recruiting a component of RNA polymerase I transcription initiation complex to germline cell nucleoli].

Science.gov (United States)

Fefelova, E A; Stolyarenko, A D; Yakushev, E Y; Gvozdev, V A; Klenov, M S

2017-01-01

Proteins of the Piwi family and short Piwi-interacting RNAs (piRNAs) ensure the protection of the genome from transposable elements. We have previously shown that nuclear Piwi protein tends to concentrate in the nucleoli of the cells of Drosophila melanogaster ovaries. It could be hypothesized that the function of Piwi in the nucleolus is associated with the repression of R1 and R2 retrotransposons inserted into the rDNA cluster. Here, we show that Piwi participates in recruiting Udd protein to nucleoli. Udd is a component of the conserved Selectivity Factor I-like (SL1-like) complex, which is required for transcription initiation by RNA polymerase I. We found that Udd localization depends on Piwi in germline cells, but not in somatic cells of the ovaries. In contrast, knockdowns of the SL1-like components (Udd or TAF1b) do not disrupt Piwi localization. We also observed that the absence of Udd or TAF1b in germline cells, as well as the impairment of Piwi nuclear localization lead to the accumulation of late stage egg chambers in the ovaries, which could be explained by reduced rRNA transcription. These results allow us to propose for the first time a role for Piwi in the nucleolus that is not directly associated with transposable element repression.

CHD chromatin remodelers and the transcription cycle

Science.gov (United States)

Murawska, Magdalena

2011-01-01

It is well established that ATP-dependent chromatin remodelers modulate DNA access of transcription factors and RNA polymerases by “opening” or “closing” chromatin structure. However, this view is far too simplistic. Recent findings have demonstrated that these enzymes not only set the stage for the transcription machinery to act but also are actively involved at every step of the transcription process. As a consequence, they affect initiation, elongation, termination and RNA processing. In this review we will use the CHD family as a paradigm to illustrate the progress that has been made in revealing these new concepts. PMID:22223048

X-ray Crystal Structures Elucidate the Nucleotidyl Transfer Reaction of Transcript Initiation Using Two Nucleotides

Energy Technology Data Exchange (ETDEWEB)

M Gleghorn; E Davydova; R Basu; L Rothman-Denes; K Murakami

2011-12-31

We have determined the X-ray crystal structures of the pre- and postcatalytic forms of the initiation complex of bacteriophage N4 RNA polymerase that provide the complete set of atomic images depicting the process of transcript initiation by a single-subunit RNA polymerase. As observed during T7 RNA polymerase transcript elongation, substrate loading for the initiation process also drives a conformational change of the O helix, but only the correct base pairing between the +2 substrate and DNA base is able to complete the O-helix conformational transition. Substrate binding also facilitates catalytic metal binding that leads to alignment of the reactive groups of substrates for the nucleotidyl transfer reaction. Although all nucleic acid polymerases use two divalent metals for catalysis, they differ in the requirements and the timing of binding of each metal. In the case of bacteriophage RNA polymerase, we propose that catalytic metal binding is the last step before the nucleotidyl transfer reaction.

Detection of foot-and-mouth disease virus rna by reverse transcription loop-mediated isothermal amplification

Directory of Open Access Journals (Sweden)

Chen Hao-tai

2011-11-01

Full Text Available Abstract A reverse transcription loop-mediated isothermal amplification (RT-LAMP assay was developed for foot-and-mouth disease virus (FMDV RNA. The amplification was able to finish in 45 min under isothermal condition at 64°C by employing a set of four primers targeting FMDV 2B. The assay showed higher sensitivity than RT-PCR. No cross reactivity was observed from other RNA viruses including classical swine fever virus, swine vesicular disease, porcine reproductive and respiratory syndrome virus, Japanese encephalitis virus. Furthermore, the assay correctly detected 84 FMDV positive samples but not 65 FMDV negative specimens. The result indicated the potential usefulness of the technique as a simple and rapid procedure for the detection of FMDV infection.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

Directory of Open Access Journals (Sweden)

Matsutani Sachiko

2004-08-01

Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

Science.gov (United States)

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

The cavity-nest ant Temnothorax crassispinus prefers larger nests.

