A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

Directory of Open Access Journals (Sweden)

Meng Shuang

2010-06-01

Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

NARCIS (Netherlands)

Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

2010-01-01

Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

Science.gov (United States)

Mo, Yiqun; Wan, Rong; Zhang, Qunwei

2012-01-01

Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

Science.gov (United States)

Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

2014-09-01

Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

Science.gov (United States)

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-06-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

Science.gov (United States)

Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

2005-01-01

Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

DEFF Research Database (Denmark)

Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

2013-01-01

Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

Science.gov (United States)

Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

2014-01-01

Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

Science.gov (United States)

Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

2008-10-01

The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

Directory of Open Access Journals (Sweden)

Ana Luiza Chaves Valadão

2015-06-01

Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

Science.gov (United States)

Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

2003-01-01

Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

OpenAIRE

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-01-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

OpenAIRE

Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui

2010-01-01

Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...

HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

DEFF Research Database (Denmark)

Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran

2017-01-01

BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

Energy Technology Data Exchange (ETDEWEB)

Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T

2007-04-11

We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

OpenAIRE

DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

2012-01-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

Comparison of the performance in detection of HPV infections between the high-risk HPV genotyping real time PCR and the PCR-reverse dot blot assays.

Science.gov (United States)

Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun

2018-01-01

A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.

Evaluation of a duplex reverse-transcription real-time PCR assay for the detection of encephalomyocarditis virus.

Science.gov (United States)

Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D

2018-06-01

We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

International Nuclear Information System (INIS)

Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

2004-01-01

Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

Directory of Open Access Journals (Sweden)

Nike Susanti

2016-07-01

Polio Vaccine into Vaccine-Derived Poliovirus still continue. Since 1991, WHO has developedAcute Flaccid Paralysis (AFP laboratory based surveillance. In 2014, the polioviruses identification by real-timeReverse Transcriptase Polymerase Chain Reaction (rRT-PCR, has been introduced to National Polio Laboratory(NPL Center for Biomedical and Basic Technology of Health. The objective of the rRT-PCR application is to havefaster and better diagnostic methods to monitor the circulation and mutation of polio viruses.Methods: Isolate tested by rRT-PCR using a combination of primers and probe mentioned by WHO manual.The viral RNA is converted to cDNA using reverse transcriptase and amplified in a PCR reaction using Taqpolymerase. The PCR products are detected and identified by hybridization with specific probes. The combinationof primers and probes will result in the serotype identification and intratypic differentiation of poliovirus isolates.Results: In 2014 NPL Jakarta received 604 AFP cases through the surveillance system, five cases foundpositive for polio viruses by culture. All of the specimens were positive for polio vaccine viruses. Twocases were polio virus type P2 (40%, one cases polio virus type P1 (20%, 1 case polio virus type P3(20% and one case mix polio viruses type P1+P2 (20%.Conclusion: The real-time PCR assay was able to help the identification of polio viruses rapidly in Jakartalab. The test can be utilized for monitoring the population routinely immunized with OPV. (Health ScienceJournal of Indonesia 2016;7:27-31Keywords: ITD, Poliovirus, Identification, rRT-PCR

Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

International Nuclear Information System (INIS)

Bavand, M.R.; Laub, O.

1988-01-01

Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

Directory of Open Access Journals (Sweden)

Ajay Kumar

2010-01-01

Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

Directory of Open Access Journals (Sweden)

Qin E-de

2010-06-01

Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

Comparison of multiplex reverse transcription-PCR-enzyme ...

African Journals Online (AJOL)

Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

DEFF Research Database (Denmark)

Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

2003-01-01

A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

Science.gov (United States)

Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

2017-10-01

Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

Science.gov (United States)

Spackman, Erica; Suarez, David L

2005-01-01

Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

Immune pressure analysis of protease and reverse transcriptase ...

African Journals Online (AJOL)

/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

Science.gov (United States)

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

Science.gov (United States)

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Performance of PCR-reverse blot hybridization assay for detection of rifampicin-resistant Mycobacterium leprae.

Science.gov (United States)

Wang, Hye-young; Kim, Hyunjung; Kim, Yeun; Bang, Hyeeun; Kim, Jong-Pill; Hwang, Joo Hwan; Cho, Sang-Nae; Kim, Tae Ue; Lee, Hyeyoung

2015-10-01

Drug resistance in Mycobacterium leprae is a significant problem in countries where leprosy is endemic. A sensitive, specific, and high-throughput reverse blot hybridization assay (REBA) for the detection of genotypic resistance to rifampicin (RIF) was designed and evaluated. It has been shown that resistance to RIF in M. leprae involves mutations in the rpoB gene encoding the -subunit of the RNA polymerase. The PCR-REBA simultaneously detects both 6 wild-type regions and 5 different mutations (507 AGC, 513 GTG, 516 TAT, 531 ATG, and 531 TTC) including the most prevalent mutations at positions 507 and 531. Thirty-one clinical isolates provided by Korea Institute of Hansen-s Disease were analyzed by PCR-REBA with RIF resistance of rpoB gene. As a result, missense mutations at codons 507 AGC and 531 ATG with 2-nucleotide substitutions were found in one sample, and a missense mutation at codon 516 TAT and ΔWT6 (deletion of 530-534) was found in another sample. These cases were confirmed by DNA sequence analysis. This rapid, simple, and highly sensitive assay provides a practical alternative to sequencing for genotypic evaluation of RIF resistance in M. leprae.

Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

Directory of Open Access Journals (Sweden)

FIGUEIREDO Luiz Tadeu Moraes

1997-01-01

Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression.

Science.gov (United States)

Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong

2013-01-01

In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

DEFF Research Database (Denmark)

Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

2004-01-01

Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...

RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

DEFF Research Database (Denmark)

Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

2003-01-01

A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.

Science.gov (United States)

Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V

2011-12-20

Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

DEFF Research Database (Denmark)

Munch, M.; Nielsen, L.P.; Handberg, Kurt

2001-01-01

A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

International Nuclear Information System (INIS)

Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong

2007-01-01

The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation

In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

Energy Technology Data Exchange (ETDEWEB)

Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn

2007-04-06

The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.

Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M

2018-01-01

Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

International Nuclear Information System (INIS)

Zhu Hanneng; Chen Wenying; Xiong Sidong

2000-01-01

Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

International Nuclear Information System (INIS)

Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

1986-01-01

The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

Science.gov (United States)

Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

2018-05-03

Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

Science.gov (United States)

Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

2011-07-01

Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase.

Science.gov (United States)

Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano

2017-01-17

Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

LENUS (Irish Health Repository)

Menton, John F

2007-01-01

BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

DEFF Research Database (Denmark)

Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

2012-01-01

Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?

Science.gov (United States)

Nolan, David

2005-01-01

Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.

Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

International Nuclear Information System (INIS)

Lina MR; Dadang S; Budiman Bela

2004-01-01

Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

International Nuclear Information System (INIS)

Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

2008-01-01

Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡

Science.gov (United States)

Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

2011-01-01

Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

Improved detection limit in rapid detection of human enterovirus 71 and coxsackievirus A16 by a novel reverse transcription-isothermal multiple-self-matching-initiated amplification assay.

Science.gov (United States)

Ding, Xiong; Nie, Kai; Shi, Lei; Zhang, Yong; Guan, Li; Zhang, Dan; Qi, Shunxiang; Ma, Xuejun

2014-06-01

Rapid detection of human enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) is important in the early phase of hand-foot-and-mouth disease (HFMD). In this study, we developed and evaluated a novel reverse transcription-isothermal multiple-self-matching-initiated amplification (RT-IMSA) assay for the rapid detection of EV71 and CVA16 by use of reverse transcriptase, together with a strand displacement DNA polymerase. Real-time RT-IMSA assays using a turbidimeter and visual RT-IMSA assays to detect EV71 and CVA16 were established and completed in 1 h, and the reported corresponding real-time reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assays targeting the same regions of the VP1 gene were adopted as parallel tests. Through testing VP1 RNAs transcribed in vitro, the real-time RT-IMSA assays exhibited better linearity of quantification, with R(2) values of 0.952 (for EV71) and 0.967 (for CVA16), than the real-time RT-LAMP assays, which had R(2) values of 0.803 (for EV71) and 0.904 (for CVA16). Additionally, the detection limits of the real-time RT-IMSA assays (approximately 937 for EV71 and 67 for CVA16 copies/reaction) were higher than those of real-time RT-LAMP assays (approximately 3,266 for EV71 and 430 for CVA16 copies/reaction), and similar results were observed in the visual RT-IMSA assays. The new approaches also possess high specificities for the corresponding targets, with no cross-reactivity observed. In clinical assessment, compared to commercial reverse transcription-quantitative PCR (qRT-PCR) kits, the diagnostic sensitivities of the real-time RT-IMSA assays (96.4% for EV71 and 94.6% for CVA16) were higher than those of the real-time RT-LAMP assays (91.1% for EV71 and 90.8% for CVA16). The visual RT-IMSA assays also exhibited the same results. In conclusion, this proof-of-concept study suggests that the novel RT-IMSA assay is superior to the RT-LAMP assay in terms of detection limit and has the potential to rapidly detect EV71

Reverse transcriptase inhibitors as microbicides.

Science.gov (United States)

Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido

2012-01-01

The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

Directory of Open Access Journals (Sweden)

Edward J. Steele

2017-11-01

Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

Science.gov (United States)

Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

2017-02-01

Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

Multiplexed Molecular Assays for Rapid Rule-Out of Foot-and-Mouth Disease

Energy Technology Data Exchange (ETDEWEB)

Lenhoff, R; Naraghi-Arani, P; Thissen, J; Olivas, J; Carillo, C; Chinn, C; Rasmussen, M; Messenger, S; Suer, L; Smith, S M; Tammero, L; Vitalis, E; Slezak, T R; Hullinger, P J; Hindson, B J; Hietala, S; Crossley, B; Mcbride, M

2007-06-26

A nucleic acid-based multiplexed assay was developed that combines detection of foot-and-mouth disease virus (FMDV) with rule-out assays for two other foreign animal diseases and four domestic animal diseases that cause vesicular or ulcerative lesions indistinguishable from FMDV infection in cattle, sheep and swine. The FMDV 'look-alike' diagnostic assay panel contains five PCR and twelve reverse transcriptase PCR (RT-PCR) signatures for a total of seventeen simultaneous PCR amplifications for seven diseases plus incorporating four internal assay controls. It was developed and optimized to amplify both DNA and RNA viruses simultaneously in a single tube and employs Luminex{trademark} liquid array technology. Assay development including selection of appropriate controls, a comparison of signature performance in single and multiplex testing against target nucleic acids, as well of limits of detection for each of the individual signatures is presented. While this assay is a prototype and by no means a comprehensive test for FMDV 'look-alike' viruses, an assay of this type is envisioned to have benefit to a laboratory network in routine surveillance and possibly for post-outbreak proof of freedom from foot-and-mouth disease.

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

Science.gov (United States)

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus.

Science.gov (United States)

Guionie, O; Toquin, D; Sellal, E; Bouley, S; Zwingelstein, F; Allée, C; Bougeard, S; Lemière, S; Eterradossi, N

2007-02-01

Avian metapneumovirus (AMPV) is an important pathogen causing respiratory diseases and egg drops in several avian species. Four AMPV subgroups have been identified. The laboratory diagnosis of AMPV infections relies on serological methods, on labour-intensive virus isolation procedures, and on recently developed subgroup specific reverse transcription PCR (RT-PCR) protocols. In the present study, both the specificity and sensitivity of a commercial real-time reverse transcription PCR (RRT-PCR) for the detection and identification of the four AMPV subgroups were evaluated. Fifteen non-AMPV avian viruses belonging to 7 genera and 32 AMPV belonging to the 4 subgroups were tested. No non-AMPV virus was detected, whereas all AMPV viruses were identified in agreement with their previous molecular and antigenic subgroup assignment. The sensitivity and quantitating ability of the RRT-PCR assay were determined using serial dilutions of RNA derived either from AMPV virus stocks or from runoff transcripts. In all cases, linear dose/responses were observed. The detection limits of the different subgroups ranged from 500 to 5000 RNA copies and from 0.03 to 3.16TCID50/ml. The results were reproducible under laboratory conditions, thus showing that quantitative RRT-PCR is a new and powerful tool for the rapid and sensitive detection, identification and quantitation of AMPVs.

Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

Science.gov (United States)

Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

2015-10-01

Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

Science.gov (United States)

Zhao, Chen; Pyle, Anna Marie

2017-12-01

The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

Science.gov (United States)

Collins, Kathleen; Nilsen, Timothy W

2013-08-01

Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

Science.gov (United States)

Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

1972-01-01

Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

Science.gov (United States)

Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

2007-10-01

Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

Science.gov (United States)

Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

2003-12-01

A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

Directory of Open Access Journals (Sweden)

Anna Figueiredo

2006-11-01

Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Reverse-Transcriptase PCR Detection of Leptospira: Absence of Agreement with Single-Specimen Microscopic Agglutination Testing.

Science.gov (United States)

Waggoner, Jesse J; Balassiano, Ilana; Mohamed-Hadley, Alisha; Vital-Brazil, Juliana Magalhães; Sahoo, Malaya K; Pinsky, Benjamin A

2015-01-01

Reference diagnostic tests for leptospirosis include nucleic acid amplification tests, bacterial culture, and microscopic agglutination testing (MAT) of acute and convalescent serum. However, clinical laboratories often do not receive paired specimens. In the current study, we tested serum samples using a highly sensitive real-time nucleic acid amplification test for Leptospira and compared results to MAT performed on the same specimens. 478 serum samples from suspected leptospirosis cases in Rio de Janeiro were tested using a real-time RT-PCR for the diagnosis of leptospirosis, malaria and dengue (the Lepto-MD assay). The Lepto-MD assay detects all species of Leptospira (saprophytic, intermediate, and pathogenic), and in the current study, we demonstrate that this assay amplifies both Leptospira RNA and DNA. Dengue virus RNA was identified in 10 patients, and no cases of malaria were detected. A total of 65 samples (13.6%) were positive for Leptospira: 35 samples (7.3%) in the Lepto-MD assay, 33 samples (6.9%) by MAT, and 3 samples tested positive by both (kappa statistic 0.02). Poor agreement between methods was consistent regardless of the titer used to define positive MAT results or the day of disease at sample collection. Leptospira nucleic acids were detected in the Lepto-MD assay as late as day 22, and cycle threshold values did not differ based on the day of disease. When Lepto-MD assay results were added to the MAT results for all patients in 2008 (n=818), the number of detected leptospirosis cases increased by 30.4%, from 102 (12.5%) to 133 (16.3%). This study demonstrates a lack of agreement between nucleic acid detection of Leptospira and single-specimen MAT, which may result from the clearance of bacteremia coinciding with the appearance of agglutinating antibodies. A combined testing strategy for acute leptospirosis, including molecular and serologic testing, appears necessary to maximize case detection.

Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2009-07-01

HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

2013-11-01

Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

Directory of Open Access Journals (Sweden)

Hackett James R

2007-08-01

Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

DEFF Research Database (Denmark)

Lundgren, Jens

2008-01-01

BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

Improved Detection of Lassa Virus by Reverse Transcription-PCR Targeting the 5′ Region of S RNA▿

OpenAIRE

Ölschläger, Stephan; Lelke, Michaela; Emmerich, Petra; Panning, Marcus; Drosten, Christian; Hass, Meike; Asogun, Danny; Ehichioya, Deborah; Omilabu, Sunday; Günther, Stephan

2010-01-01

The method of choice for the detection of Lassa virus is reverse transcription (RT)-PCR. However, the high degree of genetic variability of the virus poses a problem with the design of RT-PCR assays that will reliably detect all strains. Recently, we encountered difficulties in detecting some strains from Liberia and Nigeria in a commonly used glycoprotein precursor (GPC) gene-specific RT-PCR assay (A. H. Demby, J. Chamberlain, D. W. Brown, and C. S. Clegg, J. Clin. Microbiol. 32:2898-2903, 1...

A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

Directory of Open Access Journals (Sweden)

Luiz Tadeu M Figueiredo

1997-05-01

Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.

Science.gov (United States)

Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

2018-01-01

Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

A multiplex reverse transcription PCR and automated electronic microarray assay for detection and differentiation of seven viruses affecting swine.

Science.gov (United States)

Erickson, A; Fisher, M; Furukawa-Stoffer, T; Ambagala, A; Hodko, D; Pasick, J; King, D P; Nfon, C; Ortega Polo, R; Lung, O

2018-04-01

Microarray technology can be useful for pathogen detection as it allows simultaneous interrogation of the presence or absence of a large number of genetic signatures. However, most microarray assays are labour-intensive and time-consuming to perform. This study describes the development and initial evaluation of a multiplex reverse transcription (RT)-PCR and novel accompanying automated electronic microarray assay for simultaneous detection and differentiation of seven important viruses that affect swine (foot-and-mouth disease virus [FMDV], swine vesicular disease virus [SVDV], vesicular exanthema of swine virus [VESV], African swine fever virus [ASFV], classical swine fever virus [CSFV], porcine respiratory and reproductive syndrome virus [PRRSV] and porcine circovirus type 2 [PCV2]). The novel electronic microarray assay utilizes a single, user-friendly instrument that integrates and automates capture probe printing, hybridization, washing and reporting on a disposable electronic microarray cartridge with 400 features. This assay accurately detected and identified a total of 68 isolates of the seven targeted virus species including 23 samples of FMDV, representing all seven serotypes, and 10 CSFV strains, representing all three genotypes. The assay successfully detected viruses in clinical samples from the field, experimentally infected animals (as early as 1 day post-infection (dpi) for FMDV and SVDV, 4 dpi for ASFV, 5 dpi for CSFV), as well as in biological material that were spiked with target viruses. The limit of detection was 10 copies/μl for ASFV, PCV2 and PRRSV, 100 copies/μl for SVDV, CSFV, VESV and 1,000 copies/μl for FMDV. The electronic microarray component had reduced analytical sensitivity for several of the target viruses when compared with the multiplex RT-PCR. The integration of capture probe printing allows custom onsite array printing as needed, while electrophoretically driven hybridization generates results faster than conventional

Comparison of Assays for Sensitive and Reproducible Detection of Cell Culture-Infectious Cryptosporidium parvum and Cryptosporidium hominis in Drinking Water

Science.gov (United States)

Di Giovanni, George D.; Rochelle, Paul A.

