Reverse transcriptase inhibitors as microbicides.
Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido
2012-01-01
The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.
Reverse transcriptase inhibitors as potential colorectal microbicides.
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J
2009-05-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.
HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors
DEFF Research Database (Denmark)
Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran
2017-01-01
BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...
Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?
Nolan, David
2005-01-01
Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.
Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko
2011-01-01
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.
[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].
Tarasova, O A; Filimonov, D A; Poroikov, V V
2017-10-01
Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.
Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.
Sharma, Mamta; Saravolatz, Louis D
2013-02-01
Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.
Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.
2009-01-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-07-01
HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.
DEFF Research Database (Denmark)
Lundgren, Jens
2008-01-01
BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...
R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)
2013-01-01
textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the
DEFF Research Database (Denmark)
Borges, Álvaro H; Lundh, Andreas; Tendal, Britta
2016-01-01
BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...
Nicolas Sluis-Cremer
2014-01-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...
Directory of Open Access Journals (Sweden)
Lucianna Helene Santos
2015-11-01
Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2013-11-01
Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.
Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M
2018-01-01
Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma
Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...
Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.
Directory of Open Access Journals (Sweden)
Anna Figueiredo
2006-11-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.
Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano
2017-01-17
Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.
Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X
2002-12-01
Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-11-01
Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.
Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F
2008-10-01
Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association
Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda
2016-01-01
Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.
Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.
Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A
2011-01-01
We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.
TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats
Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin
2011-01-01
In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472
Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.
2004-01-01
Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add
Directory of Open Access Journals (Sweden)
Meytal Galilee
2018-01-01
Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study
Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A
2013-11-01
Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.
Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Directory of Open Access Journals (Sweden)
Lapadula Giuseppe
2007-05-01
Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.
Sluis-Cremer, Nicolas
2014-07-31
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors
Directory of Open Access Journals (Sweden)
S. Ganguly
2008-01-01
Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2014-07-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.
Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .
Markowitz, Martin; Sarafianos, Stefan G
2018-07-01
4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.
Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.
Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M
2017-12-01
Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these
Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.
Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D
2006-11-15
TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients
Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H
2015-12-15
Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).
Directory of Open Access Journals (Sweden)
Oluwafeyisetan O. Adebiyi
2015-12-01
Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.
Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul
2004-01-01
The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2010-03-01
Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.
Czech Academy of Sciences Publication Activity Database
Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko
2016-01-01
Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016
Fang, Evandro Fei; Ng, Tzi Bun
2015-04-01
Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.
Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark
2013-11-01
BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.
Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong
2012-01-01
1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.
DEFF Research Database (Denmark)
Kirk, Ole; Lundgren, Jens D; Pedersen, Court
2003-01-01
BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....
Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R
2009-02-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.
Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W
2012-05-01
Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.
Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan
2010-12-12
Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.
Sivan, Sree Kanth; Manga, Vijjulatha
2010-06-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.
Energy Technology Data Exchange (ETDEWEB)
Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.
2017-02-06
The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Cha YJ
2014-09-01
Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600
Directory of Open Access Journals (Sweden)
Mark A Winters
Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.
Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen
2016-03-01
Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.
International Nuclear Information System (INIS)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki
2015-01-01
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)
2015-10-23
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.
Directory of Open Access Journals (Sweden)
Markus Hecht
Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic
Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C
2000-05-18
To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.
Giacobbi, Nicholas S; Sluis-Cremer, Nicolas
2017-07-01
Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.
Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S
2014-06-01
The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.
Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami
2017-06-01
We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.
Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio
2016-09-30
We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.
Directory of Open Access Journals (Sweden)
Alessandra M. T. de Souza
2013-10-01
Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.
Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang
2017-06-16
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
DEFF Research Database (Denmark)
Fox, Zoe; Phillips, Andrew; Cohen, Cal
2008-01-01
the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...
DEFF Research Database (Denmark)
Mocroft, A; Horban, A; Clumeck, N
2006-01-01
increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)
Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P
2000-05-04
Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M
2007-01-01
Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M
2007-01-01
Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691
Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo
2017-08-31
In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat
2011-01-01
We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.
Directory of Open Access Journals (Sweden)
Jean-Guy Baril
2003-01-01
Full Text Available OBJECTIVE: To assess the efficacy of nelfinavir mesylate (NFV in combination with delavirdine mesylate(DLV or efavirenz (EFV and other antiretroviral agents following virological failure on other protease inhibitor (PI-based regimens.
Monforte, Anna-Maria; Ferro, Stefania; De Luca, Laura; Lo Surdo, Giuseppa; Morreale, Francesca; Pannecouque, Christophe; Balzarini, Jan; Chimirri, Alba
2014-02-15
A series of novel N1-aryl-2-arylthioacetamido-benzimidazoles were synthesized and evaluated as inhibitors of human immunodeficiency virus type-1 (HIV-1). Some of them proved to be effective in inhibiting HIV-1 replication at submicromolar and nanomolar concentration acting as HIV-1 non-nucleoside RT inhibitors (NNRTIs), with low cytotoxicity. The preliminary structure-activity relationship (SAR) of these new derivatives was discussed and rationalized by docking studies. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L
2017-11-08
The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.
Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang
2017-12-01
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50 = 0.04 μM) with decent antiviral potency (EC 50 = 7.4 μM) and no cytotoxicity (CC 50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido
2013-09-01
Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.
Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun
2017-09-01
The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.
Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia
2011-06-01
Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.
Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors
CSIR Research Space (South Africa)
Bode, ML
2011-06-01
Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...
La Regina, Giuseppe; Coluccia, Antonio; Brancale, Andrea; Piscitelli, Francesco; Gatti, Valerio; Maga, Giovanni; Samuele, Alberta; Pannecouque, Christophe; Schols, Dominique; Balzarini, Jan; Novellino, Ettore; Silvestri, Romano
2011-03-24
New indolylarylsulfone derivatives bearing cyclic substituents at indole-2-carboxamide linked through a methylene/ethylene spacer were potent inhibitors of the WT HIV-1 replication in CEM and PBMC cells with inhibitory concentrations in the low nanomolar range. Against the mutant L100I and K103N RT HIV-1 strains in MT-4 cells, compounds 20, 24-26, 36, and 40 showed antiviral potency superior to that of NVP and EFV. Against these mutant strains, derivatives 20, 24-26, and 40 were equipotent to ETV. Molecular docking experiments on this novel series of IAS analogues have also suggested that the H-bond interaction between the nitrogen atom in the carboxamide chain of IAS and Glu138:B is important in the binding of these compounds. These results are in accordance with the experimental data obtained on the WT and on the mutant HIV-1 strains tested.
de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão
2008-08-01
A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.
Directory of Open Access Journals (Sweden)
Marius Lazea
2011-12-01
Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.
Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi
2018-05-11
Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.
International Nuclear Information System (INIS)
Lund, Kaleb C.; Wallace, Kendall B.
2008-01-01
Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug
Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R
2015-01-01
Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...
Patick, A K; Boritzki, T J; Bloom, L A
1997-10-01
Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.
Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni
2005-01-01
Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294
Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania
2018-02-01
Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda
2010-06-05
The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Immune pressure analysis of protease and reverse transcriptase ...
African Journals Online (AJOL)
/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
DEFF Research Database (Denmark)
Sabin, Caroline A; Worm, Signe W; Weber, Rainer
2008-01-01
cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...
Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong
2018-06-18
We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H = 1.77 μM, IC 50 IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang
2006-05-01
To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Directory of Open Access Journals (Sweden)
Dieter Hoffmann
Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.
Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.
2017-10-01
The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.
Czech Academy of Sciences Publication Activity Database
Prejdová, Jana; Weber, Jan; Machala, L.; Reiniš, Milan; Linka, M.; Brůčková, M.; Vandasová, M.; Staňková, M.; Konvalinka, Jan
2005-01-01
Roč. 49, č. 1 (2005), 29-36 ISSN 0001-723X R&D Projects: GA MZd(CZ) NI6339 Grant - others:5th Framework(XE) QLK2-CT-2001-02360 Institutional research plan: CEZ:AV0Z4055905 Keywords : HIV * protease inhibitors * resistance development Subject RIV: CE - Biochemistry Impact factor: 0.696, year: 2005
Energy Technology Data Exchange (ETDEWEB)
Su, Hua-Poo; Yan, Youwei; Prasad, G. Sridhar; Smith, Robert F.; Daniels, Christopher L.; Abeywickrema, Pravien D.; Reid, John C.; Loughran, H. Marie; Kornienko, Maria; Sharma, Sujata; Grobler, Jay A.; Xu, Bei; Sardana, Vinod; Allison, Timothy J.; Williams, Peter D.; Darke, Paul L.; Hazuda, Daria J.; Munshi, Sanjeev (Merck)
2010-09-02
HIV/AIDS continues to be a menace to public health. Several drugs currently on the market have successfully improved the ability to manage the viral burden in infected patients. However, new drugs are needed to combat the rapid emergence of mutated forms of the virus that are resistant to existing therapies. Currently, approved drugs target three of the four major enzyme activities encoded by the virus that are critical to the HIV life cycle. Although a number of inhibitors of HIV RNase H activity have been reported, few inhibit by directly engaging the RNase H active site. Here, we describe structures of naphthyridinone-containing inhibitors bound to the RNase H active site. This class of compounds binds to the active site via two metal ions that are coordinated by catalytic site residues, D443, E478, D498, and D549. The directionality of the naphthyridinone pharmacophore is restricted by the ordering of D549 and H539 in the RNase H domain. In addition, one of the naphthyridinone-based compounds was found to bind at a second site close to the polymerase active site and non-nucleoside/nucleotide inhibitor sites in a metal-independent manner. Further characterization, using fluorescence-based thermal denaturation and a crystal structure of the isolated RNase H domain reveals that this compound can also bind the RNase H site and retains the metal-dependent binding mode of this class of molecules. These structures provide a means for structurally guided design of novel RNase H inhibitors.
Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi
2016-12-10
The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure
Directory of Open Access Journals (Sweden)
Ana Luiza Chaves Valadão
2015-06-01
Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.
International Nuclear Information System (INIS)
Spadafora, C.; Sciamanna, I.; Misteli, T.
2009-01-01
Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma
NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Energy Technology Data Exchange (ETDEWEB)
Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)
2016-12-15
The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.
Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
Directory of Open Access Journals (Sweden)
Ma Bi
2017-10-01
Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.
A second chance for telomerase reverse transcriptase in anticancer immunotherapy.
Zanetti, Maurizio
2017-02-01
Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.
2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase
International Nuclear Information System (INIS)
Starnes, M.C.
1988-01-01
2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells
I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)
2015-01-01
textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2008-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...
Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.
Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E
2013-06-18
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Patick, A K; Boritzki, T J; Bloom, L A
1997-01-01
Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritona...
Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni
2008-09-01
We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.
2011-01-01
The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who
Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles
International Nuclear Information System (INIS)
Bavand, M.R.; Laub, O.
1988-01-01
Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein
Directory of Open Access Journals (Sweden)
Ajay Kumar
2010-01-01
Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.
International Nuclear Information System (INIS)
Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.
2004-01-01
Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies
International Nuclear Information System (INIS)
Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado
2011-01-01
LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy
DEFF Research Database (Denmark)
Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin
2013-01-01
Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...
Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A
2017-01-01
Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N
Directory of Open Access Journals (Sweden)
Ilaria eSciamanna
2016-02-01
Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado
2016-02-01
In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity
House, M.L.; Kim, C.H.; Reno, P.W.
1998-01-01
Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.
Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory
Directory of Open Access Journals (Sweden)
Edward J. Steele
2017-11-01
Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.
Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina
2013-01-01
The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences
A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome
Directory of Open Access Journals (Sweden)
Marcin Kierczak
2009-10-01
Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.
The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.
Zhao, Chen; Pyle, Anna Marie
2017-12-01
The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.
Telomerase reverse transcriptase promoter mutations in bladder cancer
DEFF Research Database (Denmark)
Allory, Yves; Beukers, Willemien; Sagrera, Ana
2014-01-01
for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...
Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind
2014-04-01
A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.
Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase
DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami
2012-01-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...
Wang, Shuwen; Zhu, Jiyue
2003-05-23
The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.
Regina, Giuseppe La; Coluccia, Antonio; Piscitelli, Francesco; Bergamini, Alberto; Sinistro, Anna; Cavazza, Antonella; Maga, Giovanni; Samuele, Alberta; Zanoli, Samantha; Novellino, Ettore; Artico, Marino; Silvestri, Romano
2007-10-04
Indolyl aryl sulfones bearing the 4,5-difluoro (10) or 5-chloro-4-fluoro (16) substitution pattern at the indole ring were potent inhibitors of HIV-1 WT and the NNRTI-resistant strains Y181C and K103N-Y181C. These compounds were highly effective against the 112 and the AB1 strains in lymphocytes and inhibited at nanomolar concentration the multiplication of the IIIBBa-L strain in macrophages. Compound 16 was exceptionally potent against RT WT and RTs carrying the K103N, Y181I, and L100I mutations.
Collins, Kathleen; Nilsen, Timothy W
2013-08-01
Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.
Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.
Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao
2015-10-01
Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
Directory of Open Access Journals (Sweden)
Elisabeth Humphris-Narayanan
Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.
Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.
Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V
2011-12-20
Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.
Directory of Open Access Journals (Sweden)
Dolores Bautista-España
Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.
Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.
Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari
2018-05-03
Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon
2015-08-01
completion. We show here for the first time that a single mutation in HIV-1 reverse transcriptase (L92P) selectively abolishes strand transfers without affecting the enzyme's DNA polymerase and RNase H functions. When this mutation was introduced into an infectious HIV-1 clone, viral replication was lost due to an impaired intracellular strand transfer, thus supporting the in vitro data. Therefore, finding novel drugs that target HIV-1 reverse transcriptase Leu92 may be beneficial for developing new potent and selective inhibitors of retroviral reverse transcription that will obstruct HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2009-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331
Directory of Open Access Journals (Sweden)
Ammad Ahmad Farooqi
2018-04-01
Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.
Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells
Directory of Open Access Journals (Sweden)
Yong Teng
2014-02-01
Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Lescot, Magali
2015-11-27
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Reverse transcriptase directs viral evolution in a deep ocean methane seep
Paul, B. G.; Bagby, S. C.
2013-12-01
Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.
Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer
International Nuclear Information System (INIS)
Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen
2001-01-01
Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts
Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis
2010-01-01
Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948
Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki
2015-01-01
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
International Nuclear Information System (INIS)
Ferkous, F.; Saihi, Y.
2018-01-01
Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)
Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification
Energy Technology Data Exchange (ETDEWEB)
Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P
2011-12-08
RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.
Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel
1972-01-01
Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137
Directory of Open Access Journals (Sweden)
Stefanou Nikolaos
2010-08-01
Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.
Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita
2018-01-01
Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673
Energy Technology Data Exchange (ETDEWEB)
Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)
2017-12-15
Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
International Nuclear Information System (INIS)
Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.
1986-01-01
The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)
DEFF Research Database (Denmark)
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy
2011-01-01
Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...
Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan
2016-05-01
Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.
Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato
2012-06-06
Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic
Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B
2018-02-06
Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.
Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L
1999-12-17
Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
Directory of Open Access Journals (Sweden)
Soo-Huey Yap
2007-12-01
Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which
Energy Technology Data Exchange (ETDEWEB)
Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy
2017-04-10
HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.
Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad
2016-05-01
Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.
Directory of Open Access Journals (Sweden)
Weizi Liang
Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.
Oude Essink, B. B.; Das, A. T.; Berkhout, B.
1995-01-01
Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
Directory of Open Access Journals (Sweden)
Johnson Barry C
2012-12-01
Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.
Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng
2018-06-27
The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Energy Technology Data Exchange (ETDEWEB)
Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)
2010-03-26
The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.
Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J
2009-06-01
Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.
A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.
2010-01-01
Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved
Directory of Open Access Journals (Sweden)
Warrilow David
2008-12-01
Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.
Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis
2017-02-01
Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.
Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue
2013-05-01
To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis
Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi
2014-01-01
Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.
Directory of Open Access Journals (Sweden)
Johannes Van Staden
2010-10-01
Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.
Gnanasekaran, Ramachandran
2017-11-08
We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.
Directory of Open Access Journals (Sweden)
Madeleine Zerbato
Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.
Directory of Open Access Journals (Sweden)
Rami Kantor
2005-04-01
Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
Directory of Open Access Journals (Sweden)
Gronenborn Angela M
2010-05-01
Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
Li, Runqin; Zhang, Yinglin
2016-01-01
Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-01-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...
Directory of Open Access Journals (Sweden)
Francesca Carlini
Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.
Directory of Open Access Journals (Sweden)
Atsuko Hachiya
2011-01-01
Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.
Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z
2017-07-11
Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From
Directory of Open Access Journals (Sweden)
Isabel Hostettler
2014-12-01
Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.
Directory of Open Access Journals (Sweden)
Jessica H Brehm
Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.
Directory of Open Access Journals (Sweden)
Sukrit Silas
2017-07-01
Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
International Nuclear Information System (INIS)
Zhu Hanneng; Chen Wenying; Xiong Sidong
2000-01-01
Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)
Directory of Open Access Journals (Sweden)
Liu Tiantian
2010-05-01
Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.
Directory of Open Access Journals (Sweden)
Su X
2016-11-01
Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation
Directory of Open Access Journals (Sweden)
Winny Xie
2013-12-01
Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.
LENUS (Irish Health Repository)
Bansode, Vijay B
2011-10-13
Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge
Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X
2014-07-01
Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan
2012-01-01
The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.
Directory of Open Access Journals (Sweden)
Tandale Babasaheb V
2008-12-01
Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy
Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki
2014-01-01
Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M
2016-04-01
Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.
Ngai, Patrick H K; Ng, T B
2003-11-14
From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.
Directory of Open Access Journals (Sweden)
Barbara A Rath
Full Text Available Effectiveness of ART regimens strongly depends upon complex interactions between the selective pressure of drugs and the evolution of mutations that allow or restrict drug resistance.Four clinical isolates from NRTI-exposed, NNRTI-naive subjects were passaged in increasing concentrations of NVP in combination with 1 µM 3 TC and 2 µM ADV to assess selective pressures of multi-drug treatment. A novel parameter inference procedure, based on a stochastic viral growth model, was used to estimate phenotypic resistance and fitness from in vitro combination passage experiments.Newly developed mathematical methods estimated key phenotypic parameters of mutations arising through selective pressure exerted by 3 TC and NVP. Concentrations of 1 µM 3 TC maintained the M184V mutation, which was associated with intrinsic fitness deficits. Increasing NVP concentrations selected major NNRTI resistance mutations. The evolutionary pathway of NVP resistance was highly dependent on the viral genetic background, epistasis as well as stochasticity. Parameter estimation indicated that the previously unrecognized mutation L228Q was associated with NVP resistance in some isolates.Serial passage of viruses in the presence of multiple drugs may resemble the selection of mutations observed among treated individuals and populations in vivo and indicate evolutionary preferences and restrictions. Phenotypic resistance estimated here "in silico" from in vitro passage experiments agreed well with previous knowledge, suggesting that the unique combination of "wet-" and "dry-lab" experimentation may improve our understanding of HIV-1 resistance evolution in the future.
Czech Academy of Sciences Publication Activity Database
Patel, Rahul V.; Park, S.W.
2015-01-01
Roč. 23, č. 17 (2015), s. 5247-5263 ISSN 0968-0896 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Pyrrole * Arylthiopyrrole * Triciribine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.923, year: 2015
Suicide Inhibitors of Reverse Transcriptase in the Therapy of AIDS and Other Retroviruses
1989-07-01
are shown below. One of the first, [N-(L-3-tran carboxyxiran-2-carbonyl)-L-leucyl]-amido (4-guanido) butane was isolated from Asperg /II japonicus and...using uridine nucleosides to enhance the antiviral selectivity. j, Synthesis of Uridine 2’ and 3*-Ribosoiroxr’es 3*-uridine spiroxirane was...system used (Figure 2). Also shown in this figure is the enhanced sensitivity of the vaccif recombinant HIV-RT to Foscarnet when expressed in monkey kidney
Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao
2016-01-01
Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were
Directory of Open Access Journals (Sweden)
Turyadi Turyadi
2018-01-01
Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase. Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis
Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc
2011-07-01
Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.
Indanones as high-potency reversible inhibitors of monoamine oxidase.
Mostert, Samantha; Petzer, Anél; Petzer, Jacobus P
2015-05-01
Recent reports document that α-tetralone (3,4-dihydro-2H-naphthalen-1-one) is an appropriate scaffold for the design of high-potency monoamine oxidase (MAO) inhibitors. Based on the structural similarity between α-tetralone and 1-indanone, the present study involved synthesis of 34 1-indanone and related indane derivatives as potential inhibitors of recombinant human MAO-A and MAO-B. The results show that C6-substituted indanones are particularly potent and selective MAO-B inhibitors, with IC50 values ranging from 0.001 to 0.030 μM. C5-Substituted indanone and indane derivatives are comparatively weaker MAO-B inhibitors. Although the 1-indanone and indane derivatives are selective inhibitors of the MAO-B isoform, a number of homologues are also potent MAO-A inhibitors, with three homologues possessing IC50 values 1-indanone as a reversible MAO inhibitor with a competitive mode of inhibition. It may be concluded that 1-indanones are promising leads for the design of therapies for neurodegenerative and neuropsychiatric disorders such as Parkinson's disease and depression. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Song, Yue; Shen, Keng; Yu, Jing-rong
2007-11-06
To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase
Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark
2009-01-01
Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161
Li, An; Ziehr, Jessica L; Johnson, Kenneth A
2017-04-21
Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DEFF Research Database (Denmark)
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah
2015-01-01
-AIDS-defining cancers (NADC), AIDS-defining cancers (ADC), and the most frequently occurring ADC (Kaposi sarcoma, non-Hodgkin lymphoma) and NADC (lung, invasive anal, head/neck cancers, and Hodgkin lymphoma). RESULTS: A total of 41,762 persons contributed 241,556 person-years (PY). A total of 1832 cancers were...
Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael
2012-01-01
Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...
Zhu, Tao; Niu, Deng-Ke
2013-03-05
Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.
Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong
2013-01-01
In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.
Directory of Open Access Journals (Sweden)
Niu Meijuan
2004-10-01
Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.
DEFF Research Database (Denmark)
Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens
2012-01-01
Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...
Liang, Y H; Chen, F E
2007-08-01
Theoretical investigations of the interaction between dapivirine and the HIV-1 RT binding site have been performed by the ONIOM2 (B3LYP/6-31G (d,p): PM3) and B3LYP/6-31G (d,p) methods. The results derived from this study indicate that this inhibitor dapivirine forms two hydrogen bonds with Lys101 and exhibits strong π-π stacking or H…π interaction with Tyr181 and Tyr188. These interactions play a vital role in stabilizing the NNIBP/dapivirine complex. Additionally, the predicted binding energy of the BBF optimized structure for this complex system is -18.20 kcal/mol.
Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis
2013-12-23
At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.
Spackman, Erica; Suarez, David L
2005-01-01
Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.
Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake
2017-11-22
Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.
International Nuclear Information System (INIS)
Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin
2008-01-01
Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Directory of Open Access Journals (Sweden)
Meng Shuang
2010-06-01
Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.
Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi
2017-12-01
We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.
Directory of Open Access Journals (Sweden)
Mengjuan Zhu
2016-03-01
Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.
Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin
2010-01-01
The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.
International Nuclear Information System (INIS)
Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun
2007-01-01
Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers
International Nuclear Information System (INIS)
Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.
2006-01-01
Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)
Directory of Open Access Journals (Sweden)
Parvathi Chary
Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.
International Nuclear Information System (INIS)
Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha
2005-01-01
Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols
Berman, Andrea J; Gooding, Anne R; Cech, Thomas R
2010-10-01
The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.
Amendola, R
1994-11-01
The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.
International Nuclear Information System (INIS)
Freeman-Wittig, M.J.B.
1986-01-01
The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan
Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang
2010-01-01
A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408
Directory of Open Access Journals (Sweden)
Yanrui Li
2010-01-01
Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.
Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni
2016-01-01
Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647
International Nuclear Information System (INIS)
Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong
2005-01-01
The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)
Effect of the scale inhibitor on ion content in reverse osmosis system for seawater desalination
Gao, Yuhua; Liu, Zhenfa; Zhang, Lihui; Li, Haihua
2017-09-01
A scale inhibitor was synthesized from polysuccinimide with 2-aminoethanesulfonic acid and aspartic acid. The effect of scale inhibitor on ion content in reverse osmosis system for seawater desalination was studied. The results showed that the ion content of permeate water is lower with the scale inhibitor added in RO system for seawater desalination than without scale inhibitor. On the contrary, the ion content of concentrate water is higher when with scale inhibitor in RO system.
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-07-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.
1999-01-01
We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N
2005-05-01
To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.
Directory of Open Access Journals (Sweden)
Jie Xu
Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.
Ma, Xiongchao; Sun, Baozhen; Zhu, Fei
2018-02-01
This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-06-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Dissection of membrane protein degradation mechanisms by reversible inhibitors
International Nuclear Information System (INIS)
Hare, J.F.
1988-01-01
The degradation of slowly turning over 125I-lactoperoxidase-labeled plasma membrane polypeptides in response to reversible temperature and lysosomotropic inhibitors was studied in rat hepatoma cultures. Cells were radiolabeled and left for 24 h to allow the removal of rapidly degraded proteins. Remaining trichloroacetic acid-precipitable protein was degraded (t 1/2 = 40-68 h) by an apparent first order process 60-86% sensitive to 10 mM NH4Cl or 5 mM methylamine and greater than 95% inhibited by temperature reduction to 18 degrees C. Thus, membrane proteins are selected for degradation in a time-dependent manner by a system which is sensitive to both 18 degrees C and to lysosomotropic amines. When inhibitory conditions were removed after 40-48 h, degradation of 125I-labeled protein resumed at the same rate as that seen in their absence. Since membrane proteins do not exhibit accelerated degradation after removal of inhibitory conditions, there can be no marking or sorting of those proteins destined for degradation during the 40-h exposure to inhibitory conditions. Exposure to amines or 18 degrees C did not affect the position of two-dimensionally resolved labeled polypeptides. Fractionation of labeled cells on Percoll gradients after 40 h of exposure to low temperature or amines showed that labeled protein remained in the plasma membrane fractions of the gradient although shifted to a slightly lower buoyant density in the presence of amines. These results support the notion that selection of plasma membrane proteins for degradation requires their internalization into acidic vesicles. Lysosomotropic amines and reduced temperature interfere with the selection process by preventing membrane fusion events
Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng
2014-07-01
The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.
Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram
2003-01-01
Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we
International Nuclear Information System (INIS)
Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key
2016-01-01
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Lin Bai
Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.
Directory of Open Access Journals (Sweden)
Mok Helen OL
2006-09-01
Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This
Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd
2013-11-05
Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable
Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W
2014-09-01
Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We
Energy Technology Data Exchange (ETDEWEB)
Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)
2016-08-26
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Vacas-Córdoba E
2014-07-01
Full Text Available Enrique Vacas-Córdoba,1–3 Marta Galán,3,4 Francisco J de la Mata,3,4 Rafael Gómez,3,4 Marjorie Pion,1–3 M Ángeles Muñoz-Fernández1–3 1Laboratorio InmunoBiología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spain; 2Instituto de Investigación Sanitaria del Gregorio Marañón, Madrid, Spain; 3Networking Research Center on Bioengineering, Biomaterials and Nanomedicine, (CIBER-BBN, Madrid, Spain; 4Dendrimers for Biomedical Applications Group (BioInDen, University of Alcalá, Madrid, Spain Abstract: Self-administered topical microbicides or oral preexposure prophylaxis could be very helpful tools for all risk groups to decrease the human immunodeficiency virus (HIV-1 infection rates. Up until now, antiretrovirals (ARVs have been the most advanced microbicide candidates. Nevertheless, the majority of clinical trials has failed in HIV-1 patients. Nanotechnology offers suitable approaches to develop novel antiviral agents. Thereby, new nanosystems, such as carbosilane dendrimers, have been shown to be safe and effective compounds against HIV with great potential as topical microbicides. In addition, because most of the attempts to develop effective topical microbicides were unsuccessful, combinatorial strategies could be a valid approach when designing new microbicides. We evaluated various combinations of anionic carbosilane dendrimers with sulfated (G3-S16 and naphthyl sulfonated (G2-NF16 ended groups with different ARVs against HIV-1 infection. The G3-S16 and G2-NF16 dendrimers showed a synergistic or additive activity profile with zidovudine, efavirenz, and tenofovir in the majority of the combinations tested against the X4 and R5 tropic HIV-1 in cell lines, as well as in human primary cells. Therefore, the combination of ARVs and polyanionic carbosilane dendrimers enhances the antiviral potency of the individual compounds, and our findings support further clinical research on combinational approaches as potential microbicides to block the sexual transmission of HIV-1. Keywords: microbicides, HIV, carbosilane dendrimer, antiretroviral, synergy
CSIR Research Space (South Africa)
Bode, M
2010-09-01
Full Text Available .6 µM N N NH Cl Res Act = 3% IC50 = 2 µM MAGI IC50 = 0.2 µM N N NH Cl Res Act = 5% IC50 = 3.5 µM MAGI IC50 = 0.18 µM N N NH Cl Res Act = 13% IC50 = 8 µM MAGI IC50 = 0.6 µM N N NH Cl Cl Res Act = 4% IC50 = 1.5 µM MAGI IC50... 2010 www.csir.co.za N N NH N N NH Cl N N NH Cl CN IC50= 4.4 uM (RT) IC50= 0.16 uM (PBMC) IC50= 0.41 uM (MAGI) cf . Nevirapine IC50=0.67 uM (RT) IC50=0.033 uM (PBMC) IC50= 29 uM (RT) IC50= 41 uM (PBMC) cf...
Directory of Open Access Journals (Sweden)
Colebunders Robert
2010-11-01
Full Text Available Abstract Background Vitamin D is an important determinant of bone health and also plays a major role in the regulation of the immune system. Interestingly, vitamin D status before the start of highly active antiretroviral therapy (HAART has been recently associated with HIV disease progression and overall mortality in HIV-positive pregnant women. We prospectively studied vitamin D status in HIV individuals on HAART in Belgium. We selected samples from HIV-positive adults starting HAART with a pre-HAART CD4 T-cell count >100 cells/mm3 followed up for at least 12 months without a treatment change. We compared 25-hydroxyvitamin D plasma [25-(OHD] concentration in paired samples before and after 12 months of HAART. 25-(OHD levels are presented using two different cut-offs: Results Vitamin D deficiency was common before HAART, the frequency of plasma 25-(OHD concentrations below 20 ng/ml and 30 below ng/ml was 43.7% and 70.1% respectively. After 12 months on HAART, the frequency increased to 47.1% and 81.6%. HAART for 12 months was associated with a significant decrease of plasma 25-(OHD concentration (p = 0.001. Decreasing plasma 25-(OHD concentration on HAART was associated in the multivariate model with NNRTI-based regimen (p = 0.001 and lower body weight (p = 0.008. Plasma 25-(OHD concentrations decreased significantly in both nevirapine and efavirenz-containing regimens but not in PI-treated patients. Conclusions Vitamin D deficiency is frequent in HIV-positive individuals and NNRTI therapy further decreases 25-(OHD concentrations. Consequently, vitamin D status need to be checked regularly in all HIV-infected patients and vitamin D supplementation should be given when needed.
van Leeuwen, R.; Lange, J. M.; Hussey, E. K.; Donn, K. H.; Hall, S. T.; Harker, A. J.; Jonker, P.; Danner, S. A.
1992-01-01
To determine the safety and pharmacokinetics of the nucleoside analogue, 3TC. A Phase I, open-label, single-centre study. Twenty asymptomatic, HIV-infected male patients with CD4 lymphocyte counts < 500 x 10(6)/l who had not received previous antiretroviral therapy completed the study. Each patient
Reverse zymography alone does not confirm presence of a protease inhibitor.
Dutta, Sangita; Bhattacharyya, Debasish
2013-03-01
Reverse zymography is applied for identification and semi-quantification of protease inhibitors that are of protein in nature. However, a protein that shows band in reverse zymography against a protease used for digestion of the gel need not be an inhibitor; it might be resistant to degradation by the protease. We demonstrate that in reverse zymography, avidin, streptavidin and the leaf extract of Catharanthus roseus behave like inhibitors of proteases like papain, ficin, bromelain extracts from pineapple leaf, stem and fruit and trypsin. Still, they do not act as inhibitors of those proteases when enzyme assays were done in solution. In reverse zymography, the extract of pineapple crown leaf shows two major inhibitor bands against its own proteases. Identification of these proteins from sequences derived from MALDI TOF MS analysis indicated that they are fruit and stem bromelains. Avidin, streptavidin and bromelains are 'kinetically stable proteins' that are usually resistant to proteolysis. Thus, it is recommended that identification of an inhibitor of a protease by reverse zymography should be supported by independent assay methods for confirmation.
MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish
DEFF Research Database (Denmark)
Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.
2015-01-01
Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors...... as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult...... zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance...
Song, Yue; Shen, Keng; He, Chun-Xia
2007-09-01
To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells
2-acetylphenol analogs as potent reversible monoamine oxidase inhibitors
Directory of Open Access Journals (Sweden)
Legoabe LJ
2015-07-01
Full Text Available Lesetja J Legoabe,1 Anél Petzer,1 Jacobus P Petzer1,21Centre of Excellence for Pharmaceutical Sciences, 2Department of Pharmaceutical Chemistry, School of Pharmacy, North-West University, Potchefstroom, South AfricaAbstract: Based on a previous report that substituted 2-acetylphenols may be promising leads for the design of novel monoamine oxidase (MAO inhibitors, a series of C5-substituted 2-acetylphenol analogs (15 and related compounds (two were synthesized and evaluated as inhibitors of human MAO-A and MAO-B. Generally, the study compounds exhibited inhibitory activities against both MAO-A and MAO-B, with selectivity for the B isoform. Among the compounds evaluated, seven compounds exhibited IC50 values <0.01 µM for MAO-B inhibition, with the most selective compound being 17,000-fold selective for MAO-B over the MAO-A isoform. Analyses of the structure–activity relationships for MAO inhibition show that substitution on the C5 position of the 2-acetylphenol moiety is a requirement for MAO-B inhibition, and the benzyloxy substituent is particularly favorable in this regard. This study concludes that C5-substituted 2-acetylphenol analogs are potent and selective MAO-B inhibitors, appropriate for the design of therapies for neurodegenerative disorders such as Parkinson’s disease.Keywords: monoamine oxidase, MAO, inhibition, 2-acetylphenol, structure–activity relationship
Ramallo, I Ayelen; García, Paula; Furlan, Ricardo L E
2015-11-01
A dual readout autographic assay to detect acetylcholinesterase inhibitors present in complex matrices adsorbed on reversed-phase or normal-phase thin-layer chromatography plates is described. Enzyme gel entrapment with an amphiphilic copolymer was used for assay development. The effects of substrate and enzyme concentrations, pH, incubation time, and incubation temperature on the sensitivity and the detection limit of the assay were evaluated. Experimental design and response surface methodology were used to optimize conditions with a minimum number of experiments. The assay allowed the detection of 0.01% w/w of physostigmine in both a spiked Sonchus oleraceus L. extract chromatographed on normal phase and a spiked Pimenta racemosa (Mill.) J.W. Moore leaf essential oil chromatographed on reversed phase. Finally, the reversed-phase thin-layer chromatography assay was applied to reveal the presence of an inhibitor in the Cymbopogon citratus (DC.) Stapf essential oil. The developed assay is able to detect acetylcholinesterase inhibitors present in complex matrixes that were chromatographed in normal phase or reversed-phase thin-layer chromatography. The detection limit for physostigmine on both normal and reversed phase was of 1×10(-4) μg. The results can be read by a change in color and/or a change in fluorescence. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cervero, Miguel; Torres, Rafael; Jusdado, Juan José; Pastor, Susana; Agud, Jose Luis
2016-04-15
To determine the prevalence and types of clinically significant drug-drug interactions (CSDI) in the drug regimens of HIV-infected patients receiving antiretroviral treatment. retrospective review of database. Centre: Hospital Universitario Severo Ochoa, Infectious Unit. one hundred and forty-two participants followed by one of the authors were selected from January 1985 to December 2014. from their outpatient medical records we reviewed information from the last available visit of the participants, in relation to HIV infection, comorbidities, demographics and the drugs that they were receiving; both antiretroviral drugs and drugs not related to HIV infection. We defined CSDI from the information sheet and/or database on antiretroviral drug interactions of the University of Liverpool (http://www.hiv-druginteractions.org) and we developed a diagnostic tool to predict the possibility of CSDI. By multivariate logistic regression analysis and by estimating the diagnostic performance curve obtained, we identified a quick tool to predict the existence of drug interactions. Of 142 patients, 39 (29.11%) had some type of CSDI and in 11.2% 2 or more interactions were detected. In only one patient the combination of drugs was contraindicated (this patient was receiving darunavir/r and quetiapine). In multivariate analyses, predictors of CSDI were regimen type (PI or NNRTI) and the use of 3 or more non-antiretroviral drugs (AUC 0.886, 95% CI 0.828 to 0.944; P=.0001). The risk was 18.55 times in those receiving NNRTI and 27,95 times in those receiving IP compared to those taking raltegravir. Drug interactions, including those defined as clinically significant, are common in HIV-infected patients treated with antiretroviral drugs, and the risk is greater in IP-based regimens. Raltegravir-based prescribing, especially in patients who receive at least 3 non-HIV drugs could avoid interactions. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.
Krep, H H; Graves, S W; Price, D A; Lazarus, M; Ensign, A; Soszynski, P A; Hollenberg, N K
1996-01-01
The possibility that a circulating sodium pump inhibitor contributes to the pathogenesis of volume-dependent hypertension via an action on vascular smooth muscle (VSM) is supported by multiple lines of investigation, but remains controversial. We had two goals in this study. The first was to compare the pattern of contractile response of rabbit aorta induced by two candidates, ouabain and a labile sodium pump inhibitor that we have identified in the peritoneal dialysate of volume-expanded hypertensive patients with chronic renal failure. Our second goal was to examine the ability of Digibind, a Fab fragment of antisera directed against digoxin, to reverse VSM contraction induced by both agents. Ouabain induced a concentration-dependent contraction, which was delayed in onset, was gradual, and reached a stable plateau after many hours. The labile sodium pump inhibitor induced a qualitatively similar series of responses. Digibind rapidly reversed the contractile responses to both sodium pump inhibitors, with a rate of relaxation that matched that induced by physical removal of the pump inhibitor from the bath. For ouabain, the Digibind:ouabain stoichiometry was highly predictable. When Digibind was present in a molar concentration equivalent to that of ouabain, or less, it had no effect. When the Digibind concentration was twice that of ouabain, complete relaxation occurred. Although the concentration:VSM response relationship for ouabain was steep, the concentration:effect interaction with Digibind was even more steep. The molar concentration of Digibind required to reverse the effects of the labile endogenous inhibitor from peritoneal dialysate was consistently lower than that for ouabain, which is compatible with either greater potency of the labile factor in VSM or greater affinity for Digibind. These findings are compatible with a role for one or more endogenous sodium pump inhibitors as the determinant of vascular smooth muscle tone in the volume
Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano
2005-01-13
Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.
International Nuclear Information System (INIS)
Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong
2007-01-01
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation
Energy Technology Data Exchange (ETDEWEB)
Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn
2007-04-06
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.
2007-05-08
deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong
2018-01-01
As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.
Fowler, Joanna S; Logan, Jean; Azzaro, Albert J; Fielding, Robert M; Zhu, Wei; Poshusta, Amy K; Burch, Daniel; Brand, Barry; Free, James; Asgharnejad, Mahnaz; Wang, Gene-Jack; Telang, Frank; Hubbard, Barbara; Jayne, Millard; King, Payton; Carter, Pauline; Carter, Scott; Xu, Youwen; Shea, Colleen; Muench, Lisa; Alexoff, David; Shumay, Elena; Schueller, Michael; Warner, Donald; Apelskog-Torres, Karen
2010-01-01
Reversible inhibitors of monoamine oxidase-A (RIMA) inhibit the breakdown of three major neurotransmitters, serotonin, norepinephrine and dopamine, offering a multi-neurotransmitter strategy for the treatment of depression. CX157 (3-fluoro-7-(2,2,2-trifluoroethoxy)phenoxathiin-10,10-dioxide) is a RIMA, which is currently in development for the treatment of major depressive disorder. We examined the degree and reversibility of the inhibition of brain monoamine oxidase-A (MAO-A) and plasma CX157 levels at different times after oral dosing to establish a dosing paradigm for future clinical efficacy studies, and to determine whether plasma CX157 levels reflect the degree of brain MAO-A inhibition. Brain MAO-A levels were measured with positron emission tomography (PET) imaging and [11C]clorgyline in 15 normal men after oral dosing of CX157 (20–80 mg). PET imaging was conducted after single and repeated doses of CX157 over a 24-h time course. We found that 60 and 80 mg doses of CX157 produced a robust dose-related inhibition (47–72%) of [11C]clorgyline binding to brain MAO-A at 2 h after administration and that brain MAO-A recovered completely by 24 h post drug. Plasma CX157 concentration was highly correlated with the inhibition of brain MAO-A (EC50: 19.3 ng/ml). Thus, CX157 is the first agent in the RIMA class with documented reversible inhibition of human brain MAO-A, supporting its classification as a RIMA, and the first RIMA with observed plasma levels that can serve as a biomarker for the degree of brain MAO-A inhibition. These data were used to establish the dosing regimen for a current clinical efficacy trial with CX157. PMID:19890267
Janssen, B.M.G.; Engelen, W.; Merkx, M.
2015-01-01
DNA-templated reversible assembly of an enzyme–inhibitor complex is presented as a new and highly modular approach to control enzyme activity. TEM1-ß-lactamase and its inhibitor protein BLIP were conjugated to different oligonucleotides, resulting in enzyme inhibition in the presence of template
Identification and characterization of the novel reversible and selective cathepsin X inhibitors.
Fonović, Urša Pečar; Mitrović, Ana; Knez, Damijan; Jakoš, Tanja; Pišlar, Anja; Brus, Boris; Doljak, Bojan; Stojan, Jure; Žakelj, Simon; Trontelj, Jurij; Gobec, Stanislav; Kos, Janko
2017-09-13
Cathepsin X is a cysteine peptidase involved in the progression of cancer and neurodegenerative diseases. Targeting this enzyme with selective inhibitors opens a new possibility for intervention in several therapeutic areas. In this study triazole-based reversible and selective inhibitors of cathepsin X have been identified. Their selectivity and binding is enhanced when the 2,3-dihydrobenzo[b][1,4]dioxine moiety is present as the R 1 substituent. Of a series of selected triazole-benzodioxine derivatives, compound 22 is the most potent inhibitor of cathepsin X carboxypeptidase activity (K i = 2.45 ± 0.05 μM) with at least 100-fold greater selectivity in comparison to cathepsin B or other related cysteine peptidases. Compound 22 is not cytotoxic to prostate cancer cells PC-3 or pheochromocytoma PC-12 cells at concentrations up to 10 μM. It significantly inhibits the migration of tumor cells and increases the outgrowth of neurites, both processes being under the control of cathepsin X carboxypeptidase activity. Compound 22 and other characterized triazole-based inhibitors thus possess a great potential for further development resulting in several in vivo applications.
Histone deacetylase inhibitors reverse age-related increases in side effects of haloperidol in mice.
Montalvo-Ortiz, Janitza L; Fisher, Daniel W; Rodríguez, Guadalupe; Fang, Deyu; Csernansky, John G; Dong, Hongxin
2017-08-01
Older patients can be especially susceptible to antipsychotic-induced side effects, and the pharmacodynamic mechanism underlying this phenomenon remains unclear. We hypothesized that age-related epigenetic alterations lead to decreased expression and functionality of the dopamine D2 receptor (D2R), contributing to this susceptibility. In this study, we treated young (2-3 months old) and aged (22-24 months old) C57BL/6 mice with the D2R antagonist haloperidol (HAL) once a day for 14 days to evaluate HAL-induced motor side effects. In addition, we pretreated separate groups of young and aged mice with histone deacetylase (HDAC) inhibitors valproic acid (VPA) or entinostat (MS-275) and then administered HAL. Our results show that the motor side effects of HAL are exaggerated in aged mice as compared to young mice and that HDAC inhibitors are able to reverse the severity of these deficits. HAL-induced motor deficits in aged mice are associated with an age- and drug-dependent decrease in striatal D2R protein levels and functionality. Further, histone acetylation was reduced while histone tri-methylation was increased at specific lysine residues of H3 and H4 within the Drd2 promoter in the striatum of aged mice. HDAC inhibitors, particularly VPA, restored striatal D2R protein levels and functionality and reversed age- and drug-related histone modifications at the Drd2 promoter. These results suggest that epigenetic changes at the striatal Drd2 promoter drive age-related increases in antipsychotic side effect susceptibility, and HDAC inhibitors may be an effective adjunct treatment strategy to reduce side effects in aged populations.
Brown, Holden D.; Amodeo, Dionisio A.; Sweeney, John A.; Ragozzino, Michael E.
2011-01-01
Previous findings indicate treatment with a selective serotonin reuptake inhibitor (SSRI) facilitates behavioral flexibility when conditions require inhibition of a learned response pattern. The present experiment investigated whether acute treatment with the SSRI, escitalopram, affects behavioral flexibility when conditions require inhibition of a naturally-biased response pattern (elevated conflict test) and/or reversal of a learned response pattern (spatial reversal learning). An additional experiment was carried out to determine whether escitalopram, at doses that affected behavioral flexibility, also reduced anxiety as tested in the elevated plus-maze. In each experiment, Long-Evans rats received an intraperitoneal injection of either saline or escitalopram (0.03, 0.3 or 1.0 mg/kg) 30 minutes prior to behavioral testing. Escitalopram, at all doses tested, enhanced acquisition in the elevated conflict test, but did not affect performance in the elevated plus-maze. Escitalopram (0.3 and 1.0 mg/kg) did not alter acquisition of the spatial discrimination, but facilitated reversal learning. In the elevated conflict and spatial reversal learning test, escitalopram enhanced the ability to maintain the relevant strategy after being initially selected. The present findings suggest that enhancing serotonin transmission with a SSRI facilitates inhibitory processes when conditions require a shift away from either a naturally-biased response pattern or a learned choice pattern. PMID:22219222
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-01-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260
Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella
2005-01-01
The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650
Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K
2015-04-01
MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.
Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre
2012-04-01
The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa
2012-11-01
Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.
Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin
2017-08-02
Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.
Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max
2014-01-01
During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.
Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben
2004-01-01
Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation
Reversibility of membrane N-glycome of HeLa cells upon treatment with epigenetic inhibitors.
Directory of Open Access Journals (Sweden)
Tomislav Horvat
Full Text Available Glycans are essential regulators of protein function and are now in the focus of research in many physiological and pathophysiological processes. There are numerous modes of regulating their biosynthesis, including epigenetic mechanisms implicated in the expression of glyco-genes. Since N-glycans located at the cell membrane define intercellular communication as well as a cellular response to a given environment, we developed a method to preferentially analyze this fraction of glycans. The method is based on incorporation of living cells into polyacrylamide gels, partial denaturation of membrane proteins with 3 M urea and subsequent release of N-glycans with PNGase F followed by HPLC analysis. Using this newly developed method, we revealed multiple effects of epigenetic inhibitors Trichostatin A, sodium butyrate and zebularine on the composition of N-glycans in human cells. The induced changes were found to be reversible after inhibitor removal. Given that many epigenetic inhibitors are currently explored as a therapeutic strategy in treatment of cancer, wherein surface glycans play an important role, the presented work contributes to our understanding of their efficiency in altering the N-glycan profile of cancer cells in culture.
Detection of human telomerase reverse transcriptase messenger ...
African Journals Online (AJOL)
Introduction and Objectives: Bladder cancer is an important national health problem as it is the leading cancer in men in Egypt. Cystoscopy and biopsy, currently remains the gold standard procedure for diagnosis, yet, it is invasive and costly. Urinary cytopathology remains to be the only non-invasive alternative method for ...
Menin-MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.
Grembecka, Jolanta; He, Shihan; Shi, Aibin; Purohit, Trupta; Muntean, Andrew G; Sorenson, Roderick J; Showalter, Hollis D; Murai, Marcelo J; Belcher, Amalia M; Hartley, Thomas; Hess, Jay L; Cierpicki, Tomasz
2012-01-29
Translocations involving the mixed lineage leukemia (MLL) gene result in human acute leukemias with very poor prognosis. The leukemogenic activity of MLL fusion proteins is critically dependent on their direct interaction with menin, a product of the multiple endocrine neoplasia (MEN1) gene. Here we present what are to our knowledge the first small-molecule inhibitors of the menin-MLL fusion protein interaction that specifically bind menin with nanomolar affinities. These compounds effectively reverse MLL fusion protein-mediated leukemic transformation by downregulating the expression of target genes required for MLL fusion protein oncogenic activity. They also selectively block proliferation and induce both apoptosis and differentiation of leukemia cells harboring MLL translocations. Identification of these compounds provides a new tool for better understanding MLL-mediated leukemogenesis and represents a new approach for studying the role of menin as an oncogenic cofactor of MLL fusion proteins. Our findings also highlight a new therapeutic strategy for aggressive leukemias with MLL rearrangements.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Giri, Shibashish; Bader, Augustinus
2014-09-01
Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a
Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin
2017-04-01
Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.
Directory of Open Access Journals (Sweden)
Pedersen Niels C
2007-04-01
Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be
PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR
Directory of Open Access Journals (Sweden)
Nagaraju Anreddy
2014-06-01
Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.
Martin, John C; Hitchcock, Michael J M; De Clercq, Erik; Prusoff, William H
2010-01-01
The occasion of this 25th anniversary issue encouraged us to reminisce about the important history of the discovery of the dideoxynucleoside analogues for the treatment of HIV/AIDS and to chronicle our thoughts about a particular exciting and rewarding period of our scientific careers. Following the identification of the anti-HIV activity of zidovudine (AZT), we participated in the urgent quest to discover optimal treatments of HIV infection and AIDS. A number of previously synthesized nucleoside analogues were comparatively evaluated, and stavudine (D4T) emerged as a promising candidate for development. Following clinical evaluation, D4T became a mainstay of the initial antiretroviral combination therapy, prolonging and saving numerous lives. It has only recently been supplanted by better-tolerated treatments. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, vol. 85, issue 1, 2010. Copyright 2009 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Dinesh Bure,
2016-08-01
Full Text Available Introduction of first line and second line antiretroviral therapy has dramatically improved the quality of life and survival of the HIV-1 infected individuals. Extension of this therapy in children has similar effect. However the emergence of drug selected resistance has hampered the response to the therapy. A database of prevalence of drug resistance mutations in the Indian children both ART naïve and treated will help in deciding the appropriate regimen for the individual patient as well as formulating the policies regarding the composition of drugs included in the fixed dose combinations and its periodic review by analysis of the information that is made available from time to time. This will enable us to utilize our limited resources in most prudent way.