Science.gov (United States)

Mitrus, S

Colonies of the ant Temnothorax crassispinus inhabit mostly cavities in wood and hollow acorns. Typically in the field, nest sites that can be used by the ant are a limited resource. In a field experiment, it was investigated whether the ants prefer a specific size of nest, when different ones are available. In July 2011, a total of 160 artificial nests were placed in a beech-pine forest. Four artificial nests (pieces of wood with volume cavities, ca 415, 605, 730, and 980 mm 3 , respectively) were located on each square meter of the experimental plot. One year later, shortly before the emergence of new sexuals, the nests were collected. In July 2012, colonies inhabited more frequently bigger nests. Among queenright colonies, the ones which inhabited bigger nests had more workers. However, there was no relationship between volume of nest and number of workers for queenless colonies. Queenright colonies from bigger nests produced more sexual individuals, but there was no correlation between number of workers and sex allocation ratio, or between volume of nest and sex allocation ratio. In a laboratory experiment where ant colonies were kept in 470 and 860 mm 3 nests, larger colonies allocated more energy to produce sexual individuals. The results of this study show the selectivity of T. crassispinus ants regarding the size of nest cavity, and that the nest volume has an impact on life history parameters.

Application of anti-listerial bacteriocins: monitoring enterocin expression by multiplex relative reverse transcription-PCR.

Science.gov (United States)

Williams, D Ross; Chanos, Panagiotis

2012-12-01

Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali

2015-11-27

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

2015-01-01

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Recovery of infectious type Asia1 foot-and-mouth disease virus from suckling mice directly inoculated with an RNA polymerase I/II-driven unidirectional transcription plasmid.

Science.gov (United States)

Lian, Kaiqi; Yang, Fan; Zhu, Zixiang; Cao, Weijun; Jin, Ye; Li, Dan; Zhang, Keshan; Guo, Jianhong; Zheng, Haixue; Liu, Xiangtao

2015-10-02

We developed an RNA polymerase (pol) I- and II-driven plasmid-based reverse genetics system to rescue infectious foot-and-mouth disease virus (FMDV) from cloned cDNA. In this plasmid-based transfection, the full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta ribozyme (HdvRz) sequences, which were arranged downstream of the two promoters (cytomegalovirus (CMV) and pol I promoter) and upstream of the terminators and polyadenylation signal, respectively. The utility of this method was demonstrated by the recovery of FMDV Asia1 HN/CHA/06 in BHK-21 cells transfected with cDNA plasmids. Furthermore, infectious FMDV Asia1 HN/CHA/06 could be rescued from suckling mice directly inoculated with cDNA plasmids. Thus, this reverse genetics system can be applied to fundamental research and vaccine studies, most notably to rescue those viruses for which there is currently an absence of a suitable cell culture system. Copyright © 2015 Elsevier B.V. All rights reserved.

Interference of transcription across H-NS binding sites and repression by H-NS.

Science.gov (United States)

Rangarajan, Aathmaja Anandhi; Schnetz, Karin

2018-05-01

Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.

Distinct transcriptional networks in quiescent myoblasts: a role for Wnt signaling in reversible vs. irreversible arrest.

Directory of Open Access Journals (Sweden)

Sindhu Subramaniam

Full Text Available Most cells in adult mammals are non-dividing: differentiated cells exit the cell cycle permanently, but stem cells exist in a state of reversible arrest called quiescence. In damaged skeletal muscle, quiescent satellite stem cells re-enter the cell cycle, proliferate and subsequently execute divergent programs to regenerate both post-mitotic myofibers and quiescent stem cells. The molecular basis for these alternative programs of arrest is poorly understood. In this study, we used an established myogenic culture model (C2C12 myoblasts to generate cells in alternative states of arrest and investigate their global transcriptional profiles. Using cDNA microarrays, we compared G0 myoblasts with post-mitotic myotubes. Our findings define the transcriptional program of quiescent myoblasts in culture and establish that distinct gene expression profiles, especially of tumour suppressor genes and inhibitors of differentiation characterize reversible arrest, distinguishing this state from irreversibly arrested myotubes. We also reveal the existence of a tissue-specific quiescence program by comparing G0 C2C12 myoblasts to isogenic G0 fibroblasts (10T1/2. Intriguingly, in myoblasts but not fibroblasts, quiescence is associated with a signature of Wnt pathway genes. We provide evidence that different levels of signaling via the canonical Wnt pathway characterize distinct cellular states (proliferation vs. quiescence vs. differentiation. Moderate induction of Wnt signaling in quiescence is associated with critical properties such as clonogenic self-renewal. Exogenous Wnt treatment subverts the quiescence program and negatively affects clonogenicity. Finally, we identify two new quiescence-induced regulators of canonical Wnt signaling, Rgs2 and Dkk3, whose induction in G0 is required for clonogenic self-renewal. These results support the concept that active signal-mediated regulation of quiescence contributes to stem cell properties, and have implications for

Distinct transcriptional networks in quiescent myoblasts: a role for Wnt signaling in reversible vs. irreversible arrest.