2012-01-01

This study compared the three most commonly used assays for detecting Cryptosporidium sp. infections in cell culture: immunofluorescent antibody and microscopy assay (IFA), PCR targeting Cryptosporidium sp.-specific DNA, and reverse transcriptase PCR (RT-PCR) targeting Cryptosporidium sp.-specific mRNA. Monolayers of HCT-8 cells, grown in 8-well chamber slides or 96-well plates, were inoculated with a variety of viable and inactivated oocysts to assess assay performance. All assays detected infection with low doses of flow cytometry-enumerated Cryptosporidium parvum oocysts, including infection with one oocyst and three oocysts. All methods also detected infection with Cryptosporidium hominis. The RT-PCR assay, IFA, and PCR assay detected infection in 23%, 25%, and 51% of monolayers inoculated with three C. parvum oocysts and 10%, 9%, and 16% of monolayers inoculated with one oocyst, respectively. The PCR assay was the most sensitive, but it had the highest frequency of false positives with mock-infected cells and inactivated oocysts. IFA was the only infection detection assay that did not produce false positives with mock-infected monolayers. IFA was also the only assay that detected infections in all experiments with spiked oocysts recovered from Envirochek capsules following filtration of 1,000 liters of treated water. Consequently, cell culture with IFA detection is the most appropriate method for routine and sensitive detection of infectious Cryptosporidium parvum and Cryptosporidium hominis in drinking water. PMID:22038611

Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

NARCIS (Netherlands)

Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

2013-01-01

The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

Science.gov (United States)

Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

2005-03-01

We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

Science.gov (United States)

Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

2012-11-01

In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma

OpenAIRE

Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

2018-01-01

Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

Directory of Open Access Journals (Sweden)

Yong Huang

Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

Science.gov (United States)

Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

Science.gov (United States)

Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

NARCIS (Netherlands)

R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)

2013-01-01

textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

Science.gov (United States)

Ogrean, Christy; Jackson, Ben; Covino, James

2010-01-01

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

DEFF Research Database (Denmark)

Borges, Álvaro H; Lundh, Andreas; Tendal, Britta

2016-01-01

BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

Directory of Open Access Journals (Sweden)

U. Pagnini

2010-02-01

Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

9 CFR 146.13 - Testing.

Science.gov (United States)

2010-01-01

...) Enzyme-linked immunosorbent assay (ELISA). ELISA must be conducted using test kits approved by the... conducted on all ELISA-positive samples. (B) The AGID test must be conducted using reagents approved by the... time reverse transcriptase/polymerase chain reaction (RRT-PCR) assay. (A) The RRT-PCR tests must be...

Evaluation of a single-tube fluorogenic RT-PCR assay for detection of bovine respiratory syncytial virus in clinical samples

DEFF Research Database (Denmark)

Hakhverdyan, Mikhayil; Hägglund, Sara; Larsen, Lars Erik

2005-01-01

understanding of the virus. In this study, a BRSV fluorogenic reverse transcription PCR (fRT-PCR) assay, based on TaqMan principle, was developed and evaluated on a large number of clinical samples, representing various cases of natural and experimental BRSV infections. By using a single-step closed-tube format......, the turn-around time was shortened drastically and results were obtained with minimal risk for cross-contamination. According to comparative analyses, the detection limit of the fRT-PCR was on the same level as that of a nested PCR and the sensitivity relatively higher than that of a conventional PCR......, antigen ELISA (Ag-ELISA) and virus isolation (VI). Interspersed negative control samples, samples from healthy animals and eight symptomatically or genetically related viruses were all negative, confirming a high specificity of the assay. Taken together, the data indicated that the fRT-PCR assay can...

Real-time PCR assays for hepatitis B virus DNA quantification may require two different targets.

Science.gov (United States)

Liu, Chao; Chang, Le; Jia, Tingting; Guo, Fei; Zhang, Lu; Ji, Huimin; Zhao, Junpeng; Wang, Lunan

2017-05-12

Quantification Hepatitis B virus (HBV) DNA plays a critical role in the management of chronic HBV infections. However, HBV is a DNA virus with high levels of genetic variation, and drug-resistant mutations have emerged with the use of antiviral drugs. If a mutation caused a sequence mismatched in the primer or probe of a commercial DNA quantification kit, this would lead to an underestimation of the viral load of the sample. The aim of this study was to determine whether commercial kits, which use only one pair of primers and a single probe, accurately quantify the HBV DNA levels and to develop an improved duplex real-time PCR assay. We developed a new duplex real-time PCR assay that used two pairs of primers and two probes based on the conserved S and C regions of the HBV genome. We performed HBV DNA quantitative detection of HBV samples and compared the results of our duplex real-time PCR assays with the COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. The target region of the discordant sample was amplified, sequenced, and validated using plasmid. The results of the duplex real-time PCR were in good accordance with the commercial COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. We showed that two samples from Chinese HBV infections underestimated viral loads when quantified by the Roche kit because of a mismatch between the viral sequence and the reverse primer of the Roche kit. The HBV DNA levels of six samples were undervalued by duplex real-time PCR assays of the C region because of mutations in the primer of C region. We developed a new duplex real-time PCR assay, and the results of this assay were similar to the results of commercial kits. The HBV DNA level could be undervalued when using the COBAS TaqMan HBV Test version 2 for Chinese HBV infections owing to a mismatch with the primer/probe. A duplex real-time PCR assay based on the S and C regions could solve this problem to some extent.

Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

Science.gov (United States)

Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

2014-01-01

During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

Science.gov (United States)

Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

2015-10-01

The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

Science.gov (United States)

Li, Runqin; Zhang, Yinglin

2016-01-01

Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

Reverse transcriptase inhibitors as potential colorectal microbicides.

Science.gov (United States)

Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

2009-05-01

We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

Science.gov (United States)

Sivan, Sree Kanth; Manga, Vijjulatha

2010-06-01

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

NARCIS (Netherlands)

Oude Essink, B. B.; Das, A. T.; Berkhout, B.

1995-01-01

Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

DEFF Research Database (Denmark)

Kirk, Ole; Lundgren, Jens D; Pedersen, Court

2003-01-01

BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

Directory of Open Access Journals (Sweden)

Anita Chakravarti

2016-01-01

Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations.

Science.gov (United States)

Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark

2013-11-01

BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

Directory of Open Access Journals (Sweden)

Elisabeth Humphris-Narayanan

Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

Science.gov (United States)

Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

2008-10-01

Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

Molecular and biochemical toxicology

National Research Council Canada - National Science Library

Smart, Robert C; Hodgson, Ernest

2008-01-01

... Expression and Regulation 2.6.1 Northern Analysis 2.6.2 Nuclear Run-On 2.6.3 Promoter Deletion Analysis/Reporter Gene Assays 2.6.4 Microarrays 2.6.5 Reverse Transcriptase-PCR (RT-PCR) and Real-Time P...

Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

Science.gov (United States)

Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

2013-10-01

High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

Validated reverse transcription droplet digital PCR serves as a higher order method for absolute quantification of Potato virus Y strains.

Science.gov (United States)

Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša

2018-05-03

RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.

Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus

DEFF Research Database (Denmark)

Dukes, J.P.; King, D.P.; Alexandersen, Søren

2006-01-01

Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...

NMR structure of the HIV-1 reverse transcriptase thumb subdomain

Energy Technology Data Exchange (ETDEWEB)

Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

2016-12-15

The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

NARCIS (Netherlands)

Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

2004-01-01

Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

OpenAIRE

Nicolas Sluis-Cremer

2014-01-01

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

Real-Time PCR (qPCR) Primer Design Using Free Online Software

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

Visual detection of the human metapneumovirus using reverse transcription loop-mediated isothermal amplification with hydroxynaphthol blue dye

Directory of Open Access Journals (Sweden)

Wang Xiang

2012-07-01

Full Text Available Abstract Background Human metapneumovirus (hMPV is a major cause of acute respiratory infections ranging from wheezing to bronchiolitis and pneumonia in children worldwide. The objective of this study is to develop a visual reverse transcription loop-mediated isothermal amplification (RT-LAMP assay for the detection of hMPV and applied to the clinical samples. Results In this study, visual RT-LAMP assay for hMPV was performed in one step with the addition of hydroxynaphthol blue (HNB, and were used to detect respiratory samples. Six primers, including two outer primers (F3 and B3, two inner primers (FIP, BIP and two loop primers (LF and LB, were designed for hMPV N gene by the online software. Moreover, the RT-LAMP assay showed good specificity and no cross-reactivity was observed with human rhinovirus (HRV, human respiratory syncytial Virus (RSV, or influenza virus A/PR/8/34 (H1N1. The detection limit of the RT-LAMP assay was approximately ten viral RNA copies, lower than that of traditional reverse transcriptase polymerase chain reaction (RT-PCR 100 RNA copies. In the 176 nasopharyngeal samples, 23 (13.1% were conformed as hMPV positive by RT-LAMP, but 18 (10.2% positive by RT-PCR. Conclusion Compared with conventional RT-PCR, the visual hMPV RT-LAMP assay performed well in the aspect of detect time, sensitivity, specificity and visibility. It is anticipated that the RT-LAMP will be used for clinical tests in hospital or field testing during outbreaks and in emergency.

A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

Science.gov (United States)

Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

2013-10-01

A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene.

Science.gov (United States)

Kumar, Deepak; Singh, S P; Karabasanavar, Nagappa S; Singh, Rashmi; Umapathi, V

2014-11-01

Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168-776 bp) of mitochondrial cytochrome-b (cytb) gene for targeted species was designed which yielded a 609 bp PCR amplicon. Further, restriction enzyme digestion of the amplicons with Alu1 and Taq1 restriction enzymes resulted in a distinctive digestion pattern that was able to discriminate each species. The repeatability of the PCR-RFLP assay was validated ten times with consistent results observed. The developed assay can be used in routine diagnostic laboratories to differentiate the meats of closely related domestic livestock species namely cattle from buffalo and sheep from goat.

High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

Science.gov (United States)

Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

2016-01-01

Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

Science.gov (United States)

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

Science.gov (United States)

Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

2014-05-30

Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

Science.gov (United States)

Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

2013-01-01

Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

Science.gov (United States)

Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

2012-08-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

Science.gov (United States)

Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

2018-02-15

Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

Directory of Open Access Journals (Sweden)

Amanda de Faveri Pitz

2013-12-01

Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Prospective comparison of the detection rates of human enterovirus and parechovirus RT-qPCR and viral culture in different pediatric specimens

NARCIS (Netherlands)

de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A

2013-01-01

BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared

Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

Science.gov (United States)

Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

2009-01-01

We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

Diagnostic assays for active infection with human herpesvirus 6 (HHV-6).

Science.gov (United States)

Caserta, Mary T; Hall, Caroline Breese; Schnabel, Kenneth; Lofthus, Geraldine; Marino, Andrea; Shelley, Lynne; Yoo, Christina; Carnahan, Jennifer; Anderson, Linda; Wang, Hongyue

2010-05-01

Human herpesvirus 6 (HHV-6) causes ubiquitous infection in early childhood with lifelong latency or persistence. Reactivation of HHV-6 has been associated with multiple diseases including encephalitis. Chromosomal integration of HHV-6 also occurs. Previous studies have suggested that the detection of HHV-6 DNA in plasma is an accurate marker of active viral replication. We sought to determine whether PCR assays on plasma could correctly differentiate between primary HHV-6 infection, chromosomal integration of HHV-6 and latent HHV-6 infection. We performed qualitative PCR, real-time quantitative PCR (RQ-PCR), and reverse-transcriptase PCR (RT-PCR) assays on samples of peripheral and cord blood mononuclear cells, as well as plasma, from groups of subjects with well defined HHV-6 infection, including subjects with chromosomally integrated HHV-6. The detection of HHV-6 DNA in plasma was 92% sensitive compared to viral isolation for the identification of primary infection with HHV-6. All plasma samples from infants with chromosomally integrated HHV-6 had HHV-6 DNA detectable in plasma while only 5.6% were positive by RT-PCR. The specificity of plasma PCR for active replication of HHV-6 was 84% compared to viral culture while the specificity of RT-PCR was 98%. Our results demonstrate that qualitative or quantitative PCR of plasma is insufficient to distinguish between active viral replication and chromosomal integration with HHV-6. We found a higher specificity of RT-PCR performed on PBMC samples compared to PCR or RQ-PCR performed on plasma when evaluating samples for active HHV-6 replication. Copyright 2010 Elsevier B.V. All rights reserved.

Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

Energy Technology Data Exchange (ETDEWEB)

Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

2007-07-26

A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

Science.gov (United States)

Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

2016-01-01

Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

Nicolas Sluis-Cremer

2013-11-01

Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

A MIQE-compliant real-time PCR assay for Aspergillus detection.

Directory of Open Access Journals (Sweden)

Gemma L Johnson

Full Text Available The polymerase chain reaction (PCR is widely used as a diagnostic tool in clinical laboratories and is particularly effective for detecting and identifying infectious agents for which routine culture and microscopy methods are inadequate. Invasive fungal disease (IFD is a major cause of morbidity and mortality in immunosuppressed patients, and optimal diagnostic criteria are contentious. Although PCR-based methods have long been used for the diagnosis of invasive aspergillosis (IA, variable performance in clinical practice has limited their value. This shortcoming is a consequence of differing sample selection, collection and preparation protocols coupled with a lack of standardisation of the PCR itself. Furthermore, it has become clear that the performance of PCR-based assays in general is compromised by the inadequacy of experimental controls, insufficient optimisation of assay performance as well as lack of transparency in reporting experimental details. The recently published "Minimum Information for the publication of real-time Quantitative PCR Experiments" (MIQE guidelines provide a blueprint for good PCR assay design and unambiguous reporting of experimental detail and results. We report the first real-time quantitative PCR (qPCR assay targeting Aspergillus species that has been designed, optimised and validated in strict compliance with the MIQE guidelines. The hydrolysis probe-based assay, designed to target the 18S rRNA DNA sequence of Aspergillus species, has an efficiency of 100% (range 95-107%, a dynamic range of at least six orders of magnitude and limits of quantification and detection of 6 and 0.6 Aspergillus fumigatus genomes, respectively. It does not amplify Candida, Scedosporium, Fusarium or Rhizopus species and its clinical sensitivity is demonstrated in histological material from proven IA cases, as well as concordant PCR and galactomannan data in matched broncho-alveolar lavage and blood samples. The robustness

2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

International Nuclear Information System (INIS)

Starnes, M.C.

1988-01-01

2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

Directory of Open Access Journals (Sweden)

Warrilow David

2008-12-01

Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

Literature Reference for Influenza H5N1 (Emerging Infectious Diseases. 2005. 11(8): 1303–1305)

Science.gov (United States)

Procedures are described for analysis of clinical samples and may be adapted for assessment of solid, particulate, aerosol, liquid and water samples. This is a two-step, real-time reverse transcriptase-PCR multiplex assay.

Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

Science.gov (United States)

Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

2016-10-01

Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples，95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

Science.gov (United States)

Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

2011-01-01

Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

Development and validation of a quantitative PCR assay for Ichthyophonus spp.

Science.gov (United States)

White, Vanessa C; Morado, J Frank; Crosson, Lisa M; Vadopalas, Brent; Friedman, Carolyn S

2013-04-29

Members of the genus Ichthyophonus are trophically transmitted, cosmopolitan parasites that affect numerous fish species worldwide. A quantitative PCR (qPCR) assay specific for genus Ichthyophonus 18S ribosomal DNA was developed for parasite detection and surveillance. The new assay was tested for precision, repeatability, reproducibility, and both analytical sensitivity and specificity. Diagnostic sensitivity and specificity were estimated using tissue samples from a wild population of walleye pollock Theragra chalcogramma. Ichthyophonus sp. presence in tissue samples was determined by qPCR, conventional PCR (cPCR), and histology. Parasite prevalence estimates varied depending upon the detection method employed and tissue type tested. qPCR identified the greatest number of Ichthyophonus sp.-positive cases when applied to walleye pollock skeletal muscle. The qPCR assay proved sensitive and specific for Ichthyophonus spp. DNA, but like cPCR, is only a proxy for infection. When compared to cPCR, qPCR possesses added benefits of parasite DNA quantification and a 100-fold increase in analytical sensitivity. Because this novel assay is specific for known members of the genus, it is likely appropriate for detecting Ichthyophonus spp. DNA in various hosts from multiple regions. However, species-level identification and isotype variability would require DNA sequencing. In addition to distribution and prevalence applications, this assay could be modified and adapted for use with zooplankton or environmental samples. Such applications could aid in investigating alternate routes of transmission and life history strategies typical to members of the genus Ichthyophonus.

Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

Science.gov (United States)

Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

1996-11-01

A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle

DEFF Research Database (Denmark)

Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

1999-01-01

A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...

Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

Science.gov (United States)

Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

2002-12-01

Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

Development and evaluation of a nested-PCR assay for Senecavirus A diagnosis.

Science.gov (United States)

Feronato, Cesar; Leme, Raquel A; Diniz, Jaqueline A; Agnol, Alais Maria Dall; Alfieri, Alice F; Alfieri, Amauri A

2018-02-01

Senecavirus A (SVA) has been associated with vesicular disease in weaned and adult pigs and with high mortality of newborn piglets. This study aimed to establish a nested-PCR assay for the routine diagnosis of SVA infection. Tissue samples (n = 177) were collected from 37 piglets of 18 pig farms located in four different Brazilian states. For the nested-PCR, a primer set was defined to amplify an internal VP1 fragment of 316 bp of SVA genome. Of the 37 piglets, 15 (40.5%) and 23 (62.2%) were positive for the SVA in the RT-PCR and nested-PCR assays, respectively. The SVA RNA was detected in 61/177 (34.5%) samples with the RT-PCR, while the nested-PCR assay showed 84/177 (47.5%) samples with the virus (p PCR and nested-PCR assays, respectively. Nucleotide sequencing analysis revealed similarities of 98.7-100% among SVA Brazilian strains and of 86.6-98% with SVA strains from other countries. The nested-PCR assay in this study was suitable to recover the SVA RNA in biological specimens, piglets, and/or herds that were considered as negative in the RT-PCR assay, and is proposed for the routine investigation of the SVA infection in piglets, especially when other techniques are not available or when a great number of samples has to be examined.

Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.

Science.gov (United States)

Sharma, Mamta; Saravolatz, Louis D

2013-02-01

Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

A one-step, real-time PCR assay for rapid detection of rhinovirus.

Science.gov (United States)

Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

2010-01-01

One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

NARCIS (Netherlands)

Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,

2015-01-01

BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

NARCIS (Netherlands)

Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.

2015-01-01

BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

A family-wide RT-PCR assay for detection of paramyxoviruses and application to a large-scale surveillance study.

Directory of Open Access Journals (Sweden)

Sander van Boheemen

Full Text Available Family-wide molecular diagnostic assays are valuable tools for initial identification of viruses during outbreaks and to limit costs of surveillance studies. Recent discoveries of paramyxoviruses have called for such assay that is able to detect all known and unknown paramyxoviruses in one round of PCR amplification. We have developed a RT-PCR assay consisting of a single degenerate primer set, able to detect all members of the Paramyxoviridae family including all virus genera within the subfamilies Paramyxovirinae and Pneumovirinae. Primers anneal to domain III of the polymerase gene, with the 3' end of the reverse primer annealing to the conserved motif GDNQ, which is proposed to be the active site for nucleotide polymerization. The assay was fully optimized and was shown to indeed detect all available paramyxoviruses tested. Clinical specimens from hospitalized patients that tested positive for known paramyxoviruses in conventional assays were also detected with the novel family-wide test. A high-throughput fluorescence-based RT-PCR version of the assay was developed for screening large numbers of specimens. A large number of samples collected from wild birds was tested, resulting in the detection of avian paramyxoviruses type 1 in both barnacle and white-fronted geese, and type 8 in barnacle geese. Avian metapneumovirus type C was found for the first time in Europe in mallards, greylag geese and common gulls. The single round family-wide RT-PCR assay described here is a useful tool for the detection of known and unknown paramyxoviruses, and screening of large sample collections from humans and animals.

Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2010-03-01

Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

Science.gov (United States)

Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

2017-02-01

Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

Targeted resequencing and variant validation using pxlence PCR assays

Directory of Open Access Journals (Sweden)

Frauke Coppieters

2016-01-01

Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.

Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

Directory of Open Access Journals (Sweden)

Lucianna Helene Santos

2015-11-01

Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

Multicenter Clinical Evaluation of the Alere i Respiratory Syncytial Virus Isothermal Nucleic Acid Amplification Assay.

Science.gov (United States)

Hassan, Ferdaus; Hays, Lindsay M; Bonner, Aleta; Bradford, Bradley J; Franklin, Ruffin; Hendry, Phyllis; Kaminetsky, Jed; Vaughn, Michael; Cieslak, Kristin; Moffatt, Mary E; Selvarangan, Rangaraj

2018-03-01

The Alere i respiratory syncytial virus (RSV) assay is an isothermal nucleic acid amplification test capable of detecting RSV directly from respiratory specimens, with results being available in ≤13 min after test initiation. The objective of this study was to evaluate the performance characteristics of the Alere i RSV assay in a point-of-care setting by using direct nasopharyngeal (NP) swab specimens (direct NP) and nasopharyngeal swab specimens eluted and transported in viral transport medium (VTM NP). The study was a prospective, multicenter, clinical trial conducted at 9 sites across the United States to evaluate the clinical performance of the Alere i RSV assay with respiratory specimens obtained from both children (age, 60 years). The performance of the Alere i RSV assay was compared with that of the reference method, the Prodesse ProFlu+ real-time reverse transcriptase PCR (RT-PCR) assay. All specimens with discrepant test results were tested further by a second FDA-cleared PCR assay (the Verigene respiratory virus plus nucleic acid test; Luminex Inc., TX). A total of 554 subjects with signs and symptoms of respiratory infections were enrolled, and respiratory samples were collected in this study. In comparison with the ProFlu+ real-time RT-PCR, the overall sensitivity and specificity of Alere i RSV assay for the detection of RSV were 98.6% (95% confidence interval [CI], 94.4 to 99.7%) and 98.0% (95% CI, 95.8 to 99.1%), respectively, for direct NP and 98.6% (95% CI, 94.4 to 99.7%) and 97.8% (95% CI, 95.5 to 98.9%), respectively, for VTM NP. The Alere i RSV is a highly sensitive and specific molecular assay ideal for rapid RSV detection in patients in the point-of-care setting due to its minimal hands-on time and rapid result availability. Copyright © 2018 American Society for Microbiology.

[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

Science.gov (United States)

Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

2005-07-01

To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

Directory of Open Access Journals (Sweden)

Winny Xie

2013-12-01

Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

Science.gov (United States)

Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

2015-08-01

The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

Science.gov (United States)

Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

2013-06-18

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

NARCIS (Netherlands)

Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

2011-01-01

The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

Science.gov (United States)

2007-05-08

deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

Directory of Open Access Journals (Sweden)

Dolores Bautista-España

Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus.

Science.gov (United States)

Pierce, K E; Mistry, R; Reid, S M; Bharya, S; Dukes, J P; Hartshorn, C; King, D P; Wangh, L J

2010-07-01

A novel molecular assay for the detection of foot-and-mouth disease virus (FMDV) was developed using linear-after-the-exponential polymerase chain reaction (LATE-PCR). Pilot experiments using synthetic DNA targets demonstrated the ability of LATE-PCR to quantify initial target concentration through endpoint detection. A two-step protocol involving reverse transcription (RT) followed by LATE-PCR was then used to confirm the ability of the assay to detect FMDV RNA. Finally, RT and LATE-PCR were combined in a one-step duplex assay for co-amplification of an FMDV RNA segment and an internal control comprised of an Armored RNA. In that form, each of the excess primers in the reaction mixture hybridize to their respective RNA targets during a short pre-incubation, then generate cDNA strands during a 3-min RT step at 60°C, and the resulting cDNA is amplified by LATE-PCR without intervening sample processing. The RT-LATE-PCR assay generates fluorescent signals at endpoint that are proportional to the starting number of RNA targets and can detect a range of sequence variants using a single mismatch-tolerant probe. In addition to offering improvements over current laboratory-based molecular diagnostic assays for FMDV, this new assay is compatible with a novel portable ('point-of-care') device, the BioSeeq II, designed for the rapid diagnosis of FMD in the field. © 2009 The Authors. Journal compilation © 2009 The Society for Applied Microbiology.

A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1 Strain

Directory of Open Access Journals (Sweden)

Theo P. Sloots

2009-12-01

Full Text Available Timely implementation of antiviral treatment and other public health based responses are dependent on accurate and rapid diagnosis of the novel pandemic influenza A(H1N1 strain. In this study we developed a duplex real-time PCR (RT-PCR (dFLU-TM assay for the simultaneous detection of a broad range of influenza A subtypes and specific detection of the novel H1N1 2009 pandemic strain. The assay was compared to the combined results of two previously described monoplex RT-PCR assays using 183 clinical samples and 10 seasonal influenza A isolates. Overall, the results showed that the dFLU-TM RT-PCR method is suitable for detection of influenza A, including the novel H1N1 pandemic strain, in clinical samples.

Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

DEFF Research Database (Denmark)

Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

2004-01-01

, minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

Science.gov (United States)

Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

2017-09-15

Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

Directory of Open Access Journals (Sweden)

Ravi Prakash

2014-12-01

Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

Science.gov (United States)

Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

2016-06-11

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.

Science.gov (United States)

Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge

2013-12-27

Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.

Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

OpenAIRE

Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

2008-01-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

Assay optimization for molecular detection of Zika virus

NARCIS (Netherlands)

Corman, Victor M.; Rasche, Andrea; Baronti, Cecile; Aldabbagh, Souhaib; Cadar, Daniel; Reusken, Chantal Bem; Pas, Suzan D.; Goorhuis, Abraham; Schinkel, Janke; Molenkamp, Richard; Kümmerer, Beate M.; Bleicker, Tobias; Brünink, Sebastian; Eschbach-Bludau, Monika; Eis-Hübinger, Anna M.; Koopmans, Marion P.; Schmidt-Chanasit, Jonas; Grobusch, Martin P.; de Lamballerie, Xavier; Drosten, Christian; Drexler, Jan Felix

2016-01-01

To examine the diagnostic performance of real-time reverse transcription (RT)-polymerase chain reaction (PCR) assays for Zika virus detection. We compared seven published real-time RT-PCR assays and two new assays that we have developed. To determine the analytical sensitivity of each assay, we

Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

Energy Technology Data Exchange (ETDEWEB)

Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

2009-07-01

The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

International Nuclear Information System (INIS)

Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

2009-01-01

The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

Science.gov (United States)

Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

2015-02-13

Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

International Nuclear Information System (INIS)

Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

2006-01-01

Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

Analytical and clinical evaluation of the Abbott RealTime hepatitis B sequencing assay.

Science.gov (United States)

Huh, Hee Jae; Kim, Ji-Youn; Lee, Myoung-Keun; Lee, Nam Yong; Kim, Jong-Won; Ki, Chang-Seok

2016-12-01

Long-term nucleoside analogue (NA) treatment leads to selection for drug-resistant mutations in patients undergoing hepatitis B virus (HBV) therapy. The Abbott RealTime HBV Sequencing assay (Abbott assay; Abbott Molecular Inc., Des Plaines, IL, USA) targets the reverse transcriptase region of the polymerase gene and as such has the ability to detect NA resistance-associated mutations in HBV. We evaluated the analytical performance of the Abbott assay and compared its diagnostic performance to that of a laboratory-developed nested-PCR and sequencing method. The analytical sensitivity of the Abbott assay was determined using a serially-diluted WHO International Standard. To validate the clinical performances of the Abbott assay and the laboratory-developed assay, 89 clinical plasma samples with various levels of HBV DNA were tested using both assays. The limit of detection of the Abbott assay, was 210IU/ml and it successfully detected mutations when the mutant types were present at levels ≥20%. Among 89 clinical specimens, 43 and 42 were amplification positive in the Abbott and laboratory-developed assays, respectively, with 87.6% overall agreement (78/89; 95% confidence interval [CI], 78.6-93.4). The Abbott assay failed to detect the minor mutant populations in two specimens, and therefore overall concordance was 85.3% (76/89), and the kappa value was 0.79 (95% CI, 0.67-0.90). The Abbott assay showed comparable diagnostic performance to laboratory-developed nested PCR followed by direct sequencing, and may be useful as a routine method for detecting HBV NA resistance-associated mutations in clinical laboratory settings. Copyright © 2016 Elsevier B.V. All rights reserved.

Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

Directory of Open Access Journals (Sweden)

Ma Bi

2017-10-01

Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

Effect of specific or random c-DNA priming on sensitivity of tyrosinase nested RT-PCR : Potential clinical relevance

NARCIS (Netherlands)

Calogero, A; Hospers, GAP; Timmer-Bosscha, H; Mulder, NH; Schraffordt Koops, H.

2000-01-01

The reverse transcriptase polymerase chain reaction (RT-PCR) can be of clinical relevance in identifying malignant melanoma cells in blood or tissues of patients at risk for disseminated melanoma. The diagnostic value of this marker however, is still controversial. The objective of this study was to

Detection of Anti-Hepatitis B Virus Drug Resistance Mutations Based on Multicolor Melting Curve Analysis.

Science.gov (United States)

Mou, Yi; Athar, Muhammad Ammar; Wu, Yuzhen; Xu, Ye; Wu, Jianhua; Xu, Zhenxing; Hayder, Zulfiqar; Khan, Saeed; Idrees, Muhammad; Nasir, Muhammad Israr; Liao, Yiqun; Li, Qingge

2016-11-01

Detection of anti-hepatitis B virus (HBV) drug resistance mutations is critical for therapeutic decisions for chronic hepatitis B virus infection. We describe a real-time PCR-based assay using multicolor melting curve analysis (MMCA) that could accurately detect 24 HBV nucleotide mutations at 10 amino acid positions in the reverse transcriptase region of the HBV polymerase gene. The two-reaction assay had a limit of detection of 5 copies per reaction and could detect a minor mutant population (5% of the total population) with the reverse transcriptase M204V amino acid mutation in the presence of the major wild-type population when the overall concentration was 10 4 copies/μl. The assay could be finished within 3 h, and the cost of materials for each sample was less than $10. Clinical validation studies using three groups of samples from both nucleos(t)ide analog-treated and -untreated patients showed that the results for 99.3% (840/846) of the samples and 99.9% (8,454/8,460) of the amino acids were concordant with those of Sanger sequencing of the PCR amplicon from the HBV reverse transcriptase region (PCR Sanger sequencing). HBV DNA in six samples with mixed infections consisting of minor mutant subpopulations was undetected by the PCR Sanger sequencing method but was detected by MMCA, and the results were confirmed by coamplification at a lower denaturation temperature-PCR Sanger sequencing. Among the treated patients, 48.6% (103/212) harbored viruses that displayed lamivudine monoresistance, adefovir monoresistance, entecavir resistance, or lamivudine and adefovir resistance. Among the untreated patients, the Chinese group had more mutation-containing samples than did the Pakistani group (3.3% versus 0.56%). Because of its accuracy, rapidness, wide-range coverage, and cost-effectiveness, the real-time PCR assay could be a robust tool for the detection if anti-HBV drug resistance mutations in resource-limited countries. Copyright © 2016, American Society for

Quantitative CrAssphage PCR Assays for Human Fecal ...

Science.gov (United States)

Environmental waters are monitored for fecal pollution to protect public health and water resources. Traditionally, general fecal indicator bacteria are used; however, they cannot distinguish human fecal waste from pollution from other animals. Recently, a novel bacteriophage, crAssphage, was discovered by metagenomic data mining and reported to be abundant in and closely associated with human fecal waste. To confirm bioinformatic predictions, 384 primer sets were designed along the length of the crAssphage genome. Based upon initial screening, two novel crAssphage qPCR assays (CPQ_056 and CPQ_064) were designed and evaluated in reference fecal samples and water matrices. The assays exhibited high specificities (98.6%) when tested against a large animal fecal reference library and were highly abundant in raw sewage and sewage impacted water samples. In addition, CPQ_056 and CPQ_064 assay performance was compared to HF183/BacR287 and HumM2 methods in paired experiments. Findings confirm viral crAssphage qPCR assays perform at a similar level to well established bacterial human-associated fecal source identification technologies. These new viral based assays could become important water quality management and research tools. To inform the public.

Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

NARCIS (Netherlands)

Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

2003-01-01

An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

Science.gov (United States)

Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu

2017-01-01

Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high

A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

Directory of Open Access Journals (Sweden)

Ashutosh Wadhwa

2017-01-01

Full Text Available Rabies, resulting from infection by Rabies virus (RABV and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses

Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

Czech Academy of Sciences Publication Activity Database

Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

2016-01-01

Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

Study comparing human papillomavirus (HPV) real-time multiplex PCR and Hybrid Capture II INNO-LiPA v2 HPV genotyping PCR assays

DEFF Research Database (Denmark)

Iftner, Thomas; Germ, Liesje; Swoyer, Ryan

2009-01-01

methods has not been well characterized. Clinically, cytology is used to establish possible HPV infection. We evaluated the sensitivity and specificity of HPV multiplex PCR assays compared to those of the testing scheme of the Hybrid Capture II (HCII) assay followed by an HPV PCR/line hybridization assay...... (HCII-LiPA v2). SurePath residual samples were split into two aliquots. One aliquot was subjected to HCII testing followed by DNA extraction and LiPA v2 genotyping. The second aliquot was shipped to a second laboratory, where DNA was extracted and HPV multiplex PCR testing was performed. Comparisons...... were evaluated for 15 HPV types common in both assays. A slightly higher proportion of samples tested positive by the HPV multiplex PCR than by the HCII-LiPA v2 assay. The sensitivities of the multiplex PCR assay relative to those of the HCII-LiPA v2 assay for HPV types 6, 11, 16, and 18, for example...

DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

Directory of Open Access Journals (Sweden)

Sumit Chowdhury

2016-12-01

Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

2011-01-01

We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

A novel peptide-nucleotide dual vaccine of human telomerase reverse transcriptase induces a potent cytotoxic T-cell response in vivo

International Nuclear Information System (INIS)

Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun

2007-01-01

Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers

The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients

Science.gov (United States)

Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita

2018-01-01

Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

Evaluation of the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction assay and the INFINITI® Respiratory Viral Panel Plus assay for the detection of human metapneumovirus in Kuwait.

Science.gov (United States)

Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad

2012-04-01

Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.

Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages

Science.gov (United States)

Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis

2010-01-01

Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

Science.gov (United States)

Zanetti, Maurizio

2017-02-01

Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR.

Science.gov (United States)

Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W Ian; Kabuusu, Richard M; Ferguson, Hugh; Del Pozo, Jorge; Eldar, Avi; Bacharach, Eran

2017-03-01

Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. Copyright © 2017 American Society for Microbiology.

Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR

Science.gov (United States)

Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W. Ian; Kabuusu, Richard M.; Ferguson, Hugh; del Pozo, Jorge

2016-01-01

ABSTRACT Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. PMID:27974544

Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

Science.gov (United States)

Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

2009-06-01

Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

Clinical Assessment of a Nocardia PCR-Based Assay for Diagnosis of Nocardiosis.

