Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors
DEFF Research Database (Denmark)
Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran
2017-01-01
BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...
International Nuclear Information System (INIS)
Spadafora, C.; Sciamanna, I.; Misteli, T.
2009-01-01
Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
Immune pressure analysis of protease and reverse transcriptase ...
African Journals Online (AJOL)
/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...
Directory of Open Access Journals (Sweden)
Ana Luiza Chaves Valadão
2015-06-01
Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.
Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W
2012-05-01
Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.
Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina
2013-01-01
The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences
Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.
Directory of Open Access Journals (Sweden)
Anna Figueiredo
2006-11-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase
DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami
2012-01-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...
Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification
Energy Technology Data Exchange (ETDEWEB)
Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P
2011-12-08
RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2013-11-01
Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.
International Nuclear Information System (INIS)
Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.
2004-01-01
Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies
Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M
2018-01-01
Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-07-01
HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.
NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Energy Technology Data Exchange (ETDEWEB)
Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)
2016-12-15
The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.
Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon
2015-08-01
The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
Directory of Open Access Journals (Sweden)
Lucianna Helene Santos
2015-11-01
Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.
2011-01-01
The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who
Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.
Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E
2013-06-18
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X
2002-12-01
Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.
International Nuclear Information System (INIS)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki
2015-01-01
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)
2015-10-23
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.
Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
Directory of Open Access Journals (Sweden)
Ma Bi
2017-10-01
Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.
Oude Essink, B. B.; Das, A. T.; Berkhout, B.
1995-01-01
Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A
2013-11-01
Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko
2011-01-01
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.
Reverse transcriptase inhibitors as potential colorectal microbicides.
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J
2009-05-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano
2017-01-17
Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.
Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong
2018-01-01
As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.
2009-01-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
International Nuclear Information System (INIS)
Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado
2011-01-01
LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy
2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase
International Nuclear Information System (INIS)
Starnes, M.C.
1988-01-01
2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells
Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.
2010-01-01
Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved
Directory of Open Access Journals (Sweden)
Warrilow David
2008-12-01
Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.
Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A
2011-01-01
We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Gronenborn Angela M
2010-05-01
Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.
[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].
Tarasova, O A; Filimonov, D A; Poroikov, V V
2017-10-01
Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.
Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles
International Nuclear Information System (INIS)
Bavand, M.R.; Laub, O.
1988-01-01
Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C
2000-05-18
To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.
Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J
2009-06-01
Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.
A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome
Directory of Open Access Journals (Sweden)
Marcin Kierczak
2009-10-01
Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.
Directory of Open Access Journals (Sweden)
Ilaria eSciamanna
2016-02-01
Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado
2016-02-01
In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z
2017-07-11
Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From
I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)
2015-01-01
textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have
Lescot, Magali
2015-11-27
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki
2015-01-01
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity
House, M.L.; Kim, C.H.; Reno, P.W.
1998-01-01
Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.
Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S
2014-06-01
The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447
International Nuclear Information System (INIS)
Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin
2008-01-01
Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems
Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan
2012-01-01
The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.
DEFF Research Database (Denmark)
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy
2011-01-01
Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Zhu, Tao; Niu, Deng-Ke
2013-03-05
Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.
Directory of Open Access Journals (Sweden)
Niu Meijuan
2004-10-01
Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.
Directory of Open Access Journals (Sweden)
Meytal Galilee
2018-01-01
Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study
Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami
2017-06-01
We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.
Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni
2005-01-01
Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294
International Nuclear Information System (INIS)
Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.
1986-01-01
The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
Directory of Open Access Journals (Sweden)
Sukrit Silas
2017-07-01
Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.
DEFF Research Database (Denmark)
Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin
2013-01-01
Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...
Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?
Nolan, David
2005-01-01
Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Pedersen Niels C
2007-04-01
Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi
2017-12-01
We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.
Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M
2017-12-01
Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these
Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind
2014-04-01
A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.
Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael
2012-01-01
Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...
Reverse transcriptase inhibitors as microbicides.
Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido
2012-01-01
The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.
Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory
Directory of Open Access Journals (Sweden)
Edward J. Steele
2017-11-01
Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.
Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis
2013-12-23
At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-11-01
Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.
Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan
2010-12-12
Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.
Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao
2015-10-01
Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.
Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L
1999-12-17
Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.
The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.
Zhao, Chen; Pyle, Anna Marie
2017-12-01
The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun
2016-11-01
A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.
Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong
2012-01-01
1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.
Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania
2018-02-01
Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
Collins, Kathleen; Nilsen, Timothy W
2013-08-01
Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.
Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel
1972-01-01
Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137
International Nuclear Information System (INIS)
Zhu Hanneng; Chen Wenying; Xiong Sidong
2000-01-01
Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)
RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza
DEFF Research Database (Denmark)
Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen
2003-01-01
A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...
Directory of Open Access Journals (Sweden)
Ajay Kumar
2010-01-01
Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
Directory of Open Access Journals (Sweden)
Jessica H Brehm
Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.
de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A
2013-01-01
BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared
DEFF Research Database (Denmark)
Dybkær, Karen; Munch, Mette; Handberg, Kurt J.
2004-01-01
Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...
Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang
2017-06-16
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Gnanasekaran, Ramachandran
2017-11-08
We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.
Directory of Open Access Journals (Sweden)
Jie Xu
Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.
RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza
DEFF Research Database (Denmark)
Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen
2003-01-01
A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....
Directory of Open Access Journals (Sweden)
Alessandra M. T. de Souza
2013-10-01
Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.
Directory of Open Access Journals (Sweden)
Johnson Barry C
2012-12-01
Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.
Directory of Open Access Journals (Sweden)
Parvathi Chary
Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.
The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers
Oude Essink, B. B.; Berkhout, B.
1999-01-01
Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by
Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni
2008-09-01
We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.
DEFF Research Database (Denmark)
Lundgren, Jens
2008-01-01
BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad
2016-05-01
Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.
DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA
Directory of Open Access Journals (Sweden)
Sumit Chowdhury
2016-12-01
Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.
Energy Technology Data Exchange (ETDEWEB)
Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy
2017-04-10
HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.
Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang
2017-12-01
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50 = 0.04 μM) with decent antiviral potency (EC 50 = 7.4 μM) and no cytotoxicity (CC 50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Spackman, Erica; Suarez, David L
2005-01-01
Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.
Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo
2017-08-31
In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Calogero, A; Hospers, GAP; Timmer-Bosscha, H; Mulder, NH; Schraffordt Koops, H.
2000-01-01
The reverse transcriptase polymerase chain reaction (RT-PCR) can be of clinical relevance in identifying malignant melanoma cells in blood or tissues of patients at risk for disseminated melanoma. The diagnostic value of this marker however, is still controversial. The objective of this study was to
Energy Technology Data Exchange (ETDEWEB)
Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.
2017-02-06
The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma
Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...
Directory of Open Access Journals (Sweden)
Tandale Babasaheb V
2008-12-01
Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy
R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)
2013-01-01
textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the
Directory of Open Access Journals (Sweden)
FIGUEIREDO Luiz Tadeu Moraes
1997-01-01
Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination
DEFF Research Database (Denmark)
Borges, Álvaro H; Lundh, Andreas; Tendal, Britta
2016-01-01
BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...
Directory of Open Access Journals (Sweden)
Turyadi Turyadi
2018-01-01
Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase. Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
Li, Runqin; Zhang, Yinglin
2016-01-01
Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632
Sivan, Sree Kanth; Manga, Vijjulatha
2010-06-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.
Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N
2005-05-01
To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.
DEFF Research Database (Denmark)
Kirk, Ole; Lundgren, Jens D; Pedersen, Court
2003-01-01
BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....
Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P
2000-05-04
Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.
Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.
Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V
2011-12-20
Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.
Directory of Open Access Journals (Sweden)
Elisabeth Humphris-Narayanan
Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.
Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F
2008-10-01
Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association
Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake
2017-11-22
Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.
Directory of Open Access Journals (Sweden)
Winny Xie
2013-12-01
Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.
Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio
2016-09-30
We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.
MZC Gel Inhibits SHIV-RT and HSV-2 in Macaque Vaginal Mucosa and SHIV-RT in Rectal Mucosa.
Calenda, Giulia; Villegas, Guillermo; Barnable, Patrick; Litterst, Claudia; Levendosky, Keith; Gettie, Agegnehu; Cooney, Michael L; Blanchard, James; Fernández-Romero, José A; Zydowsky, Thomas M; Teleshova, Natalia
2017-03-01
The Population Council's microbicide gel MZC (also known as PC-1005) containing MIV-150 and zinc acetate dihydrate (ZA) in carrageenan (CG) has shown promise as a broad-spectrum microbicide against HIV, herpes simplex virus (HSV), and human papillomavirus. Previous data show antiviral activity against these viruses in cell-based assays, prevention of vaginal and rectal simian-human immunodeficiency virus reverse transcriptase (SHIV-RT) infection, and reduction of vaginal HSV shedding in rhesus macaques and also excellent antiviral activity against HSV and human papillomavirus in murine models. Recently, we demonstrated that MZC is safe and effective against SHIV-RT in macaque vaginal explants. Here we established models of ex vivo SHIV-RT/HSV-2 coinfection of vaginal mucosa and SHIV-RT infection of rectal mucosa in macaques (challenge of rectal mucosa with HSV-2 did not result in reproducible tissue infection), evaluated antiviral activity of MZC, and compared quantitative polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay readouts for monitoring SHIV-RT infection. MZC (at nontoxic dilutions) significantly inhibited SHIV-RT in vaginal and rectal mucosas and HSV-2 in vaginal mucosa when present during viral challenge. Analysis of SHIV-RT infection and MZC activity by 1-step simian immunodeficiency virus gag quantitative RT-PCR and p27 enzyme-linked immunosorbent assay demonstrated similar virus growth dynamics and MZC activity by both methods and higher sensitivity of quantitative RT-PCR. Our data provide more evidence that MZC is a promising dual compartment multipurpose prevention technology candidate.
Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.
2004-01-01
Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add
Directory of Open Access Journals (Sweden)
Amanda E Calvert
Full Text Available Zika virus (ZIKV has emerged as a major global public health concern in the last two years due to its link as a causative agent of human birth defects. Its rapid expansion into the Western Hemisphere as well as the ability to be transmitted from mother to fetus, through sexual transmission and possibly through blood transfusions has increased the need for a rapid and expansive public health response to this unprecedented epidemic. A non-invasive and rapid ZIKV diagnostic screening assay that can be performed in a clinical setting throughout pregnancy is vital for prenatal care of women living in areas of the world where exposure to the virus is possible. To meet this need we have developed a sensitive and specific reverse transcriptase loop-mediated isothermal amplification (RT-LAMP assay to detect ZIKV RNA in urine and serum with a simple visual detection. RT-LAMP results were shown to have a limit of detection 10-fold higher than qRT-PCR. As little as 1.2 RNA copies/μl was detected by RT-LAMP from a panel of 178 diagnostic specimens. The assay was shown to be highly specific for ZIKV RNA when tested with diagnostic specimens positive for dengue virus (DENV and chikungunya virus (CHIKV. The assay described here illustrates the potential for a fast, reliable, sensitive and specific assay for the detection of ZIKV from urine or serum that can be performed in a clinical or field setting with minimal equipment and technological expertise.
Nicolas Sluis-Cremer
2014-01-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
Directory of Open Access Journals (Sweden)
Atsuko Hachiya
2011-01-01
Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.
Directory of Open Access Journals (Sweden)
Meng Shuang
2010-06-01
Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.
International Nuclear Information System (INIS)
Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.
2006-01-01
Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)
Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong
2013-01-01
In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-07-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.
Directory of Open Access Journals (Sweden)
Johannes Van Staden
2010-10-01
Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.
Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda
2016-01-01
Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.
Directory of Open Access Journals (Sweden)
Nike Susanti
2016-07-01
Full Text Available AbstrakLatar belakang: Virus polio indigenous terakhir ditemukan di Indonesia tahun 1995 tetapi ancaman viruspolio impor dan mutasi virus dari Oral Polio Vaccine (OPV menjadi Vaccine Derived Poliovirus (VDPVmasih berlanjut. Tahun 1991 WHO mengembangkan Surveilans Acute Flaccid Paralysis (AFP dan tahun2014, identifikasi virus polio dengan real-time reverse transcriptase Polymerase Chain Reaction (rRTPCRmulai digunakan di Laboratorium Nasional Polio Pusat Biomedis dan Teknologi Dasar Kesehatan.Tujuan dari penggunaan rRT-PCR untuk mendapatkan metode yang cepat dan lebih baik dalam memantausirkulasi dan mutasi virus polio.Metode: Isolat polio positif diidentifikasi menggunakanan rRT PCR dengan kombinasi primer dan probeyang ditetapkan WHO. RNA virus di konversi ke cDNA menggunakan reverse transcriptase lalu diamplifikasimenggunakan taq polymerase. Produk PCR di deteksi dan diidentifikasi dengan hibridisasi menggunakanprobe spesifik. Sintesis cDNA dan reaksi PCR menggunakan primer yang dilekatkan di probe. Kombinasiprimer dan probe menghasilkan identifikasi serotipe dan intratypic differentiation (ITD dari isolat virus.Hasil: Selama tahun 2014, NPL Jakarta menerima 604 kasus AFP dari surveilans dan lima kasusterdeteksi positif mengandung virus polio. Semua spesimen positif mengandung virus polio yang berasaldari vaksin. Dua kasus positif virus polio tipe P2 (40%, satu kasus jenis virus polio P1 (20%, 1 kasusjenis virus polio P3 (20% dan satu kasus virus polio campuran jenis P1 + P2 (20%.Kesimpulan: Real-time PCR dapat digunakan di Laboratorium Polio Jakarta untuk membantu identifikasivirus Polio secara cepat. Tes ini dapat digunakan untuk memantau sirkulasi virus polio pada populasiyang rutin diimunisasi dengan OPV. (Health Science Journal of Indonesia 2016;7:27-31Kata kunci: ITD, Poliovirus, Identification, rRT-PCR AbstractBackground: The last indigenous polio was detected in 1995 but the threat of wild type polio viruses and themutation of Oral
Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret
2003-12-01
A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.
MIV-150-containing intravaginal rings protect macaque vaginal explants against SHIV-RT infection.
Ouattara, Louise A; Barnable, Patrick; Mawson, Paul; Seidor, Samantha; Zydowsky, Thomas M; Kizima, Larisa; Rodriguez, Aixa; Fernández-Romero, José A; Cooney, Michael L; Roberts, Kevin D; Gettie, Agegnehu; Blanchard, James; Robbiani, Melissa; Teleshova, Natalia
2014-05-01
Recent studies demonstrated that intravaginal rings (IVRs) containing 100 mg of the nonnucleoside reverse transcriptase inhibitor (NNRTI) MIV-150 significantly protect macaques against a chimeric simian-human immunodeficiency virus that expresses the HIV-1 HxB2 reverse transcriptase (SHIV-RT) when present before and after vaginal challenge. The objectives of this study were to (i) evaluate the pharmacodynamics (PD) of MIV-150 in vaginal fluids (VF) and in ectocervical and vaginal tissues following 100-mg MIV-150 IVR exposure and to (ii) gain more insight whether pharmacokinetics (PK) of MIV-150 can predict PD. MIV-150 in VF collected at 1 day and 14 days post-MIV-150 IVR insertion inhibited ex vivo SHIV-RT infection in vaginal biopsy specimens from untreated animals (not carrying IVRs) in a dose-dependent manner. Previous PK studies demonstrated a significant increase of ectocervical and vaginal tissue MIV-150 concentrations 14 days versus 1 day post-IVR insertion, with the highest increase in vaginal tissue. Therefore, we tested PD of MIV-150 in tissues 14 days post-MIV-150 IVR insertion. Ex vivo SHIV-RT infection of vaginal, but not ectocervical, tissues collected 14 days post-MIV-150 IVR insertion was significantly inhibited compared to infection at the baseline (prior to MIV-150 IVR exposure). No changes in vaginal and ectocervical tissue infection were observed after placebo IVR exposure. Overall, these data underscore the use of the ex vivo macaque explant challenge models to evaluate tissue and VF PK/PD of candidate microbicides before in vivo animal efficacy studies. The data support further development of MIV-150-containing IVRs.
Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.
Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari
2018-05-03
Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.
Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.
Sharma, Mamta; Saravolatz, Louis D
2013-02-01
Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.
International Nuclear Information System (INIS)
Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong
2007-01-01
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation
Energy Technology Data Exchange (ETDEWEB)
Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn
2007-04-06
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.
Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-01-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2010-03-01
Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.
Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark
2009-01-01
Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161
Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.
2017-10-01
The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.
The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.
Directory of Open Access Journals (Sweden)
Dolores Bautista-España
Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.
Directory of Open Access Journals (Sweden)
Soo-Huey Yap
2007-12-01
Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which
Directory of Open Access Journals (Sweden)
W. Ali
2017-06-01
Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2008-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...
International Nuclear Information System (INIS)
Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong
2005-01-01
The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)
Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui
2010-01-01
Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...
Amendola, R
1994-11-01
The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.
Directory of Open Access Journals (Sweden)
Francesca Carlini
Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.
DEFF Research Database (Denmark)
Dukes, J.P.; King, D.P.; Alexandersen, Søren
2006-01-01
Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...
Directory of Open Access Journals (Sweden)
Mark A Winters
Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.
Czech Academy of Sciences Publication Activity Database
Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko
2016-01-01
Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016
Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M
2016-04-01
Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.
A second chance for telomerase reverse transcriptase in anticancer immunotherapy.
Zanetti, Maurizio
2017-02-01
Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.
Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram
2003-01-01
Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we
Directory of Open Access Journals (Sweden)
Weizi Liang
Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W
2014-09-01
Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We
Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd
2013-11-05
Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable
Directory of Open Access Journals (Sweden)
Lapadula Giuseppe
2007-05-01
Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.
Directory of Open Access Journals (Sweden)
Chen Hao-tai
2011-10-01
Full Text Available Abstract A reverse transcriptase loop-mediated isothermal amplification (RT-LAMP assay was rapidly used to detect serotype Asia 1 of foot-and-mouth disease virus (FMDV within 45 min at 61°C. All FMDV serotype Asia 1 reference strains were positive by RT-LAMP, while other viruses such as FMDV serotypes O, C, A and classical swine fever virus, swine vesicular disease virus, porcine reproductive and respiratory syndrome virus and Japanese encephalitis virus remained negative. Furthermore, FMDV sreotype Asia 1 positive samples were able to detect by RT-LAMP assay. This RT-LAMP assay may be suitable particularly for diagnosis of FMDV serotype Asia 1 infection in field stations.
Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C
2018-02-15
Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.
Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin
2017-04-01
Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.
International Nuclear Information System (INIS)
Niezgoda, J.; Wronska-Fortuna, D.; Sechman, A.; Bobek, S.; Sowa, J.
1994-01-01
It has been established that 3.3',5-triiodothyronine (T 3 ) acts hipermetabolically, whereas 3'3.5'-triiodothyronine (reverse T 3 , rT 3 ) acts hypometabolically. The normal ratio of T 3 to rT 3 in domestic flows fluctuates around 10. Since the excess of T 3 may promote catabolic processes and lower weight gain, the aim of this experiment was to find the optimal ratio of T 3 :rT 3 in blood plasma which corresponds with the greatest weight gain in Japanese quail. Reverse T 3 was given in drinking water (1 μg rT 3 /ml) for 3, 10, 20 or 30 days. It has been found that T 3 /rT 3 ratio of about 5, after 20 days of rT 3 administration, stimulated the weight gain of Japanese quail of both sexes from 7 to 44% with more pronounced effect in female birds. (author). 26 refs, 4 figs, 1 tab
TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats
Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin
2011-01-01
In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472
PpRT1: the first complete gypsy-like retrotransposon isolated in Pinus pinaster.