Science.gov (United States)

Subramaniam, Sindhu; Sreenivas, Prethish; Cheedipudi, Sirisha; Reddy, Vatrapu Rami; Shashidhara, Lingadahalli Subrahmanya; Chilukoti, Ravi Kumar; Mylavarapu, Madhavi; Dhawan, Jyotsna

2014-01-01

Most cells in adult mammals are non-dividing: differentiated cells exit the cell cycle permanently, but stem cells exist in a state of reversible arrest called quiescence. In damaged skeletal muscle, quiescent satellite stem cells re-enter the cell cycle, proliferate and subsequently execute divergent programs to regenerate both post-mitotic myofibers and quiescent stem cells. The molecular basis for these alternative programs of arrest is poorly understood. In this study, we used an established myogenic culture model (C2C12 myoblasts) to generate cells in alternative states of arrest and investigate their global transcriptional profiles. Using cDNA microarrays, we compared G0 myoblasts with post-mitotic myotubes. Our findings define the transcriptional program of quiescent myoblasts in culture and establish that distinct gene expression profiles, especially of tumour suppressor genes and inhibitors of differentiation characterize reversible arrest, distinguishing this state from irreversibly arrested myotubes. We also reveal the existence of a tissue-specific quiescence program by comparing G0 C2C12 myoblasts to isogenic G0 fibroblasts (10T1/2). Intriguingly, in myoblasts but not fibroblasts, quiescence is associated with a signature of Wnt pathway genes. We provide evidence that different levels of signaling via the canonical Wnt pathway characterize distinct cellular states (proliferation vs. quiescence vs. differentiation). Moderate induction of Wnt signaling in quiescence is associated with critical properties such as clonogenic self-renewal. Exogenous Wnt treatment subverts the quiescence program and negatively affects clonogenicity. Finally, we identify two new quiescence-induced regulators of canonical Wnt signaling, Rgs2 and Dkk3, whose induction in G0 is required for clonogenic self-renewal. These results support the concept that active signal-mediated regulation of quiescence contributes to stem cell properties, and have implications for pathological

DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

Directory of Open Access Journals (Sweden)

Cheng-Yao eChen

2014-06-01

Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

Directory of Open Access Journals (Sweden)

Trina Ekawati Tallei

2015-10-01

Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

Microprocessor Recruitment to Elongating RNA Polymerase II Is Required for Differential Expression of MicroRNAs

Directory of Open Access Journals (Sweden)

Victoria A. Church

2017-09-01

Full Text Available The cellular abundance of mature microRNAs (miRNAs is dictated by the efficiency of nuclear processing of primary miRNA transcripts (pri-miRNAs into pre-miRNA intermediates. The Microprocessor complex of Drosha and DGCR8 carries this out, but it has been unclear what controls Microprocessor’s differential processing of various pri-miRNAs. Here, we show that Drosophila DGCR8 (Pasha directly associates with the C-terminal domain of the RNA polymerase II elongation complex when it is phosphorylated by the Cdk9 kinase (pTEFb. When association is blocked by loss of Cdk9 activity, a global change in pri-miRNA processing is detected. Processing of pri-miRNAs with a UGU sequence motif in their apical junction domain increases, while processing of pri-miRNAs lacking this motif decreases. Therefore, phosphorylation of RNA polymerase II recruits Microprocessor for co-transcriptional processing of non-UGU pri-miRNAs that would otherwise be poorly processed. In contrast, UGU-positive pri-miRNAs are robustly processed by Microprocessor independent of RNA polymerase association.

Reversible Communicating Processes

Directory of Open Access Journals (Sweden)

Geoffrey Brown

2016-02-01

Full Text Available Reversible distributed programs have the ability to abort unproductive computation paths and backtrack, while unwinding communication that occurred in the aborted paths. While it is natural to assume that reversibility implies full state recovery (as with traditional roll-back recovery protocols, an interesting alternative is to separate backtracking from local state recovery. For example, such a model could be used to create complex transactions out of nested compensable transactions where a programmer-supplied compensation defines the work required to "unwind" a transaction. Reversible distributed computing has received considerable theoretical attention, but little reduction to practice; the few published implementations of languages supporting reversibility depend upon a high degree of central control. The objective of this paper is to demonstrate that a practical reversible distributed language can be efficiently implemented in a fully distributed manner. We discuss such a language, supporting CSP-style synchronous communication, embedded in Scala. While this language provided the motivation for the work described in this paper, our focus is upon the distributed implementation. In particular, we demonstrate that a "high-level" semantic model can be implemented using a simple point-to-point protocol.