Science.gov (United States)

Rouzaud, Claire; Rodriguez-Nava, Véronica; Catherinot, Emilie; Méchaï, Frédéric; Bergeron, Emmanuelle; Farfour, Eric; Scemla, Anne; Poirée, Sylvain; Delavaud, Christophe; Mathieu, Daniel; Durupt, Stéphane; Larosa, Fabrice; Lengelé, Jean-Philippe; Christophe, Jean-Louis; Suarez, Felipe; Lortholary, Olivier; Lebeaux, David

2018-06-01

The diagnosis of nocardiosis, a severe opportunistic infection, is challenging. We assessed the specificity and sensitivity of a 16S rRNA Nocardia PCR-based assay performed on clinical samples. In this multicenter study (January 2014 to April 2015), patients who were admitted to three hospitals and had an underlying condition favoring nocardiosis, clinical and radiological signs consistent with nocardiosis, and a Nocardia PCR assay result for a clinical sample were included. Patients were classified as negative control (NC) (negative Nocardia culture results and proven alternative diagnosis or improvement at 6 months without anti- Nocardia treatment), positive control (PC) (positive Nocardia culture results), or probable nocardiosis (positive Nocardia PCR results, negative Nocardia culture results, and no alternative diagnosis). Sixty-eight patients were included; 47 were classified as NC, 8 as PC, and 13 as probable nocardiosis. PCR results were negative for 35/47 NC patients (74%). For the 12 NC patients with positive PCR results, the PCR assay had been performed with respiratory samples. These NC patients had chronic bronchopulmonary disease more frequently than did the NC patients with negative PCR results (8/12 patients [67%] versus 11/35 patients [31%]; P = 0.044). PCR results were positive for 7/8 PC patients (88%). There were 13 cases of probable nocardiosis, diagnosed solely using the PCR results; 9 of those patients (69%) had lung involvement (consolidation or nodule). Nocardia PCR testing had a specificity of 74% and a sensitivity of 88% for the diagnosis of nocardiosis. Nocardia PCR testing may be helpful for the diagnosis of nocardiosis in immunocompromised patients but interpretation of PCR results from respiratory samples is difficult, because the PCR assay may also detect colonization. Copyright © 2018 American Society for Microbiology.

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

International Nuclear Information System (INIS)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

2015-01-01

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

Energy Technology Data Exchange (ETDEWEB)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

2015-10-23

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

Molecular surveillance of true nontypeable Haemophilus influenzae: an evaluation of PCR screening assays.

Science.gov (United States)

Binks, Michael J; Temple, Beth; Kirkham, Lea-Ann; Wiertsema, Selma P; Dunne, Eileen M; Richmond, Peter C; Marsh, Robyn L; Leach, Amanda J; Smith-Vaughan, Heidi C

2012-01-01

Unambiguous identification of nontypeable Haemophilus influenzae (NTHi) is not possible by conventional microbiology. Molecular characterisation of phenotypically defined NTHi isolates suggests that up to 40% are Haemophilus haemolyticus (Hh); however, the genetic similarity of NTHi and Hh limits the power of simple molecular techniques such as PCR for species discrimination. Here we assess the ability of previously published and novel PCR-based assays to identify true NTHi. Sixty phenotypic NTHi isolates, classified by a dual 16S rRNA gene PCR algorithm as NTHi (n = 22), Hh (n = 27) or equivocal (n = 11), were further characterised by sequencing of the 16S rRNA and recA genes then interrogated by PCR-based assays targeting the omp P2, omp P6, lgtC, hpd, 16S rRNA, fucK and iga genes. The sequencing data and PCR results were used to define NTHi for this study. Two hpd real time PCR assays (hpd#1 and hpd#3) and the conventional iga PCR assay were equally efficient at differentiating study-defined NTHi from Hh, each with a receiver operator characteristic curve area of 0.90 [0.83; 0.98]. The hpd#1 and hpd#3 assays were completely specific against a panel of common respiratory bacteria, unlike the iga PCR, and the hpd#3 assay was able to detect below 10 copies per reaction. Our data suggest an evolutionary continuum between NTHi and Hh and therefore no single gene target could completely differentiate NTHi from Hh. The hpd#3 real time PCR assay proved to be the superior method for discrimination of NTHi from closely related Haemophilus species with the added potential for quantification of H. influenzae directly from specimens. We suggest the hpd#3 assay would be suitable for routine NTHi surveillance and to assess the impact of antibiotics and vaccines, on H. influenzae carriage rates, carriage density, and disease.

Molecular surveillance of true nontypeable Haemophilus influenzae: an evaluation of PCR screening assays.

Directory of Open Access Journals (Sweden)

Michael J Binks

Full Text Available BACKGROUND: Unambiguous identification of nontypeable Haemophilus influenzae (NTHi is not possible by conventional microbiology. Molecular characterisation of phenotypically defined NTHi isolates suggests that up to 40% are Haemophilus haemolyticus (Hh; however, the genetic similarity of NTHi and Hh limits the power of simple molecular techniques such as PCR for species discrimination. METHODOLOGY/PRINCIPAL FINDINGS: Here we assess the ability of previously published and novel PCR-based assays to identify true NTHi. Sixty phenotypic NTHi isolates, classified by a dual 16S rRNA gene PCR algorithm as NTHi (n = 22, Hh (n = 27 or equivocal (n = 11, were further characterised by sequencing of the 16S rRNA and recA genes then interrogated by PCR-based assays targeting the omp P2, omp P6, lgtC, hpd, 16S rRNA, fucK and iga genes. The sequencing data and PCR results were used to define NTHi for this study. Two hpd real time PCR assays (hpd#1 and hpd#3 and the conventional iga PCR assay were equally efficient at differentiating study-defined NTHi from Hh, each with a receiver operator characteristic curve area of 0.90 [0.83; 0.98]. The hpd#1 and hpd#3 assays were completely specific against a panel of common respiratory bacteria, unlike the iga PCR, and the hpd#3 assay was able to detect below 10 copies per reaction. CONCLUSIONS/SIGNIFICANCE: Our data suggest an evolutionary continuum between NTHi and Hh and therefore no single gene target could completely differentiate NTHi from Hh. The hpd#3 real time PCR assay proved to be the superior method for discrimination of NTHi from closely related Haemophilus species with the added potential for quantification of H. influenzae directly from specimens. We suggest the hpd#3 assay would be suitable for routine NTHi surveillance and to assess the impact of antibiotics and vaccines, on H. influenzae carriage rates, carriage density, and disease.

APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

Directory of Open Access Journals (Sweden)

Weizi Liang

Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

Multiplex real-time PCR assay for Legionella species.

Science.gov (United States)

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

DEFF Research Database (Denmark)

Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

2004-01-01

Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

Science.gov (United States)

Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

2001-07-01

Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

Science.gov (United States)

Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

2013-01-01

In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

Directory of Open Access Journals (Sweden)

Lapadula Giuseppe

2007-05-01

Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

Apoptotic properties of Citrus sudachi Hort, ex Shirai (Rutaceae ...

African Journals Online (AJOL)

Methods: 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and annexin V/propidium iodidle assay were used to test the antiproliferative activity and apoptosis of methanol extract of Citrus sudachi, respectively. Griess reaction and reverse transcriptase-polymerase chain reaction (RT-PCR) were carried ...

Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene

OpenAIRE

Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.

2012-01-01

Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...

Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

Science.gov (United States)

Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

2016-05-01

The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

Effects of exogenous ATM gene on mRNA expression of human telomerase reverse transcriptase in AT cells induced by irradiation

International Nuclear Information System (INIS)

Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong

2005-01-01

The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)

Numeric definition of the clinical performance of the nested reverse transcription-PCR for detection of hematogenous epithelial cells and correction for specific mRNA of non-target cell origin as evaluated for prostate cancer cells

NARCIS (Netherlands)

Schamhart, Denis; Swinnen, Johannes; Kurth, Karl-Heinz; Westerhof, Alex; Kusters, Ron; Borchers, Holger; Sternberg, Cora

2003-01-01

Background: Inappropriate quality management,of reverse transcription-PCR (RT-PCR) assays for the detection of blood-borne prostate cancer (PCa) cells hampers clinical conclusions. Improvement of the RT-PCR-methodology for prostate-specific, antigen (PSA) mRNA should focus on an appropriate numeric.

Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

Science.gov (United States)

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

International Nuclear Information System (INIS)

Spadafora, C.; Sciamanna, I.; Misteli, T.

2009-01-01

Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

Soil Baiting, Rapid PCR Assay and Quantitative Real Time PCR to Diagnose Late Blight of Potato in Quarantine Programs

Directory of Open Access Journals (Sweden)

Touseef Hussain

2018-05-01

Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.

Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission.

Science.gov (United States)

Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido

2013-09-01

Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

Science.gov (United States)

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

Detection of live Salmonella enterica in fresh-cut vegetables by a TaqMan-based one-step reverse transcription real-time PCR.

Science.gov (United States)

Miao, Y J; Xiong, G T; Bai, M Y; Ge, Y; Wu, Z F

2018-05-01

Fresh-cut produce is at greater risk of Salmonella contamination. Detection and early warning systems play an important role in reducing the dissemination of contaminated products. One-step Reverse Transcription Polymerase Chain Reaction (RT-qPCR) targeting Salmonella tmRNA with or without a 6-h enrichment was evaluated for the detection of Salmonella in fresh-cut vegetables after 6-h storage. LOD of one-step RT-qPCR was 1·0 CFU per ml (about 100 copies tmRNA per ml) by assessed 10-fold serially diluted RNA from 10 6 CFU per ml bacteria culture. Then, one-step RT-qPCR assay was applied to detect viable Salmonella cells in 14 fresh-cut vegetables after 6-h storage. Without enrichment, this assay could detect 10 CFU per g for fresh-cut lettuce, cilantro, spinach, cabbage, Chinese cabbage and bell pepper, and 10 2 CFU per g for other vegetables. With a 6-h enrichment, this assay could detect 10 CFU per g for all fresh-cut vegetables used in this study. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. Significance and Impact of the Study: Fresh-cut produce is at greater risk of Salmonella contamination. Rapid detection methods play an important role in reducing the dissemination of contaminated products. One-step RT-qPCR assay used in this study could detect 10 CFU per g Salmonella for 14 fresh-cut vegetables with a 6-h short enrichment. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. © 2018 The Society for Applied Microbiology.

Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

Science.gov (United States)

Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

2000-05-18

To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

Science.gov (United States)

Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

2014-04-01

A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

International Nuclear Information System (INIS)

Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

2011-01-01

LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

Enzymatic and viability RT-qPCR assays for evaluation of enterovirus, hepatitis A virus and norovirus inactivation: Implications for public health risk assessment.

Science.gov (United States)

Monteiro, S; Santos, R

2018-04-01

To assess the potential of a viability dye and an enzymatic reverse transcription quantitative PCR (RT-qPCR) pretreatment to discriminate between infectious and noninfectious enteric viruses. Enterovirus (EntV), norovirus (NoV) GII.4 and hepatitis A virus (HAV) were inactivated at 95°C for 10 min, and four methods were used to compare the efficiency of inactivation: (i) cell culture plaque assay for HAV and EntV, (ii) RT-qPCR alone, (iii) RT-qPCR assay preceded by RNase treatment, and (iv) pretreatment with a viability dye (reagent D (RD)) followed by RT-qPCR. In addition, heat-inactivated NoV was treated with RD coupled with surfactants to increase the efficiency of the viability dye. No treatment was able to completely discriminate infectious from noninfectious viruses. RD-RT-qPCR reduced more efficiently the detection of noninfectious viruses with little to no removal observed with RNase. RD-RT-qPCR method was the closest to cell culture assay. The combination of surfactants and RD did not show relevant improvements on the removal of inactivated viruses signal compared with viability RT-qPCR, with the exception of Triton X-100. The use of surfactant/RD-RT-qPCR, although not being able to completely remove the signal from noninfectious viral particles, yielded a better estimation of viral infectivity. Surfactant/RD-RT-qPCR may be an advantageous tool for a better detection of infectious viruses with potential significant impact in the risk assessment of the presence of enteric viruses. © 2017 The Society for Applied Microbiology.

Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage.

Science.gov (United States)

Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X

2014-07-01

Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats

Science.gov (United States)

Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin

2011-01-01

In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay.

Science.gov (United States)

Babu, Binoy; Washburn, Brian K; Ertek, Tülin Sarigül; Miller, Steven H; Riddle, Charles B; Knox, Gary W; Ochoa-Corona, Francisco M; Olson, Jennifer; Katırcıoğlu, Yakup Zekai; Paret, Mathews L

2017-09-01

Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (rose varieties, collected from different states in the U.S. The entire process, including the extraction can be completed in 25min, with less sophisticated equipments. The developed assay can be used with high efficiency in large scale field testing for rapid detection of RRV in commercial nurseries and landscapes. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

Science.gov (United States)

Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

2017-07-25

Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

The Genomic Grade Assay Compared With Ki67 to Determine Risk of Distant Breast Cancer Recurrence

DEFF Research Database (Denmark)

Ignatiadis, Michail; Azim, Hatem A; Desmedt, Christine

2016-01-01

Importance: The Genomic Grade Index (GGI) was previously developed, evaluated on frozen tissue, and shown to be prognostic in early breast cancer. To test the GGI in formalin-fixed, paraffin-embedded breast cancer tumors, a quantitative reverse transcriptase polymerase chain reaction assay...

Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

Science.gov (United States)

Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

2017-09-01

The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

International Nuclear Information System (INIS)

Ferkous, F.; Saihi, Y.

2018-01-01

Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

Directory of Open Access Journals (Sweden)

Kelly J. Henrickson

2009-10-01

Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

Science.gov (United States)

Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

2016-06-01

Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

Directory of Open Access Journals (Sweden)

Yong Teng

2014-02-01

Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

Science.gov (United States)

Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

2011-07-01

Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

Science.gov (United States)

Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2015-07-01

Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

A sensitive, reproducible, and economic real-time reverse transcription PCR detecting avian metapneumovirus subtypes A and B.

Science.gov (United States)

Franzo, G; Drigo, M; Lupini, C; Catelli, E; Laconi, A; Listorti, V; Bonci, M; Naylor, C J; Martini, M; Cecchinato, M

2014-06-01

Use of real-time PCR is increasing in the diagnosis of infectious disease due to its sensitivity, specificity, and speed of detection. These characteristics make it particularly suited for the diagnosis of viral infections, like avian metapneumovirus (AMPV), for which effective control benefits from continuously updated knowledge of the epidemiological situation. Other real-time reverse transcription (RT)-PCRs have been published based on highly specific fluorescent dye-labeled probes, but they have high initial cost, complex validation, and a marked susceptibility to the genetic variability of their target sequence. With this in mind, we developed and validated a SYBR Green I-based quantitative RT-PCR for the detection of the two most prevalent AMPV subtypes (i.e., subtypes A and B). The assay demonstrated an analytical sensitivity comparable with that of a previously published real-time RT-PCR and the ability to detect RNA equivalent to approximately 0.5 infectious doses for both A and B subtypes. The high efficiency and linearity between viral titer and crossing point displayed for both subtypes make it suited for viral quantification. Optimization of reaction conditions and the implementation of melting curve analysis guaranteed the high specificity of the assay. The stable melting temperature difference between the two subtypes indicated the possibility of subtyping through melting temperature analysis. These characteristics make our assay a sensitive, specific, and rapid tool, enabling contemporaneous detection, quantification, and discrimination of AMPV subtype A and B.

Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

Science.gov (United States)

Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

2008-01-01

Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

Directory of Open Access Journals (Sweden)

Steven Y C Tong

Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

NARCIS (Netherlands)

I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

2015-01-01

textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

Development of a one-step duplex RT-qPCR for the quantification of phocine distemper virus.

Science.gov (United States)

Bogomolni, Andrea L; Frasca, Salvatore; Matassa, Keith A; Nielsen, Ole; Rogers, Kara; De Guise, Sylvain

2015-04-01

Worldwide, stranded marine mammals and the network personnel who respond to marine mammal mortality have provided much of the information regarding marine morbillivirus infections. An assay to determine the amount of virus present in tissue samples would be useful to assist in routine surveying of animal health and for monitoring large-scale die-off events. False negatives from poor-quality samples prevent determination of the true extent of infection, while only small amounts of tissue samples or archived RNA may be available at the time of collection for future retrospective analysis. We developed a one-step duplex real-time reverse transcriptase-quantitative-PCR assay (RT-qPCR) based on Taqman probe technology to quantify phocine distemper virus (PDV) isolated from an outbreak in harbor (Phoca vitulina concolor) and gray seals (Halichoerus grypus) along the northeast US coast in 2006. The glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) gene was selected to assess RNA quality. This duplex assay is specific for PDV and sensitive through a range of 10(0) to 10(9) copies ds-plasmid DNA. For the GAPDH target, the reaction in duplex amplified 10(0) to 10(9) copies of ds-plasmid DNA and was detectable in multiple seal species. This assay reduced the likelihood of false negative results due to degradation of tissues and well-to-well variability while providing sensitive and specific detection of PDV, which would be applicable in molecular epidemiologic studies and pathogen detection in field and laboratory investigations involving a variety of seal species.

In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

Science.gov (United States)

Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

2004-01-01

The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

Development of an ultrasensitive PCR assay for polycyclic musk determination in fish.

Science.gov (United States)

Zhang, Xiaohan; Zhuang, Huisheng

2018-05-01

Polycyclic musks (PCMs) in the aquatic environment and organisms have become an emerging environmental issue because of their potential risk. The most used method for polycyclic musk determination is gas chromatography-mass spectrometry (GC-MS) with different sample extractions, which are somewhat expensive to operate, complex and laborious. In this study, a novel and ultrasensitive real-time polymerase chain reaction (PCR) assay with multiple signal amplification of carboxylic-DNA by gold nanoparticle-polyamidoamine conjugation (Au-PAMAM) was developed for determining polycyclic musks in fish. Hapten and immunogen were specially prepared. Polyclonal antibodies were produced based on the optimal immunisation, and the antibodies were characterised. Due to PAMAM's unique nanostructure of numerous functional amino groups, polyclonal antibody and carboxylic-DNA were immobilised by Au-PAMAM conjugation to develop the antibody-Au-PAMAM-DNA probes, which were used as a signal DNA amplifier in the PCR system. Compared with real-time immuno-PCR, this biological probe-amplified immuno-PCR (BPAI-PCR) assay had higher sensitivity due to the probes' higher ratio of signal DNA. Finally, the BPAI-PCR assay was applied to analyse AHTN (7-acetyl-1,1,3,4,4,6-hexamethyl-1,2,3,4-tetrahydronaphthalene,Tonalide) concentrations in fish samples in the range from 1 pg/L to 10 ng/L, giving an of LOD 0.61 pg/L. In general, due to the specificity of the antibody and novel nanoprobe design, this BPAI-PCR assay provided a potential way for trace analysis of AHTN in the aquatic organisms. The high concentrations of AHTN found in cultivated fish should encourage further toxicological studies.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali

2015-11-27

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

2015-01-01

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

Science.gov (United States)

Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

2004-01-01

A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner. PMID:15071047

Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

OpenAIRE

Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

2004-01-01

A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner.

Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.

Science.gov (United States)

Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang

2017-12-01

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

International Nuclear Information System (INIS)

Freeman-Wittig, M.J.B.

1986-01-01

The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

Science.gov (United States)

Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

2017-05-01

Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

Directory of Open Access Journals (Sweden)

Oluwafeyisetan O. Adebiyi

2015-12-01

Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples

Science.gov (United States)

Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris

2002-01-01

A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951

Analysis of molecular intra-patient variation and delineation of a prognostic 12-gene signature in non-muscle invasive bladder cancer; technology transfer from microarrays to PCR

DEFF Research Database (Denmark)

Andersen, Lars Dyrskjøt; Reinert, Thomas; Novoradovsky, A

2012-01-01

. Methods: We measured the intra-patient variation of an 88-gene progression signature using 39 metachronous tumours from 17 patients. For delineation of the optimal quantitative reverse transcriptase PCR panel of markers, we used 115 tumour samples from patients in Denmark, Sweden, UK and Spain. Results...

Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice.

Science.gov (United States)

Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue

2013-05-01

To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants.

Science.gov (United States)

Rosner, A; Maslenin, L; Spiegel, S

1997-09-01

The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

How to evaluate PCR assays for the detection of low-level DNA

DEFF Research Database (Denmark)

Banch-Clausen, Frederik; Urhammer, Emil; Rieneck, Klaus

2015-01-01

distribution describing parameters for singleplex real-time PCR-based detection of low-level DNA. The model was tested against experimental data of diluted cell-free foetal DNA. Also, the model was compared with a simplified formula to enable easy predictions. The model predicted outcomes that were...... not significantly different from experimental data generated by testing of cell-free foetal DNA. Also, the simplified formula was applicable for fast and accurate assay evaluation. In conclusion, the model can be applied for evaluation of sensitivity of real-time PCR-based detection of low-level DNA, and may also......High sensitivity of PCR-based detection of very low copy number DNA targets is crucial. Much focus has been on design of PCR primers and optimization of the amplification conditions. Very important are also the criteria used for determining the outcome of a PCR assay, e.g. how many replicates...

Cutaneous and visceral leishmaniasis co-infection in dogs from Rio de Janeiro, Brazil: evaluation by specific PCR and RFLP-PCR assays

Directory of Open Access Journals (Sweden)

Marize Quinhones Pires

2014-04-01

Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.

Analysis of the Kinetics and Regulation of Cytokine Gene Expression During the Primary In Vivo Immune Response to Killed Brucella Abortus

Science.gov (United States)

1992-08-10

Purified protein derivative of Mycobacterium tuberculosis and excretory-secretory antigen(s) of Toxocara canis expand in vitro human T cells with...day after immunization viii 47 49 LIST OF TABLES I. PCR primers and Southern blot probes of Th 11Th2 cytokines II. Cytokine mRNA levels in Thyl...sensitive quantitative reverse transcriptase-polymerase chain reaction (RT- PCR ) assay to measure changes in Thl and Th2 cytokine gene expression during

Telomerase reverse transcriptase promoter mutations in bladder cancer

DEFF Research Database (Denmark)

Allory, Yves; Beukers, Willemien; Sagrera, Ana

2014-01-01

for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...

Simultaneous detection of Zika, Chikungunya and Dengue viruses by a multiplex real-time RT-PCR assay.

Science.gov (United States)

Pabbaraju, Kanti; Wong, Sallene; Gill, Kara; Fonseca, Kevin; Tipples, Graham A; Tellier, Raymond

2016-10-01

In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased their area of endemicity and presented as an emerging global public health threat. To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1-4 from patients with symptoms of arboviral infection. This would be advantageous because of the similar clinical presentation typically encountered with these viruses and their co-circulation in endemic areas. In this study we have developed and validated a triplex real time reverse transcription PCR assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein 4 (nsP4) from CHIKV and 3' untranslated region (3'UTR) of DENV 1-4. The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily implemented for diagnostic testing of patient samples, even in a high throughput laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

Application of a Receptor-Binding Capture Quantitative Reverse Transcription-PCR Assay To Concentrate Human Norovirus from Sewage and To Study the Distribution and Stability of the Virus

Science.gov (United States)

Yang, David; Pan, Liangwen; Mandrell, Robert

2012-01-01

Water is an important route for human norovirus (HuNoV) transmission. Using magnetic beads conjugated with blood group-like antigens (HuNoV receptors), we developed a simple and rapid receptor-binding capture and magnetic sequestration (RBCMS) method and compared it to the existing negatively charged membrane absorption/elution (NCMAE) method for concentrating HuNoV from sewage effluent. RBCMS required 6-fold-less sample volume than the NCMAE method and also resulted in a significantly higher yield of HuNoV. The NCMAE and RBCMS concentrations of genogroup I (GI) HuNoV measured by quantitative reverse transcription-PCR (qRT-PCR) resulted in average threshold cycle (CT) values of 34.68 (8.68 copies, 252-fold concentration) versus 34.07 (13.05 copies, 477-fold concentration), respectively; the NCMAE and RBCMS concentrations of genogroup II (GII) HuNoV were measured as average CT values of 33.32 (24.7 copies, 239-fold concentration) versus 32.38 (46.9 copies, 333-fold concentration), respectively. The specificity of qRT-PCR was confirmed by traditional RT-PCR and an RNase I protection assay. The qRT-PCR signal from RBCMS-concentrated HuNoV treated with RNase I indicated that it was from encapsidated RNA and, probably, viable virus. In contrast, the qRT-PCR signal from NCMAE-concentrated HuNoV was not protected from RNase I and, likely, degradation. Both GI and GII HuNoV were detected from sewage effluent samples collected between April and July with average concentrations of 7.8 × 103 genomic copies per liter (gc/liter) and 4.3 × 104 gc/liter, respectively. No GI and sewage samples stored at room temperature for 4 weeks. We conclude that RBCMS requires less sample volume, has better recovery and sensitivity, and is faster than NCMAE for detection of HuNoV in sewage. PMID:22101044

Simultaneous detection of Legionella species and Legionella pneumophila by duplex PCR (dPCR assay in cooling tower water samples from Jakarta, Indonesia

Directory of Open Access Journals (Sweden)

Andi Yasmon

2010-11-01

Full Text Available Aim: Since culture method is time-consuming and has low  sensitivity, we developed a duplex PCR (dPCR assay for the detection of Legionella sp. and L. pneumophila in cooling tower samples. We used culture method as a gold standard.Methods: Optimization of dPCR method was performed to obtain an assay with high sensitivity and specifi city. The optimized method was used to detect Legionella sp. dan L. pneumophila in 9 samples obtained from 9 buildings in Jakarta. For culture method, the bacteria were grown or isolated on selective growth factor supplemented-buffered charcoal yeast extract (BCYE media.Results: Of 9 samples tested by dPCR assay, 6 were positive for Legionella species,1 was positive for L. pneumophila, and 2 showed negative results. For the same samples, no Legionella sp. was detected by the culture method.Conclusion: dPCR assay was much more sensitive than the culture method and was potentially used as a rapid, specifi c and sensitive test for routine detection of Legionella sp. dan for L. pneumophila in water samples. (Med J Indones 2010; 19:223-7Keywords: BCYE media, mip gene, 16S-rRNA gene

The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

Directory of Open Access Journals (Sweden)

Gronenborn Angela M

2010-05-01

Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

2010-03-26

The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

Science.gov (United States)

Tarasova, O A; Filimonov, D A; Poroikov, V V

2017-10-01

Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

Viability-qPCR for detecting Legionella: Comparison of two assays based on different amplicon lengths.

Science.gov (United States)

Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M

2015-08-01

Two different real-time quantitative PCR (PMA-qPCR) assays were applied for quantification of Legionella spp. by targeting a long amplicon (approx 400 bp) of 16S rRNA gene and a short amplicon (approx. 100 bp) of 5S rRNA gene. Purified DNA extracts from pure cultures of Legionella spp. and from environmental water samples were quantified. Application of the two assays to quantify Legionella in artificially contaminated water achieved that both assays were able to detect Legionella over a linear range of 10 to 10(5) cells ml(-1). A statistical analysis of the standard curves showed that both assays were linear with a good correlation coefficient (R(2) = 0.99) between the Ct and the copy number. Amplification with the reference assay was the most effective for detecting low copy numbers (1 bacterium per PCR mixture). Using selective quantification of viable Legionella by the PMA-qPCR method we obtained a greater inhibition of the amplification of the 400-bp 16S gene fragment (Δlog(10) = 3.74 ± 0.39 log(10) GU ml(-1)). A complete inhibition of the PCR signal was obtained when heat-killed cells in a concentration below 1 × 10(5) cells ml(-1) were pretreated with PMA. Analysing short amplicon sizes led to only 2.08 log reductions in the Legionella dead-cell signal. When we tested environmental water samples, the two qPCR assays were in good agreement according to the kappa index (0.741). Applying qPCR combined with PMA treatment, we also obtained a good agreement (kappa index 0.615). The comparison of quantitative results shows that both assays yielded the same quantification sensitivity (mean log = 4.59 vs mean log = 4.31). Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparative evaluation of a laboratory developed real-time PCR assay and the RealStar® HHV-6 PCR Kit for quantitative detection of human herpesvirus 6.

Science.gov (United States)

Yip, Cyril C Y; Sridhar, Siddharth; Cheng, Andrew K W; Fung, Ami M Y; Cheng, Vincent C C; Chan, Kwok-Hung; Yuen, Kwok-Yung

2017-08-01

HHV-6 reactivation in immunocompromised patients is common and may be associated with serious morbidity and mortality; therefore, early detection and initiation of therapy might be of benefit. Real-time PCR assays allow for early identification of HHV-6 reactivation to assist in providing a timely response. Thus, we compared the performance of an in-house developed HHV-6 quantitative PCR assay with a commercially available kit, the RealStar ® HHV-6 PCR Kit. The analytical sensitivity, analytical specificity, linearity, precision and accuracy of the in-house developed HHV-6 qPCR assay were evaluated. The diagnostic performance of the in-house HHV-6 qPCR assay was compared with the RealStar ® HHV-6 PCR Kit, using 72 clinical specimens and 17 proficiency testing samples. Linear regression analysis of the quantitative results showed a dynamic range from 2 to 10 log 10 copies/ml and a coefficient of determination (R 2 ) of 0.999 for the in-house assay. A dilution series demonstrated a limit of detection and a limit of quantification of 1.7 log 10 and 2 log 10 copies/ml, respectively. The precision of the assay was highly reproducible among runs with coefficients of variance (CV) ranging from 0.27% to 4.37%. A comparison of 27 matched samples showed an excellent correlation between the quantitative viral loads measured by the in-house HHV-6 qPCR assay and the RealStar ® HHV-6 PCR Kit (R 2 =0.926; PPCR Kit. Copyright © 2017 Elsevier B.V. All rights reserved.

Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2009-11-01

Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

Development and validation of a real-time PCR assay for the detection of anguillid herpesvirus 1.

Science.gov (United States)

van Beurden, S J; Voorbergen-Laarman, M A; Roozenburg, I; van Tellingen, J; Haenen, O L M; Engelsma, M Y

2016-01-01

Anguillid herpesvirus 1 (AngHV1) causes a haemorrhagic disease with increased mortality in wild and farmed European eel, Anguilla anguilla (L.) and Japanese eel Anguilla japonica, Temminck & Schlegel). Detection of AngHV1 is currently based on virus isolation in cell culture, antibody-based typing assays or conventional PCR. We developed, optimized and concisely validated a diagnostic TaqMan probe based real-time PCR assay for the detection of AngHV1. The primers and probe target AngHV1 open reading frame 57, encoding the capsid protease and scaffold protein. Compared to conventional PCR, the developed real-time PCR is faster, less labour-intensive and has a reduced risk of cross-contamination. The real-time PCR assay was shown to be analytically sensitive and specific and has a high repeatability, efficiency and r(2) -value. The diagnostic performance of the assay was determined by testing 10% w/v organ suspensions and virus cultures from wild and farmed European eels from the Netherlands by conventional and real-time PCR. The developed real-time PCR assay is a useful tool for the rapid and sensitive detection of AngHV1 in 10% w/v organ suspensions from wild and farmed European eels. © 2015 John Wiley & Sons Ltd.

A multiplex real-time PCR assay for routine diagnosis of bacterial vaginosis

NARCIS (Netherlands)

Kusters, J. G.; Reuland, E. A.; Bouter, S.; Koenig, P.; Dorigo-Zetsma, J. W.

2015-01-01

A semi-quantitative multiplex PCR assay for the diagnosis of bacterial vaginosis (BV) was evaluated in a prospective study in a population of Dutch women with complaints of abnormal vaginal discharge. The PCR targets Gardnerella vaginalis, Atopobium vaginae, Megasphaera phylotype 1, Lactobacillus

Tetrahymena telomerase protein p65 induces conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse transcriptase and TER assembly mutants.

Science.gov (United States)

Berman, Andrea J; Gooding, Anne R; Cech, Thomas R

2010-10-01

The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.

A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

Science.gov (United States)

Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

2017-01-01

This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

Directory of Open Access Journals (Sweden)

W. Ali

2017-06-01

Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

Directory of Open Access Journals (Sweden)

Aili Cui

Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

Directory of Open Access Journals (Sweden)

Francielle Gibson da Silva-Zacarias

2009-11-01

Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

Improved Safety for Molecular Diagnosis of Classical Rabies Viruses by Use of a TaqMan Real-Time Reverse Transcription-PCR "Double Check" Strategy

DEFF Research Database (Denmark)

Hoffmann, B.; Freuling, C. M.; Wakeley, P. R.

2010-01-01

To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus...... sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany......), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome...

Development of a multiple-marker polymerase chain reaction assay for detection of metastatic melanoma in lymph node aspirates of dogs.

Science.gov (United States)

Catchpole, Brian; Gould, Sara M; Kellett-Gregory, Lindsay M; Dobson, Jane M

2003-05-01

To develop a reverse transcriptase-polymerase chain reaction (RT-PCR) assay to detect canine melanoma-associated antigens (MAAs) and to use this technique to screen aspirates of lymph nodes (LNs) for evidence of metastatic spread of oral malignant melanoma. 7 dogs with oral malignant melanoma and 4 dogs with multicentric lymphosarcoma. We prepared cDNA from melanoma tumor biopsies and fine-needle aspirates obtained from submandibular LNs of dogs with oral malignant melanoma or multicentric lymphosarcoma. The RT-PCR assay was performed by use of tyrosinase, Melan-A, gp100, tyrosinase-related protein 2 (TRP-2), or melanoma antigen-encoding gene B (MAGE-B)-specific primers. We detected MAGE-B mRNA in canine testicular tissue but not in melanoma biopsy specimens. Tyrosinase, Melan-A, gp100, and TRP-2 mRNAs were detected in tumor biopsy specimens and in 2 of 5 LN aspirates from dogs with melanoma, suggesting metastatic spread in those 2 dogs. We did not detect MAAs in LN aspirates obtained from dogs with multicentric lymphosarcoma. Sequencing of canine Melan-A and gp100 PCR products confirmed the specificity of the assay for these genes. Clinical staging of dogs with oral malignant melanoma is useful to assist in designing appropriate treatments. However, results of histologic examination of LN biopsy specimens can be inconclusive and, in humans, can underestimate the number of patients with metastatic disease. Molecular staging of melanomas in dogs can be achieved by screening LN aspirates for MAA mRNA, and this can be performed in combination with cytologic examination to aid in detection of metastatic disease.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

Directory of Open Access Journals (Sweden)

Takao Ito

Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

zino

2014-02-05

Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

International Nuclear Information System (INIS)

Maria Lina R; Andi Yasmon

2011-01-01

There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

OpenAIRE

Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

2003-01-01

A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

Development of an RT-qPCR assay for the specific detection of a distinct genetic lineage of the infectious bursal disease virus.

Science.gov (United States)

Tomás, Gonzalo; Hernández, Martín; Marandino, Ana; Techera, Claudia; Grecco, Sofia; Hernández, Diego; Banda, Alejandro; Panzera, Yanina; Pérez, Ruben

2017-04-01

The infectious bursal disease virus (IBDV) is a major health threat to the world's poultry industry despite intensive controls including proper biosafety practices and vaccination. IBDV (Avibirnavirus, Birnaviridae) is a non-enveloped virus with a bisegmented double-stranded RNA genome. The virus is traditionally classified into classic, variant and very virulent strains, each with different epidemiological relevance and clinical implications. Recently, a novel worldwide spread genetic lineage was described and denoted as distinct (d) IBDV. Here, we report the development and validation of a reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay for the specific detection of dIBDVs in the global poultry industry. The assay employs a TaqMan-MGB probe that hybridizes with a unique molecular signature of dIBDV. The assay successfully detected all the assessed strains belonging to the dIBDV genetic lineage, showing high specificity and absence of cross-reactivity with non-dIBDVs, IBDV-negative samples and other common avian viruses. Using serial dilutions of in vitro-transcribed RNA we obtained acceptable PCR efficiencies and determination coefficients, and relatively small intra- and inter-assay variability. The assay demonstrated a wide dynamic range between 10 3 and 10 8 RNA copies/reaction. This rapid, specific and quantitative assay is expected to improve IBDV surveillance and control worldwide and to increase our understanding of the molecular epidemiology of this economically detrimental poultry pathogen.