Rocheta, Margarida; Cordeiro, Jorge; Oliveira, M; Miguel, Célia
2007-02-01
We have isolated and characterized a complete retrotransposon sequence, named PpRT1, from the genome of Pinus pinaster. PpRT1 is 5,966 bp long and is closely related to IFG7 gypsy retrotransposon from Pinus radiata. The long terminal repeats (LTRs) have 333 bp each and show a 5.4% sequence divergence between them. In addition to the characteristic polypurine tract (PPT) and the primer binding site (PBS), PpRT1 carries internal regions with homology to retroviral genes gag and pol. The pol region contains sequence motifs related to the enzymes protease, reverse transcriptase, RNAseH and integrase in the same typical order known for Ty3/gypsy-like retrotransposons. PpRT1 was extended from an EST database sequence indicating that its transcription is occurring in pine tissues. Southern blot analyses indicate however, that PpRT1 is present in a unique or a low number of copies in the P. pinaster genome. The differences in nucleotide sequence found between PpRT1 and IFG7 may explain the strikingly different copy number in the two pine species genome. Based on the homologies observed when comparing LTR region among different gypsy elements we propose that the highly conserved LTR regions may be useful to amplify other retrotransposon sequences of the same or close retrotransposon family.
International Nuclear Information System (INIS)
Ferkous, F.; Saihi, Y.
2018-01-01
Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells
Directory of Open Access Journals (Sweden)
Yong Teng
2014-02-01
Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.
Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul
2004-01-01
The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562
A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-06-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin
2017-08-02
Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.
Directory of Open Access Journals (Sweden)
Oluwafeyisetan O. Adebiyi
2015-12-01
Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
Energy Technology Data Exchange (ETDEWEB)
Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)
2010-03-26
The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.
Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong
2007-06-30
Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.
DEFF Research Database (Denmark)
Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens
2012-01-01
Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...
(3,4-dihydroisoquinolin-2(1H)-yl)
Indian Academy of Sciences (India)
Administrator
HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.
Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark
2013-11-01
BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.
Directory of Open Access Journals (Sweden)
Qin E-de
2010-06-01
Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.
LENUS (Irish Health Repository)
Bansode, Vijay B
2011-10-13
Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge
International Nuclear Information System (INIS)
Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key
2016-01-01
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)
2016-08-26
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
Directory of Open Access Journals (Sweden)
Crumpacker Clyde S
2011-01-01
Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus
Directory of Open Access Journals (Sweden)
Wang Xiang
2012-07-01
Full Text Available Abstract Background Human metapneumovirus (hMPV is a major cause of acute respiratory infections ranging from wheezing to bronchiolitis and pneumonia in children worldwide. The objective of this study is to develop a visual reverse transcription loop-mediated isothermal amplification (RT-LAMP assay for the detection of hMPV and applied to the clinical samples. Results In this study, visual RT-LAMP assay for hMPV was performed in one step with the addition of hydroxynaphthol blue (HNB, and were used to detect respiratory samples. Six primers, including two outer primers (F3 and B3, two inner primers (FIP, BIP and two loop primers (LF and LB, were designed for hMPV N gene by the online software. Moreover, the RT-LAMP assay showed good specificity and no cross-reactivity was observed with human rhinovirus (HRV, human respiratory syncytial Virus (RSV, or influenza virus A/PR/8/34 (H1N1. The detection limit of the RT-LAMP assay was approximately ten viral RNA copies, lower than that of traditional reverse transcriptase polymerase chain reaction (RT-PCR 100 RNA copies. In the 176 nasopharyngeal samples, 23 (13.1% were conformed as hMPV positive by RT-LAMP, but 18 (10.2% positive by RT-PCR. Conclusion Compared with conventional RT-PCR, the visual hMPV RT-LAMP assay performed well in the aspect of detect time, sensitivity, specificity and visibility. It is anticipated that the RT-LAMP will be used for clinical tests in hospital or field testing during outbreaks and in emergency.
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-01-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...
DEFF Research Database (Denmark)
Fox, Zoe; Phillips, Andrew; Cohen, Cal
2008-01-01
the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...
Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer
International Nuclear Information System (INIS)
Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen
2001-01-01
Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts
Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano
2005-01-13
Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.
Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella
2005-01-01
The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650
Prevalence of genotypic HIV-1 drug resistance in Thailand, 2002
Directory of Open Access Journals (Sweden)
Watitpun Chotip
2003-03-01
Full Text Available Abstract Background The prices of reverse transcriptase (RT inhibitors in Thailand have been reduced since December 1, 2001. It is expected that reduction in the price of these inhibitors may influence the drug resistance mutation pattern of HIV-1 among infected people. This study reports the frequency of HIV-1 genetic mutation associated with drug resistance in antiretroviral-treated patients from Thailand. Methods Genotypic resistance testing was performed on samples collected in 2002 from 88 HIV-1 infected individuals. Automated DNA sequencing was used to genotype the HIV-1 polymerase gene isolated from patients' plasma. Results Resistance to protease inhibitors, nucleoside and non-nucleoside reverse transcriptase inhibitors were found in 10 (12%, 42 (48% and 19 (21% patients, respectively. The most common drug resistance mutations in the protease gene were at codon 82 (8%, 90 (7% and 54 (6%, whereas resistant mutations at codon 215 (45%, 67 (40%, 41 (38% and 184 (27% were commonly found in the RT gene. This finding indicates that genotypic resistance to nucleoside reverse transcriptase inhibitors was prevalent in 2002. The frequency of resistant mutations corresponding to non-nucleoside reverse transcriptase inhibitors was three times higher-, while resistant mutation corresponding to protease inhibitors was two times lower than those frequencies determined in 2001. Conclusion This study shows that the frequencies of RT inhibitor resistance mutations have been increased after the reduction in the price of RT inhibitors since December 2001. We believe that this was an important factor that influenced the mutation patterns of HIV-1 protease and RT genes in Thailand.
Reverse transcriptase directs viral evolution in a deep ocean methane seep
Paul, B. G.; Bagby, S. C.
2013-12-01
Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Sluis-Cremer, Nicolas
2014-07-31
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
The role of pleural fluid MAGE RT-nested PCR in the diagnosis of malignant pleural effusion.
Jeon, Eun Ju; Park, Hye Kyeong; Jeon, Kyeongman; Koh, Won-Jung; Suh, Gee Young; Chung, Man Pyo; Kim, Hojoong; Kwon, O Jung; Ki, Chang-Seok; Kim, Jong-Won; Shim, Young Mog; Um, Sang-Won
2012-11-01
Melanoma antigen (MAGE) genes are expressed in tumor cells, the testis and the placenta. The purpose of this prospective study was to investigate the sensitivity, specificity, and accuracy of the carcinoembryonic antigen (CEA), MAGE reverse transcriptase-nested polymerase chain reaction (RT-nested PCR), and cytology of pleural fluid in the diagnosis of malignant pleural effusion. Patients in whom unilateral pleural effusion was identified on chest radiography from January to December 2009 were included in the study. MAGE genes were analyzed by RT-nested PCR using MAGE A1-6 common primers. Of 81 enrolled patients, 46 were diagnosed as malignant pleural effusion, and 24 were diagnosed as benign pleural effusion. The diagnoses of 11 patients were not confirmed in this study. The diagnostic sensitivity, specificity, and accuracy of MAGE RT-nested PCR were 61.4%, 95.7%, and 73.1%, respectively. The diagnostic sensitivities of cytology and CEA (>5 ng/mL) were 61.4% and 75.0%, respectively. Among 17 patients with negative cytology who had malignant pleural effusion, 12 and 10 patients were positive for CEA (>5.0 ng/mL) and MAGE RT-nested PCR, respectively. However, of five patients with malignant pleural effusion that was not recognized by cytology and CEA, MAGE RT-nested PCR correctly predicted a malignant etiology in only one additional patient (20%). MAGE RT-nested PCR seems to add little on the combination of conventional methods in the diagnosis of malignant effusion. © 2012 Tianjin Lung Cancer Institute and Wiley Publishing Asia Pty. Ltd.
DEFF Research Database (Denmark)
Uhrbrand, Katrine; Myrmel, Mette; Maunula, Leena
2010-01-01
Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently to evalu......Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently...
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.
Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .
Directory of Open Access Journals (Sweden)
Seung-Yeol Lee
2014-12-01
Full Text Available The incidence of Cherry necrotic rusty mottle virus (CNRMV and Cherry green ring mottle virus (CGRMV have recently been occurred in Korea, posing a problem for sweet cherry cultivation. Since infected trees have symptomless leaves or ring-like spots on the pericarp, it is difficult to identify a viral infection. In this study, the incidence of CNRMV and CGRMV in sweet cherry in Gyeongbuk province was surveyed using a newly developed duplex reverse transcriptase polymerase chain reaction (RT-PCR method that can detect both viruses in a single reaction. CNRMV and CGRMV co-infection rates were 29.6%, 53.6%, and 17.6%, respectively, in samples collected from three different sites (Daegu, Gyeongju and Gyeongsan in Gyeongbuk province during 2012 and 2013. This duplex RT-PCR method offers a simple, rapid, and effective way of identifying CNRMV and CGRMV simultaneously in sweet cherry trees, which can aid in the management of viral infections that could undermine yield.
Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre
2012-04-01
The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc
2011-07-01
Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
International Nuclear Information System (INIS)
Montero Bonilla, Andrei
2014-01-01
Respiratory viruses are diagnosed through reverse transcriptase polymerase chain reaction (RT-PCR) in people with acute respiratory disease of the Area de Salud Pavas, Area de Salud Paraiso and Hospital Nacional de Ninos. The frequency of respiratory viruses are determined in the samples analyzed in the study population. The presence of viral coinfections is identified in the samples analyzed. The frequency of patients with respiratory viruses is categorized according to age in the study population. The frequency of respiratory viruses is examined between the studied geographic regions (Pavas and Paraiso). The results found by RT-PCR are compared with the frequency data reported with the direct immunofluorescence technique [es
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2014-07-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju
2016-10-01
Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.
Thanarajoo, Sathis Sri; Kong, Lih Ling; Kadir, Jugah; Lau, Wei Hongi; Vadamalai, Ganesan
2014-06-01
A reverse transcription loop-mediated isothermal amplification (RT-LAMP) detected Coconut cadang-cadang viroid (CCCVd) within 60 min at 60 °C in total nucleic acid extracted from oil palm leaves infected with CCCVd. Positive reactions showed colour change from orange to green in the reaction mix after the addition of fluorescent reagent, and a laddering pattern band on 2% agarose gel electrophoresis. Conventional RT-PCR with LAMP primers produced amplicons with a sequence identical to the 297-nt CCCVd oil palm variant with the primers being specific for CCCVd and not for other viroids such as PSTVd and CEVd. RT-LAMP was found to be rapid and specific for detecting oil palm CCCVd. Copyright © 2014 Elsevier B.V. All rights reserved.
Ma, Xiongchao; Sun, Baozhen; Zhu, Fei
2018-02-01
This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Munch, M.; Nielsen, L.P.; Handberg, Kurt
2001-01-01
A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...
Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong
2018-06-18
We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H = 1.77 μM, IC 50 IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Ding, Xiong; Nie, Kai; Shi, Lei; Zhang, Yong; Guan, Li; Zhang, Dan; Qi, Shunxiang; Ma, Xuejun
2014-06-01
Rapid detection of human enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) is important in the early phase of hand-foot-and-mouth disease (HFMD). In this study, we developed and evaluated a novel reverse transcription-isothermal multiple-self-matching-initiated amplification (RT-IMSA) assay for the rapid detection of EV71 and CVA16 by use of reverse transcriptase, together with a strand displacement DNA polymerase. Real-time RT-IMSA assays using a turbidimeter and visual RT-IMSA assays to detect EV71 and CVA16 were established and completed in 1 h, and the reported corresponding real-time reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assays targeting the same regions of the VP1 gene were adopted as parallel tests. Through testing VP1 RNAs transcribed in vitro, the real-time RT-IMSA assays exhibited better linearity of quantification, with R(2) values of 0.952 (for EV71) and 0.967 (for CVA16), than the real-time RT-LAMP assays, which had R(2) values of 0.803 (for EV71) and 0.904 (for CVA16). Additionally, the detection limits of the real-time RT-IMSA assays (approximately 937 for EV71 and 67 for CVA16 copies/reaction) were higher than those of real-time RT-LAMP assays (approximately 3,266 for EV71 and 430 for CVA16 copies/reaction), and similar results were observed in the visual RT-IMSA assays. The new approaches also possess high specificities for the corresponding targets, with no cross-reactivity observed. In clinical assessment, compared to commercial reverse transcription-quantitative PCR (qRT-PCR) kits, the diagnostic sensitivities of the real-time RT-IMSA assays (96.4% for EV71 and 94.6% for CVA16) were higher than those of the real-time RT-LAMP assays (91.1% for EV71 and 90.8% for CVA16). The visual RT-IMSA assays also exhibited the same results. In conclusion, this proof-of-concept study suggests that the novel RT-IMSA assay is superior to the RT-LAMP assay in terms of detection limit and has the potential to rapidly detect EV71
Fang, Evandro Fei; Ng, Tzi Bun
2015-04-01
Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.
Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis
2017-02-01
Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.
3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors
Directory of Open Access Journals (Sweden)
S. Ganguly
2008-01-01
Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.
Directory of Open Access Journals (Sweden)
St-Pierre Tim G
2009-05-01
Full Text Available Abstract Background The magnetic properties of Plasmodium-infected erythrocytes have been exploited for different clinical and research purposes. A recent study in a rural clinical setting in Papua New Guinea has demonstrated that Plasmodium falciparum gametocyte detection is facilitated by magnetic deposition microscopy but no study has yet determined the relative sensitivity and limit of detection of a magnetic fractionation technique. The present study compares the detection limit and sensitivity of a technique based on the use of commercially available magnetic fractionation columns with those for thick blood film microscopy and reverse transcriptase polymerase chain reaction (RT-PCR methods. Methods Gametocyte detection in six series of dilutions of cultured P. falciparum parasites with known gametocytaemia was conducted using magnetic fractionation, thick blood film, and RT-PCR techniques. Results The preparations obtained by the magnetic fractionation method were of thin film quality allowing easy gametocyte identification by light microscopy. Magnetic fractionation had a higher sensitivity and approximately two orders of magnitude better limit of detection than thick blood film microscopy. Gametocytes were also more readily detectable on the magnetically fractionated preparations. Magnetic fractionation had a similar limit of detection to that of RT-PCR. Conclusion Magnetic fractionation is a highly sensitive and convenient method for gametocyte detection in comparison with the standard thick blood film and RT-PCR methods, and could readily be adapted to field application.
DEFF Research Database (Denmark)
Rosa, Fabíola E; Caldeira, José R F; Felipes, Joice
2008-01-01
To elucidate the molecular profile of hormonal steroid receptor status, we analyzed ER-alpha, ER-beta, and PGR mRNA and protein expression in 80 breast carcinomas using reverse transcriptase polymerase chain reaction (RT-PCR), quantitative RT-PCR, and immunohistochemical analysis. Qualitative ana...
Imidazo[1,2-a]pyridines as NNRTIs
CSIR Research Space (South Africa)
Bode, ML
2010-01-01
Full Text Available The enzyme reverse transcriptase (RT) is a validated target for the development of anti-HIV drugs. Drugs acting against RT may act at either the catalytic site (NRTIs) or the allosteric site (NNRTIs). During random screening of a small in...
Ngai, Patrick H K; Ng, T B
2003-11-14
From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.
Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.
Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi
2005-03-01
We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.
Li, An; Ziehr, Jessica L; Johnson, Kenneth A
2017-04-21
Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Markowitz, Martin; Sarafianos, Stefan G
2018-07-01
4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.
RT-PCR for confirmation of echovirus 30 isolated in Belém, Brazil
Directory of Open Access Journals (Sweden)
Maria de Lourdes C. Gomes
Full Text Available Echovirus (Echo 30 or human enterovirus B is the most frequent enterovirus associated with meningitis cases. Epidemics and outbreaks of this disease caused by Echo 30 have occurred in several countries. In Brazil, Echo 30 has been isolated from sporadic cases and outbreaks that occurred mainly in the south and southeast regions. We used RT-PCR to examine Echo 30 isolates from meningitis cases detected from March 2002 to December 2003 in Belém, state of Pará, in northern Brazil. The patients were attended in a Basic Health Unit (State Health Secretary of Pará, where cerebrospinal fluid (CSF was collected and stored in liquid nitrogen. Weekly visits were made by technicians from Evandro Chagas Institute to the health unit and samples were stored at -70ºC in the laboratory until use. HEp-2 and RD cell lines were used for viral isolation and neutralization with specific antisera for viral identification. RNA extraction was made using Trizol reagent. The RT-PCR was made in one step, and the total mixture (50 µL was composed of: RNA, reaction buffer, dNTP, primers, Rnase inhibitor, reverse transcriptase, Taq polymerase and water. The products were visualized in agarose gel stained with ethidium bromide, visualized under UV light. Among the 279 CSF samples examined, 30 (10.7% were EV positive, 29 being Echo 30 and one was Cox B. Nineteen Echo 30 were examined with RT-PCR; 18 tested positive (762 and 494 base pairs. The use of this technique permitted viral identification in less time than usual, which benefits the patient and is of importance for public-health interventions.
Directory of Open Access Journals (Sweden)
Cha YJ
2014-09-01
Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600
Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin
2010-01-01
The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
André F A Santos
Full Text Available BACKGROUND: Although extensive HIV drug resistance information is available for the first 400 amino acids of its reverse transcriptase, the impact of antiretroviral treatment in C-terminal domains of Pol (thumb, connection and RNase H is poorly understood. METHODS AND FINDINGS: We wanted to characterize conserved regions in RT C-terminal domains among HIV-1 group M subtypes and CRF. Additionally, we wished to identify NRTI-related mutations in HIV-1 RT C-terminal domains. We sequenced 118 RNase H domains from clinical viral isolates in Brazil, and analyzed 510 thumb and connection domain and 450 RNase H domain sequences collected from public HIV sequence databases, together with their treatment status and histories. Drug-naïve and NRTI-treated datasets were compared for intra- and inter-group conservation, and differences were determined using Fisher's exact tests. One third of RT C-terminal residues were found to be conserved among group M variants. Three mutations were found exclusively in NRTI-treated isolates. Nine mutations in the connection and 6 mutations in the RNase H were associated with NRTI treatment in subtype B. Some of them lay in or close to amino acid residues which contact nucleic acid or near the RNase H active site. Several of the residues pointed out herein have been recently associated to NRTI exposure or increase drug resistance to NRTI. CONCLUSIONS: This is the first comprehensive genotypic analysis of a large sequence dataset that describes NRTI-related mutations in HIV-1 RT C-terminal domains in vivo. The findings into the conservation of RT C-terminal domains may pave the way to more rational drug design initiatives targeting those regions.
DEFF Research Database (Denmark)
Dhumpa, Raghuram; Bu, Minqiang; Handberg, Kurt
2010-01-01
Avian influenza virus (AIV) is an infectious agent of birds and mammals. AIV is causing huge economic loss and can be a threat to human health. Reverse transcriptase polymerase chain reaction (RT-PCR) has been used as a method for the detection and identification of AIV virus. Although RT...
Sawada, M; Tsurumi, H; Yamada, T; Hara, T; Oyama, M; Moriwaki, H
1999-04-01
Reverse transcriptase-polymerase chain reaction (RT-PCR) methods often detect the AML1/MTG8 fusion transcript even in acute myelogenous leukemia (AML) patients with t(8;21) who have been in long-term remission. We encountered 2 hypoplastic leukemia patients with t(8;21) who achieved cytogenetic remission with short-term conventional chemotherapy. Patient 1 was a 42-year-old woman. Chromosomal analysis detected t(8;21) (q22;q22) and PCR analysis (35 cycles PCR amplification; detection limit 1 x 10(-5) cells) detected the AML1/MTG8 fusion transcript. Complete remission was obtained with 1 course of chemotherapy consisting of low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days). After 2 courses of consolidation chemotherapy consisting of conventional-dose cytarabine and mitoxantrone, the RT-PCR findings were negative for the AML1/MTG8 fusion transcript. Patient 2 was a 67-year-old man. Cytogenetic analysis detected t(8;21) (q22;q22), and was positive for the AML1/MTG8 fusion transcript. After 2 courses of induction chemotherapy comprising low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days), and 3 courses of conventional consolidation chemotherapy, RT-PCR analysis confirmed the disappearance of the AML1/MTG8 fusion transcript.
Giacobbi, Nicholas S; Sluis-Cremer, Nicolas
2017-07-01
Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Mocroft, A; Horban, A; Clumeck, N
2006-01-01
increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)
Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F
1998-01-01
Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.
Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue
2013-05-01
To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis
Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis
2010-01-01
Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948
Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan
2016-05-01
Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2010-12-01
Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.
Directory of Open Access Journals (Sweden)
Gregory L. Damhorst
2015-09-01
Full Text Available Viral load measurements are an essential tool for the long-term clinical care of human immunodeficiency virus (HIV-positive individuals. The gold standards in viral load instrumentation, however, are still too limited by their size, cost, and sophisticated operation for these measurements to be ubiquitous in remote settings with poor healthcare infrastructure, including parts of the world that are disproportionately affected by HIV infection. The challenge of developing a point-of-care platform capable of making viral load more accessible has been frequently approached but no solution has yet emerged that meets the practical requirements of low cost, portability, and ease-of-use. In this paper, we perform reverse-transcription loop-mediated isothermal amplification (RT-LAMP on minimally processed HIV-spiked whole blood samples with a microfluidic and silicon microchip platform, and perform fluorescence measurements with a consumer smartphone. Our integrated assay shows amplification from as few as three viruses in a ~ 60 nL RT-LAMP droplet, corresponding to a whole blood concentration of 670 viruses per μL of whole blood. The technology contains greater power in a digital RT-LAMP approach that could be scaled up for the determination of viral load from a finger prick of blood in the clinical care of HIV-positive individuals. We demonstrate that all aspects of this viral load approach, from a drop of blood to imaging the RT-LAMP reaction, are compatible with lab-on-a-chip components and mobile instrumentation.
Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães
2017-04-12
The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.
Directory of Open Access Journals (Sweden)
Kashanchi Fatah
2006-01-01
Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their
Evaluation of NGS and RT-PCR methods for ALK rearrangement in European NSCLC patients
DEFF Research Database (Denmark)
Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota
2018-01-01
INTRODUCTION: The reported prevalence of ALK rearrangement in NSCLC ranges from 2%-7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proven to be a reproducible and sensitive technique. Reverse transcriptase...
Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X
2014-07-01
Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.
Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat
2011-01-01
We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.
Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita
2018-01-01
Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673
Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R
2009-02-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2009-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331
Directory of Open Access Journals (Sweden)
Ammad Ahmad Farooqi
2018-04-01
Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.
Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D
2006-11-15
TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients
Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H
2015-12-15
Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M
2007-01-01
Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.
Karade, Santosh; Chaturbhuj, Devidas N; Sen, Sourav; Joshi, Rajneesh K; Kulkarni, Smita S; Shankar, Subramanian; Gangakhedkar, Raman R
2018-01-01
The objective of this review was to assess the burden of HIV drug resistance mutations (DRM) in Indian adults exposed to first-line antiretroviral therapy (ART) as per national guidelines. An advanced search of the published literature on HIV drug resistance in India was performed in the PubMed and Scopus databases. Data pertaining to age, sex, CD4 count, viral load, and prevalence of nucleoside reverse transcriptase inhibitor (NRTI)/non-nucleoside reverse transcriptase inhibitor (NNRTI) DRM were extracted from each publication. Year-wise Indian HIV-1 reverse transcriptase (RT) sequences were retrieved from the Los Alamos HIV database and mutation analyses were performed. A time trend analysis of the proportion of sequences showing NRTI resistance mutations among individuals exposed to first-line ART was conducted. Overall, 23 studies (1046 unique RT sequences) were identified indicating a prevalence of drug resistance to NRTI and NNRTI. The proportion of RT sequences with any DRM, any NRTI DRM, and any NNRTI DRM was 78.39%, 68.83%, and 73.13%, respectively. The temporal trend analysis of individual DRM from sequences retrieved during 2004-2014 indicated a rising trend in K65R mutations (p=0.013). Although the overall burden of resistance against first-line ART agents remained steady over the study decade, periodic monitoring is essential. There is the need to develop an HIV-1 subtype C-specific resistance database in India. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Wang, Shuwen; Zhu, Jiyue
2003-05-23
The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M
2007-01-01
Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691
Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido
2013-09-01
Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.
Over-expression of Arabidopsis DnaJ (Hsp40) contributes to NaCl ...
African Journals Online (AJOL)
USER
2010-02-15
Feb 15, 2010 ... levels of DnaJ in their transgenic sense lines exhibited tolerance to NaCl stress. Under 120 mM ... polymerase chain reaction; RT-PCR, reverse transcriptase –. PCR; CTAB ..... Engineering salt tolerance in plants. Curr. Opin.
Molecular and biochemical toxicology
National Research Council Canada - National Science Library
Smart, Robert C; Hodgson, Ernest
2008-01-01
... Expression and Regulation 2.6.1 Northern Analysis 2.6.2 Nuclear Run-On 2.6.3 Promoter Deletion Analysis/Reporter Gene Assays 2.6.4 Microarrays 2.6.5 Reverse Transcriptase-PCR (RT-PCR) and Real-Time P...
2007-05-08
deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the
DEFF Research Database (Denmark)
Sabin, Caroline A; Worm, Signe W; Weber, Rainer
2008-01-01
cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...
Directory of Open Access Journals (Sweden)
Madeleine Zerbato
Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.
Forensic pregnancy diagnostics with placental mRNA markers
J. Gauvin (Jeanot); D. Zubakov (Dmitry); J. van Rhee-Binkhorst (Joke); A. Kloosterman (Ate); E.A.P. Steegers (Eric); M.H. Kayser (Manfred)
2010-01-01
textabstractCurrent methods for pregnancy diagnostics are based on immunodetection of pregnancy-specific proteins and in a forensic context suffer from sensitivity and specificity issues. Here, we applied reverse transcriptase polymerase chain reaction (RT-PCR) technology to 11 genes previously
Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd
2008-01-01
This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...
Directory of Open Access Journals (Sweden)
Qiusheng Kong
Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.
Randazzo, C.L.; Torriani, S.; Akkermans, A.D.L.; Vos, de W.M.; Vaughan, E.E.
2002-01-01
The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and
Directory of Open Access Journals (Sweden)
Liu Tiantian
2010-05-01
Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.
Towards novel therapeutics for HIV through fragment-based screening and drug design.
Tiefendbrunn, Theresa; Stout, C David
2014-01-01
Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.
An intravaginal ring that releases the NNRTI MIV-150 reduces SHIV transmission in macaques.
Singer, Rachel; Mawson, Paul; Derby, Nina; Rodriguez, Aixa; Kizima, Larisa; Menon, Radhika; Goldman, Daniel; Kenney, Jessica; Aravantinou, Meropi; Seidor, Samantha; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Robbiani, Melissa; Zydowsky, Thomas M
2012-09-05
Microbicides may prevent HIV and sexually transmitted infections (STIs) in women; however, determining the optimal means of delivery of active pharmaceutical ingredients remains a major challenge. We previously demonstrated that a vaginal gel containing the non-nucleoside reverse transcriptase inhibitor MIV-150 partially protected macaques from SHIV-RT (simian/HIV reverse transcriptase) infection, and the addition of zinc acetate rendered the gel significantly protective. We test the activity of MIV-150 without the addition of zinc acetate when delivered from either ethylene vinyl acetate (EVA) or silicone intravaginal rings (IVRs). MIV-150 was successfully delivered, because it was detected in vaginal fluids and tissues by radioimmunoassay in pharmacokinetic studies. Moreover, EVA IVRs significantly protected macaques from SHIV-RT infection. Our results demonstrate that MIV-150-containing IVRs have the potential to prevent HIV infection and highlight the possible use of IVRs for delivering drugs that block HIV and other STIs.
Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V
2017-07-01
The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Freeman-Wittig, M.J.B.
1986-01-01
The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan
Tachibana, Masatsugu; Shinagawa, Yasuhiro; Kawamata, Hitoshi; Omotehara, Fumie; Horiuchi, Hideki; Ohkura, Yasuo; Kubota, Keiichi; Imai, Yutaka; Fujibayashi, Takashi; Fujimori, Takahiro
2003-01-01
We present a new approach towards the detection of the mRNAs in formalin-fixed, paraffin-embedded samples using a reverse transcriptase (RT)-polymerase chain reaction (PCR). The total RNAs were extracted from 10-micron-thick sections and were reverse-transcribed, then the RT-products were subjected to PCR amplification of GAPDH mRNA for screening the mRNA degradation. Next, nested PCR was performed for examining the expression of p53-related genes, p21WAF1, MDM2, p33ING1 and p14ARF. GAPDH mRNA expression was detectable in 12 out of 21 oral squamous cell carcinoma (SCC) samples. p21WAF1 mRNA expression was detectable in 5 out of 12 SCC samples, MDM2 mRNA expression was detectable in 5 our of 12 SCC samples and p33ING1 mRNA expression was detectable in 6 out of 12 SCC samples. However, the expression of p14ARF mRNA was not detectable in any of the samples. Seven out of 12 oral SCC samples showed abnormal nuclear accumulation of p53 protein by immunohistochemical staining, whereas 5 out of 12 oral SCCs showed negative staining for p53 protein. Of of p33ING1 mRNA. One of these was a verrucous carcinoma in which the p53 gene products might be inactivated by the oncoprotein E6 of human papilloma virus. Thus, the p53 tumor suppressor pathway was disrupted in most oral SCCs at the cellular levels, due to either an abnormality in p53 itself or loss of expression of p53 regulatory factors. This method would assist in making diagnosis, determining therapeutic strategy and predicting the prognosis of various cancers including oral SCCs.
Yoshida, Hiromi; Sakoda, Yoshihiro; Endo, Mayumi; Motoshima, Masayuki; Yoshino, Fumi; Yamamoto, Naoki; Okamatsu, Masatoshi; Soejima, Takahiro; Senba, Syouhei; Kanda, Hidetoshi; Kida, Hiroshi
2011-06-01
Migratory water birds are a natural reservoir for influenza A viruses. Viruses replicate in the intestines of ducks and are shed with the fecal materials. Virus isolation from collected fecal materials, therefore, is an integral part of the surveillance of avian influenza in water birds. In the present study, reverse transcription loop-mediated isothermal amplification (RT-LAMP) was assessed for its usefulness in detecting the RNA of influenza A viruses in fecal materials. It was found that, RT-LAMP specifically and sensitively detects the matrix gene of influenza A viruses. Influenza A viruses were isolated from the fecal materials in which viral RNA were detected by RT-LAMP in 35 min. The present findings indicate that RT-LAMP is useful as a high throughput screening method for field samples prior to virus isolation, allowing the processing of hundreds of samples per day.
Lambert-Niclot, S.; George, E. C.; Pozniak, A.; White, E.; Schwimmer, C.; Jessen, H.; Johnson, M.; Dunn, D.; Perno, C. F.; Clotet, B.; Plettenberg, A.; Blaxhult, A.; Palmisano, L.; Wittkop, L.; Calvez, V.; Marcelin, A. G.; Raffi, F.; Dedes, Nikos; Chêne, Geneviève; Richert, Laura; Allavena, Clotilde; Raffi, François; Autran, Brigitte; Antinori, Andrea; Bucciardini, Raff Aella; Vella, Stefano; Horban, Andrzej; Arribas, Jose; Babiker, Abdel G.; Boffito, Marta; Pillay, Deenan; Pozniak, Anton; Franquet, Xavier; Schwarze, Siegfried; Grarup, Jesper; Fischer, Aurélie; Wallet, Cédrick; Diallo, Alpha; Molina, Jean-Michel; Saillard, Juliette; Moecklinghoff, Christiane; Stellbrink, Hans-Jürgen; van Leeuwen, Remko; Gatell, Jose; Sandstrom, Eric; Flepp, Markus; Ewings, Fiona; George, Elizabeth C.; Hudson, Fleur; Pearce, Gillian; Quercia, Romina; Rogatto, Felipe; Leavitt, Randi; Nguyen, Bach-Yen; Goebel, Frank; Marcotullio, Simone; Kaur, Navrup; Sasieni, Peter; Spencer-Drake, Christina; Peto, Tim; Miller, Veronica; Arnault, Fabien; Boucherie, Céline; Jean, Delphine; Paniego, Virginie; Paraina, Felasoa; Rouch, Elodie; Schwimmer, Christine; Soussi, Malika; Taieb, Audrey; Termote, Monique; Touzeau, Guillaume; Cursley, Adam; Dodds, Wendy; Hoppe, Anne; Kummeling, Ischa; Pacciarini, Filippo; Paton, Nick; Russell, Charlotte; Taylor, Kay; Ward, Denise; Aagaard, Bitten; Eid, Marius; Gey, Daniela; Jensen, Birgitte Gram; Jakobsen, Marie-Louise; Jansson, Per O.; Jensen, Karoline; Joensen, Zillah Maria; Larsen, Ellen Moseholm; Pahl, Christiane; Pearson, Mary; Nielsen, Birgit Riis; Reilev, Søren Stentoft; Christ, Ilse; Lathouwers, Desiree; Manting, Corry; Mendy, Bienvenu Yves; Metro, Annie; Couffin-Cadiergues, Sandrine; Knellwolf, Anne-Laure; Palmisiano, Lucia; Aznar, Esther; Barea, Cristina; Cotarelo, Manuel; Esteban, Herminia; Girbau, Iciar; Moyano, Beatriz; Ramirez, Miriam; Saiz, Carmen; Sanchez, Isabel; Yllescas, Maria; Binelli, Andrea; Colasanti, Valentina; Massella, Maurizio; Anagnostou, Olga; Gioukari, Vicky; Touloumi, Giota; Schmied, Brigitte; Rieger, Armin; Vetter, Norbert; de Wit, Stephane; Florence, Eric; Vandekerckhove, Linos; Gerstoft, Jan; Mathiesen, Lars; Katlama, Christine; Cabie, Andre; Cheret, Antoine; Dupon, Michel; Ghosn, Jade; Girard, Pierre-Marie; Goujard, Cécile; Lévy, Yves; Morlat, Philippe; Neau, Didier; Obadia, Martine; Perre, Philippe; Piroth, Lionel; Reynes, Jacques; Tattevin, Pierre; Ragnaud, Jean Marie; Weiss, Laurence; Yazdan, Yazdanpanah; Yeni, Patrick; Zucman, David; Behrens, Georg; Esser, Stefan; Fätkenheuer, Gerd; Hoffmann, Christian; Jessen, Heiko; Rockstroh, Jürgen; Schmidt, Reinhold; Stephan, Christoph; Unger, Stefan; Hatzakis, Angelos; Daikos, George L.; Papadopoulos, Antonios; Skoutelis, Athamasios; Banhegyi, Denes; Mallon, Paddy; Mulcahy, Fiona; Andreoni, Massimo; Bonora, Stefano; Castelli, Francesco; Monforte, Antonella D.'Arminio; Di Perri, Giovanni; Galli, Massimo; Lazzarin, Adriano; Mazzotta, Francesco; Carlo, Torti; Vullo, Vincenzo; Prins, Jan; Richter, Clemens; Verhagen, Dominique; van Eeden, Arne; Doroana, Manuela; Antunes, Francisco; Maltez, Fernando; Sarmento-Castro, Rui; Garcia, Juan Gonzalez; Aldeguer, José López; Clotet, Bonaventura; Domingo, Pere; Gatell, Jose M.; Knobel, Hernando; Marquez, Manuel; Miralles, Martin Pilar; Portilla, Joaquin; Soriano, Vicente; Tellez, Maria-Jesus; Thalme, Anders; Blaxhult, Anders; Gisslen, Magnus; Winston, Alan; Fox, Julie; Gompels, Mark; Herieka, Elbushra; Johnson, Margaret; Leen, Clifford; Teague, Alastair; Williams, Ian; Boyd, Mark Alastair; Møller, Nina Friis; Larsen, Ellen Frøsig Moseholm; Le Moing, Vincent; Wit, Ferdinand W. N. M.; Kowalska, Justyna; Berenguer, Juan; Moreno, Santiago; Müller, Nicolas J.; Török, Estée; Post, Frank; Angus, Brian; Calvez, Vincent; Boucher, Charles; Collins, Simon; Dunn, David; Lambert, Sidonie; Marcelin, Anne-Geneviève; Perno, Carlo Federico; White, Ellen; Ammassari, Adriana; Stoehr, Wolgang; Schmidt, Reinhold Ernst; Odermarsky, Michal; Smith, Colette; Thiébaut, Rodolphe; de La Serna, Jose Ignacio Bernardino; Castagna, Antonella; Furrer, Hans-Jackob; Mocroft, Amanda; Reiss, Peter; Bucciardini, Raffaella; Fragola, Vincenzo; Lauriola, Marco; Murri, Rita; Nieuwkerk, Pythia; Spire, Bruno; Volny-Anne, Alain; West, Brian; Amieva, Hélène; Llibre Codina, Josep Maria; Braggion, Marco; Focà, Emanuele
2016-01-01
To describe the pattern of drug resistance at virological failure in the NEAT001/ANRS143 trial (first-line treatment with ritonavir-boosted darunavir plus either tenofovir/emtricitabine or raltegravir). Genotypic testing was performed at baseline for reverse transcriptase (RT) and protease genes and
DEFF Research Database (Denmark)
Christoffersen, Mette; Woodward, Elizabeth; Bojesen, Anders Miki
2012-01-01
. Endometrial biopsies were obtained 3, 12, 24 and 72 hours (h) after bacterial inoculation and blood samples were obtained during the 7 day period post bacterial inoculation. Expression levels of cytokines and SAA were determined by quantitative real-time reverse transcriptase PCR (qRT-PCR)....
Ronde, Anthony de; Dooren, Maaike van; Hoek, Lian van der; Bouwhuis, Denise; Rooij, Esther de; Gemen, Bob van; Boer, R.J. de; Goudsmit, Jaap
2000-01-01
Sequence analysis of human immunodeficiency virus type 1 (HIV-1) from 74 persons with acute infections identified eight strains with mutations in the reverse transcriptase (RT) gene at positions 41, 67, 68, 70, 215, and 219 associated with resistance to the nucleoside analogue zidovudine (AZT).
de Ronde, A.; van Dooren, M.; van der Hoek, L.; Bouwhuis, D.; de Rooij, E.; van Gemen, B.; de Boer, R.; Goudsmit, J.
2001-01-01
Sequence analysis of human immunodeficiency virus type 1 (HIV-1) from 74 persons with acute infections identified eight strains with mutations in the reverse transcriptase (RT) gene at positions 41, 67, 68, 70, 215, and 219 associated with resistance to the nucleoside analogue zidovudine (AZT).
Phylogeny and resistance profiles of HIV-1 POL sequences from rectal biopsies and blood
DEFF Research Database (Denmark)
Katzenstein, Terese Lea; Petersen, A B; Storgaard, M
2010-01-01
The phylogeny and resistance profiles of human immunodeficiency virus type 1 (HIV-1) protease (PR) and reverse transcriptase (RT) sequences were compared among six patients with HIV-1 who had received numerous treatments. RNA and DNA fractions were obtained from concurrent blood and rectal biopsy...
Development of loop-mediated isothermal amplification method for ...
African Journals Online (AJOL)
A novel assay method to detect the highly virulent Porcine reproductive and respiratory syndrome virus (PRRSV) termed reverse transcriptase loop-mediated isothermal amplification (RT-LAMP), was reported by using hydroxynaphthol blue (HNB) as the LAMP product colorimetric judgment. By the set of special primers, ...
Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi
2014-01-01
Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.
Directory of Open Access Journals (Sweden)
Rami Kantor
2005-04-01
Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.
Wu, Yi-Cheng; Chang, Il-Chi; Wang, Chi-Liang; Chen, Tai-Di; Chen, Ya-Ting; Liu, Hui-Ping; Chu, Yen; Chiu, Yu-Ting; Wu, Tzu-Hua; Chou, Li-Hui; Chen, Yi-Rong; Huang, Shiu-Feng
2013-01-01
Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK) fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib) treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. Reverse transcriptase-polymerase chain reaction (RT-PCR), fluorescence in Situ hybridization (FISH) and Immunohistochemical (IHC) stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. Thirteen of the 312 patients (4.17%) had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%), but very good specificity (99.32%). IHC stain had better sensitivity (91.67%) than FISH, but lower specificity (79.52%), when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product), were also have high expression of ALK protein (IHC3+), and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80%) of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%). Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3%) was the most common type in Chinese population, while variant 1 (28/37, 75.7%) was most common in Caucasian. Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.