Detection of Aspergillus flavus and A. fumigatus in Bronchoalveolar Lavage Specimens of Hematopoietic Stem Cell Transplants and Hematological Malignancies Patients by Real-Time Polymerase Chain Reaction, Nested PCR and Mycological Assays

Science.gov (United States)

Zarrinfar, Hossein; Mirhendi, Hossein; Fata, Abdolmajid; Khodadadi, Hossein; Kordbacheh, Parivash

2015-01-01

Background: Pulmonary aspergillosis (PA) is one of the most serious complications in immunocompromised patients, in particular among hematopoietic stem cell transplants (HSCT) and patients with hematological malignancies. Objectives: The current study aimed to evaluate the incidence of PA and utility of molecular methods in HSCT and patients with hematological malignancies, four methods including direct examination, culture, nested polymerase chain reaction (PCR) and real-time PCR were performed on bronchoalveolar lavage (BAL) specimens in Tehran, Iran. Patients and Methods: During 16 months, 46 BAL specimens were obtained from individuals with allogeneic HSCT (n = 18) and patients with hematological malignancies (n = 28). Direct wet mounts with 20% potassium hydroxide (KOH) and culture on mycological media were performed. The molecular detection of Aspergillus fumigatus and A. flavus was done by amplifying the conserved sequences of internal transcribed spacer 1 (ITS1) ribosomal DNA by nested-PCR and the β-tubulin gene by TaqMan real-time PCR. Results: Seven (15.2%) out of 46 specimens were positive in direct examination and showed branched septate hyphae; 11 (23.9%) had positive culture including eight (72.7%) A. flavus and three (27.3%) A. fumigatus; 22 (47.8%) had positive nested-PCR and eight (17.4%) had positive real-time PCR. The incidence of invasive pulmonary aspergillosis (IPA) in these patients included proven IPA in 1 (2.2%), probable IPA in 10 (21.7%), possible IPA in 19 (41.3%) and not IPA in 16 cases (34.8%). Conclusions: The incidence of IPA in allogeneic HSCT and patients with hematological malignancies was relatively high and A. flavus was the most common cause of PA. As molecular methods had higher sensitivity, it may be useful as screening methods in HSCT and patients with hematological malignancies, or to determine when empirical antifungal therapy can be withheld. PMID:25763133

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Transcription arrest caused by long nascent RNA chains

DEFF Research Database (Denmark)

Bentin, Thomas; Cherny, Dmitry; Larsen, H Jakob

2004-01-01

on transcription. Using phage T3 RNA polymerase (T3 RNAP) and covalently closed circular (cccDNA) DNA templates that did not contain any strong termination signal, transcription was severely inhibited after a short period of time. Less than approximately 10% residual transcriptional activity remained after 10 min......The transcription process is highly processive. However, specific sequence elements encoded in the nascent RNA may signal transcription pausing and/or termination. We find that under certain conditions nascent RNA chains can have a strong and apparently sequence-independent inhibitory effect...... of incubation. The addition of RNase A almost fully restored transcription in a dose dependent manner. Throughout RNase A rescue, an elongation rate of approximately 170 nt/s was maintained and this velocity was independent of RNA transcript length, at least up to 6 kb. Instead, RNase A rescue increased...

Identification of a methylated oligoribonucleotide as a potent inhibitor of HIV-1 reverse transcription complex.

Science.gov (United States)

Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc

2011-07-01

Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.

Curaxin CBL0100 Blocks HIV-1 Replication and Reactivation through Inhibition of Viral Transcriptional Elongation

Directory of Open Access Journals (Sweden)

Maxime J. Jean

2017-10-01

Full Text Available Despite combination antiretroviral therapy (cART, acquired immunodeficiency syndrome (AIDS, predominantly caused by the human immunodeficiency virus type 1 (HIV-1, remains incurable. The barrier to a cure lies in the virus' ability to establish a latent infection in HIV/AIDS patients. Unsurprisingly, efforts for a sterilizing cure have focused on the “shock and kill” strategy using latency-reversing agents (LRAs to complement cART in order to eliminate these latent reservoirs. However, this method faces numerous challenges. Recently, the “block and lock” strategy has been proposed. It aims to reinforce a deep state of latency and prevent sporadic reactivation (“blip” of HIV-1 using latency-promoting agents (LPAs for a functional cure. Our studies of curaxin 100 (CBL0100, a small-molecule targeting the facilitates chromatin transcription (FACT complex, show that it blocks both HIV-1 replication and reactivation in in vitro and ex vivo models of HIV-1. Mechanistic investigation elucidated that CBL0100 preferentially targets HIV-1 transcriptional elongation and decreases the occupancy of RNA Polymerase II (Pol II and FACT at the HIV-1 promoter region. In conclusion, CBL0100 is a newly identified inhibitor of HIV-1 transcription that can be used as an LPA in the “block and lock” cure strategy.

Reg IV is a direct target of intestinal transcriptional factor CDX2 in gastric cancer.