A highly sensitive, multiplex broad-spectrum PCR-DNA-enzyme immunoassay and reverse hybridization assay for rapid detection and identification of Chlamydia trachomatis serovars.

NARCIS (Netherlands)

Quint, K.D.; Doorn, L.J. van; Kleter, B.; Koning, M.N. de; Munckhof, H.A. van den; Morre, S.A.; Harmsel, B. ter; Weiderpass, E.; Harbers, G.; Melchers, W.J.G.; Quint, W.G.V.

2007-01-01

Chlamydia trachomatis (Ct) comprises distinct serogroups and serovars. The present study evaluates a novel Ct amplification, detection, and genotyping method (Ct-DT assay). The Ct-DT amplification step is a multiplex broad-spectrum PCR for the cryptic plasmid and the VD2-region of ompl. The Ct-DT

Routine clinical application of the FRAXA Pfu PCR assay: limits and utility.

Science.gov (United States)

Condorelli, D F; Milana, G; Dell'Albani, P; Roccazzello, A M; Insirello, E; Pavone, L; Mollica, F

1996-11-01

Fragile X genotype is characterized by the excessive amplification of an unstable region of DNA: a trinucleotide repeat CGG of variable copy number present in the FRAXA locus. Methods based on polymerase chain reaction (PCR) amplification of the CGG repeat region could facilitate the development of a rapid screening assay. Unfortunately, amplification across CGG repeats can be inefficient and unreliable due to their 100% G + C base composition. The utility of the exonuclease-deficient Pfu polymerase for amplification and detection of the CGG repeats at the FRAXA locus has been reported. In the present study we analysed the utility of a Pfu PCR assay as a rapid initial screening method to rule out a diagnosis of fragile X syndrome in males with mental retardation. Affected males did not show any amplification products or a smear of amplification products between 350 and 550 bp. Only 10% of affected male samples did not show any amplification products, while the vast majority showed the amplification smear. The amplification smears represent a serious drawback of the method, since they cannot be distinguished from the amplification products of normal samples after separation in 1% agarose gel. Several modifications of the PCR conditions were attempted to eliminate this problem, but none was appropriate for clinical applications. However, the problem was easily solved by using a higher resolution electrophoretic system that allows a clear distinction of normal bands from pathological smears. We tested the specificity of the Pfu PCR assay, followed by an improved MetaPhor gel electrophoretic separation of PCR products, on 50 samples from normal males and 24 samples form affected males. The results showed that this method is a rapid, sensitive and specific assay for the exclusion of fragile X syndrome diagnosis in mentally retarded males.

Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis.

Science.gov (United States)

Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin

2017-04-01

Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

Development of a novel real-time RT-PCR assay to detect Seneca Valley virus-1 associated with emerging cases of vesicular disease in pigs.

Science.gov (United States)

Fowler, Veronica L; Ransburgh, Russell H; Poulsen, Elizabeth G; Wadsworth, Jemma; King, Donald P; Mioulet, Valerie; Knowles, Nick J; Williamson, Susanna; Liu, Xuming; Anderson, Gary A; Fang, Ying; Bai, Jianfa

2017-01-01

Seneca Valley virus 1 (SVV-1) can cause vesicular disease that is clinically indistinguishable from foot-and-mouth disease, vesicular stomatitis and swine vesicular disease. SVV-1-associated disease has been identified in pigs in several countries, namely USA, Canada, Brazil and China. Diagnostic tests are required to reliably detect this emerging virus, and this report describes the development and evaluation of a novel real-time (r) reverse-transcription (RT) PCR assay (rRT-PCR), targeting the viral polymerase gene (3D) of SVV-1. This new assay detected all historical and contemporary SVV-1 isolates examined (n=8), while no cross-reactivity was observed with nucleic acid templates prepared from other vesicular disease viruses or common swine pathogens. The analytical sensitivity of the rRT-PCR was 0.79 TCID 50 /ml and the limit of detection was equivalent using two different rRT-PCR master-mixes. The performance of the test was further evaluated using pig nasal (n=25) and rectal swab samples (n=25), where concordant results compared to virus sequencing were generated for 43/50 samples. The availability of this assay, will enable laboratories to rapidly detect SVV-1 in cases of vesicular disease in pigs, negated for notifiable diseases, and could enable existing knowledge gaps to be investigated surrounding the natural epidemiology of SVV-1. Copyright © 2016 Elsevier B.V. All rights reserved.

Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

DEFF Research Database (Denmark)

Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

2009-01-01

research use and needs qualit control for accuracy and precision. Especially the identification of experimental variations and statistical analysis has recently created discussions. The standard analytical technique is to use the Delta-Delta-Ct method. Although this method accounts for sample specific...... developed based on a linear mixed effects model for factorial designs. The model consists of an analysis of variance where the variation of each fixed effect of interest and identified experimental and biological nuisance variations are split. Hereby it accounts for varying efficiency, inhomogeneous......The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

Molecular cloning of Kuruma shrimp Marsupenaeus japonicus endonuclease-reverse transcriptase and its positive role in white spot syndrome virus and Vibrio alginolyticus infection.

Science.gov (United States)

Ma, Xiongchao; Sun, Baozhen; Zhu, Fei

2018-02-01

This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development and application of a universal Hemoplasma screening assay based on the SYBR green PCR principle.

Science.gov (United States)

Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina

2009-12-01

Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.

Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

Science.gov (United States)

Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

2013-12-23

At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

Droplet Digital™ PCR Next-Generation Sequencing Library QC Assay.

Science.gov (United States)

Heredia, Nicholas J

2018-01-01

Digital PCR is a valuable tool to quantify next-generation sequencing (NGS) libraries precisely and accurately. Accurately quantifying NGS libraries enable accurate loading of the libraries on to the sequencer and thus improve sequencing performance by reducing under and overloading error. Accurate quantification also benefits users by enabling uniform loading of indexed/barcoded libraries which in turn greatly improves sequencing uniformity of the indexed/barcoded samples. The advantages gained by employing the Droplet Digital PCR (ddPCR™) library QC assay includes the precise and accurate quantification in addition to size quality assessment, enabling users to QC their sequencing libraries with confidence.

Developing high throughput quantitative PCR assays for diagnosing Ikeda and other Theileria orientalis types common to New Zealand in bovine blood samples.

Science.gov (United States)

Pulford, D J; Gias, E; Bueno, I M; McFadden, Amj

2016-01-01

To develop rapid, quantitative PCR (qPCR) assays using high resolution melt (HRM) analysis and type-specific TaqMan assays for identifying the prevalent types of Theileria orientalis found in New Zealand cattle; and to evaluate their analytical and diagnostic characteristics compared with other assays for T. orientalis. Nucleotide sequences aligned with T. orientalis Buffeli, Chitose and Ikeda types, obtained from DNA extracted from blood samples from infected cattle, were used to design HRM and type-specific probe-based qPCR assays. The three type-specific assays were also incorporated into a single-tube multiplex qPCR assay. These assays were validated using DNA extracted from blood samples from cattle in herds with or without clinical signs of T. orientalis infection, other veterinary laboratory samples, as well as plasmids containing T. orientalis type-specific sequences. Diagnostic specificity (DSp) and sensitivity (DSe) estimates for the qPCR assays were compared to blood smear piroplasm results, and other PCR assays for T. orientalis. Copy number estimates of Ikeda DNA in blood were determined from cattle exhibiting anaemia using the Ikeda-specific qPCR assay. The T. orientalis type-specific and the HRM qPCR assays displayed 100% analytical specificity. The Ikeda-specific qPCR assay exhibited linearity (R(2) = 0.997) with an efficiency of 94.3%. Intra-assay CV were ≤0.08 and inter-assay CV were ≤0.095. For blood samples from cows with signs of infection with T. orientalis, the DSp and DSe of the multiplex probe qPCR assay were 93 and 96%, respectively compared with blood smears, and 97 and 100%, respectively compared with conventional PCR assays. For the Ikeda-specific qPCR assay, the number of positive samples (n=66) was slightly higher than a conventional PCR assay (n=64). The concentration of Ikeda genomes in blood samples from 41 dairy cows with signs of infection with T. orientalis ranged between 5.6 × 10(4) and 3.3 × 10(6) genomes per

Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

Science.gov (United States)

Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

2013-01-01

Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

Directory of Open Access Journals (Sweden)

Huali Huang

Full Text Available Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L. DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

Evaluation of Four Endogenous Reference Genes and Their Real-Time PCR Assays for Common Wheat Quantification in GMOs Detection

Science.gov (United States)

Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

2013-01-01

Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat. PMID:24098735

A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

Science.gov (United States)

Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

2018-03-01

The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection of bovine herpesvirus 4 glycoprotein B and thymidine kinase DNA by PCR assays in bovine milk

NARCIS (Netherlands)

Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.

2001-01-01

A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were

A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

Science.gov (United States)

Reich, J D; Alexander, T W; Chatterton, S

2016-05-01

Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

Science.gov (United States)

Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

2013-12-01

Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

Science.gov (United States)

Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

2013-07-30

Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

Development and validation of a duplex real-time PCR assay for the diagnosis of equine piroplasmosis.

Science.gov (United States)

Lobanov, Vladislav A; Peckle, Maristela; Massard, Carlos L; Brad Scandrett, W; Gajadhar, Alvin A

2018-03-02

Equine piroplasmosis (EP) is an economically significant infection of horses and other equine species caused by the tick-borne protozoa Theileria equi and Babesia caballi. The long-term carrier state in infected animals makes importation of such subclinical cases a major risk factor for the introduction of EP into non-enzootic areas. Regulatory testing for EP relies on screening of equines by serological methods. The definitive diagnosis of EP infection in individual animals will benefit from the availability of sensitive direct detection methods, for example, when used as confirmatory assays for non-negative serological test results. The objectives of this study were to develop a real-time quantitative polymerase chain reaction (qPCR) assay for simultaneous detection of both agents of EP, perform comprehensive evaluation of its performance and assess the assay's utility for regulatory testing. We developed a duplex qPCR targeting the ema-1 gene of T. equi and the 18S rRNA gene of B. caballi and demonstrated that the assay has high analytical sensitivities for both piroplasm species. Validation of the duplex qPCR on samples from 362 competitive enzyme-linked immunosorbent assay (cELISA)-negative horses from Canada and the United States yielded no false-positive reactions. The assay's performance was further evaluated using samples collected from 430 horses of unknown EP status from a highly endemic area in Brazil. This set of samples was also tested by a single-target 18S rRNA qPCR for T. equi developed at the OIE reference laboratory for EP in Japan, and a previously published single-target 18S rRNA qPCR for B. caballi whose oligonucleotides we adopted for use in the duplex qPCR. Matching serum samples were tested for antibodies to these parasites using cELISA. By the duplex qPCR, T. equi-specific 18S rRNA qPCR and cELISA, infections with T. equi were detected in 87.9% (95% confidence interval, CI: 84.5-90.7%), 90.5% (95% CI: 87.3-92.3%) and 87.4% (95% CI: 84

A Highly Sensitive Telomerase Activity Assay that Eliminates False-Negative Results Caused by PCR Inhibitors

Directory of Open Access Journals (Sweden)

Hidenobu Yaku

2013-09-01

Full Text Available An assay for telomerase activity based on asymmetric polymerase chain reaction (A-PCR on magnetic beads (MBs and subsequent application of cycling probe technology (CPT is described. In this assay, the telomerase reaction products are immobilized on MBs, which are then washed to remove PCR inhibitors that are commonly found in clinical samples. The guanine-rich sequences (5'-(TTAGGGn-3' of the telomerase reaction products are then preferentially amplified by A-PCR, and the amplified products are subsequently detected via CPT, where a probe RNA with a fluorophore at the 5' end and a quencher at the 3' end is hydrolyzed by RNase H in the presence of the target DNA. The catalyst-mediated cleavage of the probe RNA enhances fluorescence from the 5' end of the probe. The assay allowed us to successfully detect HeLa cells selectively over normal human dermal fibroblast (NHDF cells. Importantly, this selectivity produced identical results with regard to detection of HeLa cells in the absence and presence of excess NHDF cells; therefore, this assay can be used for practical clinical applications. The lower limit of detection for HeLa cells was 50 cells, which is lower than that achieved with a conventional telomeric repeat amplification protocol assay. Our assay also eliminated false-negative results caused by PCR inhibitors. Furthermore, we show that this assay is appropriate for screening among G-quadruplex ligands to find those that inhibit telomerase activity.

Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility.

Science.gov (United States)

Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W

2012-05-01

Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

Directory of Open Access Journals (Sweden)

Qing Fan

Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

Science.gov (United States)

Schuster, W; Brennicke, A

1987-01-01

We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay

Directory of Open Access Journals (Sweden)

Farzaneh Lotfipour

2015-06-01

Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.

A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

Directory of Open Access Journals (Sweden)

Marcin Kierczak

2009-10-01

Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

Directory of Open Access Journals (Sweden)

Stefanou Nikolaos

2010-08-01

Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

Reverse transcription loop-mediated isothermal amplification assays for rapid identification of eastern and western strains of bluetongue virus in India.

Science.gov (United States)

Maan, S; Maan, N S; Batra, K; Kumar, A; Gupta, A; Rao, Panduranga P; Hemadri, Divakar; Reddy, Yella Narasimha; Guimera, M; Belaganahalli, M N; Mertens, P P C

2016-08-01

Bluetongue virus (BTV) infects all ruminants, including cattle, goats and camelids, causing bluetongue disease (BT) that is often severe in naïve deer and sheep. Reverse-transcription-loop-mediated-isothermal-amplification (RT-LAMP) assays were developed to detect eastern or western topotype of BTV strains circulating in India. Each assay uses four primers recognizing six distinct sequences of BTV genome-segment 1 (Seg-1). The eastern (e)RT-LAMP and western (w)RT-LAMP assay detected BTV RNA in all positive isolates that were tested (n=52, including Indian BTV-1, -2, -3, -5, -9, -10, -16, -21 -23, and -24 strains) with high specificity and efficiency. The analytical sensitivity of the RT-LAMP assays is comparable to real-time RT-PCR, but higher than conventional RT-PCR. The accelerated eRT-LAMP and wRT-LAMP assays generated detectable levels of amplified DNA, down to 0.216 fg of BTV RNA template or 108 fg of BTV RNA template within 60-90min respectively. The assays gave negative results with RNA from foot-and-mouth-disease virus (FMDV), peste des petits ruminants virus (PPRV), or DNA from Capripox viruses and Orf virus (n=10), all of which can cause clinical signs similar to BT. Both RT-LAMP assays did not show any cross-reaction among themselves. The assays are rapid, easy to perform, could be adapted as a 'penside' test making them suitable for 'front-line' diagnosis, helping to identify and contain field outbreaks of BTV. Copyright © 2016 Elsevier B.V. All rights reserved.

Determining the analytical specificity of PCR-based assays for the diagnosis of IA: What is Aspergillus?

Science.gov (United States)

Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen

2017-06-01

A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA.

Science.gov (United States)

Majid, Farjana; Jahan, Munira; Lutful Moben, Ahmed; Tabassum, Shahina

2014-01-01

Both real-time-polymerase chain reaction (PCR) and hybrid capture 2 (HC2) assay can detect and quantify hepatitis B virus (HBV) DNA. However, real-time-PCR can detect a wide range of HBV DNA, while HC2 assay could not detect lower levels of viremia. The present study was designed to detect and quantify HBV DNA by real-time-PCR and HC2 assay and compare the quantitative data of these two assays. A cross-sectional study was conducted in between July 2010 and June 2011. A total of 66 serologically diagnosed chronic hepatitis B (CHB) patients were selected for the study. Real-time-PCR and HC2 assay was done to detect HBV DNA. Data were analyzed by statistical Package for the social sciences (SPSS). Among 66 serologically diagnosed chronic hepatitis B patients 40 (60.61%) patients had detectable and 26 (39.39%) had undetectable HBV DNA by HC2 assay. Concordant results were obtained for 40 (60.61%) out of these 66 patients by real-time-PCR and HC2 assay with mean viral load of 7.06 ± 1.13 log 10 copies/ml and 6.95 ± 1.08 log 10 copies/ml, respectively. In the remaining 26 patients, HBV DNA was detectable by real-time-PCR in 20 patients (mean HBV DNA level was 3.67 ± 0.72 log 10 copies/ml. However, HBV DNA could not be detectable in six cases by the both assays. The study showed strong correlation (r = 0.915) between real-time-PCR and HC2 assay for the detection and quantification of HBV DNA. HC2 assay may be used as an alternative to real-time-PCR for CHB patients. How to cite this article: Majid F, Jahan M, Moben AL, Tabassum S. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA. Euroasian J Hepato-Gastroenterol 2014;4(1):31-35.

Automated 5 ' nuclease PCR assay for identification of Salmonella enterica

DEFF Research Database (Denmark)

Hoorfar, Jeffrey; Ahrens, Peter; Rådström, P.

2000-01-01

-point fluorescence (FAM) signals for the samples and positive control (TET) signals (relative sensitivity [Delta Rn], >0.6). The diagnostic specificity of the method was assessed using 120 non-Salmonella strains, which all resulted in negative FAM signals (Delta Rn, less than or equal to 0.5). All 100 rough...... Salmonella strains tested resulted in positive FAM and TET signals. In addition, it was found that the complete PCR mixture, predispensed in microwell plates, could be stored for up to 3 months at -20 degrees C, Thus, the diagnostic TaqMan assay developed can be a useful and simple alternative method......A simple and ready-to-go test based on a 5' nuclease (TaqMan) PCR technique was developed for identification of presumptive Salmonella enterica isolates. The results were compared with those of conventional methods. The TaqMan assay was evaluated for its ability to accurately detect 210 S. enterica...