Opii, Wycliffe O; Sultana, Rukhsana; Abdul, Hafiz Mohmmad; Ansari, Mubeen Ahmad; Nath, Avindra; Butterfield, D Allan
2007-03-01
Human immunodeficiency virus dementia (HIVD) is the most common form of dementia occurring among young adults. In HIVD, neuronal cell loss occurs in the absence of neuronal infection. With the advent of highly active anti-retroviral therapy (HAART), the incidence of HIVD has drastically reduced, though prevalence of milder forms of HIVD continues to rise. Though these agents have been used successfully in suppressing viral production, they have also been associated with a number of side effects. Here we examine the possible role of NRTIs, in particular 2',3'-dideoxycytidine (ddC), in the neuropathology of HIVD. Synaptosomes and isolated mitochondria treated and incubated for 6 h with CSF-achievable concentrations of ddC, i.e., 6-11 ng/ml, were found to show a significant increase in oxidative stress with 40 nM ddC as measured by protein carbonyls and 3-nitrotyrosine (3NT), effects that were not observed in the more tolerable NRTI, 3TC. Protection against protein oxidation induced by ddC was observed when brain mitochondria were isolated from gerbils 1 h after injection i.p. with the brain accessible antioxidant and glutathione mimetic, tricyclodecan-9-yl-xanthogenate (D609). In addition, there is a significant reduction in the levels of anti-apoptotic protein Bcl-2 and a significant increase in cytochrome c release and also a significant increase in the expression of pro-apoptotic protein caspase-3 after mitochondria were treated with 40 nM ddC. The results reported here show that ddC at 40 nM can induce oxidative stress, cause the release of cytochrome c, and in addition, reduce the levels of anti-apoptotic proteins, increase the levels of pro-apoptotic proteins, thereby increasing the possibility for induction of apoptosis. These findings are consistent with the notion of a possible role of the NRTIs, and in particular, ddC, in the mechanisms involved in HIVD.
Directory of Open Access Journals (Sweden)
Crumpacker Clyde S
2011-01-01
Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus
Reversible Cysteine Protease Inhibitors Show Promise for a Chagas Disease Cure
Beaulieu, Christian; Black, W. Cameron; Isabel, Elise; Vasquez-Camargo, Fabio; Nath-Chowdhury, Milli; Massé, Frédéric; Mellon, Christophe; Methot, Nathalie
2014-01-01
The cysteine protease cruzipain is essential for the viability, infectivity, and virulence of Trypanosoma cruzi, the causative agent of Chagas disease. Thus, inhibitors of cruzipain are considered promising anti-T. cruzi chemotherapeutic agents. Reversible cruzipain inhibitors containing a nitrile “warhead” were prepared and demonstrated 50% inhibitory concentrations (IC50s) as potent as 1 nM in baculovirus-generated cruzipain enzyme assays. In epimastigote and intracellular amastigote in vitro assays, the most potent compounds demonstrated antiparasitic behavior in the 5 to 10 μM IC50 range; however, trypomastigote production from the amastigote form was ∼90 to 95% inhibited at 2 μM. Two key compounds, Cz007 and Cz008, with IC50s of 1.1 and 1.8 nM, respectively, against the recombinant enzyme were tested in a murine model of acute T. cruzi infection, with oral dosing in chow for 28 days at doses from 3 to 50 mg/kg of body weight. At 3 mg/kg of Cz007 and 3 mg/kg of Cz008, the blood parasitemia areas under the concentration-time curves were 16% and 25% of the untreated group, respectively. At sacrifice, 24 days after immunosuppression with cyclophosphamide, parasite presence in blood, heart, and esophagus was evaluated. Based on negative quantitative PCR results in all three tissues, cure rates in surviving animals were 90% for Cz007 at 3 mg/kg, 78% for Cz008 at 3 mg/kg, and 71% for benznidazole, the control compound, at 50 mg/kg. PMID:24323474
Preclinical profile of befloxatone, a new reversible MAO-A inhibitor.
Curet, O; Damoiseau-Ovens, G; Sauvage, C; Sontag, N; Avenet, P; Depoortere, H; Caille, D; Bergis, O; Scatton, B
1998-12-01
Befloxatone, a novel oxazolidinone derivative, is a potent, selective and reversible monoamine oxidase A (MAO-A) inhibitor in vitro (K1A = 1.9-3.6 nM) and ex vivo (ED50 MAO-A = 0.02 mg/kg, p.o.). It does not interact with a large number of receptors, monoamine transporters or other amine oxidases. Binding studies with [3H]-befloxatone in rat brain sections show that it labels with high affinity (Kd = 1.3 nM) a single population of sites with the pharmacological characteristics and regional distribution of MAO-A. In the rat brain, befloxatone (0.75 mg/kg, i.p.) increases tissue levels of monoamines and decreases levels of their deaminated metabolites. Acute administration of befloxatone (0.75 mg/kg, i.p.) induces an increase in extracellular striatal dopamine and cortical norepinephrine but not cortical serotonin levels in the rat. Befloxatone (1 mg/kg, i.p.) potently inhibits the firing rate of serotonergic neurons, partially decreases the firing of noradrenergic neurons and has no effect on the firing of dopaminergic neurons (a mirror image of its effects on monoamine release in terminal regions), suggesting that the relative effects of befloxatone on monoamine release may be governed by autoreceptor-mediated control of monoaminergic neurons at the cell body level. Befloxatone (0.03-0.3 mg/kg, p.o.) exhibits potent activity in behavioural models predictive of antidepressant activity. Befloxatone (up to 1.5 mg/kg, p.o.) does not potentiate the pressor effects of orally administered tyramine at centrally active doses and duodenal [3H]-befloxatone binding is displaced by increasing doses of orally administered tyramine (0.1-40 mg/kg, i.p.). These results suggest that befloxatone is a potent reversible MAO-A inhibitor with antidepressant potential and a wide safety margin with regard to the potentiation of the pressor effect of tyramine.
Reversal of collapsing glomerulopathy in mice with the cyclin-dependent kinase inhibitor CYC202.
Gherardi, Dana; D'Agati, Vivette; Chu, Te-Hua Tearina; Barnett, Anna; Gianella-Borradori, Athos; Gelman, Irwin H; Nelson, Peter J
2004-05-01
Collapsing glomerulopathy (CG) has become an important cause of end-stage renal disease. Whether associated with HIV-1 or other potential etiologies, the pathogenesis of CG converges to induce aberrant proliferation of renal epithelium along the entire nephron. This raises the possibility that targeting cell-cycle progression may be an effective therapeutic strategy for CG. Here, we ask whether the cyclin-dependent kinase (CDK) inhibitor, CYC202 (R-roscovitine), could attenuate or reverse existing renal disease in Tg26 mice, a well characterized HIV-1 transgenic mouse model of CG. Tg26 mice were age and disease matched through analysis of urine (protein/creatinine) to generate 12 treatment pairs covering a range of mild to severe CG. One mouse from each pair received either vehicle or 75 mg/kg of CYC202 every 12 h for 20 d, a dose 20% above that needed to prevent the development of CG. After treatment, urinary, serologic, and histopathologic indices of nephrosis showed reversal of CG in 8 of 12 CYC202-treated mice compared with progression of CG in 10 of 12 vehicle-treated mice, demonstrating a significant therapeutic benefit from CYC202 (P < 0.05). Pharmacokinetic profiles showed that concentrations of CYC202 known to inhibit cell-cycle and transcriptional CDK in vitro were achieved in plasma at efficacious doses. However, amelioration of CG by CYC202 did not correlate with decreases in kidney HIV-1 transgene expression, indicating that suppression of HIV-1 transcription was not a prerequisite for the antiproliferative activity of CYC202. These results demonstrate a novel therapeutic strategy for CG.
International Nuclear Information System (INIS)
Herraiz, Tomas; Chaparro, Carolina
2005-01-01
Monoamine oxidase (MAO) is a mitochondrial outer-membrane flavoenzyme involved in brain and peripheral oxidative catabolism of neurotransmitters and xenobiotic amines, including neurotoxic amines, and a well-known target for antidepressant and neuroprotective drugs. Recently, positron emission tomography imaging has shown that smokers have a much lower activity of peripheral and brain MAO-A (30%) and -B (40%) isozymes compared to non-smokers. This MAO inhibition results from a pharmacological effect of smoke, but little is known about its mechanism. Working with mainstream smoke collected from commercial cigarettes we confirmed that cigarette smoke is a potent inhibitor of human MAO-A and -B isozymes. MAO inhibition was partly reversible, competitive for MAO-A, and a mixed-type inhibition for MAO-B. Two β-carboline alkaloids, norharman (β-carboline) and harman (1-methyl-β-carboline), were identified by GC-MS, quantified, and isolated from the mainstream smoke by solid phase extraction and HPLC. Kinetics analysis revealed that β-carbolines from cigarette smoke were competitive, reversible, and potent inhibitors of MAO enzymes. Norharman was an inhibitor of MAO-A (K i = 1.2 ± 0.18 μM) and MAO-B (K i = 1.12 ± 0.19 μM), and harman of MAO-A (K i = 55.54 ± 5.3 nM). β-Carboline alkaloids are psychopharmacologically active compounds that may occur endogenously in human tissues, including the brain. These results suggest that β-carboline alkaloids from cigarette smoke acting as potent reversible inhibitors of MAO enzymes may contribute to the MAO-reduced activity produced by tobacco smoke in smokers. The presence of MAO inhibitors in smoke like β-carbolines and others may help us to understand some of the purported neuropharmacological effects associated with smoking
Energy Technology Data Exchange (ETDEWEB)
Petzer, Anél, E-mail: 12264954@nwu.ac.za [Unit for Drug Research and Development, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa); Harvey, Brian H. [Division of Pharmacology, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa); Wegener, Gregers [Centre for Psychiatric Research, Aarhus University Hospital-Risskov, Skovagervej 2, 8240 Risskov (Denmark); Petzer, Jacobus P. [Division of Pharmaceutical Chemistry, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa)
2012-02-01
Methylene blue (MB) has been shown to act at multiple cellular and molecular targets and as a result possesses diverse medical applications. Among these is a high potency reversible inhibition of monoamine oxidase A (MAO-A) that may, at least in part, underlie its adverse effects but also its psycho- and neuromodulatory actions. MB is metabolized to yield N-demethylated products of which azure B, the monodemethyl species, is the major metabolite. Similar to MB, azure B also displays a variety of biological activities and may therefore contribute to the pharmacological profile of MB. Based on these observations, the present study examines the interactions of azure B with recombinant human MAO-A and -B. The results show that azure B is a potent MAO-A inhibitor (IC{sub 50} = 11 nM), approximately 6-fold more potent than is MB (IC{sub 50} = 70 nM) under identical conditions. Measurements of the time-dependency of inhibition suggest that the interaction of azure B with MAO-A is reversible. Azure B also reversibly inhibits the MAO-B isozyme with an IC{sub 50} value of 968 nM. These results suggest that azure B may be a hitherto under recognized contributor to the pharmacology and toxicology of MB by blocking central and peripheral MAO-A activity and as such needs to be considered during its use in humans and animals. Highlights: ► Methylene blue (MB) is a known potent MAO-A inhibitor. ► Azure B, the major metabolite of MB, is more potent as a MAO-A inhibitor. ► Azure B may be a contributor to the CNS pharmacology and toxicology of MB.
... JM, and the Hemophilia Inhibitor Research Study Investigators. Validation of Nijmegen-Bethesda assay modifications to allow inhibitor ... webinars on blood disorders Language: English (US) Español (Spanish) File Formats Help: How do I view different ...
Honda, Yuko; Furugohri, Taketoshi; Morishima, Yoshiyuki
2018-01-01
Agents to reverse the anticoagulant effect of edoxaban, an oral direct factor Xa inhibitor, would be desirable in emergency situations. The aim of this study is to determine the effect of tranexamic acid, an antifibrinolytic agent, on the anticoagulant activity and bleeding by edoxaban in rats. A supratherapeutic dose of edoxaban (3 mg/kg) was intravenously administered to rats. Three minutes after dosing, tranexamic acid (100 mg/kg) was given intravenously. Bleeding was induced by making an incision with a blade on the planta 8 min after edoxaban injection and bleeding time was measured. Prothrombin time (PT) and clot lysis were examined. A supratherapeutic dose of edoxaban significantly prolonged PT and bleeding time. Tranexamic acid did not affect PT or bleeding time prolonged by edoxaban, although tranexamic acid significantly inhibited clot lysis in rat plasma. An antifibrinolytic agent tranexamic acid failed to reverse the anticoagulant effect and bleeding by edoxaban in rats. © 2017 S. Karger AG, Basel.
The interaction of quaternary reversible acetylcholinesterase inhibitors with the nicotinic receptor
Czech Academy of Sciences Publication Activity Database
Šepsová, V.; Krůšek, Jan; Zdarová Karasová, J.; Zemek, F.; Musílek, K.; Kuča, K.; Soukup, O.
2014-01-01
Roč. 63, č. 6 (2014), s. 771-777 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GBP304/12/G069 Institutional support: RVO:67985823 Keywords : acetylcholinesterase inhibitor * nicotin receptor Subject RIV: ED - Physiology Impact factor: 1.293, year: 2014
Directory of Open Access Journals (Sweden)
Luis Miguel Ruilope
2007-03-01
Full Text Available Luis Miguel Ruilope1, Josep Redón2, Roland Schmieder31Servicio de Nefrologia, Unidad de Hipertension Hospital, 12 de Octubre, Madrid, Spain; 2Department of Internal Medicine, Hospital Clinico University of Valencia, Valencia, Spain; 3Department of Nephrology and Hypertension, Friedrich-Alexander-Universitat, Erlangen-Nurnberg, GermanyAbstract: Endothelial dysfunction is the initial pathophysiological step in a progression of vascular damage that leads to overt cardiovascular and chronic kidney disease. Angiotensin II, the primary agent of the renin–angiotensin system (RAS, has a central role in endothelial dysfunction. Therefore, RAS blockade with an angiotensin receptor blocker (ARB and/or angiotensin-converting enzyme (ACE inhibitor provides a rational approach to reverse endothelial dysfunction, reduce microalbuminuria, and, thus, improves cardiovascular and renal prognosis. ARBs and ACE inhibitors act at different points in the RAS pathway and recent evidence suggests that there are differences regarding their effects on endothelial dysfunction. In addition to blood pressure lowering, studies have shown that ARBs reduce target-organ damage, including improvements in endothelial dysfunction, arterial stiffness, the progression of renal dysfunction in patients with type 2 diabetes, proteinuria, and left ventricular hypertrophy. The ONgoing Telmisartan Alone in combination with Ramipril Global Endpoint Trial (ONTARGET Programme is expected to provide the ultimate evidence of whether improved endothelial func tion translates into reduced cardiovascular and renal events in high-risk patients, and to assess possible differential outcomes with telmisartan, the ACE inhibitor ramipril, or a combination of both (dual RAS blockade. Completion of ONTARGET is expected in 2008. Keywords: angiotensin-converting enzyme inhibitor, angiotensin receptor blocker, endothelial dysfunction, ONTARGET, renin–angiotensin system, telmisartan
Felten, Sandra; Leutenegger, Christian M.; Balzer, Hans Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman|info:eu-repo/dai/nl/089740890; Hartmann, Katrin
2017-01-01
Background: Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse
Directory of Open Access Journals (Sweden)
Christina R. Steadman Tyler
2018-06-01
Full Text Available Several studies have demonstrated that exposure to arsenic in drinking water adversely affects brain development and cognitive function in adulthood. While the mechanism by which arsenic induces adverse neurological outcomes remains elusive, studies suggest a link between reduced levels of histone acetylation and impaired performance on a variety of behavioral tasks following arsenic exposure. Using our developmental arsenic exposure (DAE paradigm, we have previously reported reduced histone acetylation and associated histone acetyltransferase enzyme expression in the frontal cortex of C57BL/6J adult male mice, with no changes observed in the female frontal cortex. In the present study, we sought to determine if DAE produced sex-dependent deficits in frontal cortical executive function using the Y-maze acquisition and reversal learning tasks, which are specific for assessing cognitive flexibility. Further, we tested whether the administration of valproic acid, a class I–IIa histone deacetylase inhibitor, was able to mitigate behavioral and biochemical changes resulting from DAE. As anticipated, DAE inhibited acquisition and reversal learning performance in adult male, but not female, mice. Valproate treatment for 2 weeks restored reversal performance in the male arsenic-exposed offspring, while not affecting female performance. Protein levels of HDACs 1, 2, and 5 were elevated following behavioral assessment but only in DAE male mice; restoration of appropriate HDAC levels occurred after valproate treatment and was concurrent with improved behavioral performance, particularly during reversal learning. Female frontal cortical levels of HDAC enzymes were not impacted by DAE or valproate treatment. Finally, mRNA expression levels of brain-derived neurotrophic factor, Bdnf, which has been implicated in the control of frontal cortical flexibility and is regulated by HDAC5, were elevated in DAE male mice and restored to normal levels following HDACi
Saitoh, Eiichi; Yamamoto, Shinya; Okamoto, Eishiro; Hayakawa, Yoshimi; Hoshino, Takashi; Sato, Ritsuko; Isemura, Satoko; Ohtsubo, Sadami; Taniguchi, Masayuki
2007-01-01
We have developed a two-dimensional (2D-) gel system of zymography and reverse zymography for the detection and characterization of proteases and protease inhibitors. Isoelectric focusing (IEF) agarose gels with pH gradients were employed for separation in the fi rst-dimension and sodium dodecyl sulfate (SDS)-polyacrylamide gel copolymerized with gelatin used for the second dimension. Proteases and protease inhibitors separated by IEF gel were applied on the second gel without trichloroacetic...
Tabrizian, Kaveh; Azami, Kian; Belaran, Maryam; Soodi, Maliheh; Abdi, Khosrou; Fanoudi, Sahar; Sanati, Mehdi; Mottaghi Dastjerdi, Negar; Soltany Rezaee-Rad, Mohammad; Sharifzadeh, Mohammad
2016-10-01
Zinc, an essential micronutrient and biochemical element of the human body, plays structural, catalytic, and regulatory roles in numerous physiological functions. In the current study, the effects of a pretraining oral administration of zinc chloride (10, 25, and 50 mg/kg) for 14 consecutive days and post-training bilateral intra-hippocampal infusion of 1400W as a selective inducible nitric oxide synthase (iNOS) inhibitor (10, 50, and 100 μM/side), alone and in combination, on the spatial memory retention in Morris water maze (MWM) were investigated. Animals were trained for 4 days and tested 48 h after completion of training. Also, the molecular effects of these compounds on the expression of choline acetyltransferase (ChAT), as a cholinergic marker in the CA1 region of the hippocampus and medial septal area (MSA), were evaluated. Behavioral and molecular findings of this study showed that a 2-week oral administration of zinc chloride (50 mg/kg) impaired spatial memory retention in MWM and decreased ChAT expression. Immunohistochemical analysis of post-training bilateral intra-hippocampal infusion of 1400W revealed a significant increase in ChAT immunoreactivity. Furthermore, post-training bilateral intra-hippocampal infusion of 1400W into the CA1 region of the hippocampus reversed zinc chloride-induced spatial memory impairment in MWM and significantly increased ChAT expression in comparison with zinc chloride-treated animals. Taken together, these results emphasize the role of selective iNOS inhibitors in reversing zinc chloride-induced spatial memory deficits via modulation of cholinergic marker expression.
International Nuclear Information System (INIS)
Zhang Qunwei; Salnikow, Konstantin; Kluz, Thomas; Chen, L.C.; Su, W.C.; Costa, Max
2003-01-01
The carcinogenic process initiated by nongenotoxic carcinogens involves modulation of gene expression. Nickel compounds have low mutagenic activity, but are highly carcinogenic. In vitro both mouse and human cells can be efficiently transformed by soluble and insoluble nickel compounds to anchorage-independent growth. Because previous studies have shown that carcinogenic nickel compounds silence genes by inhibiting histone acetylation and enhancing DNA methylation, we investigated the effect of enhancing histone acetylation on cell transformation. The exposure of nickel-transformed cells to the histone deacetylase inhibitor trichostatin A (TSA) resulted in the appearance of significant number of revertants measured by their inability to grow in soft agar. Using the Affymetrix GeneChip we found that the level of expression of a significant number of genes was changed (suppressed or upregulated) in nickel-transformed clones but returned to a normal level in revertants obtained following TSA treatment. Moreover, we found that treatment of cells with TSA inhibited the ability of nickel to transform mouse PW cells to anchorage-independent growth. Treatment with TSA also inhibited the ability of nickel to transform human HOS cells, although to a lesser extent. In contrast, treatment with TSA was not able to revert established cancer cell lines as readily as the nickel-transformed cells. These data indicated that modulation of gene expression is important for nickel-induced transformation
Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong
2007-06-30
Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.
Saitoh, Eiichi; Yamamoto, Shinya; Okamoto, Eishiro; Hayakawa, Yoshimi; Hoshino, Takashi; Sato, Ritsuko; Isemura, Satoko; Ohtsubo, Sadami; Taniguchi, Masayuki
2007-11-18
We have developed a two-dimensional (2D-) gel system of zymography and reverse zymography for the detection and characterization of proteases and protease inhibitors. Isoelectric focusing (IEF) agarose gels with pH gradients were employed for separation in the first-dimension and sodium dodecyl sulfate (SDS)-polyacrylamide gel copolymerized with gelatin used for the second dimension. Proteases and protease inhibitors separated by IEF gel were applied on the second gel without trichloroacetic acid (TCA) fixation. Protease activity in the 2D-gel was visualized as transparent spots where gelatin substrate was digested after commassie brilliant blue (CBB) staining. Some of the transparent spots from the skin mucus extract of rainbow trout were determined to be a cysteine protease through use of E-64 or CA-074. In the reverse zymography technique, the gel was incubated with papain solution at 37 degrees C for 18 h. Cysteine protease inhibitors from broad bean seeds were detected as clear blue spots after CBB staining. The amino (N-) terminal sequences of four papain inhibitor spots thus detected were demonstrated to be identical to that of favin beta chain, a broad bean lectin. Taken together, our system can be considered to be an efficient technique for discovering and characterizing new proteases and protease inhibitors in biological samples. This is the first report describing a 2D-gel system of zymography and reverse zymography.
Directory of Open Access Journals (Sweden)
Peter G Traber
Full Text Available Galectin-3 protein is critical to the development of liver fibrosis because galectin-3 null mice have attenuated fibrosis after liver injury. Therefore, we examined the ability of novel complex carbohydrate galectin inhibitors to treat toxin-induced fibrosis and cirrhosis. Fibrosis was induced in rats by intraperitoneal injections with thioacetamide (TAA and groups were treated with vehicle, GR-MD-02 (galactoarabino-rhamnogalaturonan or GM-CT-01 (galactomannan. In initial experiments, 4 weeks of treatment with GR-MD-02 following completion of 8 weeks of TAA significantly reduced collagen content by almost 50% based on Sirius red staining. Rats were then exposed to more intense and longer TAA treatment, which included either GR-MD-02 or GM-CT-01 during weeks 8 through 11. TAA rats treated with vehicle developed extensive fibrosis and pathological stage 6 Ishak fibrosis, or cirrhosis. Treatment with either GR-MD-02 (90 mg/kg ip or GM-CT-01 (180 mg/kg ip given once weekly during weeks 8-11 led to marked reduction in fibrosis with reduction in portal and septal galectin-3 positive macrophages and reduction in portal pressure. Vehicle-treated animals had cirrhosis whereas in the treated animals the fibrosis stage was significantly reduced, with evidence of resolved or resolving cirrhosis and reduced portal inflammation and ballooning. In this model of toxin-induced liver fibrosis, treatment with two galectin protein inhibitors with different chemical compositions significantly reduced fibrosis, reversed cirrhosis, reduced galectin-3 expressing portal and septal macrophages, and reduced portal pressure. These findings suggest a potential role of these drugs in human liver fibrosis and cirrhosis.
Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max
2014-01-01
During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931
Warot, D; Berlin, I; Patat, A; Durrieu, G; Zieleniuk, I; Puech, A J
1996-10-01
Befloxatone is a new reversible and selective monoamine oxidase (MAO-A) inhibitor that has been shown to have antidepressant activity in various animal models. To assess the effects of single oral doses of befloxatone (5, 10, and 20 mg) on psychomotor performance and memory, a randomized, double-blind, five-way, crossover study with both placebo and amitriptyline (50 mg) was carried out in 15 healthy male volunteers. Psychomotor and cognitive functions were evaluated using both objective measures, including Critical Flicker Frequency (CFF), Choice Reaction Time (CRT), Digit Symbol Substitution Test (DSST), and a picture memory test and subjective measures, including Visual Analog Scales (VAS) and Addiction Research Center Inventory (ARCI), before and 2, 4, and 8 hours after administration. Pupil diameter was recorded by videopupillography. Single doses of befloxatone from 5 to 20 mg did not result in any detrimental effects on skilled performance and memory. In contrast, amitriptyline significantly impaired arousal (CFF), speed of reaction (CRT), information processing (DSST) and long-term memory (delayed free recall of pictures) and produced subjective sedation from 2 to 8 hours after administration. At the doses studied amitriptyline induced miosis but befloxatone did not modify pupil diameter. There was no evidence in this study to suggest that befloxatone, at the doses studied, has any sedative or amnesic effects in healthy subjects.