Directory of Open Access Journals (Sweden)

Yutaka Naito

Full Text Available REG4, which encodes Reg IV protein, is a member of the calcium-dependent lectin superfamily and potent activator of the epidermal growth factor receptor/Akt/activator protein-1 signaling pathway. Several human cancers overexpress Reg IV, and Reg IV expression is associated with intestinal phenotype differentiation. However, regulation of REG4 transcription remains unclear. In the present study, we investigated whether CDX2 regulates Reg IV expression in gastric cancer (GC cells. Expression of Reg IV and CDX2 was analyzed by Western blot and quantitative reverse transcription-polymerase chain reaction in 9 GC cell lines and 2 colon cancer cell lines. The function of the 5'-flanking region of the REG4 gene was characterized by luciferase assay. In 9 GC cell lines, endogenous Reg IV and CDX2 expression were well correlated. Using an estrogen receptor-regulated form of CDX2, rapid induction of Reg IV expression was observed in HT-29 cells. Reporter gene assays revealed an important role in transcription for consensus CDX2 DNA binding elements in the 5'-flanking region of the REG4 gene. Chromatin immunoprecipitation assays showed that CDX2 binds directly to the 5'-flanking region of REG4. These results indicate that CDX2 protein directly regulates Reg IV expression.

The influence of nest-site characteristics on the nesting success of ...

African Journals Online (AJOL)

Choice of nest site has important consequences for nest survival. We examined nest-site characteristics relative to nest success in Karoo Prinias breeding in coastal dwarf shrubland, where high nest predation is the main cause of nest failure. Initially, we compared nests that failed during the building, laying, incubation and ...

A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

Science.gov (United States)

Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

2016-01-01

To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

Seasonal abundance and potential of Japanese encephalitis virus infection in mosquitoes at the nesting colony of ardeid birds, Thailand.

Science.gov (United States)

Changbunjong, Tanasak; Weluwanarak, Thekhawet; Taowan, Namaoy; Suksai, Parut; Chamsai, Tatiyanuch; Sedwisai, Poonyapat

2013-03-01

To investigate the abundance and seasonal dynamics of mosquitoes, and to detect Japanese encephalitis virus (JEV) in these mosquitoes at the nesting colony of ardeid birds. Mosquitoes were collected bimonthly from July 2009 to May 2010 by Centers for Disease Control. Light traps and dry ice, as a source of CO2, were employed to attract mosquitoes. Mosquitoes were first identified, pooled into groups of upto 50 mosquitoes by species, and tested for JEV infection by viral isolation and reverse transcriptase polymerase chain reaction. A total of 20 370 mosquitoes comprising 14 species in five genera were collected. The five most abundant mosquito species collected were Culex tritaeniorhynchus (95.46%), Culex vishnui (2.68%), Culex gelidus (0.72%), Anopheles peditaeniatus (0.58%) and Culex quinquefasciatus (0.22%). Mosquito peak densities were observed in July. All of 416 mosquito pools were negative for JEV. This study provides new information about mosquito species and status of JEV infection in mosquitoes in Thailand. Further study should be done to continue a close survey for the presence of this virus in the ardeid birds.

Do artificial nests simulate nest success of greater sage-grouse?

OpenAIRE

Dinkins, Jonathan B.; Conover, Michael R.; Mabray, Scott T.

2013-01-01

Artificial nests have been used to study factors affecting nest success because researchers can manipulate them more than natural bird nests. Many researchers have questioned the validity of generalizing the results from artificial nests onto naturally occurring nests. Other studies have assessed the validity of artificial nest studies by simultaneously comparing overall depredation or daily survival rates, depredation timing, predator species, or habitat characteristics of artificial and nat...

Role of the σ⁵⁴ Activator Interacting Domain in Bacterial Transcription Initiation

Energy Technology Data Exchange (ETDEWEB)

Siegel, Alexander R. [Univ. of California, Berkeley, CA (United States); Wemmer, David E. [Univ. of California, Berkeley, CA (United States)

2016-10-11

Bacterial sigma factors are subunits of RNA polymerase that direct the holoenzyme to specific sets of promoters in the genome and are a central element of regulating transcription. Most polymerase holoenzymes open the promoter and initiate transcription rapidly after binding. However, polymerase containing the members of the σ⁵⁴ family must be acted on by a transcriptional activator before DNA opening and initiation occur. A key domain in these transcriptional activators forms a hexameric AAA + ATPase that acts through conformational changes brought on by ATP hydrolysis. Contacts between the transcriptional activator and σ⁵⁴ are primarily made through an N-terminal σ⁵⁴ activator interacting domain (AID). To better understand this mechanism of bacterial transcription initiation, we characterized the σ⁵⁴ AID by NMR spectroscopy and other biophysical methods and show that it is an intrinsically disordered domain in σ⁵⁴ alone. In this paper, we identified a minimal construct of the Aquifex aeolicus σ⁵⁴ AID that consists of two predicted helices and retains native-like binding affinity for the transcriptional activator NtrC1. Using the NtrC1 ATPase domain, bound with the non-hydrolyzable ATP analog ADP-beryllium fluoride, we studied the NtrC1–σ⁵⁴ AID complex using NMR spectroscopy. We show that the σ⁵⁴ AID becomes structured after associating with the core loops of the transcriptional activators in their ATP state and that the primary site of the interaction is the first predicted helix. Finally, understanding this complex, formed as the first step toward initiation, will help unravel the mechanism of σ⁵⁴ bacterial transcription initiation.