Directory of Open Access Journals (Sweden)
Yi-Cheng Wu
Full Text Available BACKGROUND: Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. METHODS: Reverse transcriptase-polymerase chain reaction (RT-PCR, fluorescence in Situ hybridization (FISH and Immunohistochemical (IHC stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. RESULTS: Thirteen of the 312 patients (4.17% had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%, but very good specificity (99.32%. IHC stain had better sensitivity (91.67% than FISH, but lower specificity (79.52%, when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product, were also have high expression of ALK protein (IHC3+, and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80% of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%. Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3% was the most common type in Chinese population, while variant 1 (28/37, 75.7% was most common in Caucasian. CONCLUSIONS: Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.
Gao, Xue-Ke; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lü, Li-Min; Zhang, Li-Juan; Zhu, Xiang-Zhen; Wang, Li; Lu, Hui; Cui, Jin-Jie
2017-12-30
Lysiphlebia japonica (Ashmead) is a predominant parasitoid of cotton-melon aphids in the fields of northern China with a proven ability to effectively control cotton aphid populations in early summer. For accurate normalization of gene expression in L. japonica using quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), reference genes with stable gene expression patterns are essential. However, no appropriate reference genes is L. japonica have been investigated to date. In the present study, 12 selected housekeeping genes from L. japonica were cloned. We evaluated the stability of these genes under various experimental treatments by RT-qPCR using four independent (geNorm, NormFinder, BestKeeper and Delta Ct) and one comparative (RefFinder) algorithm. We identified genes showing the most stable levels of expression: DIMT, 18S rRNA, and RPL13 during different stages; AK, RPL13, and TBP among sexes; EF1A, PPI, and RPL27 in different tissues, and EF1A, RPL13, and PPI in adults fed on different diets. Moreover, the expression profile of a target gene (odorant receptor 1, OR1) studied during the developmental stages confirms the reliability of the chosen selected reference genes. This study provides for the first time a comprehensive list of suitable reference genes for gene expression studies in L. japonica and will benefit subsequent genomics and functional genomics research on this natural enemy. Copyright © 2017. Published by Elsevier B.V.
Sun, Bing; Shen, Feng; McCalla, Stephanie E; Kreutz, Jason E; Karymov, Mikhail A; Ismagilov, Rustem F
2013-02-05
Here we used a SlipChip microfluidic device to evaluate the performance of digital reverse transcription-loop-mediated isothermal amplification (dRT-LAMP) for quantification of HIV viral RNA. Tests are needed for monitoring HIV viral load to control the emergence of drug resistance and to diagnose acute HIV infections. In resource-limited settings, in vitro measurement of HIV viral load in a simple format is especially needed, and single-molecule counting using a digital format could provide a potential solution. We showed here that when one-step dRT-LAMP is used for quantification of HIV RNA, the digital count is lower than expected and is limited by the yield of desired cDNA. We were able to overcome the limitations by developing a microfluidic protocol to manipulate many single molecules in parallel through a two-step digital process. In the first step we compartmentalize the individual RNA molecules (based on Poisson statistics) and perform reverse transcription on each RNA molecule independently to produce DNA. In the second step, we perform the LAMP amplification on all individual DNA molecules in parallel. Using this new protocol, we increased the absolute efficiency (the ratio between the concentration calculated from the actual count and the expected concentration) of dRT-LAMP 10-fold, from ∼2% to ∼23%, by (i) using a more efficient reverse transcriptase, (ii) introducing RNase H to break up the DNA:RNA hybrid, and (iii) adding only the BIP primer during the RT step. We also used this two-step method to quantify HIV RNA purified from four patient samples and found that in some cases, the quantification results were highly sensitive to the sequence of the patient's HIV RNA. We learned the following three lessons from this work: (i) digital amplification technologies, including dLAMP and dPCR, may give adequate dilution curves and yet have low efficiency, thereby providing quantification values that underestimate the true concentration. Careful
Directory of Open Access Journals (Sweden)
Stefanou Nikolaos
2010-08-01
Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.
Energy Technology Data Exchange (ETDEWEB)
Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)
2017-12-15
Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)
Apoptotic properties of Citrus sudachi Hort, ex Shirai (Rutaceae ...
African Journals Online (AJOL)
Methods: 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and annexin V/propidium iodidle assay were used to test the antiproliferative activity and apoptosis of methanol extract of Citrus sudachi, respectively. Griess reaction and reverse transcriptase-polymerase chain reaction (RT-PCR) were carried ...
International Nuclear Information System (INIS)
Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H
2008-01-01
Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples
Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun
2017-09-01
The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.
Identification of rhabdoviral sequences in oropharyngeal swabs from German and Danish bats
DEFF Research Database (Denmark)
Fischer, Melina; Freuling, Conrad M.; Müller, Thomas
2014-01-01
Background: In the frame of active lyssavirus surveillance in bats, oropharyngeal swabs from German (N = 2297) and Danish (N = 134) insectivorous bats were investigated using a newly developed generic pan-lyssavirus real-time reverse transcriptase PCR (RT-qPCR).Findings: In total, 15 RT-qPCR posi...... bats. The results also prove that the novel generic pan-lyssavirus RT-qPCR offers a very broad detection range that allows the collection of further valuable data concerning the broad and complex diversity within the family Rhabdoviridae....
Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa
2012-11-01
Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.
Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato
2012-06-06
Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic
Berman, Andrea J; Gooding, Anne R; Cech, Thomas R
2010-10-01
The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.
4739 Volume 11 No. 3 May 2011 APPROACHES TO DIAGNOSIS ...
African Journals Online (AJOL)
user
2011-05-03
May 3, 2011 ... In this study, the comparative efficiencies of diagonal and zigzag approaches to. CBSD field .... CBSV was detected by the reverse transcriptase polymerase chain reaction (RT-PCR) using the (coat protein) ... established by ensuring that equal weight of starting tissues for RNA isolation was maintained, that ...
Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen
2016-03-01
Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.
Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L
2017-11-08
The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.
International Nuclear Information System (INIS)
Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun
2007-01-01
Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers
Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange
2018-03-01
The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be
LENUS (Irish Health Repository)
Menton, John F
2007-01-01
BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.
Evolutionary relationships within a subgroup of HERV-K-related human endogenous retroviruses
Zsíros, J.; Jebbink, M. F.; Lukashov, V. V.; Voûte, P. A.; Berkhout, B.
1998-01-01
The prototype endogenous retrovirus HERV-K10 was identified in the human genome by its homology to the exogenous mouse mammary tumour virus. By analysis of a short 244 bp segment of the reverse transcriptase (RT) gene of other HERV-K10-like sequences, it has become clear that these elements
Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang
2010-01-01
A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408
Directory of Open Access Journals (Sweden)
Yanrui Li
2010-01-01
Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.
Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng
2014-07-01
The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.
Behjati, Mohaddeseh; Hashemi, Mohammad; Kazemi, Mohammad; Salehi, Mansoor; Javanmard, Shaghayegh Haghjooy
2017-01-01
Decreased high-energy phosphate level is involved in endothelial cell injury and dysfunction. Reduced telomerase activity in endothelial cells in parallel with reduced energy levels might be due to altered direction of alternative splicing machine as a complication of depleted energy during the process of atherosclerosis. Isolated human umbilical vein endothelial cells (HUVECs) were treated for 24 hours by oligomycine (OM) and 2-deoxy glucose (2-DG). After 24 hours, the effect of energy depletion on telomerase splicing pattern was evaluated using RT-PCR. Indeed, in both treated and untargeted cells, nitric oxide (NO) and von Willebrand factor (vWF) were measured. ATP was depleted in treated cells by 43.9% compared with control group. We observed a slight decrease in NO levels ( P = 0.09) and vWF ( P = 0.395) in the setting of 49.36% ATP depletion. In both groups, no telomerase gene expression was seen. Telomerase and housekeeping gene expression were found in positive control group (colon cancer tissue) and sample tissue. The absence of telomerase gene expression in HUVECs might be due to the mortality of these cells or the low level of telomerase gene expression in these cells under normal circumstances.
Directory of Open Access Journals (Sweden)
Isabel Hostettler
2014-12-01
Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.
Directory of Open Access Journals (Sweden)
Su X
2016-11-01
Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation
Directory of Open Access Journals (Sweden)
Marius Lazea
2011-12-01
Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.
Quantitation of the mRNA expression of the epidermal growth factor system
DEFF Research Database (Denmark)
Sørensen, B S; Tørring, N; Bor, M V
2000-01-01
) and for the quantitation of mRNA for the receptors HER-1 and its preferred dimerization partner, HER-2. The method is based on the generation of specific RNA standards, which are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) with the sample RNA and a set of calibrators. The resulting calibration...
Telomerase reverse transcriptase promoter mutations in bladder cancer
DEFF Research Database (Denmark)
Allory, Yves; Beukers, Willemien; Sagrera, Ana
2014-01-01
for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...
Wu, Tiyun; Heilman-Miller, Susan L.; Levin, Judith G.
2007-01-01
HIV-1 nucleocapsid protein (NC) is a nucleic acid chaperone, which is required for highly specific and efficient reverse transcription. Here, we demonstrate that local structure of acceptor RNA at a potential nucleation site, rather than overall thermodynamic stability, is a critical determinant for the minus-strand transfer step (annealing of acceptor RNA to (−) strong-stop DNA followed by reverse transcriptase (RT)-catalyzed DNA extension). In our system, destabilization of a stem-loop stru...
de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão
2008-08-01
A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.
CSIR Research Space (South Africa)
Bode, M
2010-09-01
Full Text Available .6 µM N N NH Cl Res Act = 3% IC50 = 2 µM MAGI IC50 = 0.2 µM N N NH Cl Res Act = 5% IC50 = 3.5 µM MAGI IC50 = 0.18 µM N N NH Cl Res Act = 13% IC50 = 8 µM MAGI IC50 = 0.6 µM N N NH Cl Cl Res Act = 4% IC50 = 1.5 µM MAGI IC50... 2010 www.csir.co.za N N NH N N NH Cl N N NH Cl CN IC50= 4.4 uM (RT) IC50= 0.16 uM (PBMC) IC50= 0.41 uM (MAGI) cf . Nevirapine IC50=0.67 uM (RT) IC50=0.033 uM (PBMC) IC50= 29 uM (RT) IC50= 41 uM (PBMC) cf...
Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt
Directory of Open Access Journals (Sweden)
Laila El-Shehawy
Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in
Isolation and open reading frame 5 gene analysis of porcine ...
African Journals Online (AJOL)
ARL
2012-11-08
Nov 8, 2012 ... viral RNA of fourth generation, reverse transcriptase (RT)-PCR based on open reading frame 5 (ORF5) ... fourth generation. TCID50 of isolate measured by Reed-Muench method was 10-3.6/0.1 ml. Genetic evolution of ORF5 indicated that the two isolated strains were in a .... generation of the virus culture.
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
Directory of Open Access Journals (Sweden)
Mengjuan Zhu
2016-03-01
Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.
International Nuclear Information System (INIS)
Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha
2005-01-01
Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols
Properties of the reverse transcription reaction in mRNA quantification
DEFF Research Database (Denmark)
Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie
2004-01-01
BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...
International Nuclear Information System (INIS)
Lund, Kaleb C.; Wallace, Kendall B.
2008-01-01
Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug
Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...
EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. The viral ribonucleic acid (RNA) from water sample concentrates is extracted and tested for enterovirus and norovirus RNA using reverse transcription-quantitative PCR (RT-qPCR). V...
Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A
2008-05-20
Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.
Müllers, Erik; Uhlig, Tobias; Stirnnagel, Kristin; Fiebig, Uwe; Zentgraf, Hanswalter; Lindemann, Dirk
2011-02-01
Prototype foamy virus (PFV) Gag lacks the characteristic orthoretroviral Cys-His motifs that are essential for various steps of the orthoretroviral replication cycle, such as RNA packaging, reverse transcription, infectivity, integration, and viral assembly. Instead, it contains three glycine-arginine-rich boxes (GR boxes) in its C terminus that putatively represent a functional equivalent. We used a four-plasmid replication-deficient PFV vector system, with uncoupled RNA genome packaging and structural protein translation, to analyze the effects of deletion and various substitution mutations within each GR box on particle release, particle-associated protein composition, RNA packaging, DNA content, infectivity, particle morphology, and intracellular localization. The degree of viral particle release by all mutants was similar to that of the wild type. Only minimal effects on Pol encapsidation, exogenous reverse transcriptase (RT) activity, and genomic viral RNA packaging were observed. In contrast, particle-associated DNA content and infectivity were drastically reduced for all deletion mutants and were undetectable for all alanine substitution mutants. Furthermore, GR box I mutants had significant changes in particle morphology, and GR box II mutants lacked the typical nuclear localization pattern of PFV Gag. Finally, it could be shown that GR boxes I and III, but not GR box II, can functionally complement each other. It therefore appears that, similar to the orthoretroviral Cys-His motifs, the PFV Gag GR boxes are important for RNA encapsidation, genome reverse transcription, and virion infectivity as well as for particle morphogenesis.
Directory of Open Access Journals (Sweden)
Holly A. Basta
2007-01-01
Full Text Available Retroid agents are genomes that encode a reverse transcriptase (RT and replicate or transpose by way of an RNA intermediate. The Genome Parsing Suite (GPS is software created to identify and characterize Retroid agents in any genome database (McClure et al. 2005. The detailed analysis of all Retroid agents found by the GPS in Danio rerio (zebrafsh, Oryzias latipes (medaka, Gasterosteus aculeatus (stickleback and Tetraodon nigroviridis (spotted green pufferfish reveals extensive Retroid agent diversity in the compact genomes of all four fish. Novel Retroid agents were identified by the GPS software: the telomerase reverse transcriptase (TERT in O. latipes, G. aculeatus and T. nigroviridis and a potential TERT in D. rerio, a retrotransposon in D. rerio, and multiple lineages of endogenous retroviruses (ERVs in D. rerio, O. latipes and G. aculeatus.
A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.
Directory of Open Access Journals (Sweden)
Sandra J Laney
2008-06-01
Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.
Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B
2018-02-06
Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.
CSIR Research Space (South Africa)
Khati, M
2012-03-01
Full Text Available RNA and Vpr, respectively pol Protease (PR) gag/pol cleavage pol Reverse Transcriptase (RT) Reverse transcription pol RNase H RNase H activity pol Integrase (IN) DNA provirus integration env Env (gp120 and gp41) gp120 binds CD4 receptor and CXCR4.../CCR5 co-receptors , gp41 mediates fusion tat Tat Viral transcription activator rev Rev RNA transport, stability and utilization factor (phosphoprotein) vif Vif Promotes virion maturation and infectivity vpr Vpr Promotes nuclear localization...
Wang, Jing; Yang, Xue; Chen, Haofeng; Wang, Xuewei; Wang, Xiangyu; Fang, Yi; Jia, Zhenyu; Gao, Jidong
2017-07-11
RNA in formalin-fixed and paraffin-embedded (FFPE) tissues provides large amount of information indicating disease stages, histological tumor types and grades, as well as clinical outcomes. However, Detection of RNA expression levels in formalin-fixed and paraffin-embedded samples is extremely difficult due to poor RNA quality. Here we developed a high-throughput method, Reverse Transcription-Multiple Ligation-dependent Probe Sequencing (RT-MLPSeq), to determine expression levels of multiple transcripts in FFPE samples. By combining Reverse Transcription-Multiple Ligation-dependent Amplification method and next generation sequencing technology, RT-MLPSeq overcomes the limit of probe length in multiplex ligation-dependent probe amplification assay and thus could detect expression levels of transcripts without quantitative limitations. We proved that different RT-MLPSeq probes targeting on the same transcripts have highly consistent results and the starting RNA/cDNA input could be as little as 1 ng. RT-MLPSeq also presented consistent relative RNA levels of selected 13 genes with reverse transcription quantitative PCR. Finally, we demonstrated the application of the new RT-MLPSeq method by measuring the mRNA expression levels of 21 genes which can be used for accurate calculation of the breast cancer recurrence score - an index that has been widely used for managing breast cancer patients.
DEFF Research Database (Denmark)
Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L
2012-01-01
We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....
Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni
2016-01-01
Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647
Suicide Inhibitors of Reverse Transcriptase in the Therapy of AIDS and Other Retroviruses
1989-07-01
are shown below. One of the first, [N-(L-3-tran carboxyxiran-2-carbonyl)-L-leucyl]-amido (4-guanido) butane was isolated from Asperg /II japonicus and...using uridine nucleosides to enhance the antiviral selectivity. j, Synthesis of Uridine 2’ and 3*-Ribosoiroxr’es 3*-uridine spiroxirane was...system used (Figure 2). Also shown in this figure is the enhanced sensitivity of the vaccif recombinant HIV-RT to Foscarnet when expressed in monkey kidney
Rotili, Dante; Samuele, Alberta; Tarantino, Domenico; Ragno, Rino; Musmuca, Ira; Ballante, Flavio; Botta, Giorgia; Morera, Ludovica; Pierini, Marco; Cirilli, Roberto; Nawrozkij, Maxim B; Gonzalez, Emmanuel; Clotet, Bonaventura; Artico, Marino; Esté, José A; Maga, Giovanni; Mai, Antonello
2012-04-12
The single enantiomers of two pyrimidine-based HIV-1 non-nucleoside reverse transcriptase inhibitors, 1 (MC1501) and 2 (MC2082), were tested in both cellular and enzyme assays. In general, the R forms were more potent than their S counterparts and racemates and (R)-2 was more efficient than (R)-1 and the reference compounds, with some exceptions. Interestingly, (R)-2 displayed a faster binding to K103N RT with respect to WT RT, while (R)-1 showed the opposite behavior. © 2012 American Chemical Society
Exploiting the anti-HIV 6-desfluoroquinolones to design multiple ligands.
Sancineto, Luca; Iraci, Nunzio; Barreca, Maria Letizia; Massari, Serena; Manfroni, Giuseppe; Corazza, Gianmarco; Cecchetti, Violetta; Marcello, Alessandro; Daelemans, Dirk; Pannecouque, Christophe; Tabarrini, Oriana
2014-09-01
It is getting clearer that many drugs effective in different therapeutic areas act on multiple rather than single targets. The application of polypharmacology concepts might have numerous advantages especially for disease such as HIV/AIDS, where the rapid emergence of resistance requires a complex combination of more than one drug. In this paper, we have designed three hybrid molecules combining WM5, a quinolone derivative we previously identified as HIV Tat-mediated transcription (TMT) inhibitor, with the tricyclic core of nevirapine and BILR 355BS (BILR) non-nucleoside reverse transcriptase inhibitors (NNRTIs) to investigate whether it could be possible to obtain molecules acting on both transcription steps of the HIV replicative cycle. One among the three designed multiple ligands, reached this goal. Indeed, compound 1 inhibited both TMT and reverse transcriptase (RT) activity. Unexpectedly, while the anti-TMT activity exerted by compound 1 resulted into a selective inhibition of HIV-1 reactivation from latently infected OM10.1 cells, the anti-RT properties shown by all of the synthesized compounds did not translate into an anti-HIV activity in acutely infected cells. Thus, we have herein produced the proof of concept that the design of dual TMT-RT inhibitors is indeed possible, but optimization efforts are needed to obtain more potent derivatives. Copyright © 2014 Elsevier Ltd. All rights reserved.
Follow-up on long-term antiretroviral therapy for cats infected with feline immunodeficiency virus.
Medeiros, Sheila de Oliveira; Abreu, Celina Monteiro; Delvecchio, Rodrigo; Ribeiro, Anísia Praxedes; Vasconcelos, Zilton; Brindeiro, Rodrigo de Moraes; Tanuri, Amilcar
2016-04-01
Feline immunodeficiency virus (FIV) is a lentivirus that induces AIDS-like disease in cats. Some of the antiretroviral drugs available to treat patients with HIV type 1 are used to treat FIV-infected cats; however, antiretroviral therapy (ART) is not used in cats as a long-term treatment. In this study, the effects of long-term ART were evaluated in domestic cats treated initially with the nucleoside transcriptase reverse inhibitor (NTRI) zidovudine (AZT) over a period ranging from 5-6 years, followed by a regimen of the NTRI lamivudine (3TC) plus AZT over 3 years. Viral load, sequencing of pol (reverse transcriptase [RT]) region and CD4:CD8 lymphocyte ratio were evaluated during and after treatment. Untreated cats were evaluated as a control group. CD4:CD8 ratios were lower, and uncharacterized resistance mutations were found in the RT region in the group of treated cats. A slight increase in viral load was observed in some cats after discontinuing treatment. The data strongly suggest that treated cats were resistant to therapy, and uncharacterized resistance mutations in the RT gene of FIV were selected for by AZT. Few studies have been conducted to evaluate the effect of long-term antiretroviral therapy in cats. To date, resistance mutations have not been described in vivo. © ISFM and AAFP 2015.
