Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2010-03-01

Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

Science.gov (United States)

Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

2008-10-01

Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2009-11-01

Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

Directory of Open Access Journals (Sweden)

Lucianna Helene Santos

2015-11-01

Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

Science.gov (United States)

Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

2002-12-01

Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

NARCIS (Netherlands)

Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

2004-01-01

Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

OpenAIRE

Nicolas Sluis-Cremer

2014-01-01

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

Science.gov (United States)

Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

2009-01-01

We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

Science.gov (United States)

Tarasova, O A; Filimonov, D A; Poroikov, V V

2017-10-01

Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India.

Science.gov (United States)

Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami

2017-06-01

We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

Science.gov (United States)

Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

2000-05-18

To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

Comparison of single and boosted protease inhibitor versus nonnucleoside reverse transcriptase inhibitor-containing cART regimens in antiretroviral-naïve patients starting cART after January 1, 2000

DEFF Research Database (Denmark)

Mocroft, A; Horban, A; Clumeck, N

2006-01-01

increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)

Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

2013-11-01

Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

DEFF Research Database (Denmark)

Fox, Zoe; Phillips, Andrew; Cohen, Cal

2008-01-01

the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats

Science.gov (United States)

Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin

2011-01-01

In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

Czech Academy of Sciences Publication Activity Database

Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

2016-01-01

Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

2011-01-01

We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

Directory of Open Access Journals (Sweden)

Lapadula Giuseppe

2007-05-01

Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

Science.gov (United States)

Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

2004-01-01

The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family.

Science.gov (United States)

Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong

2012-01-01

1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.

Science.gov (United States)

Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M

2017-12-01

Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

A trypsin inhibitor from rambutan seeds with antitumor, anti-HIV-1 reverse transcriptase, and nitric oxide-inducing properties.

Science.gov (United States)

Fang, Evandro Fei; Ng, Tzi Bun

2015-04-01

Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.

Etravirine and rilpivirine resistance in HIV-1 subtype CRF01_AE-infected adults failing non-nucleoside reverse transcriptase inhibitor-based regimens.

Science.gov (United States)

Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat

2011-01-01

We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.

A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

NARCIS (Netherlands)

Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

2011-01-01

The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations.

Science.gov (United States)

Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P

2000-05-04

Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

Risk Factors for Incident Diabetes in a Cohort Taking First-Line Nonnucleoside Reverse Transcriptase Inhibitor-Based Antiretroviral Therapy.

Science.gov (United States)

Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen

2016-03-01

Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.

Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

Directory of Open Access Journals (Sweden)

Ana Luiza Chaves Valadão

2015-06-01

Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

Directory of Open Access Journals (Sweden)

Oluwafeyisetan O. Adebiyi

2015-12-01

Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme

Science.gov (United States)

Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni

2005-01-01

Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors.

Science.gov (United States)

Sluis-Cremer, Nicolas

2014-07-31

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

International Nuclear Information System (INIS)

Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

2004-01-01

Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

Directory of Open Access Journals (Sweden)

Ajay Kumar

2010-01-01

Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.

Science.gov (United States)

Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

2018-01-01

Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

Directory of Open Access Journals (Sweden)

Marcin Kierczak

2009-10-01

Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

Directory of Open Access Journals (Sweden)

Meytal Galilee

2018-01-01

Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) using pre-steady-state kinetics.

Science.gov (United States)

Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S

2014-06-01

The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.

Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

Science.gov (United States)

Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

2016-09-30

We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

International Nuclear Information System (INIS)

Bavand, M.R.; Laub, O.

1988-01-01

Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

Nicolas Sluis-Cremer

2014-07-01

Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations.

Science.gov (United States)

Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark

2013-11-01

BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

Science.gov (United States)

Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

2014-01-01

The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

International Nuclear Information System (INIS)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

2015-01-01

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

Energy Technology Data Exchange (ETDEWEB)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

2015-10-23

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

S. Ganguly

2008-01-01

Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

Structural optimization of N1-aryl-benzimidazoles for the discovery of new non-nucleoside reverse transcriptase inhibitors active against wild-type and mutant HIV-1 strains.

Science.gov (United States)

Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania

2018-02-01

Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

DEFF Research Database (Denmark)

Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

2013-01-01

Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

NARCIS (Netherlands)

I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

2015-01-01

textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

Immune pressure analysis of protease and reverse transcriptase ...