Temperature Switch PCR (TSP: Robust assay design for reliable amplification and genotyping of SNPs

Directory of Open Access Journals (Sweden)

Mather Diane E

2009-12-01

Full Text Available Abstract Background Many research and diagnostic applications rely upon the assay of individual single nucleotide polymorphisms (SNPs. Thus, methods to improve the speed and efficiency for single-marker SNP genotyping are highly desirable. Here, we describe the method of temperature-switch PCR (TSP, a biphasic four-primer PCR system with a universal primer design that permits amplification of the target locus in the first phase of thermal cycling before switching to the detection of the alleles. TSP can simplify assay design for a range of commonly used single-marker SNP genotyping methods, and reduce the requirement for individual assay optimization and operator expertise in the deployment of SNP assays. Results We demonstrate the utility of TSP for the rapid construction of robust and convenient endpoint SNP genotyping assays based on allele-specific PCR and high resolution melt analysis by generating a total of 11,232 data points. The TSP assays were performed under standardised reaction conditions, requiring minimal optimization of individual assays. High genotyping accuracy was verified by 100% concordance of TSP genotypes in a blinded study with an independent genotyping method. Conclusion Theoretically, TSP can be directly incorporated into the design of assays for most current single-marker SNP genotyping methods. TSP provides several technological advances for single-marker SNP genotyping including simplified assay design and development, increased assay specificity and genotyping accuracy, and opportunities for assay automation. By reducing the requirement for operator expertise, TSP provides opportunities to deploy a wider range of single-marker SNP genotyping methods in the laboratory. TSP has broad applications and can be deployed in any animal and plant species.

Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

Science.gov (United States)

2013-01-01

Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

Design and optimization of reverse-transcription quantitative PCR experiments.

Science.gov (United States)

Tichopad, Ales; Kitchen, Rob; Riedmaier, Irmgard; Becker, Christiane; Ståhlberg, Anders; Kubista, Mikael

2009-10-01

Quantitative PCR (qPCR) is a valuable technique for accurately and reliably profiling and quantifying gene expression. Typically, samples obtained from the organism of study have to be processed via several preparative steps before qPCR. We estimated the errors of sample withdrawal and extraction, reverse transcription (RT), and qPCR that are introduced into measurements of mRNA concentrations. We performed hierarchically arranged experiments with 3 animals, 3 samples, 3 RT reactions, and 3 qPCRs and quantified the expression of several genes in solid tissue, blood, cell culture, and single cells. A nested ANOVA design was used to model the experiments, and relative and absolute errors were calculated with this model for each processing level in the hierarchical design. We found that intersubject differences became easily confounded by sample heterogeneity for single cells and solid tissue. In cell cultures and blood, the noise from the RT and qPCR steps contributed substantially to the overall error because the sampling noise was less pronounced. We recommend the use of sample replicates preferentially to any other replicates when working with solid tissue, cell cultures, and single cells, and we recommend the use of RT replicates when working with blood. We show how an optimal sampling plan can be calculated for a limited budget. .

Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

Science.gov (United States)

Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

2008-05-20

Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

Science.gov (United States)

Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

2016-01-01

To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

Biotin Switch Assays for Quantitation of Reversible Cysteine Oxidation.

Science.gov (United States)

Li, R; Kast, J

2017-01-01

Thiol groups in protein cysteine residues can be subjected to different oxidative modifications by reactive oxygen/nitrogen species. Reversible cysteine oxidation, including S-nitrosylation, S-sulfenylation, S-glutathionylation, and disulfide formation, modulate multiple biological functions, such as enzyme catalysis, antioxidant, and other signaling pathways. However, the biological relevance of reversible cysteine oxidation is typically underestimated, in part due to the low abundance and high reactivity of some of these modifications, and the lack of methods to enrich and quantify them. To facilitate future research efforts, this chapter describes detailed procedures to target the different modifications using mass spectrometry-based biotin switch assays. By switching the modification of interest to a biotin moiety, these assays leverage the high affinity between biotin and avidin to enrich the modification. The use of stable isotope labeling and a range of selective reducing agents facilitate the quantitation of individual as well as total reversible cysteine oxidation. The biotin switch assay has been widely applied to the quantitative analysis of S-nitrosylation in different disease models and is now also emerging as a valuable research tool for other oxidative cysteine modifications, highlighting its relevance as a versatile, robust strategy for carrying out in-depth studies in redox proteomics. © 2017 Elsevier Inc. All rights reserved.

Comparison of the Diagnostic Value Between Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Histopathologic Examination in Sentinel Lymph Nodes for Patients With Gastric Carcinoma.

Science.gov (United States)

Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung

2016-05-01

Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

DEFF Research Database (Denmark)

Fox, Zoe; Phillips, Andrew; Cohen, Cal

2008-01-01

the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

Science.gov (United States)

Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

2017-08-02

Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies

DEFF Research Database (Denmark)

Hum, S.; Quinn, K.; Brunner, J.

1997-01-01

methods were attributed to methodological differences used in various laboratories. Conclusion Our results indicate that misidentification of C fetus in routine diagnostic laboratories may be relatively common. The PCR assay evaluated gave rapid and reproducible results and is thus a valuable adjunctive......Objective To evaluate a polymerase chain reaction assay for identification of Campylobacter fetus and differentiation of the defined subspecies. Design Characterisation of bacterial strains by traditional phenotyping, polymerase chain reaction, a probabilistic identification scheme...... by traditional phenotypic methods and the PCR assay was found to be 80.8%. The polymerase chain reaction proved to be a reliable technique for the species and subspecies identification of C fetus; equivocal results were obtained in only two instances. Initial misidentifications by conventional phenotyping...

Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

Directory of Open Access Journals (Sweden)

Bruynseels Peggy

2009-07-01

Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

International Nuclear Information System (INIS)

Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

2001-01-01

Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

Development and application of two independent real-time PCR assays to detect clinically relevant Mucorales species.

Science.gov (United States)

Springer, Jan; Goldenberger, Daniel; Schmidt, Friderike; Weisser, Maja; Wehrle-Wieland, Elisabeth; Einsele, Hermann; Frei, Reno; Löffler, Jürgen

2016-03-01

PCR-based detection of Mucorales species could improve diagnosis of suspected invasive fungal infection, leading to a better patient outcome. This study describes two independent probe-based real-time PCR tests for detection of clinically relevant Mucorales, targeting specific fragments of the 18S and the 28S rRNA genes. Both assays have a short turnaround time, allow fast, specific and very sensitive detection of clinically relevant Mucorales and have the potential to be used as quantitative tests. They were validated on various clinical samples (fresh and formalin-fixed paraffin-embedded specimens, mainly biopsies, n = 17). The assays should be used as add-on tools to complement standard techniques; a combined approach of both real-time PCR assays has 100 % sensitivity. Genus identification by subsequent sequencing is possible for amplicons of the 18S PCR assay. In conclusion, combination of the two independent Mucorales assays described in this study, 18S and 28S, detected all clinical samples associated with proven Mucorales infection (n = 10). Reliable and specific identification of Mucorales is a prerequisite for successful antifungal therapy as these fungi show intrinsic resistance to voriconazole and caspofungin.

Development and comparison of a real-time PCR assay for detection of Dichelobacter nodosus with culturing and conventional PCR: harmonisation between three laboratories

DEFF Research Database (Denmark)

Frosth, Sara; Slettemeås, Jannice S.; Jørgensen, Hannah J.

2012-01-01

BACKGROUND: Ovine footrot is a contagious disease with worldwide occurrence in sheep. The main causative agent is the fastidious bacterium Dichelobacter nodosus. In Scandinavia, footrot was first diagnosed in Sweden in 2004 and later also in Norway and Denmark. Clinical examination of sheep feet...... was tested using 55 bacterial and two fungal strains. To evaluate the sensitivity and harmonisation of results between different laboratories, aliquots of a single DNA preparation were analysed at three Scandinavian laboratories. The developed real-time PCR assay was compared to culturing by analysing 126...... laboratories and corresponds to approximately three copies of the D. nodosus genome per reaction. The assay showed 100% inclusivity and 100% exclusivity for the strains tested. The real-time PCR assay found 54.8% more positive samples than by culturing and 8% more than conventional PCR. CONCLUSIONS...

The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

Directory of Open Access Journals (Sweden)

Niu Meijuan

2004-10-01

Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

A novel method for detection of dioxins. Exonuclease protection mediated PCR assay

Energy Technology Data Exchange (ETDEWEB)

Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College

2004-09-15

The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.

In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

Directory of Open Access Journals (Sweden)

Johannes Van Staden

2010-10-01

Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.

Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

Directory of Open Access Journals (Sweden)

Laila El-Shehawy

Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

Detection of 12 respiratory viruses by duplex real time PCR assays in respiratory samples.

Science.gov (United States)

Arvia, Rosaria; Corcioli, Fabiana; Ciccone, Nunziata; Della Malva, Nunzia; Azzi, Alberta

2015-12-01

Different viruses can be responsible for similar clinical manifestations of respiratory infections. Thus, the etiological diagnosis of respiratory viral diseases requires the detection of a large number of viruses. In this study, 6 duplex real-time PCR assays, using EvaGreen intercalating dye, were developed to detect 12 major viruses responsible for respiratory diseases: influenza A and B viruses, enteroviruses (including enterovirus spp, and rhinovirus spp), respiratory syncytial virus, human metapneumovirus, coronaviruses group I (of which CoV 229E and CoV NL63 are part) and II (including CoV OC43 and CoV HKU1), parainfluenza viruses type 1, 2, 3 and 4, human adenoviruses and human bocaviruses. The 2 target viruses of each duplex reaction were distinguishable by the melting temperatures of their amplicons. The 6 duplex real time PCR assays were applied for diagnostic purpose on 202 respiratory samples from 157 patients. One hundred fifty-seven samples were throat swabs and 45 were bronchoalveolar lavages. The results of the duplex PCR assays were confirmed by comparison with a commercial, validated, assay; in addition, the positive results were confirmed by sequencing. The analytical sensitivity of the duplex PCR assays varied from 10(3) copies/ml to 10(4) copies/ml. For parainfluenza virus 2 only it was 10(5) copies/ml. Seventy clinical samples (35%) from 55 patients (30 children and 25 adults) were positive for 1 or more viruses. In adult patients, influenza A virus was the most frequently detected respiratory virus followed by rhinoviruses. In contrast, respiratory syncytial virus was the most common virus in children, followed by enteroviruses, influenza A virus and coronavirus NL63. The small number of samples/patients does not allow us to draw any epidemiological conclusion. Altogether, the results of this study indicate that the 6 duplex PCR assays described in this study are sensitive, specific and cost-effective. Thus, this assay could be

Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

Directory of Open Access Journals (Sweden)

Markus Hecht

Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

Science.gov (United States)

Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

2009-01-01

A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A quantitative PCR (TaqMan assay for pathogenic Leptospira spp

Directory of Open Access Journals (Sweden)

Symonds Meegan L

2002-07-01

Full Text Available Abstract Background Leptospirosis is an emerging infectious disease. The differential diagnosis of leptospirosis is difficult due to the varied and often "flu like" symptoms which may result in a missed or delayed diagnosis. There are over 230 known serovars in the genus Leptospira. Confirmatory serological diagnosis of leptospirosis is usually made using the microscopic agglutination test (MAT which relies on the use of live cultures as the source of antigen, often performed using a panel of antigens representative of local serovars. Other techniques, such as the enzyme linked immunosorbent assay (ELISA and slide agglutination test (SAT, can detect different classes of antibody but may be subject to false positive reactions and require confirmation of these results by the MAT. Methods The polymerase chain reaction (PCR has been used to detect a large number of microorganisms, including those of clinical significance. The sensitivity of PCR often precludes the need for isolation and culture, thus making it ideal for the rapid detection of organisms involved in acute infections. We employed real-time (quantitative PCR using TaqMan chemistry to detect leptospires in clinical and environmental samples. Results and Conclusions The PCR assay can be applied to either blood or urine samples and does not rely on the isolation and culture of the organism. Capability exists for automation and high throughput testing in a clinical laboratory. It is specific for Leptospira and may discriminate pathogenic and non-pathogenic species. The limit of detection is as low as two cells.

Development of a novel real-time qPCR assay for the dual detection of canine and phocine distemper virus

DEFF Research Database (Denmark)

Nielsen, Linette Buxbom; Hjulsager, Charlotte Kristiane; Larsen, Helene

conventional PCR assays with real-time PCR assays to obtain a uniform assay palette. The present work describes the development of a novel real-time RT-qPCR assay for the dual detection of canine and phocine distemper virus. The assay is relevant for the future detection of outbreaks of canine distemper virus...... in e.g. in farmed mink and wildlife and phocine distemper in seals. A set of primers and dual labelled probe was designed based on an alignment of distemper sequences in GenBank from various species and in-house sequences from recent outbreaks in Danish farmed mink. The assay amplifies a segment of 151...... bp in the Phosphoprotein (P) gene of the distemper virus genome. The dynamic range and PCR efficiency (E) was experimentally determined using 10-fold dilutions of a specially designed distemper DNA-oligo in addition to extracted RNA from clinical samples. E of the real-time assay was shown to range...

Reverse transcriptase directs viral evolution in a deep ocean methane seep

Science.gov (United States)

Paul, B. G.; Bagby, S. C.

2013-12-01

Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

LENUS (Irish Health Repository)

Bansode, Vijay B

2011-10-13

Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

A semiquantitative PCR assay for assessing Perkinsus marinus infections in the eastern oyster, Crassostrea virginica.

Science.gov (United States)

Marsh, A G; Gauthier, J D; Vasta, G R

1995-08-01

A 3.2-kb fragment of Perkinsus marinus DNA was cloned and sequenced. A noncoding domain was identified and targeted for the development of a semiquantitative polymerase chain reaction (PCR) assay for the presence of P. marinus in eastern oyster tissues. The assay involves extracting total DNA from oyster hemolymph and using 1 microgram of that DNA as template in a stringent PCR amplification with oligonucleotide primers that are specific for the P. marinus 3.2-kb fragment. With this assay, we can detect 10 pg of total P. marinus DNA per 1 microgram of oyster hemocyte DNA with ethidium bromide (EtBr) staining of agarose gels, 100 fg total P. marinus DNA with Southern blot autoradiography, and 10 fg of total P. marinus DNA with dot-blot hybridizations. We have used the sensitivity of the PCR assay to develop a method for estimating the level of P. marinus DNA in oyster hemolymph and have successfully applied this technique to gill tissues. Our semiquantitative assay uses a dilution series to essentially titrate the point at which a P. marinus DNA target is no longer amplified in a sample. We refer to this technique as "dilution endpoint" PCR. Using hemocytes obtained by withdrawing a 1-ml sample of hemolymph, this assay provides a nondestructive methodology for rapidly screening large numbers of adult oysters for the presence and quantification of P. marinus infection levels. This technique is applicable to other tissues (gills) and could potentially be applied to DNA extracts of whole larvae or spat.

The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors.

Science.gov (United States)

Sluis-Cremer, Nicolas

2014-07-31

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme

Science.gov (United States)

Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni

2005-01-01

Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

Science.gov (United States)

Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

2016-02-01

Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.

Science.gov (United States)

Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I

2014-03-01

In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.

A Simple, High-Throughput Assay for Fragile X Expanded Alleles Using Triple Repeat Primed PCR and Capillary Electrophoresis

Science.gov (United States)

Lyon, Elaine; Laver, Thomas; Yu, Ping; Jama, Mohamed; Young, Keith; Zoccoli, Michael; Marlowe, Natalia

2010-01-01

Population screening has been proposed for Fragile X syndrome to identify premutation carrier females and affected newborns. We developed a PCR-based assay capable of quickly detecting the presence or absence of an expanded FMR1 allele with high sensitivity and specificity. This assay combines a triplet repeat primed PCR with high-throughput automated capillary electrophoresis. We evaluated assay performance using archived samples sent for Fragile X diagnostic testing representing a range of Fragile X CGG-repeat expansions. Two hundred five previously genotyped samples were tested with the new assay. Data were analyzed for the presence of a trinucleotide “ladder” extending beyond 55 repeats, which was set as a cut-off to identify expanded FMR1 alleles. We identified expanded FMR1 alleles in 132 samples (59 premutation, 71 full mutation, 2 mosaics) and normal FMR1 alleles in 73 samples. We found 100% concordance with previous results from PCR and Southern blot analyses. In addition, we show feasibility of using this assay with DNA extracted from dried-blood spots. Using a single PCR combined with high-throughput fragment analysis on the automated capillary electrophoresis instrument, we developed a rapid and reproducible PCR-based laboratory assay that meets many of the requirements for a first-tier test for population screening. PMID:20431035

Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

Science.gov (United States)

Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

2003-05-01

Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay

Directory of Open Access Journals (Sweden)

Dabisch-Ruthe Mareike

2012-07-01

Full Text Available Abstract Background A broad spectrum of pathogens is causative for respiratory tract infections, but symptoms are mostly similar. Therefore, the identification of the causative viruses and bacteria is only feasible using multiplex PCR or several monoplex PCR tests in parallel. Methods The analytical sensitivity of three multiplex PCR assays, RespiFinder-19, RespiFinder-SMART-22 and xTAG-Respiratory-Virus-Panel-Fast-Assay (RVP, were compared to monoplex real-time PCR with quantified standardized control material. All assays include the most common respiratory pathogens. Results To compare the analytical sensitivity of the multiplex assays, samples were inoculated with 13 different quantified viruses in the range of 101 to 105 copies/ml. Concordant results were received for rhinovirus, whereas the RVP detected influenzavirus, RSV and hMPV more frequently in low concentrations. The RespiFinder-19 and the RespiFinder-SMART-22 showed a higher analytical sensitivity for adenoviruses and coronaviruses, whereas the RVP was incapable to detect adenovirus and coronavirus in concentrations of 104 copies/ml. The RespiFinder-19 and RespiFinder-SMART-22A did not detect influenzaviruses (104 copies/ml and RSV (103 copies/ml. The detection of all 13 viruses in one sample was only achieved using monoplex PCR. To analyze possible competitive amplification reactions between the different viruses, samples were further inoculated with only 4 different viruses in one sample. Compared to the detection of 13 viruses in parallel, only a few differences were found. The incidence of respiratory viruses was compared in tracheal secretion (TS samples (n = 100 of mechanically ventilated patients in winter (n = 50 and summer (n = 50. In winter, respiratory viruses were detected in 32 TS samples (64% by RespiFinder-19, whereas the detection rate with RVP was only 22%. The most frequent viruses were adenovirus (32% and PIV-2 (20%. Multiple infections were detected

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

OpenAIRE

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.