Directory of Open Access Journals (Sweden)
Nagaraj B. Kalburgi
2013-01-01
Full Text Available Background. Proinflammatory and anti-inflammatory cytokines play a key role in the pathogenesis of periodontal diseases. Secretion of bioactive IL-35 has been described by T regulatory cells ( and is required for their maximal suppressive activity. are involved in the modulation of local immune response in chronic periodontitis patients. Objective. Hence, the present study was aimed to investigate the expression of IL-35 mRNA in chronic periodontitis and aggressive periodontitis patients. Materials and Methods. The present study was carried out in 60 subjects, which included 20 chronic periodontitis patients, 20 aggressive periodontitis patients, and 20 periodontally healthy controls. IL-35 mRNA expression in gingival tissue samples of all subjects was semiquantitatively analyzed using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR. Results. The present study demonstrated the expression of IL-35 mRNA in gingival tissues of all the three groups. IL-35 mRNA expression was highest in chronic periodontitis subjects ( as compared to the aggressive periodontitis group ( and least seen in healthy patients (. Conclusion. The increased expression of IL-35 in chronic and aggressive periodontitis suggests its possible role in pathogenesis of periodontitis. Future studies done on large samples with intervention will strengthen our result.
Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.
Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le
2017-11-01
Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.
Kilian, A; Bowtell, D D; Abud, H E; Hime, G R; Venter, D J; Keese, P K; Duncan, E L; Reddel, R R; Jefferson, R A
1997-11-01
Telomerase is a multicomponent reverse transcriptase enzyme that adds DNA repeats to the ends of chromosomes using its RNA component as a template for synthesis. Telomerase activity is detected in the germline as well as the majority of tumors and immortal cell lines, and at low levels in several types of normal cells. We have cloned a human gene homologous to a protein from Saccharomyces cerevisiae and Euplotes aediculatus that has reverse transcriptase motifs and is thought to be the catalytic subunit of telomerase in those species. This gene is present in the human genome as a single copy sequence with a dominant transcript of approximately 4 kb in a human colon cancer cell line, LIM1215. The cDNA sequence was determined using clones from a LIM1215 cDNA library and by RT-PCR, cRACE and 3'RACE on mRNA from the same source. We show that the gene is expressed in several normal tissues, telomerase-positive post-crisis (immortal) cell lines and various tumors but is not expressed in the majority of normal tissues analyzed, pre-crisis (non-immortal) cells and telomerase-negative immortal (ALT) cell lines. Multiple products were identified by RT-PCR using primers within the reverse transcriptase domain. Sequencing of these products suggests that they arise by alternative splicing. Strikingly, various tumors, cell lines and even normal tissues (colonic crypt and testis) showed considerable differences in the splicing patterns. Alternative splicing of the telomerase catalytic subunit transcript may be important for the regulation of telomerase activity and may give rise to proteins with different biochemical functions.
Reverse triiodothyronine in protein energy malnutrition
International Nuclear Information System (INIS)
Hafiez, A.A.; Abdel-Salam, E.; Abbas, E.Z.; Halawa, F.A.; El-Hefnawy, N.
1984-01-01
Serum levels of thyroxine (T 4 ), triiodothyronine (T 3 ), reverse triiodothyronine (rT 3 ) and thyrotropin (TSH) were determined in cases of kwashiorkor and marasmus. Decreased levels of T 4 and T 3 , and increased levels of rT 3 with no change in TSH were obtained. Thus in infants suffering from protein energy malnutrition there is a state of thyroid dysfunction as well as a shift in the peripheral T 4 metabolism being converted to the inert rT 3 rather than to the physiologically active T 3 . (author)
Directory of Open Access Journals (Sweden)
Markus Hecht
Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic
International Nuclear Information System (INIS)
Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.
1999-01-01
We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia
2011-06-01
Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.
Kurosaki, Yohei; Magassouba, N’Faly; Oloniniyi, Olamide K.; Cherif, Mahamoud S.; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro
2016-01-01
Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure. PMID:26900929
Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O
2017-10-01
Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.
Okuda, Mitsuru; Okuda, Shiori; Iwai, Hisashi
2015-09-01
Cucurbit chlorotic yellows virus (CCYV) of the genus Crinivirus within the family Closteroviridae is an emerging infectious agent of cucurbits leading to severe disease and significant economic losses. Effective detection and identification methods for this virus are urgently required. In this study, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed to detect CCYV from its vector Bemisia tabaci. LAMP primer sets to detect CCYV were evaluated for their sensitivity and specificity, and a primer set designed from the HSP70h gene with corresponding loop primers were selected. The RT-LAMP assay was applied to detect CCYV from viruliferous B. tabaci trapped on sticky traps. A simple extraction procedure using RNAsecure™ was developed for template preparation. CCYV was detected in all of the B. tabaci 0, 1, 7 and 14 days after they were trapped. Although the rise of turbidity was delayed in reactions using RNA from B. tabaci trapped for 7 and 14 days compared with those from 0 and 1 day, the DNA amplification was sufficient to detect CCYV in all of the samples. These findings therefore present a simple template preparation method and an effective RT-LAMP assay, which can be easily and rapidly performed to monitor CCYV-viruliferous B. tabaci in the field. Copyright © 2015 Elsevier B.V. All rights reserved.
Design, Conformation, and Crystallography of 2-Naphthyl Phenyl Ethers as Potent Anti-HIV Agents
Energy Technology Data Exchange (ETDEWEB)
Lee, Won-Gil; Chan, Albert H.; Spasov, Krasimir A.; Anderson, Karen S.; Jorgensen, William L.
2016-12-08
Catechol diethers that incorporate a 7-cyano-2-naphthyl substituent are reported as non-nucleoside inhibitors of HIV-1 reverse transcriptase (NNRTIs). Many of the compounds have 1–10 nM potencies toward wild-type HIV-1. An interesting conformational effect allows two unique conformers for the naphthyl group in complexes with HIV-RT. X-ray crystal structures for 4a and 4f illustrate the alternatives.
Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip
Directory of Open Access Journals (Sweden)
Yanling Xia
2018-04-01
Full Text Available Objective Molecular cloning and bioinformatics analysis of annexin A2 (ANXA2 gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. Methods The reverse transcriptase polymerase chain reaction (RT-PCR was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer (Cervus Nippon hortulorum and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR. Results The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus. Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period. Conclusion ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.
Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki
2014-01-01
Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.
Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi
2018-05-11
Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.
Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR
Directory of Open Access Journals (Sweden)
Sérgio Monteiro de Almeida
Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.
HCV viremia in clinical and biomedical perspective
International Nuclear Information System (INIS)
Hussain, A.B.; Tariq, W.Z.; Karamat, K.A.; Ghani, E.; Mushtaq, S.
2000-01-01
Sera of 172 patients from military / civil hospitals and general practitioners of Rawalpindi/Islamabad region and vicinity areas of northern Pakistan with anti-HCV IgG positive aerostats were tested at Armed Forces Institute of Pathology (AFIP), Rawalpindi, between July and November, 1997 for detection of HCV viremia by reverse transcriptases polymerase chain reaction (RT-PCR). Randomly selected 100 samples (40 viremia positive and 60 negative after PCR) were tested for serum alanine aminotransferase (ALT) levels. For each patient, information based upon clinical and laboratory findings was recorded on a performa to correlate the clinical and biochemical findings with the results of qualitative reverse transcriptase polymerase Chain Reaction (RT PCR) for HCV in Hepatitis C virus (HCV) infected patients. Of the total 172 HCV infected (Anti HCV Positive), 61(35.61%) patients were found to be viremic. Active infection was more frequent in the age of 30 years onwards. The past history of jaundice, surgical operation and chronic renal failure was more frequent with the viremia positive cases. Although, statistically insignificant, there was evidence of some association of diabetes mellitus with viremia ALT levels and its mean were higher in viremics, 27(73%) of 37 cases with a minimum three months history of interferon treatment for hepatitis C were found negative for viremia. (author)
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Höfler, Daniela; Böhmer, Gerd; von Wasielewski, Reinhard; Neumann, Heinrich; Halec, Gordana; Holzinger, Dana; Dondog, Bolormaa; Gissmann, Lutz; Pawlita, Michael; Schmitt, Markus
2015-09-01
Cervical cancer precursor screening by HPV testing has a low positive predictive value for advanced lesion. HPV16 RNA patterns characteristic for HPV16-transformed cells but based on laborious, cost-intensive singleplex NASBA reactions promised high value in triaging HPV16 DNA-positive women. We developed two high-throughput reverse transcriptase quantitative (RT-q) PCR assays for the HPV16 transcripts E6*I, E1^E4 and E1C and the cellular transcript ubiquitin C and analysed RNA of 158 singly HPV16 DNA-positive cervical cell samples archived in PreservCyt buffer for the presence of transformation-associated HPV16 RNA patterns, i.e., upregulation of E6*I relative to E1^E4 and/or presence of E1C. HPV16 RNA pattern analyses classified 85% of 58 samples diagnosed ≤CIN1 (no cytologically and histologically detectable cervical lesion or CIN grade 1) as negative and 90% of 59 samples diagnosed as ≥CIN3 (CIN grade 3 or invasive cancer) as positive. Among 41 CIN grade 2 samples representing an intermediate lesion group, 49% were HPV16 RNA patterns-positive. Interestingly, 3 of 4 HPV16 RNA patterns-positive lesions initially diagnosed as ≤CIN1 at follow-up 5-24 months later had progressed to ≥CIN2. We successfully developed and validated a second generation of HPV16 RNA patterns assay by rapid RT-qPCR as triage marker for HPV16 DNA-positive women offering clinical utility to distinguish between the need for immediate colposcopy and continued observation. Limited follow-up data suggests that HPV16 RNA patterns-positivity in ≤CIN1 lesions can predict disease progression. Copyright © 2015 Elsevier Inc. All rights reserved.
Development of a one-step duplex RT-qPCR for the quantification of phocine distemper virus.
Bogomolni, Andrea L; Frasca, Salvatore; Matassa, Keith A; Nielsen, Ole; Rogers, Kara; De Guise, Sylvain
2015-04-01
Worldwide, stranded marine mammals and the network personnel who respond to marine mammal mortality have provided much of the information regarding marine morbillivirus infections. An assay to determine the amount of virus present in tissue samples would be useful to assist in routine surveying of animal health and for monitoring large-scale die-off events. False negatives from poor-quality samples prevent determination of the true extent of infection, while only small amounts of tissue samples or archived RNA may be available at the time of collection for future retrospective analysis. We developed a one-step duplex real-time reverse transcriptase-quantitative-PCR assay (RT-qPCR) based on Taqman probe technology to quantify phocine distemper virus (PDV) isolated from an outbreak in harbor (Phoca vitulina concolor) and gray seals (Halichoerus grypus) along the northeast US coast in 2006. The glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) gene was selected to assess RNA quality. This duplex assay is specific for PDV and sensitive through a range of 10(0) to 10(9) copies ds-plasmid DNA. For the GAPDH target, the reaction in duplex amplified 10(0) to 10(9) copies of ds-plasmid DNA and was detectable in multiple seal species. This assay reduced the likelihood of false negative results due to degradation of tissues and well-to-well variability while providing sensitive and specific detection of PDV, which would be applicable in molecular epidemiologic studies and pathogen detection in field and laboratory investigations involving a variety of seal species.
International Nuclear Information System (INIS)
Maria Lina R; Andi Yasmon
2011-01-01
There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
International Nuclear Information System (INIS)
Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander
2002-01-01
Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment
1992-08-10
Purified protein derivative of Mycobacterium tuberculosis and excretory-secretory antigen(s) of Toxocara canis expand in vitro human T cells with...day after immunization viii 47 49 LIST OF TABLES I. PCR primers and Southern blot probes of Th 11Th2 cytokines II. Cytokine mRNA levels in Thyl...sensitive quantitative reverse transcriptase-polymerase chain reaction (RT- PCR ) assay to measure changes in Thl and Th2 cytokine gene expression during
Identification of rhabdoviral sequences in oropharyngeal swabs from German and Danish bats.
Fischer, Melina; Freuling, Conrad M; Müller, Thomas; Schatz, Juliane; Rasmussen, Thomas Bruun; Chriel, Mariann; Balkema-Buschmann, Anne; Beer, Martin; Hoffmann, Bernd
2014-11-25
In the frame of active lyssavirus surveillance in bats, oropharyngeal swabs from German (N = 2297) and Danish (N = 134) insectivorous bats were investigated using a newly developed generic pan-lyssavirus real-time reverse transcriptase PCR (RT-qPCR). In total, 15 RT-qPCR positive swabs were detected. Remarkably, sequencing of positive samples did not confirm the presence of bat associated lyssaviruses but revealed nine distinct novel rhabdovirus-related sequences. Several novel rhabdovirus-related sequences were detected both in German and Danish insectivorous bats. The results also prove that the novel generic pan-lyssavirus RT-qPCR offers a very broad detection range that allows the collection of further valuable data concerning the broad and complex diversity within the family Rhabdoviridae.
Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.
Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping
2017-07-25
Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an
Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.
De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda
2018-04-01
Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun
2011-07-01
This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Wang Wei
2011-03-01
Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.
Satoh, Tetsuya; Kouroki, Seiya; Ogawa, Keita; Tanaka, Yorika; Matsumura, Kazutoshi; Iwase, Susumu
2018-04-25
Identifying body fluids from forensic samples can provide valuable evidence for criminal investigations. Messenger RNA (mRNA)-based body fluid identification was recently developed, and highly sensitive parallel identification using reverse transcription polymerase chain reaction (RT-PCR) has been described. In this study, we developed reverse transcription loop-mediated isothermal amplification (RT-LAMP) as a simple, rapid assay for identifying three common forensic body fluids, namely blood, semen, and saliva, and evaluated its specificity and sensitivity. Hemoglobin beta (HBB), transglutaminase 4 (TGM4), and statherin (STATH) were selected as marker genes for blood, semen, and saliva, respectively. RT-LAMP could be performed in a single step including both reverse transcription and DNA amplification under an isothermal condition within 60 min, and detection could be conveniently performed via visual fluorescence. Marker-specific amplification was performed in each assay, and no cross-reaction was observed among five representative forensically relevant body fluids. The detection limits of the assays were 0.3 nL, 30 nL, and 0.3 μL for blood, semen, and saliva, respectively, and their sensitivities were comparable with those of RT-PCR. Furthermore, RT-LAMP assays were applicable to forensic casework samples. It is considered that RT-LAMP is useful for body fluid identification.
Wang, D; Wang, X; Geng, Y; An, C
2014-01-01
The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR) and real-time PCR. A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.
Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi
2016-12-10
The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure
Modeling qRT-PCR dynamics with application to cancer biomarker quantification.
Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A
2017-01-01
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.
Biomarker discovery for colon cancer using a 761 gene RT-PCR assay
Directory of Open Access Journals (Sweden)
Hackett James R
2007-08-01
Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of
SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.
Directory of Open Access Journals (Sweden)
Daijun Ling
Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.
Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A
2010-10-01
The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT
Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan
2017-01-01
The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...
Maw, Min Thein; Yamaguchi, Tsuyoshi; Kasanga, Christopher J; Terasaki, Kaori; Fukushi, Hideto
2006-12-01
A practical sampling method for bursal tissue using ordinary paper for molecular diagnosis of infectious bursal disease (IBD) was established. IBD virus-infected bursa was directly smeared on chromatography paper, filter paper, or stationery copy paper and was then fixed with absolute ethanol, Tris-HCl-saturated phenol, or phenol:chloroform:isoamyl alcohol (25:24:1). Flinders Technology Associates (FTA) card, which is designed for the collection of biological samples for molecular detection, was also used. After storage at 37 C for up to 30 days, total RNA directly extracted from the tissue fixed on the papers and FTA card were subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) for detection of IBD virus (IBDV) RNA. In addition, the ability of each chemical used in the fixation and the FTA card to inactivate IBDV was evaluated. Regardless of the paper quality, storage period, and fixation method, IBDV RNA was consistently detected in all of the samples. IBDV in the bursal tissue was inactivated with phenol but not with ethanol or the unknown chemicals in FTA card. These results show that ordinary papers sustain the viral RNA, as does FTA card, but phenol fixation is superior to FTA card in inactivating IBDV. The new sampling method using ordinary paper with phenol fixation is safe, inexpensive, simple, and easy, and is thus suitable for conducting a global survey of IBD even where laboratory resources are limited. This practical method should contribute to the control of IBD worldwide.
Rapid, sensitive and effective diagnostic tools for foot-and-mouth disease virus in Africa
Directory of Open Access Journals (Sweden)
Christopher J. Kasanga
2014-04-01
Full Text Available Speed is paramount in the diagnosis of highly infectious diseases, such as foot-and-mouth disease (FMD, as well as for emerging diseases; however, simplicity is required if a test is to be deployed in the field. Recent developments in molecular biology have enabled the specific detection of FMD virus (FMDV by reverse-transcription loop-mediated isothermal amplification (RT-LAMP, real-time reverse-transcription polymerase chain reaction (RT-qPCR and sequencing. RT-LAMP enables amplification of the FMDV RNA-dependent RNA polymerase 3D(pol gene at 63 °C (in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase for 1 h, whilst RT-qPCR amplifies the same gene in approximately 2 h 30 min. In this study, we compared the sensitivity and effectiveness of RT-LAMP against RT-qPCR for the detection of the FMDV 3D(pol gene in 179 oesophageal-pharyngeal scraping samples (collected by probang obtained from clinically healthy cattle and buffalo in Malawi, Mozambique and Tanzania in 2010. The FMDV detection rate was higher with RT-LAMP (30.2%; n = 54 than with RT-qPCR (17.3%; n = 31. All samples positive by RT-qPCR (Cq ≤ 32.0 were also positive for the RT-LAMP assay; and both assays proved to be highly specific for the FMDV target sequence. In addition, the VP1 sequences of 10 viruses isolated from positive samples corresponded to the respective FMDV serotypes and genotypes. Our findings indicate that the performance of RT-LAMP is superior to RT-qPCR. Accordingly, we consider this test to have great potential with regard to the specific detection and surveillance of infectious diseases of humans and animals in resource-compromised developing countries.
Directory of Open Access Journals (Sweden)
Dieter Hoffmann
Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.
Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption
Directory of Open Access Journals (Sweden)
Liu Chengqian
2011-05-01
Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.
DEFF Research Database (Denmark)
Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe
2009-01-01
Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....
Early Hypoparathyroidism Reversibility with Treatment of Riedel's Thyroiditis.
Stan, Marius N; Haglind, Elizabeth G; Drake, Matthew T
2015-09-01
Riedel's thyroiditis (RT) is a rare, fibroinflammatory condition which induces gradual thyroid gland destruction and adjacent soft-tissue fibrous infiltration. About one- seventh of RT cases are associated with hypoparathyroidism, necessitating long-term therapy for symptomatic hypocalcemia. The reversibility of the parathyroid hormone deficit has not been fully described. A 40-year-old woman with no prior history of thyroid disease presented with a six month history of progressive thyroid enlargement complicated by worsening dysphagia and positional dyspnea. Her past medical history was remarkable only for retroperitoneal fibrosis. Physical examination revealed a large, hard, non-mobile goiter. Thyroid indices while maintained on levothyroxine were normal, but marked asymptomatic hypocalcemia with an inappropriately normal parathyroid hormone level was noted. Thyroid imaging and fine needle aspiration were consistent with RT. Isthmectomy and subsequent serial corticosteroid and tamoxifen treatment led to rapid symptom improvement. Serum calcium and parathyroid hormone levels returned to the reference range within three months. We describe a case of RT in which hypoparathyroidism resolved after treatment targeted the mechanical compression and the fibroinflammatory milieu of the patient's thyroidal disease. RT can be associated with hypoparathyroidism that is clinically silent at presentation. Mechanical decompression of the goiter and immunomodulatory therapy can reverse the fibrosclerotic process and lead to rapid recovery of parathyroid gland function, as in this patient. However, in most cases hypoparathyroidism is persistent and requires continued treatment to prevent symptomatic hypocalcemia.