African Journals Online (AJOL)

/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

OpenAIRE

Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

2014-01-01

The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.

Science.gov (United States)

Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D

2006-11-15

TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

Calibrated user-friendly reverse transcriptase-PCR assay

DEFF Research Database (Denmark)

Bor, M V; Sørensen, B S; Rammer, P

1998-01-01

We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase.

Science.gov (United States)

Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong

2018-06-18

We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H  = 1.77 μM, IC 50 IN  = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

Science.gov (United States)

House, M.L.; Kim, C.H.; Reno, P.W.

1998-01-01

Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

Science.gov (United States)

Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

2013-06-18

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor.

Science.gov (United States)

Markowitz, Martin; Sarafianos, Stefan G

2018-07-01

4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

Pharmacokinetics and tolerability of the new second-generation nonnucleoside reverse- transcriptase inhibitor KM-023 in healthy subjects

Directory of Open Access Journals (Sweden)

Cha YJ

2014-09-01

Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600

Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

OpenAIRE

Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

2008-01-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection.

Science.gov (United States)

Giacobbi, Nicholas S; Sluis-Cremer, Nicolas

2017-07-01

Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.

Structural and Preclinical Studies of Computationally Designed Non-Nucleoside Reverse Transcriptase Inhibitors for Treating HIV infection

Energy Technology Data Exchange (ETDEWEB)

Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.

2017-02-06

The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.

Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

Science.gov (United States)

Patick, A K; Boritzki, T J; Bloom, L A

1997-10-01

Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

Directory of Open Access Journals (Sweden)

Mark A Winters

Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues

Science.gov (United States)

Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang

2006-05-01

To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

Inhibition of human immunodeficiency virus type 1 infection by the candidate microbicide dapivirine, a nonnucleoside reverse transcriptase inhibitor.

Science.gov (United States)

Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R

2009-02-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.

Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

International Nuclear Information System (INIS)

Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

1986-01-01

The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial.

Science.gov (United States)

Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H

2015-12-15

Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

Science.gov (United States)

Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

2017-06-16

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission.

Science.gov (United States)

Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido

2013-09-01

Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

Design, synthesis and antiviral evaluation of novel heteroarylcarbothioamide derivatives as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and RDDP functions.

Science.gov (United States)

Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo

2017-08-31

In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

Science.gov (United States)

Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

2010-12-12

Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients enrolled in the D:A:D study: a multi-cohort collaboration

DEFF Research Database (Denmark)

Sabin, Caroline A; Worm, Signe W; Weber, Rainer

2008-01-01

cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...

Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

International Nuclear Information System (INIS)

Spadafora, C.; Sciamanna, I.; Misteli, T.

2009-01-01

Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

Active methamphetamine use is associated with transmitted drug resistance to non-nucleoside reverse transcriptase inhibitors in individuals with HIV infection of unknown duration.

Science.gov (United States)

Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M

2007-01-01

Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.

Crystallographic Study of a Novel Sub-Nanomolar Inhibitor Provides Insight on the Binding Interactions of Alkenyldiarylmethanes with Human Immunodeficiency Virus-1 (HIV-1) Reverse Transcriptase†

Science.gov (United States)

Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark

2009-01-01

Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161

Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.

Science.gov (United States)

Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang

2017-12-01

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

Science.gov (United States)

Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

2016-06-01

Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

Active Methamphetamine Use is Associated with Transmitted Drug Resis-tance to Non-Nucleoside Reverse Transcriptase Inhibitors in Individuals with HIV Infection of Unknown Duration

Science.gov (United States)

Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M

2007-01-01

Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691

Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

Directory of Open Access Journals (Sweden)

Edward J. Steele

2017-11-01

Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

Nelfinavir and Non-Nucleoside Reverse Transcriptase Inhibitor-Based Salvage Regimes in Heavily Hiv Pretreated Patients

Directory of Open Access Journals (Sweden)

Jean-Guy Baril

2003-01-01

Full Text Available OBJECTIVE: To assess the efficacy of nelfinavir mesylate (NFV in combination with delavirdine mesylate(DLV or efavirenz (EFV and other antiretroviral agents following virological failure on other protease inhibitor (PI-based regimens.