Okiyama, Naoko; Furumoto, Yasuko; Villarroel, Vadim A; Linton, Jay T; Tsai, Wanxia L; Gutermuth, Jan; Ghoreschi, Kamran; Gadina, Massimo; O'Shea, John J; Katz, Stephen I
2014-01-01
The utility of allogeneic hematopoietic stem cell transplantation is limited by graft-versus-host disease (GVHD), a significant cause of morbidity and mortality. Patients with GVHD exhibit cutaneous manifestations with histological features of interface dermatitis followed by scleroderma-like changes. JAK inhibitors represent a class of immunomodulatory drugs that inhibit signaling by multiple cytokines. Herein we report the effects of tofacitinib in a murine model of GVHD. Oral administration of tofacitinib prevented GVHD-like disease manifested by weight loss and mucocutaneous lesions. More importantly, tofacitinib was also effective in reversing established disease. Tofacitinib diminished the expansion and activation of murine CD8 T cells in this model, and had similar effects on IL-2-stimulated human CD8 T cells. Tofacitinib also inhibited the expression of IFN-γ-inducible chemoattractants by keratinocytes, and IFN-γ-inducible cell death of keratinocytes. Tofacitinib may be an effective drug for treatment against CD8 T-cell–mediated mucocutaneous diseases in patients with GVHD. PMID:24213371
Hattori, Shunji; Fujisaki, Hitomi; Kiriyama, Tomomi; Yokoyama, Tsukao; Irie, Shinkichi
2002-02-01
Zymography and reverse zymography are widely used techniques for identifying the proteolytic activity of enzymes and the presence of protease inhibitors in polyacrylamide gels. In the current studies, we utilized a fluorescein-isothiocyanate-labeled substrate to develop novel zymographic and reverse zymographic methods for detecting matrix metalloproteinases and tissue inhibitors of the metalloproteinases, respectively. Using a transilluminator, the results can be observed visually without stopping the enzymatic reaction. For this reason, we have named these methods real-time zymography and real-time reverse zymography. These methods have the following advantages compared with conventional protocols: (1) because the reaction can be repeatedly monitored on the polyacrylamide gels, optimization of the incubation time can be achieved without preliminary analyses; (2) higher sensitivity is achieved with a lower amount of substrate than with conventional methods; (3) a semi-quantitative analysis of matrix metalloproteinases is possible. An additional advantage of the real-time reverse zymography is that, because the fluorescence detection is specific for substrate digestion, the inhibitor bands can be easily distinguished from contaminating proteins.
Moruno-Dávila, M A; Garrido-del Solo, C; García-Moreno, M; Havsteen, B H; Garcia-Sevilla, F; Garcia-Cánovas, F; Varón, R
2001-02-01
The use of suicide substrates remains a very important and useful method in enzymology for studying enzyme mechanisms and designing potential drugs. Suicide substrates act as modified substrates for the target enzymes and bind to the active site. Therefore the presence of a competitive reversible inhibitor decreases the rate of substrate-induced inactivation and protects the enzyme from this inactivation. This lowering on the inactivation rate has evident physiological advantages, since it allows the easy acquisition of experimental data and facilitates kinetic data analysis by providing another variable (inhibitor concentration). However despite the importance of the simultaneous action of a suicide substrate and a competitive reversible inhibition, to date no corresponding kinetic analysis has been carried out. Therefore we present a general kinetic analysis of a Michaelis-Menten reaction mechanism with double inhibition caused by both, a suicide substrate and a competitive reversible inhibitor. We assume rapid equilibrium of the reversible reaction steps involved, while the time course equations for the reaction product have been derived with the assumption of a limiting enzyme. The goodness of the analytical solutions has been tested by comparison with the simulated curves obtained by numerical integration. A kinetic data analysis to determine the corresponding kinetic parameters from the time progress curve of the product is suggested. In conclusion, we present a complete kinetic analysis of an enzyme reaction mechanism as described above in an attempt to fill a gap in the theoretical treatment of this type of system.
Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.
Neelakantan, Harshini; Vance, Virginia; Wetzel, Michael D; Wang, Hua-Yu Leo; McHardy, Stanton F; Finnerty, Celeste C; Hommel, Jonathan D; Watowich, Stanley J
2018-01-01
reverse diet-induced obesity and validate NNMT as a viable target to treat obesity and related metabolic conditions. Increased flux of key cellular energy regulators, including NAD + and SAM, may potentially define the therapeutic mechanism-of-action of NNMT inhibitors. Copyright © 2017 Elsevier Inc. All rights reserved.
Schulz, Daniela; Mirrione, Martine M; Henn, Fritz A
2010-02-01
Cognitive processes are assumed to change with learned helplessness, an animal model of depression, but little is known about such deficits. Here we investigated the role of cognitive and related functions in selectively bred helpless (cLH, n=10), non-helpless (cNLH, n=12) and wild type (WT, n=8) Sprague Dawley rats. The animals were exposed to an open field for 10min on each of two test days. On the third day, an object exploration paradigm was carried out. The animals were later tested for helplessness. Both cLH and cNLH rats were more active than WTs on the first day in the open field. Over trials, cNLH and WT rats lowered their activity less than cLH rats. This resistance-to-habituation co-varied with a resistance to develop helplessness. In cLH rats, higher 'anxiety' or less time spent in the center of the open field co-varied with severe helplessness. In WTs, a greater reactivity to novel objects and to a spatially relocated object predicted lower levels of helplessness. In cLH rats (n=4-5 per group), chronic treatment with a high dose of the monoamine oxidase (MAO)-B inhibitor deprenyl (10mg/kg; i.p.), an anti-Parkinson, nootropic and antidepressant drug, attenuated helplessness. Remarkably, helplessness reversal required the experience of repeated test trials, reminiscent of a learning process. Chronic deprenyl (10mg/kg; i.p.) did not alter locomotion/exploration or 'anxiety' in the open field. In conclusion, helplessness may be related to altered mechanisms of reinforcement learning and working memory, and to abnormalities in MAO-A and/or MAO-B functioning. Copyright 2009 Elsevier Inc. All rights reserved.
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Directory of Open Access Journals (Sweden)
Belarbi Karim
2012-01-01
Full Text Available Abstract Background Chronic neuroinflammation is a hallmark of several neurological disorders associated with cognitive loss. Activated microglia and secreted factors such as tumor necrosis factor (TNF-α are key mediators of neuroinflammation and may contribute to neuronal dysfunction. Our study was aimed to evaluate the therapeutic potential of a novel analog of thalidomide, 3,6'-dithiothalidomide (DT, an agent with anti-TNF-α activity, in a model of chronic neuroinflammation. Methods Lipopolysaccharide or artificial cerebrospinal fluid was infused into the fourth ventricle of three-month-old rats for 28 days. Starting on day 29, animals received daily intraperitoneal injections of DT (56 mg/kg/day or vehicle for 14 days. Thereafter, cognitive function was assessed by novel object recognition, novel place recognition and Morris water maze, and animals were euthanized 25 min following water maze probe test evaluation. Results Chronic LPS-infusion was characterized by increased gene expression of the proinflammatory cytokines TNF-α and IL-1β in the hippocampus. Treatment with DT normalized TNF-α levels back to control levels but not IL-1β. Treatment with DT attenuated the expression of TLR2, TLR4, IRAK1 and Hmgb1, all genes involved in the TLR-mediated signaling pathway associated with classical microglia activation. However DT did not impact the numbers of MHC Class II immunoreactive cells. Chronic neuroinflammation impaired novel place recognition, spatial learning and memory function; but it did not impact novel object recognition. Importantly, treatment with DT restored cognitive function in LPS-infused animals and normalized the fraction of hippocampal neurons expressing the plasticity-related immediate-early gene Arc. Conclusion Our data demonstrate that the TNF-α synthesis inhibitor DT can significantly reverse hippocampus-dependent cognitive deficits induced by chronic neuroinflammation. These results suggest that TNF-α is a
Lietzau, Grazyna; Davidsson, William; Östenson, Claes-Göran; Chiazza, Fausto; Nathanson, David; Pintana, Hiranya; Skogsberg, Josefin; Klein, Thomas; Nyström, Thomas; Darsalia, Vladimer; Patrone, Cesare
2018-02-23
Recent data suggest that olfactory deficits could represent an early marker and a pathogenic mechanism at the basis of cognitive decline in type 2 diabetes (T2D). However, research is needed to further characterize olfactory deficits in diabetes, their relation to cognitive decline and underlying mechanisms.The aim of this study was to determine whether T2D impairs odour detection, olfactory memory as well as neuroplasticity in two major brain areas responsible for olfaction and odour coding: the main olfactory bulb (MOB) and the piriform cortex (PC), respectively. Dipeptidyl peptidase-4 inhibitors (DPP-4i) are clinically used T2D drugs exerting also beneficial effects in the brain. Therefore, we aimed to determine whether DPP-4i could reverse the potentially detrimental effects of T2D on the olfactory system.Non-diabetic Wistar and T2D Goto-Kakizaki rats, untreated or treated for 16 weeks with the DPP-4i linagliptin, were employed. Odour detection and olfactory memory were assessed by using the block, the habituation-dishabituation and the buried pellet tests. We assessed neuroplasticity in the MOB by quantifying adult neurogenesis and GABAergic inhibitory interneurons positive for calbindin, parvalbumin and carletinin. In the PC, neuroplasticity was assessed by quantifying the same populations of interneurons and a newly identified form of olfactory neuroplasticity mediated by post-mitotic doublecortin (DCX) + immature neurons.We show that T2D dramatically reduced odour detection and olfactory memory. Moreover, T2D decreased neurogenesis in the MOB, impaired the differentiation of DCX+ immature neurons in the PC and altered GABAergic interneurons protein expression in both olfactory areas. DPP-4i did not improve odour detection and olfactory memory. However, it normalized T2D-induced effects on neuroplasticity.The results provide new knowledge on the detrimental effects of T2D on the olfactory system. This knowledge could constitute essentials for
Zaikos, Thomas D; Painter, Mark M; Sebastian Kettinger, Nadia T; Terry, Valeri H; Collins, Kathleen L
2018-03-15
Combinations of drugs that affect distinct mechanisms of HIV latency aim to induce robust latency reversal leading to cytopathicity and elimination of the persistent HIV reservoir. Thus far, attempts have focused on combinations of protein kinase C (PKC) agonists and pan-histone deacetylase inhibitors (HDIs) despite the knowledge that HIV gene expression is regulated by class 1 histone deacetylases. We hypothesized that class 1-selective HDIs would promote more robust HIV latency reversal in combination with a PKC agonist than pan-HDIs because they preserve the activity of proviral factors regulated by non-class 1 histone deacetylases. Here, we show that class 1-selective agents used alone or with the PKC agonist bryostatin-1 induced more HIV protein expression per infected cell. In addition, the combination of entinostat and bryostatin-1 induced viral outgrowth, whereas bryostatin-1 combinations with pan-HDIs did not. When class 1-selective HDIs were used in combination with pan-HDIs, the amount of viral protein expression and virus outgrowth resembled that of pan-HDIs alone, suggesting that pan-HDIs inhibit robust gene expression induced by class 1-selective HDIs. Consistent with this, pan-HDI-containing combinations reduced the activity of NF-κB and Hsp90, two cellular factors necessary for potent HIV protein expression, but did not significantly reduce overall cell viability. An assessment of viral clearance from in vitro cultures indicated that maximal protein expression induced by class 1-selective HDI treatment was crucial for reservoir clearance. These findings elucidate the limitations of current approaches and provide a path toward more effective strategies to eliminate the HIV reservoir. IMPORTANCE Despite effective antiretroviral therapy, HIV evades eradication in a latent form that is not affected by currently available drug regimens. Pharmacologic latency reversal that leads to death of cellular reservoirs has been proposed as a strategy for
Porter, Danielle P; Daeumer, Martin; Thielen, Alexander; Chang, Silvia; Martin, Ross; Cohen, Cal; Miller, Michael D; White, Kirsten L
2015-12-07
At Week 96 of the Single-Tablet Regimen (STaR) study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF) developed resistance mutations compared to those treated with efavirenz (EFV)/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq) was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33), as well as baseline samples from control subjects with virologic response (n = 118). Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20%) were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.
Directory of Open Access Journals (Sweden)
Danielle P. Porter
2015-12-01
Full Text Available At Week 96 of the Single-Tablet Regimen (STaR study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF developed resistance mutations compared to those treated with efavirenz (EFV/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33, as well as baseline samples from control subjects with virologic response (n = 118. Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20% were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.
Directory of Open Access Journals (Sweden)
Juan Roberto Rodriguez-Madoz
Full Text Available The combination of defined factors with small molecules targeting epigenetic factors is a strategy that has been shown to enhance optimal derivation of iPSCs and could be used for disease modelling, high throughput screenings and/or regenerative medicine applications. In this study, we showed that a new first-in-class reversible dual G9a/DNMT1 inhibitor compound (CM272 improves the efficiency of human cell reprogramming and iPSC generation from primary cells of healthy donors and patient samples, using both integrative and non-integrative methods. Moreover, CM272 facilitates the generation of human iPSC with only two factors allowing the removal of the most potent oncogenic factor cMYC. Furthermore, we demonstrated that mechanistically, treatment with CM272 induces heterochromatin relaxation, facilitates the engagement of OCT4 and SOX2 transcription factors to OSKM refractory binding regions that are required for iPSC establishment, and enhances mesenchymal to epithelial transition during the early phase of cell reprogramming. Thus, the use of this new G9a/DNMT reversible dual inhibitor compound may represent an interesting alternative for improving cell reprogramming and human iPSC derivation for many different applications while providing interesting insights into reprogramming mechanisms.
International Nuclear Information System (INIS)
Reinke, Ryan A.; Lee, Deborah J.; McDougall, Brenda R.; King, Peter J.; Victoria, Joseph; Mao Yingqun; Lei Xiangyang; Reinecke, Manfred G.; Robinson, W. Edward
2004-01-01
The human immunodeficiency virus (HIV) integrase (IN) must covalently join the viral cDNA into a host chromosome for productive HIV infection. L-Chicoric acid (L-CA) enters cells poorly but is a potent inhibitor of IN in vitro. Using quantitative real-time polymerase chain reaction (PCR), L-CA inhibits integration at concentrations from 500 nM to 10 μM but also inhibits entry at concentrations above 1 μM. Using recombinant HIV IN, steady-state kinetic analyses with L-CA were consistent with a noncompetitive or irreversible mechanism of inhibition. IN, in the presence or absence of L-CA, was successively washed. Inhibition of IN diminished, demonstrating that L-CA was reversibly bound to the protein. These data demonstrate that L-CA is a noncompetitive but reversible inhibitor of IN in vitro and of HIV integration in vivo. Thus, L-CA likely interacts with amino acids other than those which bind substrate
Rodriguez-Madoz, Juan Roberto; San Jose-Eneriz, Edurne; Rabal, Obdulia; Zapata-Linares, Natalia; Miranda, Estibaliz; Rodriguez, Saray; Porciuncula, Angelo; Vilas-Zornoza, Amaia; Garate, Leire; Segura, Victor; Guruceaga, Elizabeth; Agirre, Xabier; Oyarzabal, Julen; Prosper, Felipe
2017-01-01
The combination of defined factors with small molecules targeting epigenetic factors is a strategy that has been shown to enhance optimal derivation of iPSCs and could be used for disease modelling, high throughput screenings and/or regenerative medicine applications. In this study, we showed that a new first-in-class reversible dual G9a/DNMT1 inhibitor compound (CM272) improves the efficiency of human cell reprogramming and iPSC generation from primary cells of healthy donors and patient samples, using both integrative and non-integrative methods. Moreover, CM272 facilitates the generation of human iPSC with only two factors allowing the removal of the most potent oncogenic factor cMYC. Furthermore, we demonstrated that mechanistically, treatment with CM272 induces heterochromatin relaxation, facilitates the engagement of OCT4 and SOX2 transcription factors to OSKM refractory binding regions that are required for iPSC establishment, and enhances mesenchymal to epithelial transition during the early phase of cell reprogramming. Thus, the use of this new G9a/DNMT reversible dual inhibitor compound may represent an interesting alternative for improving cell reprogramming and human iPSC derivation for many different applications while providing interesting insights into reprogramming mechanisms.
Negredo, Eugenia; Ribalta, Josep; Paredes, Roger; Ferré, Raimón; Sirera, Guillem; Ruiz, Lidia; Salazar, Juliana; Reiss, Peter; Masana, Lluís; Clotet, Bonaventura
2002-01-01
Background: The widespread use of protease inhibitors (PI) has been associated with abnormalities in the lipid profile of HIV-1-infected patients. Treatment simplification approaches in which PI are replaced by nevirapine (NVP) have been shown to improve PI-related toxicity. Objective: To assess the
Coelho Cerqueira, Eduardo; Netz, Paulo Augusto; Diniz, Cristiane; Petry do Canto, Vanessa; Follmer, Cristian
2011-12-15
Monoamine oxidase (MAO) catalyzes the oxidative deamination of biogenic and exogenous amines and its inhibitors have therapeutic value for several conditions including affective disorders, stroke, neurodegenerative diseases and aging. The discovery of 2,3,6-trimethyl-1,4-naphthoquinone (TMN) as a nonselective and reversible inhibitor of MAO, has suggested 1,4-naphthoquinone (1,4-NQ) as a potential scaffold for designing new MAO inhibitors. Combining molecular modeling tools and biochemical assays we evaluate the kinetic and molecular details of the inhibition of human MAO by 1,4-NQ, comparing it with TMN and menadione. Menadione (2-methyl-1,4-naphthoquinone) is a multitarget drug that acts as a precursor of vitamin K and an inducer of mitochondrial permeability transition. Herein we show that MAO-B was inhibited competitively by 1,4-NQ (K(i)=1.4 μM) whereas MAO-A was inhibited by non-competitive mechanism (K(i)=7.7 μM). Contrasting with TMN and 1,4-NQ, menadione exhibited a 60-fold selectivity for MAO-B (K(i)=0.4 μM) in comparison with MAO-A (K(i)=26 μM), which makes it as selective as rasagiline. Fluorescence and molecular modeling data indicated that these inhibitors interact with the flavin moiety at the active site of the enzyme. Additionally, docking studies suggest the phenyl side groups of Tyr407 and Tyr444 (for MAO-A) or Tyr398 and Tyr435 (for MAO-B) play an important role in the interaction of the enzyme with 1,4-NQ scaffold through forces of dispersion as verified for menadione, TMN and 1,4-NQ. Taken together, our findings reveal the molecular details of MAO inhibition by 1,4-NQ scaffold and show for the first time that menadione acts as a competitive and reversible inhibitor of human MAO. Copyright © 2011 Elsevier Ltd. All rights reserved.
McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.
Minini, Lucía; Ferraro, Florencia; Cancela, Saira; Merlino, Alicia
2017-11-01
Alzheimer's disease (AD) is the most prevalent neurodegenerative disorder worldwide for which there is currently no cure. Recently, caspase-3 has been proposed as a potential therapeutic target for treating AD. Since this enzyme is overexpressed in brains from AD patients its selective modulation by non-covalent inhibitors becomes an interesting strategy in the search of potential drugs against this neuropathology. With this in mind, we have combined molecular docking, molecular dynamics simulations and QM calculations of unliganded caspase-3 and caspase-7 and in complex with a series of known inhibitors of caspase-3 described in the literature in order to assess the structural features responsible for good inhibitory activity and selectivity against this potential target. This work has allowed us to identify hotspots for drug binding as well as the importance of shape and charge distribution for interacting into the substrate binding cleft or into the dimer interface in each enzyme. Our results showed that most selective compounds against caspsase-3 bind into the substrate binding cleft acting as competitive inhibitors whereas in caspase-7 they bind close to an allosteric site at the dimer interface but since they are weakly bound their presence would not be affecting enzyme dynamics or function. In addition, for both enzymes we have found evidence indicating that differences in shape and accessibility exist between the substrate binding site of each monomer which could be modulating the binding affinity of non-covalent molecules.
International Nuclear Information System (INIS)
Pappano, William N; Sheppard, George S; Donawho, Cherrie; Buchanan, Fritz G; Davidsen, Steven K; Bell, Randy L; Wang, Jieyi; Jung, Paul M; Meulbroek, Jonathan A; Wang, Yi-Chun; Hubbard, Robert D; Zhang, Qian; Grudzien, Meagan M; Soni, Niru B; Johnson, Eric F
2009-01-01
The insulin-like growth factor (IGF) axis is an important signaling pathway in the growth and survival of many cell and tissue types. This pathway has also been implicated in many aspects of cancer progression from tumorigenesis to metastasis. The multiple roles of IGF signaling in cancer suggest that inhibition of the pathway might yield clinically effective therapeutics. We describe A-928605, a novel pyrazolo [3,4-d]pyrimidine small molecule inhibitor of the receptor tyrosine kinases (IGF1R and IR) responsible for IGF signal transduction. This compound was first tested for its activity and selectivity via conventional in vitro kinome profiling and cellular IGF1R autophosphorylation. Additionally, cellular selectivity and efficacy of A-928605 were analyzed in an IGF1R oncogene-addicted cell line by proliferation, signaling and microarray studies. Finally, in vivo efficacy of A-928605 was assessed in the oncogene-addicted cell line and in a neuroblastoma model as a single agent as well as in combination with clinically approved therapeutics targeting EGFR in models of pancreatic and non-small cell lung cancers. A-928605 is a selective IGF1R inhibitor that is able to abrogate activation of the pathway both in vitro and in vivo. This novel compound dosed as a single agent is able to produce significant growth inhibition of neuroblastoma xenografts in vivo. A-928605 is also able to provide additive effects when used in combination with clinically approved agents directed against EGFR in non-small cell lung and human pancreatic tumor models. These results suggest that a selective IGF1R inhibitor such as A-928605 may provide a useful clinical therapeutic for IGF pathway affected tumors and warrants further investigation
Energy Technology Data Exchange (ETDEWEB)
Liu, Jian; Guiadeen, Deodial; Krikorian, Arto; Gao, Xiaolei; Wang, James; Boga, Sobhana Babu; Alhassan, Abdul-Basit; Yu, Younong; Vaccaro, Henry; Liu, Shilan; Yang, Chundao; Wu, Hao; Cooper, Alan; de Man, Jos; Kaptein, Allard; Maloney, Kevin; Hornak, Viktor; Gao, Ying-Duo; Fischmann, Thierry O.; Raaijmakers, Hans; Vu-Pham, Diep; Presland, Jeremy; Mansueto, My; Xu, Zangwei; Leccese, Erica; Zhang-Hoover, Jie; Knemeyer, Ian; Garlisi, Charles G.; Bays, Nathan; Stivers, Peter; Brandish, Philip E.; Hicks, Alexandra; Kim, Ronald; Kozlowski, Joseph A. (Merck); (WuXi App Tec)
2016-02-11
Bruton’s tyrosine kinase (BTK) is a Tec family kinase with a well-defined role in the B cell receptor (BCR) pathway. It has become an attractive kinase target for selective B cell inhibition and for the treatment of B cell related diseases. We report a series of compounds based on 8-amino-imidazo[1,5-a]pyrazine that are potent reversible BTK inhibitors with excellent kinase selectivity. Selectivity is achieved through specific interactions of the ligand with the kinase hinge and driven by aminopyridine hydrogen bondings with Ser538 and Asp539, and by hydrophobic interaction of trifluoropyridine in the back pocket. These interactions are evident in the X-ray crystal structure of the lead compounds 1 and 3 in the complex with the BTK enzyme. Our lead compounds show desirable PK profiles and efficacy in the preclinical rat collagen induced arthritis model.
Long, Zhou; Chen, BaiJun; Liu, Qian; Zhao, Jiang; Yang, ZhenXing; Dong, XingYou; Xia, LiuBin; Huang, ShengQuan; Hu, XiaoYan; Song, Bo; Li, LongKun
2016-07-05
We explored the effects of KB-R7943, an inhibitor of reverse-mode NCX1 activity, in prostate cancer (PCa). NCX1 was overexpressed in PCa tissues and cell lines, and higher NCX1 levels were associated higher PCa grades. At concentrations greater than 10 μM, KB-R7943 dose-dependently decreased PC3 and LNCaP cell viability. KB-R7943 also increased cell cycle G1/S phase arrest and induced apoptosis in PC3 cells. KB-R7943 increased autophagosome accumulation in PCa cells as indicated by increases in LC3-II levels and eGFP-LC3 puncta. Combined treatment with chloroquine (CQ) and KB-R7943 decreased P62 and increased LC3-II protein levels in PC3 cells, indicating that KB-R7943 blocked autophagic flux. KB-R7943 induced autophagosome accumulation mainly by downregulating the PI3K/AKT/m-TOR pathway and upregulating the JNK pathway. In xenograft experiments, KB-R7943 inhibited tumor growth. Combined treatment with KB-R7943 and an autophagy inhibitor inhibited growth and increased apoptosis. These results indicate that KB-R7943 promotes cell death in PCa by activating the JNK signaling pathway and blocking autophagic flux.