Directory of Open Access Journals (Sweden)
D Wang
2014-01-01
Full Text Available Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD for an early treatment by using loop-mediated isothermal amplification (LAMP technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR and real-time PCR. Results : A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. Conclusions : The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.
Directory of Open Access Journals (Sweden)
Joojin Jeong
2015-09-01
Full Text Available The primary step for efficient control of viral diseases is the development of simple, rapid, and sensitive virus detection. Reverse transcription loop-mediated isothermal amplification (RT-LAMP has been used to detect viral RNA molecules because of its simplicity and high sensitivity for a number of viruses. RT-LAMP for the detection of Potato virus X (PVX was developed and compared with conventional reverse transcription polymerase chain reaction (RT-PCR to demonstrate its advantages over RT-PCR. RT-LAMP reactions were conducted with or without a set of loop primers since one out of six primers showed PVX specificity. Based on real-time monitoring, RT-LAMP detected PVX around 30 min, compared to 120 min for RT-PCR. By adding a fluorescent reagent during the reaction, the extra step of visualization by gel electrophoresis was not necessary. RT-LAMP was conducted using simple inexpensive instruments and a regular incubator to evaluate whether RNA could be amplified at a constant temperature instead of using an expensive thermal cycler. This study shows the potential of RT-LAMP for the diagnosis of viral diseases and PVX epidemiology because of its simplicity and rapidness compared to RT-PCR.
Generation and Characterization of a Defective HIV-1 Virus as an Immunogen for a Therapeutic Vaccine
García-Pérez, Javier; García, Felipe; Blanco, Julia; Escribà-García, Laura; Gatell, Jose Maria; Alcamí, Jose; Plana, Montserrat; Sánchez-Palomino, Sonsoles
2012-01-01
Background The generation of new immunogens able to elicit strong specific immune responses remains a major challenge in the attempts to obtain a prophylactic or therapeutic vaccine against HIV/AIDS. We designed and constructed a defective recombinant virus based on the HIV-1 genome generating infective but non-replicative virions able to elicit broad and strong cellular immune responses in HIV-1 seropositive individuals. Results Viral particles were generated through transient transfection in producer cells (293-T) of a full length HIV-1 DNA carrying a deletion of 892 base pairs (bp) in the pol gene encompassing the sequence that codes for the reverse transcriptase (NL4-3/ΔRT clone). The viral particles generated were able to enter target cells, but due to the absence of reverse transcriptase no replication was detected. The immunogenic capacity of these particles was assessed by ELISPOT to determine γ-interferon production in a cohort of 69 chronic asymptomatic HIV-1 seropositive individuals. Surprisingly, defective particles produced from NL4-3/ΔRT triggered stronger cellular responses than wild-type HIV-1 viruses inactivated with Aldrithiol-2 (AT-2) and in a larger proportion of individuals (55% versus 23% seropositive individuals tested). Electron microscopy showed that NL4-3/ΔRT virions display immature morphology. Interestingly, wild-type viruses treated with Amprenavir (APV) to induce defective core maturation also induced stronger responses than the same viral particles generated in the absence of protease inhibitors. Conclusions We propose that immature HIV-1 virions generated from NL4-3/ΔRT viral clones may represent new prototypes of immunogens with a safer profile and stronger capacity to induce cellular immune responses than wild-type inactivated viral particles. PMID:23144996
Raees Ahmad, Sufiyan Ahmad; Patil, Lalit; Mohammed Usman, Mohammed Rageeb; Imran, Mohammad; Akhtar, Rashid
2018-01-01
A simple rapid, accurate, precise, and reproducible validated reverse phase high performance liquid chromatography (HPLC) method was developed for the determination of Abacavir (ABAC) and Lamivudine (LAMI) in bulk and tablet dosage forms. The quantification was carried out using Symmetry Premsil C18 (250 mm × 4.6 mm, 5 μm) column run in isocratic way using mobile phase comprising methanol: water (0.05% orthophosphoric acid with pH 3) 83:17 v/v and a detection wavelength of 245 nm and injection volume of 20 μl, with a flow rate of 1 ml/min. In the developed method, the retention times of ABAC and LAMI were found to be 3.5 min and 7.4 min, respectively. The method was validated in terms of linearity, precision, accuracy, limits of detection, limits of quantitation, and robustness in accordance with the International Conference on Harmonization guidelines. The assay of the proposed method was found to be 99% - 101%. The recovery studies were also carried out and mean % recovery was found to be 99% - 101%. The % relative standard deviation from reproducibility was found to be performance liquid chromatography, UV: Ultraviolet, ICH: International Conference on Harmonization, ABAC: Abacavir, LAMI: Lamivudine, HIV: Human immunodeficiency virus, AIDS: Acquired immunodeficiency syndrome, NRTI: Nucleoside reverse transcriptase inhibitors, ARV: Antiretroviral, RSD: Relative standard deviation, RT: Retention time, SD: Standard deviation.
Chung, Suhman; Wendeler, Michaela; Rausch, Jason W.; Beilhartz, Greg; Gotte, Matthias; O'Keefe, Barry R.; Bermingham, Alun; Beutler, John A.; Liu, Shixin; Zhuang, Xiaowei; Le Grice, Stuart F. J.
2010-01-01
Vinylogous ureas 2-amino-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxamide and N-[3-(aminocarbonyl)-4,5-dimethyl-2-thienyl]-2-furancarboxamide (compounds 1 and 2, respectively) were recently identified to be modestly potent inhibitors of the RNase H activity of HIV-1 and HIV-2 reverse transcriptase (RT). Both compounds shared a 3-CONH2-substituted thiophene ring but were otherwise structurally unrelated, which prevented a precise definition of the pharmacophore. We have therefore exa...
Development of a diagnostic kit for Tamiflu-resistant influenze A (H1N1)
Energy Technology Data Exchange (ETDEWEB)
Jung, I. L.
2012-12-15
Using by pre-developed multiplex RT-PCR kit that is able to diagnosis Tamiflu-sensitive and -resistant Swine Influenza A (H1N1) in the 1st research year, reproducibility and sentitivity of the kit has been investigated in this year. The optimum concentration of reverse transcriptase has also been determined and the economic evaluation has been carried out in this year. Based on the results, a international patent has been applied and a domestic patent has been registered in this year.
Directory of Open Access Journals (Sweden)
Charlotte Nejad
2018-01-01
Full Text Available MicroRNA (miRNA detection by reverse transcription (RT quantitative real-time PCR (RT-qPCR is the most popular method currently used to measure miRNA expression. Although the majority of miRNA families are constituted of several 3′-end length variants (“isomiRs”, little attention has been paid to their differential detection by RT-qPCR. However, recent evidence indicates that 3′-end miRNA isoforms can exhibit 3′-length specific regulatory functions, underlining the need to develop strategies to differentiate 3′-isomiRs by RT-qPCR approaches. We demonstrate here that polyadenylation-based RT-qPCR strategies targeted to 20–21 nt isoforms amplify entire miRNA families, but that primers targeted to >22 nt isoforms were specific to >21 nt isoforms. Based on this observation, we developed a simple method to increase selectivity of polyadenylation-based RT-qPCR assays toward shorter isoforms, and demonstrate its capacity to help distinguish short RNAs from longer ones, using synthetic RNAs and biological samples with altered isomiR stoichiometry. Our approach can be adapted to many polyadenylation-based RT-qPCR technologies already exiting, providing a convenient way to distinguish long and short 3′-isomiRs.
Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors
CSIR Research Space (South Africa)
Bode, ML
2011-06-01
Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...
Moura, Maria Edileuza Soares; da Guarda Reis, Mônica Nogueira; Lima, Yanna Andressa Ramos; Eulálio, Kelsen Dantas; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo
2015-05-01
HIV-1 transmitted-drug-resistance and genetic diversity are dynamic and may differ in distinct locations/risk groups. In Brazil, increased AIDS incidence and related mortality have been detected in the Northeast region, differently from the epicenter in the Southeast. This cross-sectional study describes transmitted-dru- resistance and HIV-1 subtypes in protease/PR and reverse transcriptase/RT regions among antiretroviral naïve patients from Piauí State, Northeast Brazil. Among 96 patients recruited 89 (92.7%) had HIV-1 PR/RT regions sequenced: 44 females and 45 males, 22 self-declared as men who have sex with men. Transmitted-drug-resistance was investigated by CPR tool (Stanford HIV-1 Drug Resistance/SDRM). HIV-1 subtypes were assigned by REGA and phylogenetic inference. Overall, transmitted-drug-resistance rate was 11.2% (10/89; CI 95%: 5.8-19.1%); 22.7% among men who have sex with men (5/22; CI 95%: 8.8-43.4%), 10% in heterosexual men (2/20; CI 95%: 1.7-29.3%) and 6.8% in women (3/44; CI 95%: 1.8-17.4%). Singleton mutations to protease-inhibitor/PI, nucleoside-reverse-transcriptase-inhibitor/NRTI or non-nucleoside-reverse-transcriptase-inhibitor/NNRTI predominated (8/10): PI mutations (M46L, V82F, L90M); NRTI mutations (M41L, D67N) and NNRTI mutations (K103N/S). Dual class resistance mutations to NRTI and NNRTI were observed: T215L (NRTI), Y188L (NNRTI) and T215N (NRTI), F227L (NNRTI). Subtype B prevailed (86.6%; 77/89), followed by subtype F1 (1.1%, 1/89) and subtype C (1.1%, 1/89). B/F1 and B/C intersubtype recombinants represented 11.2% (10/89). In Piauí State extensive testing of incidence and transmitted-drug-resistance in all populations with risk behaviors may help control AIDS epidemic locally. © 2015 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Isoda, Hideka; Mori, Tomoko; Nishio, Daisuke; Tokura, Yoshiki; Yasuda, Hiroshi
2005-01-01
Sentinel lymph node (SLN) biopsy has been performed in 25 patients with malignant melanoma for the last four years at the Department of Dermatology, University of Occupational and Environmental Health. SLNs were identified by using both patent blue dye and redionucleotide-labeled colloid methods. The removed SLNs were subjected to routine haematoxylin-eosin staining and immunohistochemical stainings for Melan-A, S-100 protein and HMB45, and 10 of 25 cases had positive SLN metastases. In 8 cases, mRNA for malignant melanoma related molecules, gp100, MART-1 and tyrosinase, was analyzed by RT-PCR, and 7 of 8 cases gave agreement with the histopathological results. One case had negative SLN metastasis on histopathological examination but exhibited amplification of mRNA for the melanoma-related molecules on RT-PCR analysis. (author)
Study on the Image Quality Comparison between in Digital RT and Film RT
International Nuclear Information System (INIS)
Park, Sang Ki; Ahn, Yean Shik; Gil, Doo Song
2011-01-01
Conventional film radiographic test has been generally and widely used in the inspection on the weldment for quality assurance. On the other hand, since the analog RT is well known for typical time and cost consuming method with complex process of inspection, the industry has researched various ways how to improve radiographic test technology. In this study, we verified the fact that digital RT provides a lot more benefit in effectively detecting defects, ever film details, through digital processing of image enhancement, compared to film RT. As a result, we reached conclusion that digital RT is positively able to replace the film RT in industry in part or in whole
Saadati, Hakimeh; Sheibani, Vahid; Esmaeili-Mahani, Saeed; Darvishzadeh-Mahani, Fatemeh; Mazhari, Shahrzad
2014-11-01
Previous studies indicated that brain-derived neurotrophic factor (BDNF) is the main candidate to mediate the beneficial effects of exercise on cognitive function in sleep deprived male rats. In addition, our previous findings demonstrate that female rats are more vulnerable to the deleterious effects of sleep deprivation on cognitive performance and synaptic plasticity. Therefore, the current study was designed to investigate the effects of treadmill exercise and/or sleep deprivation (SD) on the levels of BDNF mRNA and protein in the hippocampus of female rats. Intact and ovariectomized (OVX) female Wistar rats were used in the present experiment. The exercise protocol was four weeks treadmill running and sleep deprivation was accomplished using the multiple platform method. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and immunoblot analysis were used to evaluate the level of BDNF mRNA and protein in the rat hippocampus respectively. Our results showed that protein and mRNA expression of BDNF was significantly (psleep deprived OVX rats under exercise conditions had a significant (peffect against hippocampus-related functions and impairments induced by sleep deprivation probably by inducing BDNF expression. Copyright © 2014 Elsevier B.V. All rights reserved.
Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.
2015-01-01
Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...
Polymorphisms of HIV RT gene among the ART naïve native drug exposed rural PLHA
Directory of Open Access Journals (Sweden)
K Mohana Krishnan
2012-01-01
Full Text Available Background: The number of people living with human immunodeficiency virus (HIV is increasing day by day in India. The disease has now spread from urban areas to rural areas. The proof reading of the reverse transcriptase enzyme is poor, which may lead to genetic diversity within the HIV strains, which in turn leads to problems like failure or resistance in antiretroviral treatment. This study is designed to find out the polymorphisms of the reverse transcriptase gene of HIV, after the native drug pressure among antiretroviral therapy (ART naïve rural people living with HIV/AIDS (RPLHA. Materials and Methods : A total of 207 HIV-Reactive patients were allowed to take native drugs from the local area and were advised to attend the center for HIV after six months for a follow-up. At the time of the follow-up visit, a second blood sample was taken from 20 reactive native-drug exposed ART-naïve patients. The plasma was separated and transported at 20°C to the YRG Care Center for genotyping. Results: Among the 20 HIV-reactive samples processed for gene sequencing analysis to detect the genotypic variations, only one sample (5% showed high-level mutational resistance variations and the predominant polymorphisms detected were V35T (100%, K122E (94.44%, and V60I (88.88%. Conclusions: The presence of drug-resistance mutations, although minimal, was important, as the drug-resistant strains could spread among the RPLHA and to their sexual partners. There was a definite need to generate a drug resistance database and the polymorphic pattern of Indian strains concern to the future clinical management of the disease, and a vaccine design to contain the disease.
Randazzo, Cinzia L.; Torriani, Sandra; Akkermans, Antoon D. L.; de Vos, Willem M.; Vaughan, Elaine E.
2002-01-01
The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene...
DEFF Research Database (Denmark)
Christoffersen, Mette; Woodward, Elizabeth; Bojesen, Anders Miki
2012-01-01
endometritis based on their endometrial histopathology and ability to clear an induced uterine inflammation. To investigate the effect of immunomodulatory therapy, the mares were inoculated with 10(5) colony forming units (CFU) Escherichia coli in three consecutive estrus cycles in a modified cross-over study...... inoculation. Endometrial biopsies were recovered 3, 24 and 72 h post inoculation. Relative gene-expression analyses were performed by quantitative reverse transcriptase PCR (qRT-PCR). Endometrial gene expression of inflammatory cytokines was modulated by administration of GC. Expression of proinflammatory...
Porcine UCHL1: genomic organization, chromosome localization and expression analysis
DEFF Research Database (Denmark)
Larsen, Knud; Madsen, Lone Bruhn; Bendixen, Christian
2012-01-01
to and protection from Parkinson’s disease. Here we report cloning, characterization, expression analysis and mapping of porcine UCHL1. The UCHL1 cDNA was amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using oligonucleotide primers derived from in silico sequences. The porcine cDNA codes...... in developing porcine embryos. UCHL1 transcript was detected as early as 40 days of gestation. A significant decrease in UCHL1 transcript was detected in basal ganglia from day 60 to day 115 of gestation...
Zhan, Fangfang; Zhou, Xiaoming
2012-12-01
Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.
Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.
Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael
2009-10-01
Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.
Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang
2006-05-01
To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.
Generation of recombinant pestiviruses using a full genome amplification strategy
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Reimann, Ilona; Uttenthal, Åse
Aim Complete genome amplification of viral RNA provides a new tool for generation of modified pestiviruses. We have recently reported a full genome amplification strategy for direct recovery of infectious pestivirus (Rasmussen et al., 2008). This comprised rescue of BDV strain “Gifhorn” from a full......-length RT-PCR amplicon demonstrating that long RT-PCR can be used for direct generation of an infectious pestivirus. The strategy is not limited to amplification of BDV “Gifhorn”, but can be further utilized for amplification of a diverse selection of pestivirus strains and for the generation of modified...... was reverse transcribed to cDNA at 50C for 90 minutes using SuperScript III reverse transcriptase (Invitrogen). Full-length PCR amplification was performed using primers specific for the extreme 5’- and 3’-ends of the viral genomes. A T7 promoter was incorporated in the 5’-primers for direct in vitro...
Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo
2013-12-01
Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.
Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei
2015-01-01
Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...
Rabies virus in a pregnant naturally infected southern yellow bat (Lasiurus ega
Directory of Open Access Journals (Sweden)
SD Allendorf
2011-01-01
Full Text Available Current knowledge on bat lyssavirus infections in their native hosts is limited and little is known about the virulence, virus dissemination and transmission among free-living insectivorous bats. The present study is a brief description of rabies virus (RABV dissemination in tissues of a naturally infected pregnant southern yellow bat (Lasiurus ega and its fetuses, obtained by reverse-transcriptase polymerase chain reaction (RT-PCR. The RT-PCR was positive in samples from the brain, salivary gland, tongue, lungs, heart, kidneys and liver. On the other hand, the placenta, three fetuses, spleen, intestine and brown fat tissue tested negative. This research demonstrated the absence of rabies virus in the fetuses, thus, in this specific case, the transplacentary transmission was not observed.
Detection of hepatitis C virus RNA using reverse transcription PCR
International Nuclear Information System (INIS)
Yap, S.F.
1998-01-01
Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory
APOBEC3G inhibits elongation of HIV-1 reverse transcripts.
Directory of Open Access Journals (Sweden)
Kate N Bishop
2008-12-01
Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.
Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T
1995-06-01
For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.
Hasiów-Jaroszewska, Beata; Budzyńska, Daria; Borodynko, Natasza; Pospieszny, Henryk
2015-12-01
A reverse transcription loop-mediated isothermal amplification assay (RT-LAMP) has been developed for detection of tomato black ring virus (TBRV) isolates collected from different hosts. One-step RT-LAMP was performed with a set of four primers, the design of which was based on the coat protein gene. Results of RT-LAMP were visualized by direct staining of products with fluorescent dyes, agarose gel electrophoresis, and analysis of amplification curves. The sensitivity of RT-LAMP was 100-fold greater than that of RT-PCR. The RT-LAMP assay developed here is a useful and practical method for diagnosis of TBRV.
Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.
Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M
2013-11-01
Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.
Detection and Analysis of Circular RNAs by RT-PCR.
Panda, Amaresh C; Gorospe, Myriam
2018-03-20
Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.
DEFF Research Database (Denmark)
Renno, T; Krakowski, M; Piccirillo, C
1995-01-01
in the pathology of multiple sclerosis and its animal model experimental allergic encephalomyelitis (EAE). We used reverse transcriptase (RT)-PCR to study the kinetics, cellular source, and regulation of cytokine gene expression in the central nervous system (CNS) of SJL/J mice with myelin basic protein......, the majority of which were identified as microglia and macrophages by their Mac-1 phenotype. Microglia could be discriminated by their low expression of CD45. Incubation of freshly derived, adult microglia from normal, uninfiltrated, CNS with activated Th1 supernatant induced the production of TNF-alpha m...
Nipah virus in the fruit bat Pteropus vampyrus in Sumatera, Indonesia.
Directory of Open Access Journals (Sweden)
Indrawati Sendow
Full Text Available Nipah virus causes periodic livestock and human disease with high case fatality rate, and consequent major economic, social and psychological impacts. Fruit bats of the genus Pteropus are the natural reservoir. In this study, we used real time PCR to screen the saliva and urine of P. vampyrus from North Sumatera for Nipah virus genome. A conventional reverse transcriptase (RT-PCR assay was used on provisionally positive samples to corroborate findings. This is the first report of Nipah virus detection in P. vampyrus in Sumatera, Indonesia.