Pan-Cancer Mutational and Transcriptional Analysis of the Integrator Complex

Directory of Open Access Journals (Sweden)

Antonio Federico

2017-04-01

Full Text Available The integrator complex has been recently identified as a key regulator of RNA Polymerase II-mediated transcription, with many functions including the processing of small nuclear RNAs, the pause-release and elongation of polymerase during the transcription of protein coding genes, and the biogenesis of enhancer derived transcripts. Moreover, some of its components also play a role in genome maintenance. Thus, it is reasonable to hypothesize that their functional impairment or altered expression can contribute to malignancies. Indeed, several studies have described the mutations or transcriptional alteration of some Integrator genes in different cancers. Here, to draw a comprehensive pan-cancer picture of the genomic and transcriptomic alterations for the members of the complex, we reanalyzed public data from The Cancer Genome Atlas. Somatic mutations affecting Integrator subunit genes and their transcriptional profiles have been investigated in about 11,000 patients and 31 tumor types. A general heterogeneity in the mutation frequencies was observed, mostly depending on tumor type. Despite the fact that we could not establish them as cancer drivers, INTS7 and INTS8 genes were highly mutated in specific cancers. A transcriptome analysis of paired (normal and tumor samples revealed that the transcription of INTS7, INTS8, and INTS13 is significantly altered in several cancers. Experimental validation performed on primary tumors confirmed these findings.

Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

Directory of Open Access Journals (Sweden)

Sérgio Monteiro de Almeida

Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

Step out of the groove : epigenetic gene control systems and engineered transcription factors

NARCIS (Netherlands)

Verschure, P.J.; Visser, A.E.; Rots, M.G.

2006-01-01

At the linear DNA level, gene activity is believed to be driven by binding of transcription factors, which subsequently recruit the RNA polymerase to the gene promoter region. However, it has become clear that transcriptional activation involves large complexes of many different proteins, which not

Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

Science.gov (United States)

Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

2014-12-01

Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

Reversible arithmetic logic unit for quantum arithmetic

DEFF Research Database (Denmark)

Thomsen, Michael Kirkedal; Glück, Robert; Axelsen, Holger Bock

2010-01-01

This communication presents the complete design of a reversible arithmetic logic unit (ALU) that can be part of a programmable reversible computing device such as a quantum computer. The presented ALU is garbage free and uses reversible updates to combine the standard reversible arithmetic...... and logical operations in one unit. Combined with a suitable control unit, the ALU permits the construction of an r-Turing complete computing device. The garbage-free ALU developed in this communication requires only 6n elementary reversible gates for five basic arithmetic-logical operations on two n......-bit operands and does not use ancillae. This remarkable low resource consumption was achieved by generalizing the V-shape design first introduced for quantum ripple-carry adders and nesting multiple V-shapes in a novel integrated design. This communication shows that the realization of an efficient reversible...

Mutations in the catalytic core or the C-terminus of murine leukemia virus (MLV) integrase disrupt virion infectivity and exert diverse effects on reverse transcription

International Nuclear Information System (INIS)

Steinrigl, Adolf; Nosek, Dagmara; Ertl, Reinhard; Guenzburg, Walter H.; Salmons, Brian; Klein, Dieter

2007-01-01

Understanding of the structures and functions of the retroviral integrase (IN), a key enzyme in the viral replication cycle, is essential for developing antiretroviral treatments and facilitating the development of safer gene therapy vehicles. Thus, four MLV IN-mutants were constructed in the context of a retroviral vector system, harbouring either a substitution in the catalytic centre, deletions in the C-terminus, or combinations of both modifications. IN-mutants were tested for their performance in different stages of the viral replication cycle: RNA-packaging; RT-activity; transient and stable infection efficiency; dynamics of reverse transcription and nuclear entry. All mutant vectors packaged viral RNA with wild-type efficiencies and displayed only slight reductions in RT-activity. Deletion of either the IN C-terminus alone, or in addition to part of the catalytic domain exerted contrasting effects on intracellular viral DNA levels, implying that IN influences reverse transcription in more than one direction

PyNEST: a convenient interface to the NEST simulator

Directory of Open Access Journals (Sweden)