Directory of Open Access Journals (Sweden)
Patrick A Randall
Full Text Available Behavioral activation is a fundamental feature of motivation, and organisms frequently make effort-related decisions based upon evaluations of reinforcement value and response costs. Furthermore, people with major depression and other disorders often show anergia, psychomotor retardation, fatigue, and alterations in effort-related decision making. Tasks measuring effort-based decision making can be used as animal models of the motivational symptoms of depression, and the present studies characterized the effort-related effects of the vesicular monoamine transport (VMAT-2 inhibitor tetrabenazine. Tetrabenazine induces depressive symptoms in humans, and also preferentially depletes dopamine (DA. Rats were assessed using a concurrent progressive ratio (PROG/chow feeding task, in which they can either lever press on a PROG schedule for preferred high-carbohydrate food, or approach and consume a less-preferred lab chow that is freely available in the chamber. Previous work has shown that the DA antagonist haloperidol reduced PROG work output on this task, but did not reduce chow intake, effects that differed substantially from those of reinforcer devaluation or appetite suppressant drugs. The present work demonstrated that tetrabenazine produced an effort-related shift in responding on the PROG/chow procedure, reducing lever presses, highest ratio achieved and time spent responding, but not reducing chow intake. Similar effects were produced by administration of the subtype selective DA antagonists ecopipam (D1 and eticlopride (D2, but not by the cannabinoid CB1 receptor neutral antagonist and putative appetite suppressant AM 4413, which suppressed both lever pressing and chow intake. The adenosine A2A antagonist MSX-3, the antidepressant and catecholamine uptake inhibitor bupropion, and the MAO-B inhibitor deprenyl, all reversed the impairments induced by tetrabenazine. This work demonstrates the potential utility of the PROG/chow procedure as a
Directory of Open Access Journals (Sweden)
Yunjeong Kim
2016-03-01
Full Text Available Coronaviruses infect animals and humans causing a wide range of diseases. The diversity of coronaviruses in many mammalian species is contributed by relatively high mutation and recombination rates during replication. This dynamic nature of coronaviruses may facilitate cross-species transmission and shifts in tissue or cell tropism in a host, resulting in substantial change in virulence. Feline enteric coronavirus (FECV causes inapparent or mild enteritis in cats, but a highly fatal disease, called feline infectious peritonitis (FIP, can arise through mutation of FECV to FIP virus (FIPV. The pathogenesis of FIP is intimately associated with immune responses and involves depletion of T cells, features shared by some other coronaviruses like Severe Acute Respiratory Syndrome Coronavirus. The increasing risks of highly virulent coronavirus infections in humans or animals call for effective antiviral drugs, but no such measures are yet available. Previously, we have reported the inhibitors that target 3C-like protease (3CLpro with broad-spectrum activity against important human and animal coronaviruses. Here, we evaluated the therapeutic efficacy of our 3CLpro inhibitor in laboratory cats with FIP. Experimental FIP is 100% fatal once certain clinical and laboratory signs become apparent. We found that antiviral treatment led to full recovery of cats when treatment was started at a stage of disease that would be otherwise fatal if left untreated. Antiviral treatment was associated with a rapid improvement in fever, ascites, lymphopenia and gross signs of illness and cats returned to normal health within 20 days or less of treatment. Significant reduction in viral titers was also observed in cats. These results indicate that continuous virus replication is required for progression of immune-mediated inflammatory disease of FIP. These findings may provide important insights into devising therapeutic strategies and selection of antiviral compounds for
Dalton, George D; Smith, Forrest L; Smith, Paul A; Dewey, William L
2005-04-01
Two peptide fragments of native Protein Kinase A inhibitor (PKI), PKI-(6-22)-amide and PKI-(Myr-14-22)-amide, significantly reversed low-level morphine antinociceptive tolerance in mice. The inhibition of Protein Kinase A (PKA) activity by both peptide fragments was then measured in specific brain regions (thalamus, periaqueductal gray (PAG), and medulla) and in lumbar spinal cord (LSC), which in previous studies have been shown to play a role in morphine-induced analgesia. In drug naive animals, cytosolic PKA activity was greater than particulate PKA activity in each region, while cytosolic and particulate PKA activities were greater in thalamus and PAG compared to medulla and LSC. The addition of both peptides to homogenates from each region completely abolished cytosolic and particulate PKA activities in vitro. Following injection into the lateral ventricle of the brain of drug naive mice and morphine-tolerant mice, both peptides inhibited PKA activity in the cytosolic, but not the particulate fraction of LSC. In addition, cytosolic and particulate PKA activities were inhibited by both peptides in thalamus. These results demonstrate that the inhibition of PKA reverses morphine tolerance. Moreover, the inhibition of PKA activity in specific brain regions and LSC from morphine-tolerant mice by PKI analogs administered i.c.v. is evidence that PKA plays a role in morphine tolerance.
Chung, Suhman; Wendeler, Michaela; Rausch, Jason W.; Beilhartz, Greg; Gotte, Matthias; O'Keefe, Barry R.; Bermingham, Alun; Beutler, John A.; Liu, Shixin; Zhuang, Xiaowei; Le Grice, Stuart F. J.
2010-01-01
Vinylogous ureas 2-amino-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxamide and N-[3-(aminocarbonyl)-4,5-dimethyl-2-thienyl]-2-furancarboxamide (compounds 1 and 2, respectively) were recently identified to be modestly potent inhibitors of the RNase H activity of HIV-1 and HIV-2 reverse transcriptase (RT). Both compounds shared a 3-CONH2-substituted thiophene ring but were otherwise structurally unrelated, which prevented a precise definition of the pharmacophore. We have therefore exa...
Tzvetkov, Nikolay T.; Stammler, Hans-Georg; Antonov, Liudmil
2017-12-01
The tautomeric properties of an N-(3,4-dichlorophenyl)-1H-indazole-5-carboxamide (NTZ-1006, 2) derivative, developed as highly potent, reversible and selective MAO-B inhibitor useful for the treatment of Parkinson's disease (PD) and other neurological disorders, have been studied both experimentally and theoretically. The theoretical data (M06-2X, B3LYP and MP2-4 quantum chemical calculations) have shown that due to aromaticity reasons the 1H tautomer strongly dominates over the 2H form. There are no substantial spectral changes by changing the solvent and the concentration, which leads to a conclusion that compound 2 exists in solution as 1H tautomer and its tautomerism is not influenced by the solvents and the concentration. The results are in line with the understanding for the tautomerism of 1H-indazole and shows that substitution at the C5 position in the indazole unit does not influence the tautomeric state. The isolated crystal structure of 2 is in an excellent agreement with the computation in respect of the most stable tautomer. Combined single X-ray/molecular modeling studies including HYdrogen-DEsolvation (HYDE) analysis provided not only insights into the enzyme-inhibitor interaction within the binding site of the human MAO-B isoform, but also a valuable information regarding the most stable 1H-indazole tautomeric form of NTZ-1006 that contributes to its high potency against hMAO-B enzyme (IC50 0.586 nm) and selectivity (>17000-fold) over the hMAO-A isoenzyme.
Sriwijitkamol, Apiradee; Christ-Roberts, Christine; Berria, Rachele; Eagan, Phyllis; Pratipanawatr, Thongchai; DeFronzo, Ralph A; Mandarino, Lawrence J; Musi, Nicolas
2006-03-01
Skeletal muscle insulin resistance plays a key role in the pathogenesis of type 2 diabetes. It recently has been hypothesized that excessive activity of the inhibitor of kappaB (IkappaB)/nuclear factor kappaB (NFkappaB) inflammatory pathway is a mechanism underlying skeletal muscle insulin resistance. However, it is not known whether IkappaB/NFkappaB signaling in muscle from subjects with type 2 diabetes is abnormal. We studied IkappaB/NFkappaB signaling in vastus lateralis muscle from six subjects with type 2 diabetes and eight matched control subjects. Muscle from type 2 diabetic subjects was characterized by a 60% decrease in IkappaB beta protein abundance, an indicator of increased activation of the IkappaB/NFkappaB pathway. IkappaB beta abundance directly correlated with insulin-mediated glucose disposal (Rd) during a hyperinsulinemic (40 mU x m(-2) x min(-1))-euglycemic clamp (r = 0.63, P = 0.01), indicating that increased IkappaB/NFkappaB pathway activity is associated with muscle insulin resistance. We also investigated whether reversal of this abnormality could be a mechanism by which training improves insulin sensitivity. In control subjects, 8 weeks of aerobic exercise training caused a 50% increase in both IkappaB alpha and IkappaB beta protein. In subjects with type 2 diabetes, training increased IkappaB alpha and IkappaB beta protein to levels comparable with that of control subjects, and these increments were accompanied by a 40% decrease in tumor necrosis factor alpha muscle content and a 37% increase in insulin-stimulated glucose disposal. In summary, subjects with type 2 diabetes have reduced IkappaB protein abundance in muscle, suggesting excessive activity of the IkappaB/NFkappaB pathway. Moreover, this abnormality is reversed by exercise training.
International Nuclear Information System (INIS)
Gomez, Daniel E.; Armando, Romina G.; Alonso, Daniel F.
2012-01-01
Telomerase is a highly specialized reverse transcriptase (RT) and the maintenance of telomeric length is determined by this specific enzyme. The human holoenzyme telomerase is a ribonucleoprotein composed by a catalytic subunit, hTERT, an RNA component, hTR, and a group of associated proteins. Telomerase is normally expressed in embryonic cells and is repressed during adulthood. The enzyme is reexpressed in around 85% of solid tumors. This observation makes it a potential target for developing drugs that could be developed for therapeutic purposes. The identification of the hTERT as a functional catalytic RT prompted studies of inhibiting telomerase with the HIV RT inhibitor azidothymidine (AZT). Previously, we have demonstrated that AZT binds preferentially to telomeres, inhibits telomerase and enhances tumor cell senescence, and apoptosis after AZT treatment in breast mammary adenocarcinoma cells. Since then, several studies have considered AZT for telomerase inhibition and have led to potential clinical strategies for anticancer therapy. This review covers present thinking of the inhibition of telomerase by AZT and future treatment protocols using the drug.
Rotili, Dante; Samuele, Alberta; Tarantino, Domenico; Ragno, Rino; Musmuca, Ira; Ballante, Flavio; Botta, Giorgia; Morera, Ludovica; Pierini, Marco; Cirilli, Roberto; Nawrozkij, Maxim B; Gonzalez, Emmanuel; Clotet, Bonaventura; Artico, Marino; Esté, José A; Maga, Giovanni; Mai, Antonello
2012-04-12
The single enantiomers of two pyrimidine-based HIV-1 non-nucleoside reverse transcriptase inhibitors, 1 (MC1501) and 2 (MC2082), were tested in both cellular and enzyme assays. In general, the R forms were more potent than their S counterparts and racemates and (R)-2 was more efficient than (R)-1 and the reference compounds, with some exceptions. Interestingly, (R)-2 displayed a faster binding to K103N RT with respect to WT RT, while (R)-1 showed the opposite behavior. © 2012 American Chemical Society
Energy Technology Data Exchange (ETDEWEB)
Fang, Evandro Fei; Wong, Jack Ho [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Bah, Clara Shui Fern [Department of Food Science, Division of Sciences, University of Otago (New Zealand); Lin, Peng [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Tsao, Sai Wah [Department of Anatomy, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Sassoon Road, Pokfulam, Hong Kong SAR (China); Ng, Tzi Bun, E-mail: b021770@mailserv.cuhk.edu.hk [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China)
2010-06-11
Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K{sub i}, 0.1 x 10{sup -9} M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.
Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun
2010-06-11
Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K(i), 0.1 x 10(-9)M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI. (c) 2010 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun
2010-01-01
Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K i , 0.1 x 10 -9 M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.
PRACTICE OF USING VIRAL PROTEASE INHIBITORS IN CHILDREN WITH HIV INFECTION
Directory of Open Access Journals (Sweden)
V.B. Denisenko
2010-01-01
Full Text Available Selection of the most effective and safest high-active antiretroviral therapies is a critical issue faced by modern HIV medicine. Authors studied 28 children with HIV infection aged from 3 to 7 divided into two groups administered a combination of two HIV reverse transcriptase nucleoside inhibitors with viral protease nelfinavir inhibitors (n = 13 and lopinavir/ritonavir (n = 15. The subjects in both groups demonstrated a decreased frequency of HIV-associated symptoms and opportunistic infections, positive dynamics of immunological indicators, suppression of HIV replication. When lopinavir/ritonavir was administered, there was more even better dynamics in clinical, immunological and virologic parameters, which allows this medication to be recommended as a antiretroviral therapy for children. Key words: HIV infection, lopinavir/ritonavir, nelfinavir, children. (Pediatric Pharmacology. – 2010; 7(1:62-67
Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R.; Yudin, Mark H.; Murphy, Kellie E.; Walmsley, Sharon L.; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena
2015-01-01
Background. Protease inhibitor (PI)–based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. Methods. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. Results. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Conclusions. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. PMID:25030058
Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R; Yudin, Mark H; Murphy, Kellie E; Walmsley, Sharon L; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena
2015-01-01
Protease inhibitor (PI)-based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.
Masuda, Yosuke; Yamaotsu, Noriyuki; Hirono, Shuichi
2017-01-01
In order to predict the potencies of mechanism-based reversible covalent inhibitors, the relationships between calculated Gibbs free energy of hydrolytic water molecule in acyl-trypsin intermediates and experimentally measured catalytic rate constants (k cat ) were investigated. After obtaining representative solution structures by molecular dynamics (MD) simulations, hydration thermodynamics analyses using WaterMap™ were conducted. Consequently, we found for the first time that when Gibbs free energy of the hydrolytic water molecule was lower, logarithms of k cat were also lower. The hydrolytic water molecule with favorable Gibbs free energy may hydrolyze acylated serine slowly. Gibbs free energy of hydrolytic water molecule might be a useful descriptor for computer-aided discovery of mechanism-based reversible covalent inhibitors of hydrolytic enzymes.
Wang, Yinhu; Mowla, Rumana; Guo, Liwei; Ogunniyi, Abiodun D; Rahman, Taufiq; De Barros Lopes, Miguel A; Ma, Shutao; Venter, Henrietta
2017-02-15
Drug efflux pumps confer multidrug resistance to dangerous pathogens which makes these pumps important drug targets. We have synthesised a novel series of compounds based on a 2-naphthamide pharmacore aimed at inhibiting the efflux pumps from Gram-negative bacteria. The archeatypical transporter AcrB from Escherichia coli was used as model efflux pump as AcrB is widely conserved throughout Gram-negative organisms. The compounds were tested for their antibacterial action, ability to potentiate the action of antibiotics and for their ability to inhibit Nile Red efflux by AcrB. None of the compounds were antimicrobial against E. coli wild type cells. Most of the compounds were able to inhibit Nile Red efflux indicating that they are substrates of the AcrB efflux pump. Three compounds were able to synergise with antibiotics and reverse resistance in the resistant phenotype. Compound A3, 4-(isopentyloxy)-2-naphthamide, reduced the MICs of erythromycin and chloramphenicol to the MIC levels of the drug sensitive strain that lacks an efflux pump. A3 had no effect on the MIC of the non-substrate rifampicin indicating that this compound acts specifically through the AcrB efflux pump. A3 also does not act through non-specific mechanisms such as outer membrane or inner membrane permeabilisation and is not cytotoxic against mammalian cell lines. Therefore, we have designed and synthesised a novel chemical compound with great potential to further optimisation as inhibitor of drug efflux pumps. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Dahl OE
2012-01-01
Full Text Available Ola E Dahl1,21Department of Orthopaedics, Innlandet Hospital Trust, Elverum Central Hospital, Elverum, Norway; 2Thrombosis Research Institute, London, UKAbstract: Venous thromboembolism, presenting as deep vein thrombosis or pulmonary embolism, is a major challenge for health care systems. It is the third most common vascular disease after coronary heart disease and stroke, and many hospitalized patients have at least one risk factor. In particular, patients undergoing hip or knee replacement are at risk, with an incidence of asymptomatic deep vein thrombosis of 40%–60% without thromboprophylaxis. Venous thromboembolism is associated with significant mortality and morbidity, with patients being at risk of recurrence, post-thrombotic syndrome, and chronic thromboembolic pulmonary hypertension. Arterial thromboembolism is even more frequent, and atrial fibrillation, the most common embolic source (cardiac arrhythmia, is associated with a five-fold increase in the risk of stroke. Strokes due to atrial fibrillation tend to be more severe and disabling and are more often fatal than strokes due to other causes. Currently, recommended management of both venous and arterial thromboembolism involves the use of anticoagulants such as coumarin and heparin derivatives. These agents are effective, although have characteristics that prevent them from providing optimal anticoagulation and convenience. Hence, new improved oral anticoagulants are being investigated. Dabigatran is a reversible, direct thrombin inhibitor, which is administered as dabigatran etexilate, the oral prodrug. Because it is the first new oral anticoagulant that has been licensed in many countries worldwide for thromboprophylaxis following orthopedic surgery and for stroke prevention in patients with atrial fibrillation, this compound will be the main focus of this review. Dabigatran has been investigated for the treatment of established venous thromboembolism and prevention of
DEFF Research Database (Denmark)
Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L
2012-01-01
We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....
Mladenović, Milan; Patsilinakos, Alexandros; Pirolli, Adele; Sabatino, Manuela; Ragno, Rino
2017-04-24
Monoamine oxidase B (MAO B) catalyzes the oxidative deamination of aryalkylamines neurotransmitters with concomitant reduction of oxygen to hydrogen peroxide. Consequently, the enzyme's malfunction can induce oxidative damage to mitochondrial DNA and mediates development of Parkinson's disease. Thus, MAO B emerges as a promising target for developing pharmaceuticals potentially useful to treat this vicious neurodegenerative condition. Aiming to contribute to the development of drugs with the reversible mechanism of MAO B inhibition only, herein, an extended in silico-in vitro procedure for the selection of novel MAO B inhibitors is demonstrated, including the following: (1) definition of optimized and validated structure-based three-dimensional (3-D) quantitative structure-activity relationships (QSAR) models derived from available cocrystallized inhibitor-MAO B complexes; (2) elaboration of SAR features for either irreversible or reversible MAO B inhibitors to characterize and improve coumarin-based inhibitor activity (Protein Data Bank ID: 2V61 ) as the most potent reversible lead compound; (3) definition of structure-based (SB) and ligand-based (LB) alignment rule assessments by which virtually any untested potential MAO B inhibitor might be evaluated; (4) predictive ability validation of the best 3-D QSAR model through SB/LB modeling of four coumarin-based external test sets (267 compounds); (5) design and SB/LB alignment of novel coumarin-based scaffolds experimentally validated through synthesis and biological evaluation in vitro. Due to the wide range of molecular diversity within the 3-D QSAR training set and derived features, the selected N probe-derived 3-D QSAR model proves to be a valuable tool for virtual screening (VS) of novel MAO B inhibitors and a platform for design, synthesis and evaluation of novel active structures. Accordingly, six highly active and selective MAO B inhibitors (picomolar to low nanomolar range of activity) were disclosed as a
Brustovetsky, Tatiana; Brittain, Matthew K; Sheets, Patrick L; Cummins, Theodore R; Pinelis, Vsevolod; Brustovetsky, Nickolay
2011-01-01
BACKGROUND AND PURPOSE An isothiourea derivative (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea methane sulfonate (KB-R7943), a widely used inhibitor of the reverse Na+/Ca2+ exchanger (NCXrev), was instrumental in establishing the role of NCXrev in glutamate-induced Ca2+ deregulation in neurons. Here, the effects of KB-R7943 on N-methyl-D-aspartate (NMDA) receptors and mitochondrial complex I were tested. EXPERIMENTAL APPROACH Fluorescence microscopy, electrophysiological patch-clamp techniques and cellular respirometry with Seahorse XF24 analyzer were used with cultured hippocampal neurons; membrane potential imaging, respirometry and Ca2+ flux measurements were made in isolated rat brain mitochondria. KEY RESULTS KB-R7943 inhibited NCXrev with IC50= 5.7 ± 2.1 µM, blocked NMDAR-mediated ion currents, and inhibited NMDA-induced increase in cytosolic Ca2+ with IC50= 13.4 ± 3.6 µM but accelerated calcium deregulation and mitochondrial depolarization in glutamate-treated neurons. KB-R7943 depolarized mitochondria in a Ca2+-independent manner. Stimulation of NMDA receptors caused NAD(P)H oxidation that was coupled or uncoupled from ATP synthesis depending on the presence of Ca2+ in the bath solution. KB-R7943, or rotenone, increased NAD(P)H autofluorescence under resting conditions and suppressed NAD(P)H oxidation following glutamate application. KB-R7943 inhibited 2,4-dinitrophenol-stimulated respiration of cultured neurons with IC50= 11.4 ± 2.4 µM. With isolated brain mitochondria, KB-R7943 inhibited respiration, depolarized organelles and suppressed Ca2+ uptake when mitochondria oxidized complex I substrates but was ineffective when mitochondria were supplied with succinate, a complex II substrate. CONCLUSIONS AND IMPLICATIONS KB-R7943, in addition to NCXrev, blocked NMDA receptors in cultured hippocampal neurons and inhibited complex I in the mitochondrial respiratory chain. These findings are critical for the correct interpretation of experimental
Song, Xiaoyun; Liu, Xingcai; Ding, Xi
2017-04-01
The human epidermal growth factor receptor (EGFR) has been established as an attractive target for lung cancer therapy. However, an acquired EGFR T790M gatekeeper mutation is frequently observed in patients treated with first-line anticancer agents such as gefitinib and erlotinib to cause drug resistance, largely limiting the application of small-molecule kinase inhibitors in EGFR-targeted chemotherapy. Previously, the reversible pan-kinase inhibitor staurosporine and its several analogs such as Gö6976 and K252a have been reported to selectively inhibit the EGFR T790M mutant (EGFR T790M ) over wild-type kinase (EGFR WT ), suggesting that the staurosporine scaffold is potentially to develop the wild-type sparing reversible inhibitors of EGFR T790M . Here, we systematically evaluated the inhibitor response of 28 staurosporine scaffold-based compounds to EGFR T790M mutation at structural, energetic, and molecular levels by using an integrated in silico-in vitro analog-sensitive (AS) kinase technology. With the strategy, we were able to identify 4 novel wild-type sparing inhibitors UCN-01, UCN-02, AFN941, and SB-218078 with high or moderate selectivity of 30-, 45-, 5-, and 8-fold for EGFR T790M over EGFR WT , respectively, which are comparable with or even better than that of the parent compound staurosporine (24-fold). Molecular modeling and structural analysis revealed that van der Waals contacts and hydrophobic forces can form between the side chain of mutated residue Met790 and the pyrrolidinone moiety of inhibitor ligand UCN-02, which may simultaneously improve the favorable interaction energy between the kinase and inhibitor, and reduce the unfavorable desolvation penalty upon the kinase-inhibitor binding. A hydroxyl group of UCN-02 additional to staurosporine locates at the pyrrolidinone moiety, which can largely alter the electronic distribution of pyrrolidinone moiety and thus promote the intermolecular interaction with Met790 residue. This can well explain
Reverse Zymography: Overview and Pitfalls.
Sharma, Kanika; Bhattacharyya, Debasish
2017-01-01
Reverse zymography is a technique by which protease inhibitor(s) in a sample could be electrophoretically separated in a substrate-impregnated acrylamide gel and their relative abundance could be semi-quantified. The gel after electrophoresis is incubated with a protease when the impregnated substrate and all other proteins of the sample are degraded into small peptides except the inhibitor(s) that show clear bands against a white background. Since reverse zymography cannot distinguish between a protease inhibitor and a protein that is resistant against proteolysis, the results should be confirmed from inhibition of protease activity by solution state assay.
Postexposure protection of macaques from vaginal SHIV infection by topical integrase inhibitors.
Dobard, Charles; Sharma, Sunita; Parikh, Urvi M; West, Rolieria; Taylor, Andrew; Martin, Amy; Pau, Chou-Pong; Hanson, Debra L; Lipscomb, Jonathan; Smith, James; Novembre, Francis; Hazuda, Daria; Garcia-Lerma, J Gerardo; Heneine, Walid
2014-03-12
Coitally delivered microbicide gels containing antiretroviral drugs are important for HIV prevention. However, to date, microbicides have contained entry or reverse transcriptase inhibitors that block early steps in virus infection and thus need to be given as a preexposure dose that interferes with sexual practices and may limit compliance. Integrase inhibitors block late steps after virus infection and therefore are more suitable for post-coital dosing. We first determined the kinetics of strand transfer in vitro and confirmed that integration begins about 6 hours after infection. We then used a repeat-challenge macaque model to assess efficacy of vaginal gels containing integrase strand transfer inhibitors when applied before or after simian/human immunodeficiency virus (SHIV) challenge. We showed that gel containing the strand transfer inhibitor L-870812 protected two of three macaques when applied 30 min before SHIV challenge. We next evaluated the efficacy of 1% raltegravir gel and demonstrated its ability to protect macaques when applied 3 hours after SHIV exposure (five of six protected; P infections showed no evidence of drug resistance in plasma or vaginal secretions despite continued gel dosing after infection. We documented rapid vaginal absorption reflecting a short pharmacological lag time and noted that vaginal, but not plasma, virus load was substantially reduced in the breakthrough infection after raltegravir gel treatment. We provide a proof of concept that topically applied integrase inhibitors protect against vaginal SHIV infection when administered shortly before or 3 hours after virus exposure.
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
Selective serotonin reuptake inhibitor suppression of HIV infectivity and replication.
Benton, Tami; Lynch, Kevin; Dubé, Benoit; Gettes, David R; Tustin, Nancy B; Ping Lai, Jian; Metzger, David S; Blume, Joshua; Douglas, Steven D; Evans, Dwight L
2010-11-01
To test the hypothesis that the selective serotonin reuptake inhibitor (SSRI) citalopram would down-regulate human immunodeficiency virus (HIV) infectivity and that the greatest effects would be seen in people with depression. Depression is a risk factor for morbidity and mortality in HIV/acquired immune deficiency syndrome. Serotonin (5-HT) neurotransmission has been implicated in the pathobiology of depression, and pharmacologic therapies for depression target this system. The 5-HT transporter and 5-HT receptors are widely distributed throughout the central nervous and immune systems. Depression has been associated with suppression of natural killer cells and CD8(+) lymphocytes, key regulators of HIV infection. Ex vivo models for acute and chronic HIV infection were used to study the effects of citalopram on HIV viral infection and replication in 48 depressed and nondepressed women. For both the acute and chronic infection models, HIV reverse transcriptase activity was measured in the citalopram treatment condition and the control condition. The SSRI significantly down-regulated the reverse transcriptase response in both the acute and chronic infection models. Specifically, citalopram significantly decreased the acute HIV infectivity of macrophages. Citalopram also significantly decreased HIV viral replication in the latently infected T-cell line and in the latently infected macrophage cell line. There was no difference in down-regulation by depression status. These studies suggest that an SSRI enhances natural killer/CD8 noncytolytic HIV suppression in HIV/acquired immune deficiency syndrome and decreases HIV viral infectivity of macrophages, ex vivo, suggesting the need for in vivo studies to determine a potential role for agents targeting serotonin in the host defense against HIV.