DEFF Research Database (Denmark)
Munch, M; Møller-Larsen, A; Christensen, T
1995-01-01
with MS who had a reactivated Epstein-Barr virus (EBV) infection. Both LCLs were found by EM to produce RVLP and EBV particles. Reverse transcriptase (RT) assays were positive in purified viral material from both LCLs. To substantiate these findings we initiated an intensified culturing procedure and were......On several occasions we have observed retrovirus-like particles (RVLPs) by transmission electron microscopy (EM) of cultured T cells from a patient with MS. Later we established spontaneously formed B-lymphoblastoid cell lines (LCLs) from a patient with an MS-like disease and from another patient...
DEFF Research Database (Denmark)
Saiag, Philippe; Grob, Jean-Jacques; Lebbe, Celeste
2015-01-01
in situ hybridisation (FISH) or multiplex reverse transcriptase-polymerase chain reaction (RT-PCR) to detect specific chromosomal translocations and fusion gene transcripts is useful to confirm a difficult DFSP diagnosis. Treatment is mainly surgical, with the aim to achieve complete resection...... of the tumour. In order to reduce the recurrence rate, the treatment of choice of DFSP seems to be Mohs' micrographic surgery (MMS) and related variants. In hospitals where only standard histopathological procedures are available, standard excision with lateral safety margin of 3cm is advisable. Imatinib...
Expression of the RET/PTC fusion gene as a marker for papillary carcinoma in Hashimoto's thyroiditis
DEFF Research Database (Denmark)
Wirtschafter, A; Schmidt, R; Rosen, D
1997-01-01
specific genes in patients diagnosed with Hashimoto's disease. The newly identified oncogenes RET/PTC1 and RET/PTC3 provide useful and specific markers of the early stages of papillary carcinoma as they are highly specific for malignant cells. Using a sensitive and specific reverse transcriptase......-polymerase chain reaction (RT-PCR) assay, we found messenger RNA (mRNA) expression for the RET/PTC1 and RET/PTC3 oncogenes in 95% of the Hashimoto's patients studied. All Hashimoto's patients presenting without histopathologic evidence of papillary thyroid cancer showed molecular genetic evidence of cancer...
Post-induction residual disease in translocation t(12;21)-positive childhood ALL
DEFF Research Database (Denmark)
Seyfarth, Jeanette; Madsen, Hans O; Nyvold, Charlotte
2003-01-01
of induction therapy (prednisolone, vincristine, doxorubicin, i.t. methotrexate) by a competitive, clone-specific, semi-nested PCR analysis. RESULTS: Among 96 children diagnosed with ALL, and quantified for post induction residual disease, 32 were t(12;21)-positive. The median residual disease was similar...... and Oncology (NOPHO) ALL-MRD 95 study, which includes children from Iceland, Norway, and Denmark diagnose d with ALL, patients were screened for the presence of t(12; 21) by reverse transcriptase-polymerase chain reaction (RT-PCR) at diagnosis, and their residual disease was quantified after 4 weeks...
A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.
Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S
2013-10-01
A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.
Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.
2011-01-01
Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey
International Nuclear Information System (INIS)
Laurberg, P.; Weeke, J.
1977-01-01
A sensitive radioimmunoassay for measurements of 3,3,5-triiodothyronine (reverse T3,rT3) in small amounts of unextracted serum is described. The interference of rT3 binding proteins in serum was precluded by addition of 8-anilinol-naphthalene sulphonic acid (ANS). The cross reaction of T4 with the rT3 anti-serum varied with the concentration of T4 in the samples. At 50 per cent inhibition of I 125 rT3 binding, the T4 cross reaction was 0.075% (mol/mol). All values were corrected for T4 cross reaction. By the present method total rT3 averaged 0.37 nmol/l in thirty-two normal subjects. Higher values (0.81-1.98 nmol/l) were obtained in seventeen thyrotoxic patients, while the rT3 was very low (<=0.046 nmol/l) in ten patients with severe primary hypothyroidism. A modification of the total rT3 assay was used for measurements of rT3 in serum dialysates (free rT3). The sensitivity was 0.46 pmol/l. This sensitivity did not allow detection of free rT3 in all normal subjects. (Auth.)
Zong, Xiaojuan; Wang, Wenwen; Wei, Hairong; Wang, Jiawei; Chen, Xin; Xu, Li; Zhu, Dongzi; Tan, Yue; Liu, Qingzhong
2014-11-01
Prunus necrotic ringspot virus (PNRSV) has seriously reduced the yield of Prunus species worldwide. In this study, a highly efficient and specific two-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed to detect PNRSV. Total RNA was extracted from sweet cherry leaf samples using a commercial kit based on a magnetic nanoparticle technique. Transcripts were used as the templates for the assay. The results of this assay can be detected using agarose gel electrophoresis or by assessing in-tube fluorescence after adding SYBR Green I. The assay is highly specific for PNRSV, and it is more sensitive than reverse-transcription polymerase chain reaction (RT-PCR). Restriction enzyme digestion verified further the reliability of this RT-LAMP assay. To our knowledge, this is the first report of the application of RT-LAMP to PNRSV detection in Prunus species. Copyright © 2014 Elsevier B.V. All rights reserved.
Stability indicating studies on NMITLI 118RT+ (standardized extract of withania somnifera dunal)
Ahmad, Hafsa; Khandelwal, Kiran; Pachauri, Shakti Deep; Sanghwan, Rajender Singh; Dwivedi, Anil Kumar
2014-01-01
Background: Withania somnifera Dunal (Ashwagandha) is an Indian medicinal plant of great medicinal value; used in many clinically proven conditions. NMITLI-118RT+ is a candidate drug under a Council of Scientific and Industrial Research (CSIR) networking project. It is a chemotype of W. somnifera's root extract, which has been used for the present study. Objectives: The present investigation aims to develop and validate a simple isocratic reverse phase-high performance liquid chromatography (...
Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases
Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz
2016-01-01
Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain sampl...
Frozen magnetoresistance at magnetization reversal of granular Bi(Pb)-HTSC
International Nuclear Information System (INIS)
Sukhanov, A.A.; Omelchenko, V.I.
2004-01-01
The frozen magnetoresistance dependences of granular Bi(Pb)-HTSC samples on fields initiating a magnetic flux trapping and on magnetic reversal fields Rt(Hi, Hr) are investigated. It is found that the Rt (Hr) dependences are nonmonotonous. The frozen magnetoresistance decreases substantially after the first pulse Hr applied (Hr < Hi) but remains practically unchanged at subsequent remagnetization by magnetic pulses of alternating polarity and of the same amplitude. The effect of magnetic reversal on magnetoresistance anisotropy and the negative magnetoresistance phenomenon are studied. Is shown that the results obtained are inconsistent with the model of critical state for SC grains and the model of SC loops but are well described quantitatively by the proposed Bi(Pb)-HTSC model according to which the magnetic flux trapping occurs in normal grains with HTSC shells and the sample resistance is determined by weak link chains
Tsukamoto, K.; Javier, P.C.; Shishido, M.; Noguchi, D.; Pearce, J.; Kang, H.-M.; Jeong, O.M.; Lee, Y.-J.; Nakanishi, K.; Ashizawa, T.
2012-01-01
Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10 1.5, 10 2.3, and 10 3.1 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples. Copyright ?? 2012, American Society for Microbiology. All Rights Reserved.
D Wang; X Wang; Y Geng; C An
2014-01-01
Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conven...
Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R
2015-01-01
Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once
Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A
2017-01-01
Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N
Directory of Open Access Journals (Sweden)
Mok Helen OL
2006-09-01
Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This
Monforte, Anna-Maria; Ferro, Stefania; De Luca, Laura; Lo Surdo, Giuseppa; Morreale, Francesca; Pannecouque, Christophe; Balzarini, Jan; Chimirri, Alba
2014-02-15
A series of novel N1-aryl-2-arylthioacetamido-benzimidazoles were synthesized and evaluated as inhibitors of human immunodeficiency virus type-1 (HIV-1). Some of them proved to be effective in inhibiting HIV-1 replication at submicromolar and nanomolar concentration acting as HIV-1 non-nucleoside RT inhibitors (NNRTIs), with low cytotoxicity. The preliminary structure-activity relationship (SAR) of these new derivatives was discussed and rationalized by docking studies. Copyright © 2014 Elsevier Ltd. All rights reserved.
Parrella, G; Caprio, E; Mazzone, P
2006-01-01
A simple and rapid method for the extraction of total nucleic acid from honeybee and mite, useful either as template for RT-PCR or in nucleic acids hybridization, was developed. Sensitivity of the methods were evaluated up to 10(9) and 10(6) dilution of TNAs extracted from a single honeybee, for reverse transcriptase polymerase chain reaction and molecular hybridization respectively. The two diagnostic methods developed could be useful for the study of the molecular biology and the pathology of DWV. For practical applications dot-blot hybridization could be used in order to study the incidence of DWV in honeybees populations. The method is enough sensitive, rapid and less affected by contamination problems compared to RT-PCR and thus it could be applied to the sanitary certification of honeybees and their products.
Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P
2001-07-01
Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.
Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša
2018-05-03
RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.
Patick, A K; Boritzki, T J; Bloom, L A
1997-10-01
Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.
Emulating a crowded intracellular environment in vitro dramatically improves RT-PCR performance
International Nuclear Information System (INIS)
Lareu, Ricky R.; Harve, Karthik S.; Raghunath, Michael
2007-01-01
The polymerase chain reaction's (PCR) phenomenal success in advancing fields as diverse as Medicine, Agriculture, Conservation, or Paleontology is based on the ability of using isolated prokaryotic thermostable DNA polymerases in vitro to copy DNA irrespective of origin. This process occurs intracellularly and has evolved to function efficiently under crowded conditions, namely in an environment packed with macromolecules. However, current in vitro practice ignores this important biophysical parameter of life. In order to more closely emulate conditions of intracellular biochemistry in vitro we added inert macromolecules into reverse transcription (RT) and PCR. We show dramatic improvements in all parameters of RT-PCR including 8- to 10-fold greater sensitivity, enhanced polymerase processivity, higher specific amplicon yield, greater primer annealing and specificity, and enhanced DNA polymerase thermal stability. The faster and more efficient reaction kinetics was a consequence of the cumulative molecular and thermodynamic effects of the excluded volume effect created by macromolecular crowding
Kim, Dowhan; Lee, Da Hye; Choi, Junjeong; Shim, Kyu Won; Kim, Se Hoon
2013-01-01
The therapeutic protocols for treatment of germinomas and non-germinomatous germ cell tumors (NGGCTs) are completely different, so it is important to distinguish pure germinomas from NGGCTs. As it can be difficult to diagnose by morphology alone, immunohisto-chemistry (IHC) has been widely used as an ancillary test to improve diagnostic accuracy. However, IHC has limitations due to the misinterpretation of results or the aberrant loss of immunoreactivity. However, real-time RT-PCR has certain advantages over IHC, including its quantitative nature. The aim of our study was to evaluate the usefulness of real-time RT-PCR on formalin-fixed paraffin-embedded (FFPE) tissue blocks for the diagnosis of germ cell tumors of the central nervous system. We selected eight markers of germ cell tumors using a literature search, and validated them using real-time RT-PCR. Among them, POU5F1, NANOG and TGFB2 were statistically significant (P=0.05) in multiple comparisons (MANOVA) of three groups (pure germinomas, mature teratomas and malignant germ cell tumors). Two-group (pure germinomas and NGGCTs) discriminant analysis achieved a 70.0% success rate in cross-validation. We concluded that real-time RT-PCR using FFPE tissue has adequate validating power comparable to IHC in the diagnosis of central nervous system germ cell tumors; therefore, when IHC is not available, not conclusive or not informative, RT-PCR is a potential alternative to a repeat biopsy.
Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor
2015-03-01
Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.
Dengue Virus in Bats from Southeastern Mexico
Sotomayor-Bonilla, Jesús; Chaves, Andrea; Rico-Chávez, Oscar; Rostal, Melinda K.; Ojeda-Flores, Rafael; Salas-Rojas, Mónica; Aguilar-Setien, Álvaro; Ibáñez-Bernal, Sergio; Barbachano-Guerrero, Arturo; Gutiérrez-Espeleta, Gustavo; Aguilar-Faisal, J. Leopoldo; Aguirre, A. Alonso; Daszak, Peter; Suzán, Gerardo
2014-01-01
To identify the relationship between landscape use and dengue virus (DENV) occurrence in bats, we investigated the presence of DENV from anthropogenically changed and unaltered landscapes in two Biosphere Reserves: Calakmul (Campeche) and Montes Azules (Chiapas) in southern Mexico. Spleen samples of 146 bats, belonging to 16 species, were tested for four DENV serotypes with standard reverse transcriptase polymerase chain reaction (RT-PCR) protocols. Six bats (4.1%) tested positive for DENV-2: four bats in Calakmul (two Glossophaga soricina, one Artibeus jamaicensis, and one A. lituratus) and two bats in Montes Azules (both A. lituratus). No effect of anthropogenic disturbance on the occurrence of DENV was detected; however, all three RT-PCR–positive bat species are considered abundant species in the Neotropics and well-adapted to disturbed habitats. To our knowledge, this study is the first study conducted in southeastern Mexico to identify DENV-2 in bats by a widely accepted RT-PCR protocol. The role that bats play on DENV's ecology remains undetermined. PMID:24752688
Use of FTA filter paper for the molecular detection of Newcastle disease virus.
Perozo, Francisco; Villegas, Pedro; Estevez, Carlos; Alvarado, Iván; Purvis, Linda B
2006-04-01
The feasibility of using Flinders Technology Associates filter papers (FTA cards) to collect allantoic fluid and chicken tissue samples for Newcastle disease virus (NDV) molecular detection was evaluated. Trizol RNA extraction and one-step reverse transcriptase-polymerase chain reaction (RT-PCR) were used. FTA cards allowed NDV identification from allantoic fluid with a titre of 10(5.8) median embryo lethal doses/ml. The inactivated virus remained stable on the cards for 15 days. NDV was detected from FTA imprints of the trachea, lung, caecal tonsil and cloacal faeces of experimentally infected birds. RT-PCR detection from FTA cards was confirmed by homologous frozen-tissue RT-PCR and virus isolation. Direct nucleotide sequence of the amplified F gene allowed prediction of NDV virulence. No virus isolation was possible from the FTA inactivated samples, indicating viral inactivation upon contact. The FTA cards are suitable for collecting and transporting NDV-positive samples, providing a reliable source of RNA for molecular characterization and a hazard-free sample.
International Nuclear Information System (INIS)
Ya Huiyuan; Jiao Zhen; Gu Yunhong; Wang Weidong; Qin Guangyong; Huo Yuping
2007-01-01
Retrotransposon-like elements are major constituents of most eukaryotic genomes. For example, they account for roughly 90% of the wheat (Triticum aestivum) genome. Previous study on a wheat strain treated by low-energy N + ions indicated the variations in AFLP (Amplified Fragment Length Polymorphism ) markers. One such variation was caused by the re-activation of Ty1-copia-like retrotransposons, implying that the mutagenic effects of low-energy ions might work through elevated activation of retrotransposons. In this paper an expression profile of Ty1-copia-like retrotransposons in wheat treated by low-energy N + ions is reported. The reverse transcriptase (RT) domains of these retrotransposons were amplified by reverse-transcriptional polymerase chain reaction (RT-PCR) and sequentially cloned. 42 and 65 clones were obtained from the treated (CL) and control materials (CK), respectively. Sequence analysis of each clone was performed by software. Phylogeny and classification were calculated responding to the sequences of the RT domains. All the results show that there is much difference in the RT domain between the control sample and the treated sample. Especially, the RT domains from the treated group encode significantly more functional ORF (open reading frames) than those from the control sample. This observation suggests that the treated sample has higher activation of retrotransposons, possibly as a consequence of low-energy ion beam irradiation. It also suggests that retrotransposons in the two groups impact the host gene expression in two different ways and carry out different functions in wheat cells
Internalization of Murine Norovirus 1 by Lactuca sativa during Irrigation ▿
Wei, Jie; Jin, Yan; Sims, Tom; Kniel, Kalmia E.
2011-01-01
Romaine lettuce (Lactuca sativa) was grown hydroponically or in soil and challenged with murine norovirus 1 (MNV) under two conditions: one mimicking a severe one-time contamination event and another mimicking a lower level of contamination occurring over time. In each condition, lettuce was challenged with MNV delivered at the roots. In the first case, contamination occurred on day one with 5 × 108 reverse transcriptase quantitative PCR (RT-qPCR) U/ml MNV in nutrient buffer, and irrigation water was replaced with virus-free buffer every day for another 4 days. In the second case, contamination with 5 × 105 RT-qPCR U/ml MNV (freshly prepared) occurred every day for 5 days. Virus had a tendency to adsorb to soil particles, with a small portion suspended in nutrient buffer; e.g., ∼8 log RT-qPCR U/g MNV was detected in soil during 5 days of challenge with virus inoculums of 5 × 108 RT-qPCR U/ml at day one, but sativa. PMID:21296944
Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro
2016-09-01
Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Toplak, Ivan; Hostnik, Peter; Rihtaric, Danijela
2010-01-01
and clinical signs of VHS were observed among the diseased fish. VHSV was confirmed by virus isolation, immunoperoxidase test, reverse transcriptase polymerase chain reaction (RT-PCR) and phylogenetic analysis. Based on 1 complete (1524 nucleotides [nt]) and 9 partial (600 nt) glycoprotein gene nucleotide...... sequences, 9 VHSV isolates from the 6 VHS outbreaks were genetically closely related (99 to 100% identity), and were classified into the Subgroup I-a of Genotype I, most closely related to the German isolates Dstg21-07, Dstg36-06, and Dstg54-1-07 (99 to 100% identity). Phylogenetic analysis...
DEFF Research Database (Denmark)
Aly, Youssef L.; Pedersen, Erik Bjerreg.; La Colla, Paolo
2007-01-01
Synthesis and antiviral activities are reported of a series of 6-(3-alkynyl benzyl)-substituted analogues of MKC-442 (6-benzyl-1-(ethoxymethyl)-5-isopropyluracil), a highly potent agent against HIV. The 3-alkynyl group is assumed to give a better stacking of the substituted benzyl group to reverse...... transcriptase (RT) and this was believed to improve antiviral activity against HIV-1. The bromo derivatives, 5-alkyl-6-(3-bromo-benzyl)-1-ethoxymethyl derivatives 7a, b and 5-alkyl-6-(3-bromobenzyl)-1-allyloxymethyl derivatives 9a, b, showed activity against HIV on the same level as their corresponding...
DEFF Research Database (Denmark)
Dale, Ole Bendik; Ørpetveit, Irene; Lyngstad, Trude Marie
2009-01-01
with slightly elevated mortality was confirmed at a seawater site rearing rainbow trout (90 to 440 g). Within 3 to 4 mo, the disease was recognised in 3 neighbouring sea sites with on-growing rainbow trout. The clinical, gross pathological and histopathological findings were in accordance with VHS......, and the diagnosis was confirmed by the detection of VHSV in brain and internal tissues by immunohistochemistry, cell culture and reverse transcriptase PCR (RT-PCR). Sequence analysis of the G-gene revealed that the isolated virus clustered with VHSV Genotype III and that the Norwegian isolate represents a unique...
Directory of Open Access Journals (Sweden)
Lin Bai
Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.
Directory of Open Access Journals (Sweden)
Anita Chakravarti
2016-01-01
Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
International Nuclear Information System (INIS)
Wu, Sing-Yung; Huang, Wen-Sheng; Chen, Wei-Lian; Polk, D.; Reviczky, A.; Williams, J. III; Chopra, I.J.; Fisher, D.A.