Science.gov (United States)

Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer

2017-05-01

Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.

Nested-PCR assay for detection of Schistosoma japonicum infection in domestic animals.

Science.gov (United States)

Zhang, Xin; He, Chuan-Chuan; Liu, Jin-Ming; Li, Hao; Lu, Ke; Fu, Zhi-Qiang; Zhu, Chuan-Gang; Liu, Yi-Ping; Tong, Lai-Bao; Zhou, De-Bao; Zha, Li; Hong, Yang; Jin, Ya-Mei; Lin, Jiao-Jiao

2017-04-13

Schistosomiasis japonica is a common zoonosis. Domestic animals are the primary source of infection and play an important role in disease transmission. The prevalence and infectivity of this disease in domestic animals in China have significantly decreased and, for this reason, diagnostics with a higher sensitivity have become increasingly necessary. It was reported that polymerase chain reaction (PCR)-based methods could be used to detect schistosome infection in humans and animals and presented a high sensitivity and specificity. The present study aimed to develop a PCR-based method for detection of Schistosoma japonicum infection in domestic animals. A specific nested-PCR assay was developed to detect S. japonicum infection in domestic animals via amplification of a 231-bp DNA fragment of retrotransposon SjR2. The developed assay was first used in sera and dry blood filter paper (DBFP) from goats and buffaloes at different time points of infection. Then, 78 DBFPs from 39 artificially-infected bovines at 14 and 28 days post-infection and 42 DBFPs from schistosome-negative bovines from the city of Huangshan in the Anhui province were used to evaluate the diagnostic validity. Furthermore, this assay was used to detect S. japonicum infection in domestic animals in Dongzhi and Wangjiang counties. The expected PCR product was detected in eggs and adult worms of S. japonicum and blood samples from S. japonicum-infected goats and water buffaloes, but not from Fasciola and Haemonchus contortus worms. The nested-PCR assay could detect the target S. japonicum DNA in DBFPs from goats and buffaloes after day 3 post-infection. The sensitivity in buffaloes at 14 and 28 days post-infection was 92.30% (36/39) and 100% (39/39), respectively. The specificity was 97.60% (41/42). The positivity rates in Dongzhi and Wangjiang counties were 6.00% and 8.00% in bovines and 22.00% and 16.67% in goats, respectively. The positivity rates in goats in both counties were higher than those

A molecular-beacon-based asymmetric PCR assay for easy visualization of amplicons in the diagnosis of trichomoniasis.

Science.gov (United States)

Sonkar, Subash C; Sachdev, Divya; Mishra, Prashant K; Kumar, Anita; Mittal, Pratima; Saluja, Daman

2016-12-15

The currently available nucleic acid amplification tests (NAATs) for trichomoniasis are accurate, quick and confirmative with superior sensitivity than traditional culture-based microbiology assays. However, these assays are associated with problems of carry over contamination, false positive results, requirement of technical expertise for performance and detection of end product. Hence, a diagnostic assay with easy visualization of the amplified product will be profitable. An in-house, rapid, sensitive, specific molecular-beacon-based PCR assay, using primers against pfoB gene of Trichomonas vaginalis, was developed and evaluated using dry ectocervical swabs (n=392) from symptomatic females with vaginal discharge. Total DNA was isolated and used as template for the PCR assays. The performance and reproducibility of PCR assay was evaluated by composite reference standard (CRS). For easy visualization of the amplified product, molecular-beacon was designed and amplicons were visualized directly using fluorescent handheld dark reader or by Micro-Plate Reader. Molecular-beacons are single-stranded hairpin shaped nucleic acid probes composed of a stem, with fluorophore/quencher pair and a loop region complementary to the desired DNA. The beacon-based PCR assay designed in the present study is highly specific as confirmed by competition experiments and extremely sensitive with detection limit of 20fg of genomic DNA (3-4 pathogens). The minimum infrastructure requirement and ease to perform the assay makes this method highly useful for resource poor countries for better disease management. Copyright © 2016 Elsevier B.V. All rights reserved.

Preclinical detection of porcine circovirus type 2 infection using an ultrasensitive nanoparticle DNA probe-based PCR assay.

Directory of Open Access Journals (Sweden)

Yong Huang

Full Text Available Porcine circovirus type 2 (PCV2 has emerged as one of the most important pathogens affecting swine production globally. Preclinical identification of PCV2 is very important for effective prophylaxis of PCV2-associated diseases. In this study, we developed an ultrasensitive nanoparticle DNA probe-based PCR assay (UNDP-PCR for PCV2 detection. Magnetic microparticles coated with PCV2 specific DNA probes were used to enrich PCV2 DNA from samples, then gold nanoparticles coated with PCV2 specific oligonucleotides were added to form a sandwich nucleic acid-complex. After the complex was formed, the oligonucleotides were released and characterized by PCR. This assay exhibited about 500-fold more sensitive than conventional PCR, with a detection limit of 2 copies of purified PCV2 genomic DNA and 10 viral copies of PCV2 in serum. The assay has a wide detection range for all of PCV2 genotypes with reliable reproducibility. No cross-reactivity was observed from the samples of other related viruses including porcine circovirus type 1, porcine parvovirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus and classical swine fever virus. The positive detection rate of PCV2 specific UNDP-PCR in 40 preclinical field samples was 27.5%, which appeared greater than that by conventional and real-time PCR and appeared application potency in evaluation of the viral loads levels of preclinical infection samples. The UNDP-PCR assay reported here can reliably rule out false negative results from antibody-based assays, provide a nucleic acid extraction free, specific, ultrasensitive, economic and rapid diagnosis method for preclinical PCV2 infection in field, which may help prevent large-scale outbreaks.

A triplex quantitative real-time PCR assay for differential detection of human adenovirus serotypes 2, 3 and 7.

Science.gov (United States)

Qiu, Fang-Zhou; Shen, Xin-Xin; Zhao, Meng-Chuan; Zhao, Li; Duan, Su-Xia; Chen, Chen; Qi, Ju-Ju; Li, Gui-Xia; Wang, Le; Feng, Zhi-Shan; Ma, Xue-Jun

2018-05-02

Human adenovirus (HAdV) serotypes 2, 3 and 7 are more prevalent than other serotypes and have been associated with severe pneumonia in pediatric children. Molecular typing of HAdV is not routinely performed in clinical diagnostic laboratories as it is time-consuming and labor-intensive. In the present study, we developed a triplex quantitative real-time PCR assay (tq-PCR) in a single closed tube for differential detection and quantitative analysis of HAdV serotypes 2, 3 and 7. The sensitivity, specificity, reproducibility and clinical performance of tq-PCR were evaluated. The analytical sensitivity of the tq-PCR was 100 copies/reaction for each of HAdV serotypes 2, 3 and 7, and no cross-reaction with other common respiratory viruses or HAdV serotypes 1,4,5,6,31,55 and 57 was observed. The coefficients of variation (CV) of intra-assay and inter-assay were between 0.6% to 3.6%. Of 138 previously-defined HAdV-positive nasopharyngeal aspirates samples tested, the detection agreement between tq-PCR and nested PCR was 96.38% (133/138). The proposed tq-PCR assay is a sensitive, specific and reproducible method and has the potential for clinical use in the rapid and differential detection and quantitation of HAdV serotypes 2, 3 and 7.

Nipah virus in the fruit bat Pteropus vampyrus in Sumatera, Indonesia.

Directory of Open Access Journals (Sweden)

Indrawati Sendow

Full Text Available Nipah virus causes periodic livestock and human disease with high case fatality rate, and consequent major economic, social and psychological impacts. Fruit bats of the genus Pteropus are the natural reservoir. In this study, we used real time PCR to screen the saliva and urine of P. vampyrus from North Sumatera for Nipah virus genome. A conventional reverse transcriptase (RT-PCR assay was used on provisionally positive samples to corroborate findings. This is the first report of Nipah virus detection in P. vampyrus in Sumatera, Indonesia.

fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

Science.gov (United States)

Khun, H H; Deved, V; Wong, H; Lee, B C

2000-12-01

The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

Accurate detection and quantification of the fish viral hemorrhagic Septicemia virus (VHSv with a two-color fluorometric real-time PCR assay.

Directory of Open Access Journals (Sweden)

Lindsey R Pierce

Full Text Available Viral Hemorrhagic Septicemia virus (VHSv is one of the world's most serious fish pathogens, infecting >80 marine, freshwater, and estuarine fish species from Eurasia and North America. A novel and especially virulent strain - IVb - appeared in the Great Lakes in 2003, has killed many game fish species in a series of outbreaks in subsequent years, and shut down interstate transport of baitfish. Cell culture is the diagnostic method approved by the USDA-APHIS, which takes a month or longer, lacks sensitivity, and does not quantify the amount of virus. We thus present a novel, easy, rapid, and highly sensitive real-time quantitative reverse transcription PCR (qRT-PCR assay that incorporates synthetic competitive template internal standards for quality control to circumvent false negative results. Results demonstrate high signal-to-analyte response (slope = 1.00±0.02 and a linear dynamic range that spans seven orders of magnitude (R(2 = 0.99, ranging from 6 to 6,000,000 molecules. Infected fishes are found to harbor levels of virus that range to 1,200,000 VHSv molecules/10(6 actb1 molecules with 1,000 being a rough cut-off for clinical signs of disease. This new assay is rapid, inexpensive, and has significantly greater accuracy than other published qRT-PCR tests and traditional cell culture diagnostics.

Accurate detection and quantification of the fish viral hemorrhagic Septicemia virus (VHSv) with a two-color fluorometric real-time PCR assay.

Science.gov (United States)

Pierce, Lindsey R; Willey, James C; Palsule, Vrushalee V; Yeo, Jiyoun; Shepherd, Brian S; Crawford, Erin L; Stepien, Carol A

2013-01-01

Viral Hemorrhagic Septicemia virus (VHSv) is one of the world's most serious fish pathogens, infecting >80 marine, freshwater, and estuarine fish species from Eurasia and North America. A novel and especially virulent strain - IVb - appeared in the Great Lakes in 2003, has killed many game fish species in a series of outbreaks in subsequent years, and shut down interstate transport of baitfish. Cell culture is the diagnostic method approved by the USDA-APHIS, which takes a month or longer, lacks sensitivity, and does not quantify the amount of virus. We thus present a novel, easy, rapid, and highly sensitive real-time quantitative reverse transcription PCR (qRT-PCR) assay that incorporates synthetic competitive template internal standards for quality control to circumvent false negative results. Results demonstrate high signal-to-analyte response (slope = 1.00±0.02) and a linear dynamic range that spans seven orders of magnitude (R(2) = 0.99), ranging from 6 to 6,000,000 molecules. Infected fishes are found to harbor levels of virus that range to 1,200,000 VHSv molecules/10(6) actb1 molecules with 1,000 being a rough cut-off for clinical signs of disease. This new assay is rapid, inexpensive, and has significantly greater accuracy than other published qRT-PCR tests and traditional cell culture diagnostics.

Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

Directory of Open Access Journals (Sweden)

Kwang-Pyo Kim

2015-09-01

Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.

Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses

Science.gov (United States)

Chen, Hongjun; Ye, Jianqiang; Xu, Kemin; Angel, Matthew; Shao, Hongxia; Ferrero, Andrea; Sutton, Troy; Perez, Daniel R.

2012-01-01

Since 1999, plasmid-based reverse genetics (RG) systems have revolutionized the way influenza viruses are studied. However, it is not unusual to encounter cloning difficulties for one or more influenza genes while attempting to recover virus de novo. To overcome some of these shortcomings we sought to develop partial or full plasmid-free RG systems. The influenza gene of choice is assembled into a RG competent unit by virtue of overlapping PCR reactions containing a cDNA copy of the viral gene segment under the control of RNA polymerase I promoter (pol1) and termination (t1) signals – herein referred to as Flu PCR amplicons. Transfection of tissue culture cells with either HA or NA Flu PCR amplicons and 7 plasmids encoding the remaining influenza RG units, resulted in efficient virus rescue. Likewise, transfections including both HA and NA Flu PCR amplicons and 6 RG plasmids also resulted in efficient virus rescue. In addition, influenza viruses were recovered from a full set of Flu PCR amplicons without the use of plasmids. PMID:23029501

Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A.

Science.gov (United States)

Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong

2007-06-30

Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays

Science.gov (United States)

Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

2013-01-01

Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707

A sensitive duplex nanoparticle-assisted PCR assay for identifying porcine epidemic diarrhea virus and porcine transmissible gastroenteritis virus from clinical specimens.

Science.gov (United States)

Zhu, Yu; Liang, Lin; Luo, Yakun; Wang, Guihua; Wang, Chunren; Cui, Yudong; Ai, Xia; Cui, Shangjin

2017-02-01

In this study, a novel duplex nanoparticle-assisted polymerase chain reaction (nanoPCR) assay was developed to detect porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV). Two pairs of primers were designed based on the conserved region within the N gene of PEDV and TGEV. In a screening of 114 clinical samples from four provinces in China for PEDV and TGEV, 48.2 and 3.5 % of the samples, respectively, tested positive. Under optimized conditions, the duplex nanoPCR assay had a detection limit of 7.6 × 10 1 and 8.5 × 10 1 copies μL -1 for PEDV and TGEV, respectively. The sensitivity of the duplex nanoPCR assay was ten times higher than that of a conventional PCR assay. Moreover, no fragments were amplified when the duplex nanoPCR assay was used to test samples containing other porcine viruses. Our results indicate that the duplex nanoPCR assay described here is useful for the rapid detection of PEDV and TGEV and can be applied in clinical diagnosis.

Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites

NARCIS (Netherlands)

van der Meide, Wendy; Guerra, Jorge; Schoone, Gerard; Farenhorst, Marit; Coelho, Leila; Faber, William; Peekel, Inge; Schallig, Henk

2008-01-01

DNA or RNA amplification methods for detection of Leishmania parasites have advantages regarding sensitivity and potential quantitative characteristics in comparison with conventional diagnostic methods but are often still not routinely applied. However, the use and application of molecular assays

Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

DEFF Research Database (Denmark)

Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

2002-01-01

) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect r = 0.99) over...... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

Comparison of two methods for the detection of hepatitis A virus in clam samples (Tapes spp.) by reverse transcription-nested PCR.

Science.gov (United States)

Suñén, Ester; Casas, Nerea; Moreno, Belén; Zigorraga, Carmen

2004-03-01

The detection of hepatitis A virus in shellfish by reverse transcription-nested polymerase chain reaction (RT-nested PCR) is hampered mainly by low levels of virus contamination and PCR inhibitors in shellfish. In this study, we focused on getting a rapid and sensitive processing procedure for the detection of HAV by RT-nested PCR in clam samples (Tapes spp.). Two previously developed processing methods for virus concentration in shellfish have been improved upon and compared. The first method involves acid adsorption, elution, polyethylene glycol (PEG) precipitation, chloroform extraction and PEG precipitation. The second method is based on elution with a glycine buffer at pH 10, chloroform extraction and concentration by ultracentrifugation. Final clam concentrates were processed by RNA extraction or immunomagnetic capture of viruses (IMC) before the RT-nested PCR reaction. Both methods of sample processing combined with the RNA extraction from the concentrates were very efficient when they were assayed in seeded and naturally contaminated samples. The results show that the first method was more effective in removal inhibitors and the second was simpler and faster. The IMC of HAV from clam concentrates processed by method 1 was revealed to be a very effective method of simultaneously removing residual PCR inhibitors and of concentrating the virus.

Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations.

Science.gov (United States)

Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P

2000-05-04

Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Gusti Ayu Yuniati Kencana

2013-07-01

Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

Directory of Open Access Journals (Sweden)

Mark A Winters

Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

A Robust PCR Protocol for HIV Drug Resistance Testing on Low-Level Viremia Samples

Directory of Open Access Journals (Sweden)

Shivani Gupta

2017-01-01

Full Text Available The prevalence of drug resistance (DR mutations in people with HIV-1 infection, particularly those with low-level viremia (LLV, supports the need to improve the sensitivity of amplification methods for HIV DR genotyping in order to optimize antiretroviral regimen and facilitate HIV-1 DR surveillance and relevant research. Here we report on a fully validated PCR-based protocol that achieves consistent amplification of the protease (PR and reverse transcriptase (RT regions of HIV-1 pol gene across many HIV-1 subtypes from LLV plasma samples. HIV-spiked plasma samples from the External Quality Assurance Program Oversight Laboratory (EQAPOL, covering various HIV-1 subtypes, as well as clinical specimens were used to optimize and validate the protocol. Our results demonstrate that this protocol has a broad HIV-1 subtype coverage and viral load span with high sensitivity and reproducibility. Moreover, the protocol is robust even when plasma sample volumes are limited, the HIV viral load is unknown, and/or the HIV subtype is undetermined. Thus, the protocol is applicable for the initial amplification of the HIV-1 PR and RT genes required for subsequent genotypic DR assays.

Real-time pcr (qpcr) assay for rhizoctonia solani anastomoses group ag2-2 iiib

International Nuclear Information System (INIS)

Abbas, S.J.; Ahmad, B.

2014-01-01

Rhizoctonia solani anastomosis group AG2-2 IIIB is a severe sugar beet and maize pathogen. It causes crown and root rot disease which leads to yield losses world-wide. The soil-borne pathogen is difficult to detect and quantify by conventional methods. We developed a real-time PCR (qPCR) assay for the quantification of genomic DNA of Rhizoctonia solani AG2-2 IIIB based on the ITS region of rDNA genes. The limit of quantification of the assay is 1.8 pg genomic DNA. The amplification efficiency was 96.4. The assay will be helpful in the diagnoses of Rhizoctonia solani infection of sugar beet and maize roots and in the quantification of R. solani AG2-2 IIIB inoculum in plant debris and soil. (author)