Molenaar, Remco J; Radivoyevitch, Tomas; Nagata, Yasunobu; Khurshed, Mohammed; Przychodzen, Bartolomiej; Makishima, Hideki; Xu, Mingjiang; Bleeker, Fonnet E; Wilmink, Johanna W; Carraway, Hetty E; Mukherjee, Sudipto; Sekeres, Mikkael A; van Noorden, Cornelis J F; Maciejewski, Jaroslaw P
2018-04-01
Purpose: Somatic mutations in IDH1/2 occur in approximately 20% of patients with myeloid neoplasms, including acute myeloid leukemia (AML). IDH1/2 MUT enzymes produce D -2-hydroxyglutarate ( D 2HG), which associates with increased DNA damage and improved responses to chemo/radiotherapy and PARP inhibitors in solid tumor cells. Whether this also holds true for IDH1/2 MUT AML is not known. Experimental Design: Well-characterized primary IDH1 MUT , IDH2 MUT , and IDH1/2 WT AML cells were analyzed for DNA damage and responses to daunorubicin, ionizing radiation, and PARP inhibitors. Results: IDH1/2 MUT caused increased DNA damage and sensitization to daunorubicin, irradiation, and the PARP inhibitors olaparib and talazoparib in AML cells. IDH1/2 MUT inhibitors protected against these treatments. Combined treatment with a PARP inhibitor and daunorubicin had an additive effect on the killing of IDH1/2 MUT AML cells. We provide evidence that the therapy sensitivity of IDH1/2 MUT cells was caused by D 2HG-mediated downregulation of expression of the DNA damage response gene ATM and not by altered redox responses due to metabolic alterations in IDH1/2 MUT cells. Conclusions: IDH1/2 MUT AML cells are sensitive to PARP inhibitors as monotherapy but especially when combined with a DNA-damaging agent, such as daunorubicin, whereas concomitant administration of IDH1/2 MUT inhibitors during cytotoxic therapy decrease the efficacy of both agents in IDH1/2 MUT AML. These results advocate in favor of clinical trials of PARP inhibitors either or not in combination with daunorubicin in IDH1/2 MUT AML. Clin Cancer Res; 24(7); 1705-15. ©2018 AACR . ©2018 American Association for Cancer Research.
Masuda, Yosuke; Yoshida, Tomoki; Yamaotsu, Noriyuki; Hirono, Shuichi
2018-01-01
We recently reported that the Gibbs free energy of hydrolytic water molecules (ΔG wat ) in acyl-trypsin intermediates calculated by hydration thermodynamics analysis could be a useful metric for estimating the catalytic rate constants (k cat ) of mechanism-based reversible covalent inhibitors. For thorough evaluation, the proposed method was tested with an increased number of covalent ligands that have no corresponding crystal structures. After modeling acyl-trypsin intermediate structures using flexible molecular superposition, ΔG wat values were calculated according to the proposed method. The orbital energies of antibonding π* molecular orbitals (MOs) of carbonyl C=O in covalently modified catalytic serine (E orb ) were also calculated by semi-empirical MO calculations. Then, linear discriminant analysis (LDA) was performed to build a model that can discriminate covalent inhibitor candidates from substrate-like ligands using ΔG wat and E orb . The model was built using a training set (10 compounds) and then validated by a test set (4 compounds). As a result, the training set and test set ligands were perfectly discriminated by the model. Hydrolysis was slower when (1) the hydrolytic water molecule has lower ΔG wat ; (2) the covalent ligand presents higher E orb (higher reaction barrier). Results also showed that the entropic term of hydrolytic water molecule (-TΔS wat ) could be used for estimating k cat and for covalent inhibitor optimization; when the rotational freedom of the hydrolytic water molecule is limited, the chance for favorable interaction with the electrophilic acyl group would also be limited. The method proposed in this study would be useful for screening and optimizing the mechanism-based reversible covalent inhibitors.
Min, Danqing; Lyons, James Guy; Jia, Junhong; Lo, Lisa; McLennan, Susan V
2006-02-01
Measurement of matrix metalloproteinases (MMPs) and their specific tissue inhibitors of metalloproteinases (TIMPs) by the techniques of zymography and reverse zymography provide useful information regarding the status of matrix accumulation or breakdown. This report describes the use of 2-methoxy-2,4-diphenyl-3(2H)-furanone (MDPF), a fluorescent compound which can be used to label gelatin as a substrate for detection of the gelatin degrading MMP-2 and -9 by zymography. In addition, a modification of the zymographic technique by addition of excess MMPs enables the use of the MDPF-labeled gelatin substrate for the identification and quantification of TIMPs by reverse zymography. Both systems are real-time sensitive reliable quantification techniques, easily used for measurement of these MMPs and TIMPs in clinical, biological, and tissue culture samples.
International Nuclear Information System (INIS)
Pugach, Pavel; Ketas, Thomas J.; Michael, Elizabeth; Moore, John P.
2008-01-01
The small molecule CCR5 inhibitors are a new class of drugs for treating infection by human immunodeficiency virus type 1 (HIV-1). They act by binding to the CCR5 co-receptor and preventing its use during HIV-1-cell fusion. Escape mutants can be raised against CCR5 inhibitors in vitro and will arise when these drugs are used clinically. Here, we have assessed the responses of CCR5 inhibitor-resistant viruses to other anti-retroviral drugs that act by different mechanisms, and their sensitivities to neutralizing antibodies (NAbs). The rationale for the latter study is that the resistance pathway for CCR5 inhibitors involves changes in the HIV-1 envelope glycoproteins (Env), which are also targets for NAbs. The escape mutants CC101.19 and D1/85.16 were selected for resistance to AD101 and vicriviroc (VVC), respectively, from the primary R5 HIV-1 isolate CC1/85. Each escape mutant was cross-resistant to other small molecule CCR5 inhibitors (aplaviroc, maraviroc, VVC, AD101 and CMPD 167), but sensitive to protein ligands of CCR5: the modified chemokine PSC-RANTES and the humanized MAb PRO-140. The resistant viruses also retained wild-type sensitivity to the nucleoside reverse transcriptase inhibitor (RTI) zidovudine, the non-nucleoside RTI nevirapine, the protease inhibitor atazanavir and other attachment and fusion inhibitors that act independently of CCR5 (BMS-806, PRO-542 and enfuvirtide). Of note is that the escape mutants were more sensitive than the parental CC1/85 isolate to a subset of neutralizing monoclonal antibodies and to some sera from HIV-1-infected people, implying that sequence changes in Env that confer resistance to CCR5 inhibitors can increase the accessibility of some NAb epitopes. The need to preserve NAb resistance may therefore be a constraint upon how escape from CCR5 inhibitors occurs in vivo
Hegedüs, Csilla; Truta-Feles, Krisztina; Antalffy, Géza; Várady, György; Német, Katalin; Ozvegy-Laczka, Csilla; Kéri, György; Orfi, László; Szakács, Gergely; Settleman, Jeffrey; Váradi, András; Sarkadi, Balázs
2012-08-01
Human ABCG2 is a plasma membrane glycoprotein that provides physiological protection against xenobiotics. ABCG2 also significantly influences biodistribution of drugs through pharmacological tissue barriers and confers multidrug resistance to cancer cells. Moreover, ABCG2 is the molecular determinant of the side population that is characteristically enriched in normal and cancer stem cells. Numerous tumors depend on unregulated EGFR signaling, thus inhibition of this receptor by small molecular weight inhibitors such as gefitinib, and the novel second generation agents vandetanib, pelitinib and neratinib, is a promising therapeutic option. In the present study, we provide detailed biochemical characterization regarding the interaction of these EGFR inhibitors with ABCG2. We show that ABCG2 confers resistance to gefitinib and pelitinib, whereas the intracellular action of vandetanib and neratinib is unaltered by the presence of the transporter. At higher concentrations, however, all these EGFR inhibitors inhibit ABCG2 function, thereby promoting accumulation of ABCG2 substrate drugs. We also report enhanced expression of ABCG2 in gefitinib-resistant non-small cell lung cancer cells, suggesting potential clinical relevance of ABCG2 in acquired drug resistance. Since ABCG2 has important impact on both the pharmacological properties and anti-cancer efficiencies of drugs, our results regarding the novel EGFR inhibitors should provide useful information about their therapeutic applicability against ABCG2-expressing cancer cells depending on EGFR signaling. In addition, the finding that these EGFR inhibitors efficiently block ABCG2 function may help to design novel drug-combination therapeutic strategies. Copyright © 2012 Elsevier Inc. All rights reserved.
Soares, Abel Esteves; Maes, Michael; Godeny, Paula; Matsumoto, Andressa Keiko; Barbosa, Décio Sabbatini; da Silva, Taysa Antonia F; Souza, Flávio Henrique M O; Delfino, Vinicius Daher Alvares
2017-12-15
Vitamin D has anti-inflammatory, anti-fibrotic effect, and may block the intrarenal renin-angiotensin system. Adequate vitamin D levels in conjunction with the use of Angiotensin-converting Enzyme Inhibitors/Angiotensin Receptor Blockers may help to slow down chronic kidney disease progression. To study a possible beneficial effect of vitamin D supplementation in chronic kidney disease patients using angiotensin-converting enzyme inhibitors/angiotensin receptor blockers on chronic kidney disease progression we performed a clinical study involving vitamin D supplementation in patients with deficiency of this vitamin. This study was conducted in two chronic kidney disease clinics in the city of Londrina, Brazil, from October 2010 to December 2012. It was involved stage 3 and 4 chronic kidney disease (estimated glomerular filtration rate between 60 and 15mL/min/1.73m 2 ) patients with and without vitamin D deficiency. The patients ingested six-month cholecalciferol 50,000IU oral supplementation to chronic kidney disease patients with vitamin D deficiency. We hypothesize changes in estimated glomerular filtration rate over study period. Our data demonstrate reservation of estimated glomerular filtration with cholecalciferol supplementation to chronic kidney disease patients taking angiotensin-converting enzyme inhibitors/angiotensin receptor blockers. The combination treatment of angiotensin converting enzyme inhibitors/angiotensin receptor blockers with cholecalciferol prevents the decline in estimated glomerular filtration in patients with chronic kidney disease following treatment with angiotensin-converting enzyme inhibitors/angiotensin receptor blockers and may represent a valid approach to reduce renal disease progression in chronic kidney disease patients with vitamin D deficiency. This result needs confirmation in prospective controlled clinical trials. Copyright © 2017. Published by Elsevier Inc.
Nishiura, T; Abe, K
1999-01-01
The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.
Directory of Open Access Journals (Sweden)
Gilberto Simeone Henriques
2005-12-01
, primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of testis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1 initial cDNA concentration of 2 µg, (2 primer concentration of 200nM, (3 hybridization temperature between 57.5ºC and 60.1ºC and (4 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.
Directory of Open Access Journals (Sweden)
Petrova Anna
2007-07-01
Full Text Available Abstract Background Although the introduction of combined therapy with reverse transcriptase and protease inhibitors has resulted in considerable decrease in HIV related mortality; it has also induced the development of multiple drug-resistant HIV-1 variants. The few studies on HIV-1 mutagenesis in HIV infected children have not evaluated the impact of HIV-1 mutations on the clinical, virological and immunological presentation of HIV disease that is fundamental to optimizing the treatment regimens for these patients. Results A cross sectional study was conducted to evaluate the impact of treatment regimens and resistance mutation patterns on the clinical, virological, and immunological presentation of HIV disease in 41 children (25 male and 16 female at the Robert Wood Johnson Pediatric AIDS Program in New Brunswick, New Jersey. The study participants were symptomatic and had preceding treatment history with combined ARV regimens including protease inhibitors (PIs, nucleoside reverse transcriptase inhibitors (NRTIs and non-nucleoside reverse transcriptase inhibitors (NNRTIs. Fifteen (36.6% children were treated with NRTI+NNRTI+ PI, 6 (14.6% with NRTI+NNRTIs, 13 (31.7% with NRTI+PIs, and the remaining 7 (17.1% received NRTIs only. Combined ARV regimens did not significantly influence the incidence of NRTI and NNRTI associated mutations. The duration of ARV therapy and the child's age had no significant impact on the ARV related mutations. The clinico-immunological presentation of the HIV disease was not associated with ARV treatment regimens or number of resistance mutations. However, primary mutations in the protease (PR gene increased the likelihood of plasma viral load (PVL ≥ 10,000 copies/mL irrespective of the child's age, duration of ARV therapy, presence of NRTI and NNRTI mutation. Viremia ≥ 10,000 copies/mL was recorded in almost all the children with primary mutations in the PR region (n = 12/13, 92.3% as compared with only 50.0% (n
Neudorfer, Catharina; Shanab, Karem; Jurik, Andreas; Schreiber, Veronika; Neudorfer, Carolina; Vraka, Chrysoula; Schirmer, Eva; Holzer, Wolfgang; Ecker, Gerhard; Mitterhauser, Markus; Wadsak, Wolfgang; Spreitzer, Helmut
2014-09-15
Since high MAO-B levels are present in early stages of AD, the MAO-B system can be designated as an appropriate and prospective tracer target of molecular imaging biomarkers for the detection of early AD. According to the preceding investigations of Mishra et al. the aim of this work was the development of a compound library of selective and reversible MAO-B inhibitors by performing bioisosteric modifications of the core structure of 3-(anthracen-9-yl)-5-phenyl-4,5-dihydro-1H-pyrazoles. In conclusion, 13 new pyrazoline based derivatives have been prepared, which will serve as precursor substances for future radiolabeling as well as reference compounds for the investigation of increased MAO-B levels in AD. Copyright © 2014 Elsevier Ltd. All rights reserved.
Reimann, I W; Jobert, M; Gleiter, C H; Turri, M; Bieck, P R; Herrmann, W M
1996-01-01
The comparison of two different modes of data processing and two different approaches to statistical testing both applied to the same set of EEG recordings was the main objective of this pharmacological study. Brofaromine (CGP 11,305 A), a new selective and reversible monoamine oxidase type A inhibitor was used as an example for investigating a potentially antidepressant drug in clinical development. The two modes of pharmaco-EEG (PEEG) data processing differed mainly in the sampling frequency and definition of spectral parameters. Patterns of significant changes were noted in terms of descriptive data analysis using either a nonparametric Wilcoxon signed-rank test or an ANOVA of transformed data, as suggested by Conover and Iman. These data clearly demonstrate that slight discrepancies in the results may simply arise from differences in data processing and statistical approach applied. In spite of these discrepancies, the pattern of brofaromine-induced PEEG changes was very similar regardless of the mode of data handling used.
Directory of Open Access Journals (Sweden)
Wenfeng Zhang
2017-08-01
Full Text Available Background/Aims: CyclinG1 (CycG1 is frequently overexpressed in solid tumors and overexpression of CycG1 promotes cell survival upon paclitaxel exposure by inducing polyploidy. Whether and how CycG1 regulates polyploidization caused by small molecular targeted inhibitors remains unclear. Methods: Immunohistochemistry and immunoblotting were utilized to examine protein expression. Cell proliferation was measured by ATPlite assay, and cell cycle distribution and apoptosis were measured by flow cytometry and/or DNA fragmentation assays. Results: Overexpression of CycG1 in breast cancer cells caused apoptosis-resistant polyploidy upon treatment with Aurora kinase inhibitor, ZM447439 (ZM. Addition of ABT-263, a small-molecule BH3 mimetic, to ZM, produced a synergistic loss of cell viability with greater sustained tumor growth inhibition in breast cancer cell lines. Decrease of Mcl-1 and increase of NOXA caused by ZM treatment, were responsible for the synergy. Furthermore, CycG1 was highly expressed in Triple-Negative-Breast-Cancer patients treated with paclitaxel and was paralleled by decreased cell survival. Conclusion: CycG1 is a crucial factor in ZM-induced polyploidy resistance, and ABT-263/ZM combination hold therapeutic utility in the CycG1-amplified subset of breast cancer and CycG1, thus, is a promising target in breast cancer.
Valvassori, Samira S; Resende, Wilson R; Budni, Josiane; Dal-Pont, Gustavo C; Bavaresco, Daniela V; Réus, Gislaine Z; Carvalho, André F; Gonçalves, Cinara L; Furlanetto, Camila B; Streck, Emilio L; Quevedo, João
2015-01-01
The aim of the present study was to evaluate the effects of sodium butyrate on depressive-like behavior and mitochondrial alteration parameters in animal models of depression induced by maternal deprivation or chronic mild stress in Wistar rats. maternal deprivation was established by separating pups from their mothers for 3 h daily from postnatal day 1 to day 10. Chronic mild stress was established by water deprivation, food deprivation, restraint stress, isolation and flashing lights. Sodium butyrate or saline was administered twice a day for 7 days before the behavioral tests. Depressive behavior was evaluated using the forced swim test. The activity of tricarboxylic acid cycle enzymes (succinate dehydrogenase and malate dehydrogenase) and of mitochondrial chain complexes (I, II, II-III and IV) was measured in the striatum of rats. From these analyses it can be observed that sodium butyrate reversed the depressive-like behavior observed in both animal models of depression. Additionally, maternal deprivation and chronic mild stress inhibited mitochondrial respiratory chain complexes and increased the activity of tricarboxylic acid cycle enzymes. Sodium butyrate treatment reversed -maternal deprivation and chronic mild stress- induced dysfunction in the striatum of rats. In conclusion, sodium butyrate showed antidepressant effects in maternal deprivation and chronic mild stress-treated rats, and this effect can be attributed to its action on the neurochemical pathways related to depression.
Directory of Open Access Journals (Sweden)
Jayanthi Palani
2011-01-01
Conclusion: There was increased expression of hTERT protein in OSCC and leukoplakia samples when compared to normal oral mucosa. The cellular localization, LI and LS in OSF were significantly different from OSCC and leukoplakia.
Mechanism of polypurine tract primer generation by HIV-1 reverse transcriptase
Czech Academy of Sciences Publication Activity Database
Figiel, M.; Krepl, Miroslav; Park, S.; Poznanski, J.; Skowronek, K.; Golab, A.; Ha, T.; Šponer, Jiří; Nowotny, M.
2018-01-01
Roč. 293, č. 1 (2018), s. 191-202 ISSN 0021-9258 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68081707 Keywords : human-immunodeficiency-virus * strand dna -synthesis * retroviral rnases-h * rna/ dna hybrid Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.125, year: 2016
Coordination between the polymerase and RNase H activity of HIV-1 reverse transcriptase
Czech Academy of Sciences Publication Activity Database
Figiel, M.; Krepl, Miroslav; Poznanski, J.; Gotab, A.; Šponer, Jiří; Nowotny, M.
2017-01-01
Roč. 45, č. 6 (2017), s. 3341-3352 ISSN 0305-1048 R&D Projects: GA ČR GAP208/12/1878 Grant - others:GA MŠk(CZ) LO1305 Institutional support: RVO:68081707 Keywords : human-immunodeficiency-virus * rna/dna hybrid * force-field Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016
Tissue-specific expression of telomerase reverse transcriptase gene variants in Nicotiana tabacum
Czech Academy of Sciences Publication Activity Database
Jurečková, J.; Sýkorová, Eva; Hafidh, Said; Honys, David; Fajkus, Jiří; Fojtová, M.
2017-01-01
Roč. 245, č. 3 (2017), s. 549-561 ISSN 0032-0935 R&D Projects: GA ČR GA13-06943S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 ; RVO:61389030 Keywords : male gametophyte development * tobacco male gametophyte * allotetraploid nicotiana Subject RIV: EF - Botanics; EF - Botanics (UEB-Q) OBOR OECD: Plant sciences, botany; Plant sciences, botany (UEB-Q) Impact factor: 3.361, year: 2016
A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.
Directory of Open Access Journals (Sweden)
Sandra J Laney
2008-06-01
Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.
Di Santo, Roberto; Costi, Roberta; Roux, Alessandra; Artico, Marino; Lavecchia, Antonio; Marinelli, Luciana; Novellino, Ettore; Palmisano, Lucia; Andreotti, Mauro; Amici, Roberta; Galluzzo, Clementina Maria; Nencioni, Lucia; Palamara, Anna Teresa; Pommier, Yves; Marchand, Christophe
2008-01-01
The virally encoded integrase protein is an essential enzyme in the life cycle of the HIV-1 virus and represents an attractive and validated target in the development of therapeutics against HIV infection. Drugs that selectively inhibit this enzyme, when used in combination with inhibitors of reverse transcriptase and protease, are believed to be highly effective in suppressing the viral replication. Among the HIV-1 integrase inhibitors, the β-diketo acids (DKAs) represent a major lead for anti-HIV-1drug development. In this study, novel bifunctional quinolonyl diketo acid derivatives were designed, synthesized and tested for their inhibitory ability against HIV-1 integrase. The compounds are potent inhibitors of integrase activity. Particularly, derivative 8 is a potent IN inhibitor for both steps of the reaction (3′-processing and strand transfer) and exhibits both high antiviral activity against HIV-1 infected cells and low cytotoxicity. Molecular modeling studies provide a plausible mechanism of action, which is consistent with ligand SARs and enzyme photo-crosslinking experiments. PMID:16539381
Leung, K. C.
1989-01-01
Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.
Weinhold, Kent J; Bukowski, Jack F; Brennan, Todd V; Noveck, Robert J; Staats, Janet S; Lin, Liwen; Stempora, Linda; Hammond, Constance; Wouters, Ann; Mojcik, Christopher F; Cheng, John; Collinge, Mark; Jesson, Michael I; Hazra, Anasuya; Biswas, Pinaki; Lan, Shuping; Clark, James D; Hodge, Jennifer A
2018-06-01
This study evaluated the short-term effects of tofacitinib treatment on peripheral blood leukocyte phenotype and function, and the reversibility of any such effects following treatment withdrawal in healthy volunteers. Cytomegalovirus (CMV)-seropositive subjects received oral tofacitinib 10 mg twice daily for 4 weeks and were followed for 4 weeks after drug withdrawal. There were slight increases in total lymphocyte and total T-cell counts during tofacitinib treatment, and B-cell counts increased by up to 26%. There were no significant changes in granulocyte or monocyte counts, or granulocyte function. Naïve and central memory T-cell counts increased during treatment, while all subsets of activated T cells were decreased by up to 69%. T-cell subsets other than effector memory cluster of differentiation (CD)4+, activated naïve CD4+ and effector CD8+ T-cell counts and B-cell counts, normalized 4 weeks after withdrawal. Following ex vivo activation, measures of CMV-specific T-cell responses, and antigen non-specific T-cell-mediated cytotoxicity and interferon (IFN)-γ production, decreased slightly. These T-cell functional changes were most pronounced at Day 15, partially normalized while still on tofacitinib and returned to baseline after drug withdrawal. Total natural killer (NK)-cell counts decreased by 33%, returning towards baseline after drug withdrawal. NK-cell function decreased during tofacitinib treatment, but without a consistent time course across measured parameters. However, markers of NK-cell-mediated cytotoxicity, antibody-dependent cellular cytotoxicity and IFN-γ production were decreased up to 42% 1 month after drug withdrawal. CMV DNA was not detectable in whole blood, and there were no cases of herpes zoster reactivation. No new safety concerns arose. In conclusion, the effect of short-term tofacitinib treatment on leukocyte composition and function in healthy CMV+ volunteers is modest and largely reversible 4 weeks after withdrawal
Kulikova, Olga
2016-01-01
This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...
Jacomasso, Thiago; Trombetta-Lima, Marina; Sogayar, Mari C; Winnischofer, Sheila M B
2014-02-01
The invasive phenotype of many tumors is associated with an imbalance between the matrix metalloproteinases (MMPs) and their inhibitors, tissue inhibitors of metalloproteinases (TIMPs), and the membrane-anchored reversion-inducing cysteine-rich protein with Kazal motifs (RECK). RECK inhibits MMP-2, MMP-9, and MT1-MMP, and has been linked to patient survival and better prognosis in several types of tumors. However, despite the wide implication of these MMPs in melanoma establishment and progression, the role of RECK in this type of tumor is still unknown. Here, we analyzed the expression of RECK, TIMP1, TIMP2, TIMP3, MT1MMP, MMP2, and MMP9 in two publicly available melanoma microarray datasets and in a panel of human melanoma cell lines. We found that RECK is downregulated in malignant melanoma, accompanied by upregulation of MT1MMP and TIMP2. In both datasets, we observed that the group of samples displaying higher RECK levels show lower median expression levels of MT1MMP and TIMP2 and higher levels of TIMP3. When tested in a sample-wise manner, these correlations were statistically significant. Inverse correlations between RECK, MT1MMP, and TIMP2 were verified in a panel of human melanoma cell lines and in a further reduced model that includes a pair of matched primary tumor-derived and metastasis-derived cell lines. Taken together, our data indicate a consistent correlation between RECK, MT1MMP, and TIMP2 across different models of clinical samples and cell lines and suggest evidence of the potential use of this subset of genes as a gene signature for diagnosing melanoma.
Yohn, Samantha E; Thompson, Christian; Randall, Patrick A; Lee, Christie A; Müller, Christa E; Baqi, Younis; Correa, Mercè; Salamone, John D
2015-04-01
Depressed people show effort-related motivational symptoms, such as anergia, retardation, lassitude, and fatigue. Animal tests can model these motivational symptoms, and the present studies characterized the effort-related effects of the vesicular monoamine transport (VMAT-2) inhibitor tetrabenazine. Tetrabenazine produces depressive symptoms in humans and, at low doses, preferentially depletes dopamine. The current studies investigated the effects of tetrabenazine on effort-based decision making using the T-maze barrier task. Rats were tested in a T-maze in which the choice arms of the maze contain different reinforcement densities, and under some conditions, a vertical barrier was placed in the high-density arm to provide an effort-related challenge. The first experiment assessed the effects of tetrabenazine under different maze conditions: a barrier in the arm with 4 food pellets and 2 pellets in the no barrier arm (4-2 barrier), 4 pellets in one arm and 2 pellets in the other with no barrier in either arm (no barrier), and 4 pellets in the barrier arm with no pellets in the other (4-0 barrier). Tetrabenazine (0.25-0.75 mg/kg IP) decreased selection of the high cost/high reward arm when the barrier was present, but had no effect on choice under the no barrier and 4-0 barrier conditions. The effects of tetrabenazine on barrier climbing in the 4-2 condition were reversed by the adenosine A2A antagonist MSX-3 and the catecholamine uptake inhibitor and antidepressant bupropion. These studies have implications for the development of animal models of the motivational symptoms of depression and other disorders.