1993-01-01
Sulfated iodothyronines including T 4 -sulfate (T 4 S) and T 3 -sulfate (T 3 S) have been identified in human serum and amniotic fluid. Little is know, however, about the existence of sulfate conjugation of reverse T 3 (rT 3 S) in man. In this report, the authors employed a novel, sensitive, and specific rT 3 S RIA to address this question. The rabbit antiserum to rT 3 S was highly specific; T 4 , T 3 , rT 3 , and 3,3'-T 2 showed less than 0.002% cross-reaction with the antiserum. Only T 4 S and T 3 S cross-reacted significantly (0.3% and 0.01%, respectively); other analogs cross-reacted less than 0.0001%. The detection threshold of the RIA was 14 pmol/L (1.0 ng/dL). The mean serum rT 3 S concentration (pmol/L) was 40 in euthyroid subjects. Values were similar in hypothyroid patients (38) and pregnant women (52) but significantly (P 3 S increased significantly in hyperthyroid patients 1 day after administration of 1 g sodium ipodate orally. Reverse T 3 S was detected consistently in amniotic fluid at 14 to 22 weeks of gestation and showed a marked rise 1-3 weeks after intraamniotic administration of 500-1000 μg T 4 . The various data suggest that : (1) rT 3 S is a normal component of human serum and amniotic fluid; (2) it is derived from metabolism of T 4 or rT 3 ; (3) circulating rT 3 S increases in hyperthyroidism and in circumstances where type I 5'-monodeiodinating activity is low, e.g. nonthyroid illnesses, fetal life, and after administration of ipodate. 20 refs., 4 figs
2018-03-23
NoRT) that was developed as part of the Applied Network Science 6.2 base program work unit at NRL, Code 5580. We explain the theory of NoRT and how...to use it. 23-03-2018 Memorandum Report TOPSIS, Social Network, Sensor Network, Centrality, Diffusion, Disease, Virus, Expectation , Pandemic...base program work unit at NRL. We explain the theory of NoRT and how to use it. Index Terms TOPSIS, Social Network, Sensor Network, Centrality, Diffusion
Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases.
Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz
2016-11-17
Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain samples from two brain regions from Alzheimer's disease (AD), Parkinson's disease (PD), Multiple System Atrophy, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori validation of RGs for RT-qPCR studies.
Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases
DEFF Research Database (Denmark)
Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian
2016-01-01
Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results......, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected...... by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori...
Directory of Open Access Journals (Sweden)
Lukas E Dow
Full Text Available Tetracycline or doxycycline (dox-regulated control of genetic elements allows inducible, reversible and tissue specific regulation of gene expression in mice. This approach provides a means to investigate protein function in specific cell lineages and at defined periods of development and disease. Efficient and stable regulation of cDNAs or non-coding elements (e.g. shRNAs downstream of the tetracycline-regulated element (TRE requires the robust expression of a tet-transactivator protein, commonly the reverse tet-transactivator, rtTA. Most rtTA strains rely on tissue specific promoters that often do not provide sufficient rtTA levels for optimal inducible expression. Here we describe the generation of two mouse strains that enable Cre-dependent, robust expression of rtTA3, providing tissue-restricted and consistent induction of TRE-controlled transgenes. We show that these transgenic strains can be effectively combined with established mouse models of disease, including both Cre/LoxP-based approaches and non Cre-dependent disease models. The integration of these new tools with established mouse models promises the development of more flexible genetic systems to uncover the mechanisms of development and disease pathogenesis.
Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao
2016-01-01
Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were
DEFF Research Database (Denmark)
Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja
2007-01-01
in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...
Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max
2014-01-01
During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.
La Regina, Giuseppe; Coluccia, Antonio; Brancale, Andrea; Piscitelli, Francesco; Gatti, Valerio; Maga, Giovanni; Samuele, Alberta; Pannecouque, Christophe; Schols, Dominique; Balzarini, Jan; Novellino, Ettore; Silvestri, Romano
2011-03-24
New indolylarylsulfone derivatives bearing cyclic substituents at indole-2-carboxamide linked through a methylene/ethylene spacer were potent inhibitors of the WT HIV-1 replication in CEM and PBMC cells with inhibitory concentrations in the low nanomolar range. Against the mutant L100I and K103N RT HIV-1 strains in MT-4 cells, compounds 20, 24-26, 36, and 40 showed antiviral potency superior to that of NVP and EFV. Against these mutant strains, derivatives 20, 24-26, and 40 were equipotent to ETV. Molecular docking experiments on this novel series of IAS analogues have also suggested that the H-bond interaction between the nitrogen atom in the carboxamide chain of IAS and Glu138:B is important in the binding of these compounds. These results are in accordance with the experimental data obtained on the WT and on the mutant HIV-1 strains tested.
DEFF Research Database (Denmark)
Nielsen, D; Maare, C; Eriksen, J
2001-01-01
PURPOSE: To characterize irradiated murine tumor cells with respect to drug resistance, drug kinetics, and ATPase activity, and to evaluate the possible role of P-glycoprotein (PGP) and murine multidrug resistance associated protein (Mrp1) in the drug-resistant phenotype of these cells. METHODS...... AND MATERIALS: Sensitive Ehrlich ascites tumor cells (EHR2) were in vitro exposed to fractionated irradiation (60 Gy). Western blot analysis was performed for determination of PGP and Mrp1, reverse transcriptase-polymerase chain reaction (RT-PCR) for determination of mdr1a + b mRNA, and semiquantitative RT......-PCR for Mrp1 mRNA. The clonogenic assay was applied to investigate sensitivity, whereas the steady-state drug accumulation of daunorubicin (DNR), 3H-vincristine (VCR), and 3H-etoposide (VP16) was measured by spectrofluorometry and scintillation counting, respectively. For determining of ATPase activity...
DEFF Research Database (Denmark)
Csillag, C.; Nielsen, O.H.; Vainer, Ben
2007-01-01
colonoscopically from 33 CD patients and from 17 control subjects. All controls and 10 CD patients were medication-free at the time of colonoscopy. The Human Genome U133 Plus 2.0 GeneChip Array was used for gene profiling. Hybridization data were analysed with dChip software. Results were confirmed by real......-time reverse transcriptase polymerase chain reaction (RT-PCR). Protein product expression of selected genes was assessed by immunohistochemistry using the Envision+ visualization technique. RESULTS: The expression profile was not homogeneous with the statistical cut-point settings applied. In comparison......, fold change 3.9), codes for a mitogenic protein; this could not be confirmed by RT-PCR. Medication-free patients had no differentially expressed genes as compared with controls. Immunohistochemistry indicated that these proteins were produced by epithelial cells (REG1A, LCN2) and leucocytes (DUOX2...
Directory of Open Access Journals (Sweden)
ROMANO-LIEBER Nicolina Silvana
2001-01-01
Full Text Available A serosurvey was conducted in wild animals captured close to two areas where hantavirus cardiopulmonary syndrome (HCPS occurred in São Paulo State, Brazil. Serum samples from a total of 43 mammals were tested for antibodies reactive with Sin Nombre (SN hantavirus using a strip immunoblot assay. RNAs from the blood clots of the positive samples were submitted to reverse transcriptase-polymerase chain reaction (RT-PCR. Two rodents of the genus Oligoryzomys were positive for hantavirus antibodies. These animals were captured in the Iguape region and represented 16.7% (2/12 of the sera from rodents and 100.0% (2/2 of the Oligoryzomys captured in that area. RT-PCR failed to amplify any viral cDNA. These results are in agreement with other data that suggest that members of this genus are important reservoirs of hantaviruses in Brazil.
Improved Detection of Lassa Virus by Reverse Transcription-PCR Targeting the 5′ Region of S RNA▿
Ölschläger, Stephan; Lelke, Michaela; Emmerich, Petra; Panning, Marcus; Drosten, Christian; Hass, Meike; Asogun, Danny; Ehichioya, Deborah; Omilabu, Sunday; Günther, Stephan
2010-01-01
The method of choice for the detection of Lassa virus is reverse transcription (RT)-PCR. However, the high degree of genetic variability of the virus poses a problem with the design of RT-PCR assays that will reliably detect all strains. Recently, we encountered difficulties in detecting some strains from Liberia and Nigeria in a commonly used glycoprotein precursor (GPC) gene-specific RT-PCR assay (A. H. Demby, J. Chamberlain, D. W. Brown, and C. S. Clegg, J. Clin. Microbiol. 32:2898-2903, 1...
DEFF Research Database (Denmark)
Robaczewska, Magdalena; Narayan, Ramamurthy; Seigneres, Beatrice
2005-01-01
BACKGROUND/AIMS: Peptide nucleic acids (PNAs) appear as promising new antisense agents, that have not yet been examined as hepatitis B virus (HBV) inhibitors. Our aim was to study the ability of PNAs targeting the duck HBV (DHBV) encapsidation signal epsilon to inhibit reverse transcription (RT...... in primary duck hepatocytes (PDH). RESULTS: Both PNAs reproducibly inhibited DHBV RT in a dose-dependent manner with IC(50) of 10nM, whereas up to 600-fold higher concentration of S-ODNs was required for similar inhibition. The PNA targeting the bulge and upper stem of epsilon appeared as more efficient RT...
Rozado-Aguirre, Zuriñe; Adams, Ian; Collins, Larissa; Fox, Adrian; Dickinson, Matthew; Boonham, Neil
2016-09-01
A new Torradovirus tentatively named Carrot torrado virus (CaTV) was an incidental finding following a next generation sequencing study investigating internal vascular necrosis in carrot. The closest related viruses are Lettuce necrotic leaf curl virus (LNLCV) found in the Netherlands in 2011 and Motherwort yellow mottle virus (MYMoV) found in Korea in 2014. Primers for reverse transcriptase-PCR (RT-PCR) and RT-qPCR were designed with the aim of testing for the presence of virus in plant samples collected from the field. Both methods successfully amplified the target from infected samples but not from healthy control samples. The specificity of the CaTV assay was also checked against other known carrot viruses and no cross-reaction was seen. A comparative study between methods showed RT-qPCR was the most reliable method, giving positive results in samples where RT-PCR fails. Evaluation of the Ct values following RT-qPCR and a direct comparison demonstrated this was due to improved sensitivity. The previous published Torradovirus genus specific RT-PCR primers were tested and shown to detect CaTV. Also, virus transmission experiments carried out suggest that unlike other species of the same genus, Carrot torrado virus could be aphid-transmitted. Copyright © 2016 Elsevier B.V. All rights reserved.
Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita
2017-06-01
Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hakhverdyan, Mikhayil; Hägglund, Sara; Larsen, Lars Erik
2005-01-01
understanding of the virus. In this study, a BRSV fluorogenic reverse transcription PCR (fRT-PCR) assay, based on TaqMan principle, was developed and evaluated on a large number of clinical samples, representing various cases of natural and experimental BRSV infections. By using a single-step closed-tube format......, the turn-around time was shortened drastically and results were obtained with minimal risk for cross-contamination. According to comparative analyses, the detection limit of the fRT-PCR was on the same level as that of a nested PCR and the sensitivity relatively higher than that of a conventional PCR......, antigen ELISA (Ag-ELISA) and virus isolation (VI). Interspersed negative control samples, samples from healthy animals and eight symptomatically or genetically related viruses were all negative, confirming a high specificity of the assay. Taken together, the data indicated that the fRT-PCR assay can...
Simultaneous detection of three pome fruit tree viruses by one-step multiplex quantitative RT-PCR.
Malandraki, Ioanna; Beris, Despoina; Isaioglou, Ioannis; Olmos, Antonio; Varveri, Christina; Vassilakos, Nikon
2017-01-01
A one-step multiplex real-time reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan probes was developed for the simultaneous detection of Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV) and Apple stem grooving virus (ASGV) in total RNA of pome trees extracted with a CTAB method. The sensitivity of the method was established using in vitro synthesized viral transcripts serially diluted in RNA from healthy, virus-tested (negative) pome trees. The three viruses were simultaneously detected up to a 10-4 dilution of total RNA from a naturally triple-infected apple tree prepared in total RNA of healthy apple tissue. The newly developed RT-qPCR assay was at least one hundred times more sensitive than conventional single RT-PCRs. The assay was validated with 36 field samples for which nine triple and 11 double infections were detected. All viruses were detected simultaneously in composite samples at least up to the ratio of 1:150 triple-infected to healthy pear tissue, suggesting the assay has the capacity to examine rapidly a large number of samples in pome tree certification programs and surveys for virus presence.
Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng
2018-06-27
The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.
Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K
2015-04-01
MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.
NCBI nr-aa BLAST: CBRC-DDIS-06-0095 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-DDIS-06-0095 gb|AAX19886.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excel...sa] gb|AAX19887.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excelsa] AAX19886.1 1e-44 25% ...
Liang, Y H; Chen, F E
2007-08-01
Theoretical investigations of the interaction between dapivirine and the HIV-1 RT binding site have been performed by the ONIOM2 (B3LYP/6-31G (d,p): PM3) and B3LYP/6-31G (d,p) methods. The results derived from this study indicate that this inhibitor dapivirine forms two hydrogen bonds with Lys101 and exhibits strong π-π stacking or H…π interaction with Tyr181 and Tyr188. These interactions play a vital role in stabilizing the NNIBP/dapivirine complex. Additionally, the predicted binding energy of the BBF optimized structure for this complex system is -18.20 kcal/mol.
Directory of Open Access Journals (Sweden)
Qing-Xiu Hu
2012-01-01
Full Text Available A novel aspartic protease with HIV-1 RT inhibitory activity was isolated and characterized from fruiting bodies of the wild mushroom Xylaria hypoxylon. The purification protocol comprised distilled water homogenization and extraction step, three ion exchange chromatographic steps (on DEAE-cellulose, Q-Sepharose, and CM-cellulose in succession, and final purification was by FPLC on Superdex 75. The protease was adsorbed on all the three ion exchangers. It was a monomeric protein with a molecular mass of 43 kDa as estimated by SDS-PAGE and FPLC. Its N-terminal amino acid sequence was HYTELLSQVV, which exhibited no sequence homology to other proteases reported. The activity of the protease was adversely affected by Pepstatin A, indicating that it is an aspartic protease. The protease activity was maximal or nearly so in the pH range 6–8 and in the temperature range 35–60°C. The purified enzyme exhibited HIV-1 RT inhibitory activity with an IC50 value of 8.3 μM, but was devoid of antifungal, ribonuclease, and hemagglutinating activities.
Yabar, Carlos Augusto; Acuña, Maribel; Gazzo, Cecilia; Salinas, Gabriela; Cárdenas, Fanny; Valverde, Ada; Romero, Soledad
2012-12-01
HIV-1 subtype B is the most frequent strain in Peru. However, there is no available data about the genetic diversity of HIV-infected patients receiving highly active antiretroviral therapy (HAART) here. A group of 267 patients in the Peruvian National Treatment Program with virologic failure were tested for genotypic evidence of HIV drug resistance at the Instituto Nacional de Salud (INS) of Peru between March 2008 and December 2010. Viral RNA was extracted from plasma and the segments of the protease (PR) and reverse transcriptase (RT) genes were amplified by reverse transcriptase polymerase chain reaction (RT-PCR), purified, and fully sequenced. Consensus sequences were submitted to the HIVdb Genotypic Resistance Interpretation Algorithm Database from Stanford University, and then aligned using Clustal X v.2.0 to generate a phylogenetic tree using the maximum likelihood method. Intrasubtype and intersubtype recombination analyses were performed using the SCUEAL program (Subtype Classification by Evolutionary ALgo-rithms). A total of 245 samples (91%) were successfully genotyped. The analysis obtained from the HIVdb program showed 81.5% resistance cases (n=198). The phylogenetic analysis revealed that subtype B was predominant in the population (98.8%), except for new cases of A, C, and H subtypes (n=4). Of these cases, only subtype C was imported. Likewise, recombination analysis revealed nine intersubtype and 20 intrasubtype recombinant cases. This is the first report of the presence of HIV-1 subtypes C and H in Peru. The introduction of new subtypes and circulating recombinants forms can make it difficult to distinguish resistance profiles in patients and consequently affect future treatment strategies against HIV in this country.
Hoferer, Marc; Braun, Anne; Skrypski, Julia; Bock, Sabine; Thalheim, Sabine; Sting, Reinhard
2017-09-01
Infectious pancreatic necrosis virus (IPNV) causes great losses in fish hatcheries world-wide. The detection of IPNV can be challenging in certain circumstances, particularly due to low viral load and the genetic variability of this RNA virus. For the first time, this project created a quantitative triplex real-time reverse transcription PCR (RT-qPCR), including an endogenous control system, for specific, sensitive and rapid detection of IPNV in routine diagnostics. Multiple sequence alignment of 46 nucleotide sequences of the segment A genome obtained from the NCBI database allowed the design of two RT-qPCR systems covering the IPNV genogroup 1 and genogroups 2-5, respectively. The completed triplex RT-qPCR including a salmonid-specific endogenous control showed high specificity and an analytical sensitivity of 20-40 oligonucleotide copies. Testing of dilution series of virus-loaded cell culture suspensions proved equality of the triplex RT-qPCR with virus detection in cell culture and a higher sensitivity than conventional RT-PCR in field samples. In comparative studies of a total of 77 field samples tested, 51 showed identical positive and 19 identical negative results in cell culture and the triplex RT-qPCR. However, seven other samples yielded positive results in the triplex RT-qPCR, but negative results in cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.
Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai
2012-06-10
Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.
DEFF Research Database (Denmark)
Telmadarraiy, Z; Ghiasi, Seyed Mojtaba; Moradi, Maryam
2010-01-01
for the presence of CCHF virus genome using gel-based and real-time reverse transcriptase polymerase chain reactions (RT-PCR). The results showed CCHF infection in almost 28% of ticks collectively. Also, of 56 livestock sera, around 39% were IgG-positive. The presence of anti-CCHF virus IgG antibodies and the CCHF...... in the adjacent districts. A comprehensive study was carried out to assess the epidemiological aspects of the disease in this province. In the study area, 130 ticks were collected from randomly selected villages and classified into 9 species of hard tick and 2 species of soft tick. All ticks were analyzed...
Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D
2018-06-01
We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.
NEW DRUGS NEW TARGETS AND NOVEL ANTIRETROVIRALS
African Journals Online (AJOL)
2005-11-02
Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).
International Nuclear Information System (INIS)
Gomez, Daniel E.; Armando, Romina G.; Alonso, Daniel F.
2012-01-01
Telomerase is a highly specialized reverse transcriptase (RT) and the maintenance of telomeric length is determined by this specific enzyme. The human holoenzyme telomerase is a ribonucleoprotein composed by a catalytic subunit, hTERT, an RNA component, hTR, and a group of associated proteins. Telomerase is normally expressed in embryonic cells and is repressed during adulthood. The enzyme is reexpressed in around 85% of solid tumors. This observation makes it a potential target for developing drugs that could be developed for therapeutic purposes. The identification of the hTERT as a functional catalytic RT prompted studies of inhibiting telomerase with the HIV RT inhibitor azidothymidine (AZT). Previously, we have demonstrated that AZT binds preferentially to telomeres, inhibits telomerase and enhances tumor cell senescence, and apoptosis after AZT treatment in breast mammary adenocarcinoma cells. Since then, several studies have considered AZT for telomerase inhibition and have led to potential clinical strategies for anticancer therapy. This review covers present thinking of the inhibition of telomerase by AZT and future treatment protocols using the drug.
Delatorre, Edson; Silva-de-Jesus, Carlos; Couto-Fernandez, José Carlos; Pilotto, Jose H; Morgado, Mariza G
2017-01-01
Antiretroviral (ARV) resistance mutations in human immunodeficiency virus type 1 (HIV-1) infection may reduce the efficacy of prophylactic therapy to prevent mother-to-child transmission (PMTCT) and future treatment options. This study evaluated the diversity and the prevalence of transmitted drug resistance (TDR) in protease (PR) and reverse transcriptase (RT) regions of HIV-1 pol gene among 87 ARV-naive HIV-1-infected pregnant women from Rio de Janeiro, Brazil, between 2012 and 2015. The viral diversity comprised HIV-1 subtypes B (67.8%), F1 (17.2%), and C (4.6%); the circulating recombinant forms 12_BF (2.3%), 28/29_BF, 39_BF, 02_AG (1.1% each) and unique recombinants forms (4.5%). The overall prevalence of any TDR was 17.2%, of which 5.7% for nucleoside RT inhibitors, 5.7% for non-nucleoside RT inhibitors, and 8% for PR inhibitors. The TDR prevalence found in this population may affect the virological outcome of the standard PMTCT ARV-regimens, reinforcing the importance of continuous monitoring.