Jochen M Eppler

2009-01-01

Full Text Available The neural simulation tool NEST (http://www.nest-initiative.org is a simulator for heterogeneous networks of point neurons or neurons with a small number of compartments. It aims at simulations of large neural systems with more than 10^4 neurons and 10^7 to 10^9 synapses. NEST is implemented in C++ and can be used on a large range of architectures from single-core laptops over multi-core desktop computers to super-computers with thousands of processor cores. Python (http://www.python.org is a modern programming language that has recently received considerable attention in Computational Neuroscience. Python is easy to learn and has many extension modules for scientific computing (e.g. http://www.scipy.org. In this contribution we describe PyNEST, the new user interface to NEST. PyNEST combines NEST’s efficient simulation kernel with the simplicity and flexibility of Python. Compared to NEST’s native simulation language SLI, PyNEST makes it easier to set up simulations, generate stimuli, and analyze simulation results. We describe how PyNEST connects NEST and Python and how it is implemented. With a number of examples, we illustrate how it is used.

Validated reverse transcription droplet digital PCR serves as a higher order method for absolute quantification of Potato virus Y strains.

Science.gov (United States)

Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša

2018-05-03

RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.

Interferon antagonist NSs of La Crosse virus triggers a DNA damage response-like degradation of transcribing RNA polymerase II.

Science.gov (United States)

Verbruggen, Paul; Ruf, Marius; Blakqori, Gjon; Överby, Anna K; Heidemann, Martin; Eick, Dirk; Weber, Friedemann

2011-02-04

La Crosse encephalitis virus (LACV) is a mosquito-borne member of the negative-strand RNA virus family Bunyaviridae. We have previously shown that the virulence factor NSs of LACV is an efficient inhibitor of the antiviral type I interferon system. A recombinant virus unable to express NSs (rLACVdelNSs) strongly induced interferon transcription, whereas the corresponding wt virus (rLACV) suppressed it. Here, we show that interferon induction by rLACVdelNSs mainly occurs through the signaling pathway leading from the pattern recognition receptor RIG-I to the transcription factor IRF-3. NSs expressed by rLACV, however, acts downstream of IRF-3 by specifically blocking RNA polymerase II-dependent transcription. Further investigations revealed that NSs induces proteasomal degradation of the mammalian RNA polymerase II subunit RPB1. NSs thereby selectively targets RPB1 molecules of elongating RNA polymerase II complexes, the so-called IIo form. This phenotype has similarities to the cellular DNA damage response, and NSs was indeed found to transactivate the DNA damage response gene pak6. Moreover, NSs expressed by rLACV boosted serine 139 phosphorylation of histone H2A.X, one of the earliest cellular reactions to damaged DNA. However, other DNA damage response markers such as up-regulation and serine 15 phosphorylation of p53 or serine 1524 phosphorylation of BRCA1 were not triggered by LACV infection. Collectively, our data indicate that the strong suppression of interferon induction by LACV NSs is based on a shutdown of RNA polymerase II transcription and that NSs achieves this by exploiting parts of the cellular DNA damage response pathway to degrade IIo-borne RPB1 subunits.

Transcription blockage by stable H-DNA analogs in vitro.

Science.gov (United States)

Pandey, Shristi; Ogloblina, Anna M; Belotserkovskii, Boris P; Dolinnaya, Nina G; Yakubovskaya, Marianna G; Mirkin, Sergei M; Hanawalt, Philip C

2015-08-18

DNA sequences that can form unusual secondary structures are implicated in regulating gene expression and causing genomic instability. H-palindromes are an important class of such DNA sequences that can form an intramolecular triplex structure, H-DNA. Within an H-palindrome, the H-DNA and canonical B-DNA are in a dynamic equilibrium that shifts toward H-DNA with increased negative supercoiling. The interplay between H- and B-DNA and the fact that the process of transcription affects supercoiling makes it difficult to elucidate the effects of H-DNA upon transcription. We constructed a stable structural analog of H-DNA that cannot flip into B-DNA, and studied the effects of this structure on transcription by T7 RNA polymerase in vitro. We found multiple transcription blockage sites adjacent to and within sequences engaged in this triplex structure. Triplex-mediated transcription blockage varied significantly with changes in ambient conditions: it was exacerbated in the presence of Mn(2+) or by increased concentrations of K(+) and Li(+). Analysis of the detailed pattern of the blockage suggests that RNA polymerase is sterically hindered by H-DNA and has difficulties in unwinding triplex DNA. The implications of these findings for the biological roles of triple-stranded DNA structures are discussed. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Variability in nest survival rates and implications to nesting studies

Science.gov (United States)

Klett, A.T.; Johnson, D.H.