CSIR Research Space (South Africa)
Lebea, Phiyani J
2007-06-01
Full Text Available .5 2 2.5 3 3.5 4 4.5 5 0 50 100 150 200 250 300 350 400 450 Wavelength (nm) O pt ic a l d e n si ty ATP + NMP NMP kinase (cellular protein mixture) ADP + NDP (1) ADP + NDP + 2PEP...) and tenofovir using the extracted total cytoplasmic kinases as well as utilising membrane bound total proteins was shown to be possible since there was considerable oxidation of β-NADH compared to the control sample (figure 3 and 4). The cytoplasmic reaction...
AlBacha, Jeanne d'Arc; Khoury, Mira; Mouawad, Charbel; Haddad, Katia; Hamoui, Samar; Azar, Albert; Fajloun, Ziad; Makdissy, Nehman
2015-01-01
Cardiovascular diseases (CVDs) are significantly high in the Lebanese population with the two most predominant forms being atherosclerosis and venous thrombosis. The purpose of our study was to assess the association of a spectrum of CVD related genes and combined state of hypertension hypercholesterolemia (HH) in unrelated Lebanese. Twelve polymorphisms were studied by multiplex PCR and reverse hybridization of DNA from 171 healthy individuals and 144 HH subjects. Two genes were significantly associated with HH: ACE (OR: 9.20, PACE activity and PAI-I increased significantly with Del/Del and 4G/5G genotypes. The co-expression of Del/4G(+/+) was detected in 113 out of 171 (66.0%) controls and 125 out of 144 (86.8%) HH subjects. Del/4G(-/-) was detected in only 6 (3.5%) controls and undetected in the HH group. Three venous thrombosis related genes [FV(Leiden), MTHFR(A1298C) and FXIII(V34L)] were significantly related to the prominence of the co-expression of Del/4G(+/+). A range of 2 to 8 combined polymorphisms co-expressed per subject where 5 mutations were the most detected. In Del/4G(+/+) subjects, peripheral blood mononuclear cells (PBMCs) produced significant elevated levels of IFN-γ and TNF-α contrary to IL-10, and no variations occurred for IL-4. ACE inhibitor (ramipril) in combination with statin (atorvastatin) and not alone reversed significantly the situation. This first report from Lebanon sheds light on an additional genetic predisposition of a complex spectrum of genes involved in CVD and suggests that the most requested gene FVL by physicians may not be sufficient to diagnose eventual future problems that can occur in the cardiovascular system. Subjects expressing the double mutations (Del/4G) are at high risk for the onset of CVDs.
Telomerase Inhibitors from Natural Products and Their Anticancer Potential
Directory of Open Access Journals (Sweden)
Kumar Ganesan
2017-12-01
Full Text Available Telomeres and telomerase are nowadays exploring traits on targets for anticancer therapy. Telomerase is a unique reverse transcriptase enzyme, considered as a primary factor in almost all cancer cells, which is mainly responsible to regulate the telomere length. Hence, telomerase ensures the indefinite cell proliferation during malignancy—a hallmark of cancer—and this distinctive feature has provided telomerase as the preferred target for drug development in cancer therapy. Deactivation of telomerase and telomere destabilization by natural products provides an opening to succeed new targets for cancer therapy. This review aims to provide a fundamental knowledge for research on telomere, working regulation of telomerase and its various binding proteins to inhibit the telomere/telomerase complex. In addition, the review summarizes the inhibitors of the enzyme catalytic subunit and RNA component, natural products that target telomeres, and suppression of transcriptional and post-transcriptional levels. This extensive understanding of telomerase biology will provide indispensable information for enhancing the efficiency of rational anti-cancer drug design.
Indian Academy of Sciences (India)
many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...
Bagley, Mark C; Davis, Terence; Rokicki, Michal J; Widdowson, Caroline S; Kipling, David
2010-02-01
UR-13756 is a potent and selective p38 mitogen-activated protein kinase (MAPK) inhibitor, reported to have good bioavailability and pharmacokinetic properties and, thus, is of potential use in the treatment of accelerated aging in Werner syndrome. Irradiation of 2-chloroacrylonitrile and methylhydrazine in ethanol at 100 °C gives 1-methyl-3-aminopyrazole, which reacts with 4-fluorobenzaldehyde and a ketone, obtained by Claisen condensation of 4-picoline, in a Hantzsch-type 3-component hereocyclocondensation, to give the pyrazolopyridine UR-13756. UR-13756 shows p38 MAPK inhibitory activity in human telomerase reverse transcriptase-immortalized HCA2 dermal fibroblasts, with an IC(50) of 80 nm, as shown by ELISA, is 100% efficacious for up to 24 h at 1.0 μm and displays excellent kinase selectivity over the related stress-activated c-Jun kinases. In addition, UR-13756 is an effective p38 inhibitor at 1.0 μm in Werner syndrome cells, as shown by immunoblot. The convergent synthesis of UR-13756 is realized using microwave dielectric heating and provides a highly selective inhibitor that shows excellent selectivity for p38 MAPK over c-Jun N-terminal kinase.
Role of hTERT in apoptosis of cervical cancer induced by histone deacetylase inhibitor
International Nuclear Information System (INIS)
Wu, Peng; Meng, Li; Wang, Hui; Zhou, Jianfeng; Xu, Gang; Wang, Shixuan; Xi, Ling; Chen, Gang; Wang, Beibei; Zhu, Tao; Lu, Yunping; Ma, Ding
2005-01-01
Human telomerase reverse transcriptase (hTERT) is the catalytic subunit of telomerase holoenzyme as well as the rate-limiting component of the telomerase enzyme complex. However, the role of the hTERT in apoptosis induced by histone deacetylase inhibitor has only been marginally addressed. For the first time, our study demonstrated that trichostatin A (TSA) briefly activated the proliferation of cervical cancer cell lines, HeLa and SiHa, within 12 h, but then inhibited cell growth after that time point. In response to TSA, hTERT expression, telomerase activity, and telomere length also underwent similar changes during the same time frame. Furthermore, the data in our study showed that cells transfected with dominant negative hTERT were more likely to undergo apoptosis induced by TSA than cells transfected with wild-type hTERT. The cyclin/cdk inhibitor p21 waf1 was down-regulated by hTERT without changing the expression of p53. Results from this study suggest that the hTERT might be a primary target of TSA and the anti-apoptosis effect of hTERT might be carried out through a p21 waf1 -dependent and p53-independent pathway
Chlorate: a reversible inhibitor of proteoglycan sulfation
International Nuclear Information System (INIS)
Humphries, D.E.; Silbert, J.E.
1988-01-01
Bovine aorta endothelial cells were cultured in medium containing [ 3 H]glucosamine, [ 35 S]sulfate, and various concentrations of chlorate. Cell growth was not affected by 10 mM chlorate, while 30 mM chlorate had a slight inhibitory effect. Chlorate concentrations greater than 10 mM resulted in significant undersulfation of chondroitin. With 30 mM chlorate, sulfation of chondroitin was reduced to 10% and heparan to 35% of controls, but [ 3 H]glucosamine incorporation on a per cell basis did not appear to be inhibited. Removal of chlorate from the culture medium of cells resulted in the rapid resumption of sulfation
Lin, Fan; Chandrasekaran, Gayathri; de Gooijer, Mark C; Beijnen, Jos H; van Tellingen, Olaf
2012-07-15
NVP-BEZ235 is a novel dual inhibitor of PI3K/mTOR and currently undergoing phase I/II clinical trials for advanced solid tumors. We developed a sensitive and selective reversed-phase high-performance liquid chromatographic (HPLC) assay with fluorometric detection for quantification of NVP-BEZ235 in biological matrices. Liquid-liquid extraction with tert-butyl methyl ether was used for sample pre-treatment, yielding a recovery of >84%. Chromatographic separation of NVP-BEZ235 and the internal standard (IS) NVP-BBD130 was achieved on a GraceSmart C-18 column by isocratic elution with a mobile phase which consisted of acetonitrile, methanol, and milliQ water adjusted with acetic acid to pH 3.7 (20:36:44, v/v/v). Fluorescence detection using excitation and emission wavelengths of 270 and 425 nm, respectively, provided a selectivity and sensitivity allowing quantification down to 1 ng/ml in human plasma and linear calibration curves within a range of 1-1000 ng/ml. The assay was validated for human plasma, mouse plasma and a range of tissues. The accuracy, within-day and between-day precision for all matrices, was within the generally accepted 15% range. NVP-BEZ235 was stable for 72 h in pretreated samples in reconstitution mixture (acetonitrile-water (30:70, v/v)), but unstable in mouse tissue homogenates upon repeated freeze-thaw cycles or long term storage (≥24 h) at room temperature. A pilot pharmacokinetic study in mice demonstrated the applicability of this method for pharmacokinetic purposes. Overall, this assay is suitable for the pharmacokinetic studies of NVP-BEZ235 in mice and in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Neiva S. L. GONÇALES
2000-10-01
Full Text Available Screening blood donations for anti-HCV antibodies and alanine aminotransferase (ALT serum levels generally prevents the transmission of hepatitis C virus (HCV by transfusion. The aim of the present study was to evaluate the efficiency of the enzyme immunoassay (EIA screening policy in identifying potentially infectious blood donors capable to transmit hepatitis C through blood transfusion. We have used a reverse transcriptase (RT-nested polymerase chain reaction (PCR to investigate the presence of HCV-RNA in blood donors. The prevalence of HCV-RNA positive individuals was compared with the recombinant immunoblot assay (RIBA-2 results in order to assess the usefulness of both tests as confirmatory assays. Both tests results were also compared with the EIA-2 OD/C ratio (optical densities of the samples divided by the cut off value. ALT results were expressed as the ALT quotient (qALT, calculated dividing the ALT value of the samples by the maximum normal value (53UI/l for the method. Donors (n=178 were divided into five groups according to their EIA anti-HCV status and qALT: group A (EIA > or = 3, ALT or = 3, ALT>1, group C (11 and group E (EIA or = 3 and detectable HCV-RNA by RT-nested PCR. We have also noted that blood donors with RIBA-2 indeterminate presented a high degree of detectable HCV-RNA using RT-nested PCR (75%, especially when the c22.3 band was detected.Na prevenção da transmissão de Hepatite por Vírus C (HCV em transfusões de hemocomponentes, utiliza-se rotineiramente, como testes de triagem de doadores de sangue, ensaios que detectam anticorpos anti-HCV e dosagens da enzima alanina-aminotransferase (ALT. O presente estudo tem como objetivo principal avaliar a eficiência do ensaio imunoenzimático de segunda geração (EIA-2 como teste de triagem, na identificação de doadores de sangue potencialmente infectados, e portanto, capazes de transmitir hepatite C pelos hemocomponentes. Nós utilizamos o ensaio de transcri
Directory of Open Access Journals (Sweden)
Nikki van Bel
Full Text Available The viral integrase (IN is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs. Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.
van Bel, Nikki; van der Velden, Yme; Bonnard, Damien; Le Rouzic, Erwann; Das, Atze T; Benarous, Richard; Berkhout, Ben
2014-01-01
The viral integrase (IN) is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs). Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.
Directory of Open Access Journals (Sweden)
Shweta Gupta
Full Text Available Efavirenz is an anti-viral agent of non-nucleoside reverse transcriptase inhibitor category used as a part of highly active retroviral therapy for the treatment of infections of human immune deficiency virus type-1. A simple, sensitive and rapid reversed-phase high performance liquid chromatographic gradient method was developed and validated for the determination of efavirenz in plasma. The method was developed with high performance liquid chromatography using Waters X-Terra Shield, RP18 50 x 4.6 mm, 3.5 μm column and a mobile phase consisting of phosphate buffer pH 3.5 and Acetonitrile. The elute was monitored with the UV-Visible detector at 260 nm with a flow rate of 1.5 mL/min. Tenofovir disoproxil fumarate was used as internal standard. The method was validated for linearity, precision, accuracy, specificity, robustness and data obtained were statistically analyzed. Calibration curve was found to be linear over the concentration range of 1-300 μg/mL. The retention times of efavirenz and tenofovir disoproxil fumarate (internal standard were 5.941 min and 4.356 min respectively. The regression coefficient value was found to be 0.999. The limit of detection and the limit of quantification obtained were 0.03 and 0.1 μg/mL respectively. The developed HPLC method can be useful for quantitative pharmacokinetic parameters determination of efavirenz in plasma.
The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers
Oude Essink, B. B.; Berkhout, B.
1999-01-01
Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by
Directory of Open Access Journals (Sweden)
Kashanchi Fatah
2006-01-01
Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their
Garcia, Jean-Michel; Gao, Anhui; He, Pei-Lan; Choi, Joyce; Tang, Wei; Bruzzone, Roberto; Schwartz, Olivier; Naya, Hugo; Nan, Fa-Jun; Li, Jia; Altmeyer, Ralf; Zuo, Jian-Ping
2009-03-01
Two decades after its discovery the human immunodeficiency virus (HIV) is still spreading worldwide and killing millions. There are 25 drugs formally approved for HIV currently on the market, but side effects as well as the emergence of HIV strains showing single or multiple resistances to current drug-therapy are causes for concern. Furthermore, these drugs target only 4 steps of the viral cycle, hence the urgent need for new drugs and also new targets. In order to tackle this problem, we have devised a cell-based assay using lentiviral particles to look for post-entry inhibitors of HIV-1. We report here the assay development, validation as well as confirmation of the hits using both wild-type and drug-resistant HIV-1 viruses. The screening was performed on an original library, rich in natural compounds and pure molecules from Traditional Chinese Medicine pharmacopoeia, which had never been screened for anti-HIV activity. The identified hits belong to four chemical sub-families that appear to be all non-nucleoside reverse transcriptase inhibitors (NNRTIs). Secondary tests with live viruses showed that there was good agreement with pseudotyped particles, confirming the validity of this approach for high-throughput drug screens. This assay will be a useful tool that can be easily adapted to screen for inhibitors of viral entry.
Directory of Open Access Journals (Sweden)
Kirsten L. White
2014-07-01
Full Text Available The integrase (IN strand transfer inhibitors (INSTIs, raltegravir (RAL, elvitegravir (EVG and dolutegravir (DTG, comprise the newest drug class approved for the treatment of HIV-1 infection, which joins the existing classes of reverse transcriptase, protease and binding/entry inhibitors. The efficacy of first-line regimens has attained remarkably high levels, reaching undetectable viral loads in 90% of patients by Week 48; however, there remain patients who require a change in regimen due to adverse events, virologic failure with emergent resistance or other issues of patient management. Large, randomized clinical trials conducted in antiretroviral treatment-naive individuals are required for drug approval in this population in the US, EU and other countries, with the primary endpoint for virologic success at Week 48. However, there are differences in the definition of virologic failure and the evaluation of drug resistance among the trials. This review focuses on the methodology and tabulation of resistance to INSTIs in phase 3 clinical trials of first-line regimens and discusses case studies of resistance.
Directory of Open Access Journals (Sweden)
Binhua Ling
Full Text Available Viral reservoirs-persistent residual virus despite combination antiretroviral therapy (cART-remain an obstacle to cure of HIV-1 infection. Difficulty studying reservoirs in patients underscores the need for animal models that mimics HIV infected humans on cART. We studied SIV-infected Chinese-origin rhesus macaques (Ch-RM treated with intensive combination antiretroviral therapy (cART and 3 weeks of treatment with the histone deacetyalse inhibitor, suberoylanilide hydroxamic acid (SAHA.SIVmac251 infected Ch-RM received reverse transcriptase inhibitors PMPA and FTC and integrase inhibitor L-870812 beginning 7 weeks post infection. Integrase inhibitor L-900564 and boosted protease inhibitor treatment with Darunavir and Ritonavir were added later. cART was continued for 45 weeks, with daily SAHA administered for the last 3 weeks, followed by euthanasia/necropsy. Plasma viral RNA and cell/tissue-associated SIV gag RNA and DNA were quantified by qRT-PCR/qPCR, with flow cytometry monitoring changes in immune cell populations.Upon cART initiation, plasma viremia declined, remaining <30 SIV RNA copy Eq/ml during cART, with occasional blips. Decreased viral replication was associated with decreased immune activation and partial restoration of intestinal CD4+ T cells. SAHA was well tolerated but did not result in demonstrable treatment-associated changes in plasma or cell associated viral parameters.The ability to achieve and sustain virological suppression makes cART-suppressed, SIV-infected Ch-RM a potentially useful model to evaluate interventions targeting residual virus. However, despite intensive cART over one year, persistent viral DNA and RNA remained in tissues of all three animals. While well tolerated, three weeks of SAHA treatment did not demonstrably impact viral RNA levels in plasma or tissues; perhaps reflecting dosing, sampling and assay limitations.
In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants
Directory of Open Access Journals (Sweden)
Mokhtar Nosrati
2017-08-01
Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.
Pagano, Nicholas; Teriete, Peter; Mattmann, Margrith E; Yang, Li; Snyder, Beth A; Cai, Zhaohui; Heil, Marintha L; Cosford, Nicholas D P
2017-12-01
Continuous flow (microfluidic) chemistry was employed to prepare a small focused library of dihydropyrimidinone (DHPM) derivatives. Compounds in this class have been reported to exhibit activity against the human immunodeficiency virus (HIV), but their molecular target had not been identified. We tested the initial set of DHPMs in phenotypic assays providing a hit (1i) that inhibited the replication of the human immunodeficiency virus HIV in cells. Flow chemistry-driven optimization of 1i led to the identification of HIV replication inhibitors such as 1l with cellular potency comparable with the clinical drug nevirapine (NVP). Mechanism of action (MOA) studies using cellular and biochemical assays coupled with 3D fingerprinting and in silico modeling demonstrated that these drug-like probe compounds exert their effects by inhibiting the viral reverse transcriptase polymerase (RT). This led to the design and synthesis of the novel DHPM 1at that inhibits the replication of drug resistant strains of HIV. Our work demonstrates that combining flow chemistry-driven analogue refinement with phenotypic assays, in silico modeling and MOA studies is a highly effective strategy for hit-to-lead optimization applicable to the discovery of future therapeutic agents. Copyright © 2017. Published by Elsevier Ltd.
Raees Ahmad, Sufiyan Ahmad; Patil, Lalit; Mohammed Usman, Mohammed Rageeb; Imran, Mohammad; Akhtar, Rashid
2018-01-01
A simple rapid, accurate, precise, and reproducible validated reverse phase high performance liquid chromatography (HPLC) method was developed for the determination of Abacavir (ABAC) and Lamivudine (LAMI) in bulk and tablet dosage forms. The quantification was carried out using Symmetry Premsil C18 (250 mm × 4.6 mm, 5 μm) column run in isocratic way using mobile phase comprising methanol: water (0.05% orthophosphoric acid with pH 3) 83:17 v/v and a detection wavelength of 245 nm and injection volume of 20 μl, with a flow rate of 1 ml/min. In the developed method, the retention times of ABAC and LAMI were found to be 3.5 min and 7.4 min, respectively. The method was validated in terms of linearity, precision, accuracy, limits of detection, limits of quantitation, and robustness in accordance with the International Conference on Harmonization guidelines. The assay of the proposed method was found to be 99% - 101%. The recovery studies were also carried out and mean % recovery was found to be 99% - 101%. The % relative standard deviation from reproducibility was found to be performance liquid chromatography, UV: Ultraviolet, ICH: International Conference on Harmonization, ABAC: Abacavir, LAMI: Lamivudine, HIV: Human immunodeficiency virus, AIDS: Acquired immunodeficiency syndrome, NRTI: Nucleoside reverse transcriptase inhibitors, ARV: Antiretroviral, RSD: Relative standard deviation, RT: Retention time, SD: Standard deviation.
International Nuclear Information System (INIS)
Zhao Qian; Ma Liying; Jiang Shibo; Lu Hong; Liu Shuwen; He Yuxian; Strick, Nathan; Neamati, Nouri; Debnath, Asim Kumar
2005-01-01
We have identified two N-phenyl-N'-(2,2,6,6-tetramethyl-piperidin-4-yl)-oxalamide analogs as a novel class of human immunodeficiency virus type 1 (HIV-1) entry inhibitors that block the gp120-CD4 interaction, using database screening techniques. The lead compounds, NBD-556 and NBD-557, are small molecule organic compounds with drug-like properties. These compounds showed potent cell fusion and virus-cell fusion inhibitory activity at low micromolar levels. A systematic study showed that these compounds target viral entry by inhibiting the binding of HIV-1 envelope glycoprotein gp120 to the cellular receptor CD4 but did not inhibit reverse transcriptase, integrase, or protease, indicating that they do not target the later stages of the HIV-1 life cycle to inhibit HIV-1 infection. These compounds were equally potent inhibitors of both X4 and R5 viruses tested in CXCR4 and CCR5 expressing cell lines, respectively, indicating that their anti-HIV-1 activity is not dependent on the coreceptor tropism of the virus. A surface plasmon resonance study, which measures binding affinity, clearly demonstrated that these compounds bind to unliganded HIV-1 gp120 but not to the cellular receptor CD4. NBD-556 and NBD-557 were active against HIV-1 laboratory-adapted strains including an AZT-resistant strain and HIV-1 primary isolates, indicating that these compounds can potentially be further modified to become potent HIV-1 entry inhibitors
NEW DRUGS NEW TARGETS AND NOVEL ANTIRETROVIRALS
African Journals Online (AJOL)
2005-11-02
Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).
New targets and novel antiretrovirals | Wood | Southern African ...
African Journals Online (AJOL)
Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). These ARV classes ...
Taldone, Tony; Kang, Yanlong; Patel, Hardik J; Patel, Maulik R; Patel, Pallav D; Rodina, Anna; Patel, Yogita; Gozman, Alexander; Maharaj, Ronnie; Clement, Cristina C; Lu, Alvin; Young, Jason C; Chiosis, Gabriela
2014-02-27
The discovery and development of heat shock protein 70 (Hsp70) inhibitors is currently a hot topic in cancer. In the preceding paper in this issue ( 10.1021/jm401551n ), we have described structure-activity relationship studies in the first Hsp70 inhibitor class rationally designed to bind to a novel allosteric pocket located in the N-terminal domain of the protein. These ligands contained an acrylamide to take advantage of an active cysteine embedded in the allosteric pocket and acted as covalent protein modifiers upon binding. Here, we perform chemical modifications around the irreversible inhibitor scaffold to demonstrate that covalent modification is not a requirement for activity within this class of compounds. The study identifies derivative 27c, which mimics the biological effects of the irreversible inhibitors at comparable concentrations. Collectively, the back-to-back manuscripts describe the first pharmacophores that favorably and selectively interact with a never explored pocket in Hsp70 and provide a novel blueprint for a cancer-oriented development of Hsp70-directed ligands.
Misik, Jan; Korabecny, Jan; Nepovimova, Eugenie; Kracmarova, Alzbeta; Kassa, Jiri
2016-01-26
Inhibitors of cholinesterase are important drugs for therapy of Alzheimer's disease and the search for new modifications is extensive, including dual inhibitors or multi-target hybrid compounds. The aim of the present study was a preliminary evaluation of pro-cognitive effects of newly-developed 7-MEOTA-donepezil like hybrids (compounds no. 1 and 2) and N-alkylated tacrine derivatives (compounds no. 3 and 4) using an animal model of pharmacologically-induced cognitive deficit. Male Wistar rats were subjected to tests of learning and memory in a water maze and step-through passive avoidance task. Cognitive impairment was induced by 3-quinuclidinyl benzilate (QNB, 2mgkg(-1)), administered intraperitoneally 1h before training sessions. Cholinesterase inhibitors were administered as a single therapeutic dose following the QNB at 30min at the following dose rates; 1 (25.6mgkg(-1)), 2 (12.3mgkg(-1)), 3 (5.7mgkg(-1)), 4 (5.2mgkg(-1)). The decrease in total path within the 10-swim session (water maze), the preference for target quadrant (water maze) and the entrance latency (passive avoidance) were taken as indicators of learning ability in rats. The effects of novel compounds were compared to that of standards tacrine (5.2mgkg(-1)) and donepezil (2.65mgkg(-1)). QNB significantly impaired spatial navigation as well as fear learning. Generally, the performance of rats was improved when treated with novel inhibitors and this effect reached efficiency of standard donepezil at selected doses. There was a significant improvement in the groups treated with compounds 2 and 3 in all behavioral tasks. The rest of the novel compounds succeed in the passive avoidance test. In summary, the potential of novel inhibitors (especially compounds 2 and 3) was proved and further detailed evaluation of these compounds as potential drugs for Alzheimer's disease treatment is proposed. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi
2014-01-01
Background Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. Methods In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking...
Directory of Open Access Journals (Sweden)
Nosratollah Zarghami
2013-02-01
Full Text Available Purpose: Telomerase is expressed in most cancers, including breast cancer. Curcumin, a polyphenolic compound that obtained from the herb of Curcuma longa, has many anticancer effects. But, its effect is low due to poor water solubility. In order to improve its solubility and drug delivery, we have utilized a β-cyclodextrin-curcumin inclusion complex. Methods: To evaluate cytotoxic effects of cyclodextrin-curcumin and free curcumin, MTT assay was done. Cells were treated with equal concentration of cyclodextrin-curcumin and free curcumin. Telomerase gene expression level in two groups was compared by Real-time PCR. Results: MTT assay demonstrated that β-cyclodextrin-curcumin enhanced curcumin delivery in T47D breast cancer cells. The level of telomerase gene expression in cells treated with cyclodextrin-curcumin was lower than that of cells treated with free curcumin (P=0.001. Conclusion: Results are suggesting that cyclodextrin-curcumin complex can be more effective than free curcumin in inhibition of telomerase expression.