1982-01-01

We used four reasonably large samples (83-213) of Mallard (Anas platyrhynchos) and Blue-winged Teal (A. discors) nests on an interstate highway right-of-way in southcentral North Dakota to evaluate potential biases in hatch-rate estimates. Twelve consecutive, weekly searches for nests were conducted with a cable-chain drag in 1976 and 1977. Nests were revisited at weekly intervals. Four methods were used to estimate hatch rates for the four data sets: the Traditional Method, the Mayfield Method, and two modifications of the Mayfield Method that are sometimes appropriate when daily mortality rates of nests are not constant. Hatch rates and the average age of nests at discovery declined as the interval between searches decreased, suggesting that mortality rates were not constant in our samples. An analysis of variance indicated that daily mortality rates varied with the age of nests in all four samples. Mortality was generally highest during the early laying period, moderately high during the late laying period, and lowest during incubation. We speculate that this relationship of mortality to nest age might be due to the presence of hens at nests or to differences in the vulnerability of nest sites to predation. A modification of the Mayfield Method that accounts for age-related variation in nest mortality was most appropriate for our samples. We suggest methods for conducting nesting studies and estimating nest success for species possessing similar nesting habits.

A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

Science.gov (United States)

Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

Peroxisome proliferator-activated receptor gamma recruits the positive transcription elongation factor b complex to activate transcription and promote adipogenesis

DEFF Research Database (Denmark)

Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien

2006-01-01

Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c......-Myc or MyoD. The P-TEFb complex is composed of a cyclin-dependent kinase (cdk9) subunit and a regulatory partner (cyclin T1, cyclin T2, or cyclin K). Because cdk9 has been shown to participate in differentiation processes, such as muscle cell differentiation, we studied a possible role of cdk9...... with and phosphorylation of peroxisome proliferator-activated receptor gamma (PPARgamma), which is the master regulator of this process, on the promoter of PPARgamma target genes. PPARgamma-cdk9 interaction results in increased transcriptional activity of PPARgamma and therefore increased adipogenesis....

Detection of Tumor Cell-Specific mRNA in the Peripheral Blood of Patients with Breast Cancer — Evaluation of Several Markers with Real-Time Reverse Transcription-PCR

Directory of Open Access Journals (Sweden)

Ulrich Andergassen

2013-01-01

Full Text Available It is widely known that cells from epithelial tumors, e.g., breast cancer, detach from their primary tissue and enter blood circulation. We show that the presence of circulating tumor cells (CTCs in samples of patients with primary and metastatic breast cancer can be detected with an array of selected tumor-marker-genes by reverse transcription real-time PCR. The focus of the presented work is on detecting differences in gene expression between healthy individuals and adjuvant and metastatic breast cancer patients, not an accurate quantification of these differences. Therefore, total RNA was isolated from blood samples of healthy donors and patients with primary or metastatic breast cancer after enrichment of mononuclear cells by density gradient centrifugation. After reverse transcription real-time PCR was carried out with a set of marker genes (BCSP, CK8, Her2, MGL, CK18, CK19. B2M and GAPDH were used as reference genes. Blood samples from patients with metastatic disease revealed increased cytokine gene levels in comparison to normal blood samples. Detection of a single gene was not sufficient to detect CTCs by reverse transcription real-time PCR. Markers used here were selected based on a recent study detecting cancer cells on different protein levels. The combination of such a marker array leads to higher and more specific discovery rates, predominantly in metastatic patients. Identification of CTCs by PCR methods may lead to better diagnosis and prognosis and could help to choose an adequate therapy.

Nucleic Acid Analogue Induced Transcription of Double Stranded DNA

DEFF Research Database (Denmark)

1998-01-01

RNA is transcribed from a double stranded DNA template by forming a complex by hybridizing to the template at a desired transcription initiation site one or more oligonucleic acid analogues of the PNA type capable of forming a transcription initiation site with the DNA and exposing the complex...... to the action of a DNA dependant RNA polymerase in the presence of nucleoside triphosphates. Equal length transcripts may be obtained by placing a block to transcription downstream from the initiation site or by cutting the template at such a selected location. The initiation site is formed by displacement...... of one strand of the DNA locally by the PNA hybridization....

Transcription of human 7S K DNA in vitro and in vivo is exclusively controlled by an upstream promoter

Energy Technology Data Exchange (ETDEWEB)

Kleinert, H.; Benecke, B.J.

1988-02-25

The authors have analyzed the transcription of a recently isolated human 7S K RNA gene in vitro and in vivo. In contrast to hitherto characterized class III genes (genes transcribed by RNA polymerase III), the coding sequence of this gene is not required for faithful and efficient transcription by RNA polymerase III. In fact, a procaryotic vector DNA sequence was efficiently transcribed by RNA polymerase III under the control of the 7S K RNA gene upstream sequence in vitro and in vivo. S/sub 1/-nuclease protection analyses confirmed that the 7S K 5'flanking sequence was sufficient for accurate transcription initiation. These data demonstrate that 7S K DNA represents a novel class III gene, the promoter elements of which are located outside the coding sequence.