International Nuclear Information System (INIS)
Isoda, Hideka; Mori, Tomoko; Nishio, Daisuke; Tokura, Yoshiki; Yasuda, Hiroshi
2005-01-01
Sentinel lymph node (SLN) biopsy has been performed in 25 patients with malignant melanoma for the last four years at the Department of Dermatology, University of Occupational and Environmental Health. SLNs were identified by using both patent blue dye and redionucleotide-labeled colloid methods. The removed SLNs were subjected to routine haematoxylin-eosin staining and immunohistochemical stainings for Melan-A, S-100 protein and HMB45, and 10 of 25 cases had positive SLN metastases. In 8 cases, mRNA for malignant melanoma related molecules, gp100, MART-1 and tyrosinase, was analyzed by RT-PCR, and 7 of 8 cases gave agreement with the histopathological results. One case had negative SLN metastasis on histopathological examination but exhibited amplification of mRNA for the melanoma-related molecules on RT-PCR analysis. (author)
Waggoner, Jesse J; Balassiano, Ilana; Mohamed-Hadley, Alisha; Vital-Brazil, Juliana Magalhães; Sahoo, Malaya K; Pinsky, Benjamin A
2015-01-01
Reference diagnostic tests for leptospirosis include nucleic acid amplification tests, bacterial culture, and microscopic agglutination testing (MAT) of acute and convalescent serum. However, clinical laboratories often do not receive paired specimens. In the current study, we tested serum samples using a highly sensitive real-time nucleic acid amplification test for Leptospira and compared results to MAT performed on the same specimens. 478 serum samples from suspected leptospirosis cases in Rio de Janeiro were tested using a real-time RT-PCR for the diagnosis of leptospirosis, malaria and dengue (the Lepto-MD assay). The Lepto-MD assay detects all species of Leptospira (saprophytic, intermediate, and pathogenic), and in the current study, we demonstrate that this assay amplifies both Leptospira RNA and DNA. Dengue virus RNA was identified in 10 patients, and no cases of malaria were detected. A total of 65 samples (13.6%) were positive for Leptospira: 35 samples (7.3%) in the Lepto-MD assay, 33 samples (6.9%) by MAT, and 3 samples tested positive by both (kappa statistic 0.02). Poor agreement between methods was consistent regardless of the titer used to define positive MAT results or the day of disease at sample collection. Leptospira nucleic acids were detected in the Lepto-MD assay as late as day 22, and cycle threshold values did not differ based on the day of disease. When Lepto-MD assay results were added to the MAT results for all patients in 2008 (n=818), the number of detected leptospirosis cases increased by 30.4%, from 102 (12.5%) to 133 (16.3%). This study demonstrates a lack of agreement between nucleic acid detection of Leptospira and single-specimen MAT, which may result from the clearance of bacteremia coinciding with the appearance of agglutinating antibodies. A combined testing strategy for acute leptospirosis, including molecular and serologic testing, appears necessary to maximize case detection.
Nosratollah Zarghami; Abbas Rami; Fatemeh Kazemi-Lomedasht
2013-01-01
Purpose: Telomerase is expressed in most cancers, including breast cancer. Curcumin, a polyphenolic compound that obtained from the herb of Curcuma longa, has many anticancer effects. But, its effect is low due to poor water solubility. In order to improve its solubility and drug delivery, we have utilized a β-cyclodextrin-curcumin inclusion complex. Methods: To evaluate cytotoxic effects of cyclodextrin-curcumin and free curcumin, MTT assay was done. Cells were treated with equal concentrati...
Sarafianos, Stefan G; Das, Kalyan; Hughes, Stephen H; Arnold, Eddy
2004-12-01
HIV undergoes rapid genetic variation; this variation is caused primarily by the enormous number of viruses produced daily in an infected individual. Because of this variation, HIV presents a moving target for drug and vaccine development. The variation within individuals has led to the generation of diverse HIV-1 subtypes, which further complicates the development of effective drugs and vaccines. In general, it is more difficult to hit a moving target than a stationary target. Two broad strategies for hitting a moving target (in this case, HIV replication) are to understand the movement and to aim at the portions that move the least. In the case of anti-HIV drug development, the first option can be addressed by understanding the mechanism(s) of drug resistance and developing drugs that effectively inhibit mutant viruses. The second can be addressed by designing drugs that interact with portions of the viral machinery that are evolutionarily conserved, such as enzyme active sites.
DEFF Research Database (Denmark)
Brudek, Tomasz; Lühdorf, Pernille; Christensen, Tove
2007-01-01
Human endogenous retroviruses (HERVs) and herpesviruses have been associated with the development of multiple sclerosis (MS). These virus groups interact with each other and have been shown to induce synergistic immune responses. Here, we focus on the possible role of herpesviruses as contributing...
Energy Technology Data Exchange (ETDEWEB)
Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T
2007-04-11
We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.
Directory of Open Access Journals (Sweden)
Maurício Machaim Franco
2003-01-01
Full Text Available After the advent of the genome projects, followed by the discovery of DNA polymorphisms, basic understanding of gene expression is the next focus to explain the association between polymorphisms and the level of gene expression, as well as to demonstrate the interaction among genes. Among the various techniques for the investigation of transcriptional profiling involving patterns of gene expression, quantitative PCR is the simplest analytical laboratory technique. The objective of this work was to analyze two strategies of a competitive PCR technique for the quantification of the pig growth hormone (GH gene expression. A pair of primers was designed targeting exons 3 and 5, and two competitive PCR strategies were performed, one utilizing a specific amplicon as a competitor, and the other utilizing a low-stringency PCR amplicon as a competitor. The latter strategy proved to be easier and more efficient, offering an accessible tool that can be used in any kind of competitive reaction, facilitating the study of gene expression patterns for both genetics and diagnostics of infectious diseases.
The G-Patch Domain of Mason-Pfizer Monkey Virus Is a Part of Reverse Transcriptase
Czech Academy of Sciences Publication Activity Database
Křížová, Ivana; Hadravová, Romana; Štokrová, Jitka; Günterová, Jana; Doležal, Michal; Ruml, T.; Rumlová, Michaela; Pichová, Iva
2012-01-01
Roč. 68, č. 4 (2012), s. 1988-1998 ISSN 0022-538X R&D Projects: GA MŠk 1M0508; GA ČR GA204/09/1388 Grant - others:GA MŠk(CZ) ME 904 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA repair enzyme * retroviral protease * Toxoplasma gondii * leukemia-virus * containing RNA Subject RIV: CE - Biochemistry Impact factor: 5.076, year: 2012
Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M
2008-10-01
The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.
DEFF Research Database (Denmark)
Tryggestad, Kjell
2004-01-01
The study aims is to describe how the inclusion and exclusion of materials and calculative devices construct the boundaries and distinctions between statistical facts and artifacts in economics. My methodological approach is inspired by John Graunt's (1667) Political arithmetic and more recent work...... within constructivism and the field of Science and Technology Studies (STS). The result of this approach is here termed reversible statistics, reconstructing the findings of a statistical study within economics in three different ways. It is argued that all three accounts are quite normal, albeit...... in different ways. The presence and absence of diverse materials, both natural and political, is what distinguishes them from each other. Arguments are presented for a more symmetric relation between the scientific statistical text and the reader. I will argue that a more symmetric relation can be achieved...
Detection of hepatitis C virus RNA using reverse transcription PCR
International Nuclear Information System (INIS)
Yap, S.F.
1998-01-01
Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory
Pivonello, Claudia; Rousaki, Panagoula; Negri, Mariarosaria; Sarnataro, Maddalena; Napolitano, Maria; Marino, Federica Zito; Patalano, Roberta; De Martino, Maria Cristina; Sciammarella, Concetta; Faggiano, Antongiulio; Rocco, Gaetano; Franco, Renato; Kaltsas, Gregory A; Colao, Annamaria; Pivonello, Rosario
2017-06-01
Somatostatin analogues and mTOR inhibitors have been used as medical therapy in lung carcinoids with variable results. No data are available on dopamine agonists as treatment for lung carcinoids. The main aim of the current study was to evaluate the effect of the combined treatment of somatostatin analogue octreotide and the dopamine agonist cabergoline with mTOR inhibitors in an in vitro model of typical lung carcinoids: the NCI-H727 cell line. In NCI-H727 cell line, reverse transcriptase-quantitative polymerase chain reaction and immunofluorescence were assessed to characterize the expression of the somatostatin receptor 2 and 5, dopamine receptor 2 and mTOR pathway components. Fifteen typical lung carcinoids tissue samples have been used for somatostatin receptor 2, dopamine receptor 2, and the main mTOR pathway component p70S6K expression and localization by immunohistochemistry. Cell viability, fluorescence-activated cell sorting analysis and western blot have been assessed to test the pharmacological effects of octreotide, cabergoline and mTOR inhibitors, and to evaluate the activation of specific cell signaling pathways in NCI-H727 cell line. NCI-H727 cell line expressed somatostatin receptor 2, somatostatin receptor 5 and dopamine receptor 2 and all mTOR pathway components at messenger and protein levels. Somatostatin receptor 2, dopamine receptor 2, and p70S6K (non phosphorylated and phosphorylated) proteins were expressed in most typical lung carcinoids tissue samples. Octreotide and cabergoline did not reduce cell viability as single agents but, when combined with mTOR inhibitors, they potentiate mTOR inhibitors effect after long-term exposure, reducing Akt and ERK phosphorylation, mTOR escape mechanisms, and increasing the expression DNA-damage-inducible transcript 4, an mTOR suppressor. In conclusion, the single use of octreotide and cabergoline is not sufficient to block cell viability but the combined approach of these agents with mTOR inhibitors
Directory of Open Access Journals (Sweden)
Hatakeyama Keiichi
2012-12-01
Full Text Available Abstract Background Alternative splicing of pre-mRNA transcripts not only plays a role in normal molecular processes but is also associated with cancer development. While normal transcripts are ubiquitously expressed in normal tissues, splice variants created through abnormal alternative splicing events are often expressed in cancer cells. Although the Rho GDP dissociation inhibitor β (ARHGDIB gene has been found to be ubiquitously expressed in normal tissues and involved in cancer development, the presence of splice variants of ARHGDIB has not yet been investigated. Results Validation analysis for the presence of and exon structures of splice variants of ARHGDIB, performed using reverse-transcriptase polymerase chain reaction and DNA sequencing, successfully identified novel splice variants of ARHGDIB, that is, 6a, 6b, and 6c, in colon, pancreas, stomach, and breast cancer cell lines. Quantitative real-time polymerase chain reaction analysis showed that these variants were also highly expressed in normal placental tissue but not in other types of normal tissue. Conclusions Expression of ARHGDIB variants 6a, 6b, and 6c appears to be restricted to cancer cells and normal placental tissue, suggesting that these variants possess cancer-specific functions and, as such, are potential cancer-related biomarkers.
Costi, Roberta; Métifiot, Mathieu; Esposito, Francesca; Cuzzucoli Crucitti, Giuliana; Pescatori, Luca; Messore, Antonella; Scipione, Luigi; Tortorella, Silvano; Zinzula, Luca; Novellino, Ettore; Pommier, Yves; Tramontano, Enzo; Marchand, Christophe; Di Santo, Roberto
2013-11-14
The increasing efficiency of HAART has helped to transform HIV/AIDS into a chronic disease. Still, resistance and drug-drug interactions warrant the development of new anti-HIV agents. We previously discovered hit 6, active against HIV-1 replication and targeting RNase H in vitro. Because of its diketo-acid moiety, we speculated that this chemotype could serve to develop dual inhibitors of both RNase H and integrase. Here, we describe a new series of 1-benzyl-pyrrolyl diketohexenoic derivatives, 7a-y and 8a-y, synthesized following a parallel solution-phase approach. Those 50 analogues have been tested on recombinant enzymes (RNase H and integrase) and in cell-based assays. Approximately half (22) exibited inhibition of HIV replication. Compounds 7b, 7u, and 8g were the most active against the RNase H activity of reverse-transcriptase, with IC50 values of 3, 3, and 2.5 μM, respectively. Compound 8g was also the most potent integrase inhibitor with an IC50 value of 26 nM.
Zhang, Jing; Biggar, Kyle K; Storey, Kenneth B
2013-01-15
The red-eared slider turtle (Trachemys scripta elegans) exhibits well-developed natural anoxia tolerance that depends on multiple biochemical adaptations, including anoxia-induced hypometabolism. We hypothesized that signaling by the p53 protein could aid in establishing the hypometabolic state by arresting the cell cycle, protecting against DNA damage as well as altering pathways of energy metabolism. Immunoblotting was used to evaluate the regulation and post-transcriptional modifications of p53 in liver and skeletal muscle of red-eared slider turtles subjected to 5h or 20h of anoxic submergence. Tissue specific regulation of p53 was observed with the liver showing a more rapid activation of p53 in response to anoxia as well as differential expression of seven serine phosphorylation and two lysine acetylation sites when compared with skeletal muscle. Protein expression of MDM2, a major p53 inhibitor, was also examined but did not change during anoxia. Reverse-transcriptase PCR was used to assess transcript levels of selected p53 target genes (14-3-3σ, Gadd45α and Pgm) and one microRNA (miR-34a); results showed down-regulation of Pgm and up-regulation of the other three. These findings show an activation of p53 in response to anoxia exposure and suggest an important role for the p53 stress response pathway in regulating natural anoxia tolerance and hypometabolism in a vertebrate facultative anaerobe. Copyright © 2012 Elsevier B.V. All rights reserved.
Kimura, Yukihiro; Chihara, Kazuyasu; Takeuchi, Kenji; Sada, Kiyonao
2013-07-01
Non-receptor type of protein-tyrosine kinase Syk (spleen tyrosine kinase) was isolated in the University of Fukui in 1991. Syk is known to be essential for the various physiological functions, especially in hematopoietic lineage cells. Moreover, ectopic expression of Syk by epigenetic changes is reported to cause retinoblastoma. Recently, novel Syk inhibitors were developed and its usefulness has been evaluated in the treatment of allergic rhinitis, rheumatoid arthritis, and idiopathic thrombocytopenic purpura. In this review, we will summarize the history, structure, and function of Syk, and then describe the novel Syk inhibitors and their current status. Furthermore, we will introduce our findings of the adaptor protein 3BP2 (c-Abl SH3 domain-binding protein-2), as a novel target of Syk.
Chihara, Kazuyasu; Kimura, Yukihiro; Honjo, Chisato; Takeuchi, Kenji; Sada, Kiyonao
2013-01-01
Non-receptor type of protein-tyrosine kinase Syk (spleen tyrosine kinase) was isolated in University of Fukui in 1991. Syk is most highly expressed by haemopoietic cells and known to play crucial roles in the signal transduction through various immunoreceptors of the adaptive immune response. However, recent reports demonstrate that Syk also mediates other biological functions, such as innate immune response, osteoclast maturation, platelet activation and cellular adhesion. Moreover, ectopic expression of Syk by epigenetic changes is reported to cause retinoblastoma. Because of its critical roles on the cellular functions, the development of Syk inhibitors for clinical use has been desired. Although many candidate compounds were produced, none of them had progressed to clinical trials. However, novel Syk inhibitors were finally developed and its usefulness has been evaluated in the treatment of allergic rhinitis, rheumatoid arthritis and idiopathic thrombocytopenic purpura. In this review, we will summarize the history, structure and function of Syk, and then the novel Syk inhibitors and their current status. In addition, we will introduce our research focused on the functions of Syk on Dectin-1-mediated mast cell activation.
Directory of Open Access Journals (Sweden)
Naoto Terami
Full Text Available Inhibition of sodium glucose cotransporter 2 (SGLT2 has been reported as a new therapeutic strategy for treating diabetes. However, the effect of SGLT2 inhibitors on the kidney is unknown. In addition, whether SGLT2 inhibitors have an anti-inflammatory or antioxidative stress effect is still unclear. In this study, to resolve these issues, we evaluated the effects of the SGLT2 inhibitor, dapagliflozin, using a mouse model of type 2 diabetes and cultured proximal tubular epithelial (mProx24 cells. Male db/db mice were administered 0.1 or 1.0 mg/kg of dapagliflozin for 12 weeks. Body weight, blood pressure, blood glucose, hemoglobin A1c, albuminuria and creatinine clearance were measured. Mesangial matrix accumulation and interstitial fibrosis in the kidney and pancreatic β-cell mass were evaluated by histological analysis. Furthermore, gene expression of inflammatory mediators, such as osteopontin, monocyte chemoattractant protein-1 and transforming growth factor-β, was evaluated by quantitative reverse transcriptase-PCR. In addition, oxidative stress was evaluated by dihydroethidium and NADPH oxidase 4 staining. Administration of 0.1 or 1.0 mg/kg of dapagliflozin ameliorated hyperglycemia, β-cell damage and albuminuria in db/db mice. Serum creatinine, creatinine clearance and blood pressure were not affected by administration of dapagliflozin, but glomerular mesangial expansion and interstitial fibrosis were suppressed in a dose-dependent manner. Dapagliflozin treatment markedly decreased macrophage infiltration and the gene expression of inflammation and oxidative stress in the kidney of db/db mice. Moreover, dapagliflozin suppressed the high-glucose-induced gene expression of inflammatory cytokines and oxidative stress in cultured mProx24 cells. These data suggest that dapagliflozin ameliorates diabetic nephropathy by improving hyperglycemia along with inhibiting inflammation and oxidative stress.
Haberichter, Jarod; Roberts, Scott; Abbasi, Imran; Dedthanou, Phonphanh; Pradhan, Prajakta; Nguyen, Marie L
2015-10-01
The life cycle of herpes simplex virus (HSV) has the potential to be further manipulated to yield novel, more effective therapeutic treatments. Recent research has demonstrated that HSV-1 can increase telomerase activity and that expression of the catalytic component of telomerase, telomerase reverse transcriptase (TERT), alters sensitivity to HSV-dependent apoptosis. Telomerase is a cellular enzyme that synthesizes nucleotide repeats at the ends of chromosomes (telomeres), which prevents shortening of the 3' ends of DNA with each cell division. Once telomeres reach a critical length, cells undergo senescence and apoptosis. Here, we used a cell-permeable, reversible inhibitor of the telomerase enzyme, MST-312, to investigate telomerase activity during HSV infection. Human mammary epithelial cells immortalized through TERT expression and human carcinoma HEp-2 cells were infected with the KOS1.1 strain of HSV-1 in the presence of MST-312. MST-312 treatment reduced the number of cells displaying a cytopathic effect and the accumulation of immediate early and late viral proteins. Moreover, the presence of 20 μM to 100 μM MST-312 during infection led to a 2.5- to 5.5-log10 decrease in viral titers. MST-312 also inhibited the replication of HSV-2 and a recent clinical isolate of HSV-1. Additionally, we determined that MST-312 has the largest impact on viral events that take place prior to 5 h postinfection (hpi). Furthermore, MST-312 treatment inhibited virus replication, as measured by adsorption assays and quantification of genome replication. Together, these findings demonstrate that MST-312 interferes with the HSV life cycle. Further investigation into the mechanism for MST-312 is warranted and may provide novel targets for HSV therapies. Herpes simplex virus (HSV) infections can lead to cold sores, blindness, and brain damage. Identification of host factors that are important for the virus life cycle may provide novel targets for HSV antivirals. One such factor
Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa
Directory of Open Access Journals (Sweden)
Aline Aki Tanikawa
2013-08-01
Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.
Managing Reverse Logistics or Reversing Logistics Management?
Brito, Marisa
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...
Profits in reverse? An examination of the decisive factors for reverse supply chain profitability
DEFF Research Database (Denmark)
Larsen, Samuel; Jacobsen, Peter
2015-01-01
Although the concept of the reverse supply chain (RSC) is not unknown in industry, an inhibitor for its successful use is low (or no) profitability. A research challenge is investigating ways to establish the RSC as a profit-creating center in the organization. This paper contributes...
Managing Reverse Logistics or Reversing Logistics Management?
M.P. de Brito (Marisa)
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse
Reversible Thermoset Adhesives
Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)
2016-01-01
Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.
From reverse transcription to human brain tumors
Directory of Open Access Journals (Sweden)
Dmitrenko V. V.
2013-05-01
Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line
... seal off the fallopian tubes, such as the Essure or Adiana systems, generally aren't reversible. Why ... electrocautery). Some types of sterilization, such as the Essure or Adiana systems, aren't considered reversible. Risks ...
Reverse logistics - a framework
M.P. de Brito (Marisa); R. Dekker (Rommert)
2002-01-01
textabstractIn this paper we define and compare Reverse Logistics definitions. We start by giving an understanding framework of Reverse Logistics: the why-what-how. By this means, we put in context the driving forces for Reverse Logistics, a typology of return reasons, a classification of
Universal, class-specific and drug-specific reversal agents for the new oral anticoagulants.
Ansell, Jack E
2016-02-01
Although there is controversy about the absolute need for a reversal agent for the new direct oral anticoagulants (DOACs), the absence of such an agent is a barrier to more widespread use of these agents. For the management of major life-threatening bleeding with the DOACs, most authorities recommend the use of four factor prothrombin complex concentrates, although the evidence to support their use in terms of improving outcomes is meager. At the present time, there are three antidotes in development and poised to enter the market. Idarucizumab is a drug-specific antidote targeted to reverse the direct thrombin inhibitor, dabigatran. Andexanet alfa is a class-specific antidote targeted to reverse the oral direct factor Xa inhibitors as well as the indirect inhibitor, enoxaparin. Ciraparantag is a universal antidote targeted to reverse the direct thrombin and factor Xa inhibitors as well as the indirect inhibitor, enoxaparin.
2000-07-07
To determine if triple combination therapy, particularly including HIV protease inhibitors (PI), confers an unique immunological benefit that is independent of reductions of plasma viral load (pVL). The correlation between changes from baseline in CD4 cell count and pVL was examined at all time points up to 52 weeks in three randomized clinical trials (AVANTI-2, AVANTI-3 and INCAS) that compared dual nucleoside therapy with triple combination therapy. Individual pVL and CD4 cell counts changes from baseline were entered into multivariate linear regression models for patients receiving double therapy and for those receiving triple therapy including a PI and/or a non-nucleoside reverse transcriptase inhibitor (NNRTI), and the null hypothesis was tested. After 52 weeks of therapy, the relationship between changes from baseline CD4 cell count and pVL was independent of whether patients were assigned double or triple therapy (P = 0.23 and 0.69 for intercept and slope, respectively), or whether patients were assigned triple therapy including a PI or triple therapy including an NNRTI (P = 0.92 and 0.95, respectively). Less than 5% of patients ever had 'discordant' increases in both CD4 cell count and pVL compared with baseline, and this proportion was unrelated to the class of therapy used. 'Discordant' decreases from baseline in both parameters were observed in up to 35% of individuals. The correlation between pVL and CD4 cell count changes from baseline improved over time on therapy, regardless of the therapeutic regimen involved. The data provide no evidence for a CD4 cell count benefit of highly active antiretroviral therapy (HAART) unique to triple therapy or PI-containing regimens.
Reversible flowchart languages and the structured reversible program theorem
DEFF Research Database (Denmark)
Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert
2008-01-01
Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...
Reversible targeting of noncatalytic cysteines with chemically tuned electrophiles
DEFF Research Database (Denmark)
Serafimova, Iana M; Pufall, Miles A; Krishnan, Shyam
2012-01-01
Targeting noncatalytic cysteine residues with irreversible acrylamide-based inhibitors is a powerful approach for enhancing pharmacological potency and selectivity. Nevertheless, concerns about off-target modification motivate the development of reversible cysteine-targeting strategies. Here we...... of these electrophiles into a noncovalent kinase-recognition scaffold produced slowly dissociating, covalent inhibitors of the p90 ribosomal protein S6 kinase RSK2. A cocrystal structure revealed specific noncovalent interactions that stabilize the complex by positioning the electrophilic carbon near the targeted...
Thakkar, Vidhi D; Cox, Robert M; Sawatsky, Bevan; da Fontoura Budaszewski, Renata; Sourimant, Julien; Wabbel, Katrin; Makhsous, Negar; Greninger, Alexander L; von Messling, Veronika; Plemper, Richard K
2018-04-15
The paramyxovirus replication machinery comprises the viral large (L) protein and phosphoprotein (P-protein) in addition to the nucleocapsid (N) protein, which encapsidates the single-stranded RNA genome. Common to paramyxovirus N proteins is a C-terminal tail (Ntail). The mechanistic role and relevance for virus replication of the structurally disordered central Ntail section are unknown. Focusing initially on members of the Morbillivirus genus, a series of measles virus (MeV) and canine distemper virus (CDV) N proteins were generated with internal deletions in the unstructured tail section. N proteins with large tail truncations remained bioactive in mono- and polycistronic minireplicon assays and supported efficient replication of recombinant viruses. Bioactivity of Ntail mutants extended to N proteins derived from highly pathogenic Nipah virus. To probe an effect of Ntail truncations on viral pathogenesis, recombinant CDVs were analyzed in a lethal CDV/ferret model of morbillivirus disease. The recombinant viruses displayed different stages of attenuation ranging from ameliorated clinical symptoms to complete survival of infected animals, depending on the molecular nature of the Ntail truncation. Reinfection of surviving animals with pathogenic CDV revealed robust protection against a lethal challenge. The highly attenuated virus was genetically stable after ex vivo passaging and recovery from infected animals. Mechanistically, gradual viral attenuation coincided with stepwise altered viral transcriptase activity