Discovery of dapivirine, a nonnucleoside HIV-1 reverse transcriptase inhibitor, as a broad-spectrum antiviral against both influenza A and B viruses.

Science.gov (United States)

Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun

2017-09-01

The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.

The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

Directory of Open Access Journals (Sweden)

Ilaria eSciamanna

2016-02-01

Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

Science.gov (United States)

Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

2016-02-01

In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

The reverse transcription inhibitor abacavir shows anticancer activity in prostate cancer cell lines.

Directory of Open Access Journals (Sweden)

Francesca Carlini

Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.

Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility.

Science.gov (United States)

Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W

2012-05-01

Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

Science.gov (United States)

Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

2017-11-08

The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

International Nuclear Information System (INIS)

Ferkous, F.; Saihi, Y.

2018-01-01

Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

Science.gov (United States)

Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

2015-10-01

Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

International Nuclear Information System (INIS)

Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

2011-01-01

LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

Science.gov (United States)

Zhao, Chen; Pyle, Anna Marie

2017-12-01

The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

Science.gov (United States)

Collins, Kathleen; Nilsen, Timothy W

2013-08-01

Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

Science.gov (United States)

Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

1972-01-01

Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

Science.gov (United States)

Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

2014-04-01

A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

Introducing Catastrophe-QSAR. Application on Modeling Molecular Mechanisms of Pyridinone Derivative-Type HIV Non-Nucleoside Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

Marius Lazea

2011-12-01

Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.

3D-QSAR CoMFA of a series of DABO derivatives as HIV-1 reverse transcriptase non-nucleoside inhibitors.

Science.gov (United States)

de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão

2008-08-01

A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.

A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

Science.gov (United States)

Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

2015-08-01

completion. We show here for the first time that a single mutation in HIV-1 reverse transcriptase (L92P) selectively abolishes strand transfers without affecting the enzyme's DNA polymerase and RNase H functions. When this mutation was introduced into an infectious HIV-1 clone, viral replication was lost due to an impaired intracellular strand transfer, thus supporting the in vitro data. Therefore, finding novel drugs that target HIV-1 reverse transcriptase Leu92 may be beneficial for developing new potent and selective inhibitors of retroviral reverse transcription that will obstruct HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

DEFF Research Database (Denmark)

Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy

2011-01-01

Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

Science.gov (United States)

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

International Nuclear Information System (INIS)

Lund, Kaleb C.; Wallace, Kendall B.

2008-01-01

Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

Science.gov (United States)

Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

2016-01-01

Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

OpenAIRE

DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

2012-01-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

Science.gov (United States)

Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

2018-01-02

The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

Science.gov (United States)

Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

2011-02-01

Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

Science.gov (United States)

Zanetti, Maurizio

2017-02-01

Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

NARCIS (Netherlands)

Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

2013-01-01

The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

Molecular Docking Studies of Marine Diterpenes as Inhibitors of Wild-Type and Mutants HIV-1 Reverse Transcriptase

Directory of Open Access Journals (Sweden)

Alessandra M. T. de Souza

2013-10-01

Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.

Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

Energy Technology Data Exchange (ETDEWEB)

Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

2011-12-08

RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

Directory of Open Access Journals (Sweden)

Ammad Ahmad Farooqi

2018-04-01

Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

Directory of Open Access Journals (Sweden)

Markus Hecht

Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

OpenAIRE

Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

2015-01-01

Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

Development and Characterization of a Vaginal Film Containing Dapivirine, a Non- nucleoside Reverse Transcriptase Inhibitor (NNRTI), for prevention of HIV-1 sexual transmission.

Science.gov (United States)

Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia

2011-06-01

Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.

Parallel screening of drug-like natural compounds using Caco-2 cell permeability QSAR model with applicability domain, lipophilic ligand efficiency index and shape property: A case study of HIV-1 reverse transcriptase inhibitors

Science.gov (United States)

Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.

2017-10-01

The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.

Molecular docking of (5E)-3-(2-aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione on HIV-1 reverse transcriptase: novel drug acting on enzyme.

Science.gov (United States)

Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan

2012-01-01

The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.

Efavirenz or nevirapine in three-drug combination therapy with two nucleoside or nucleotide-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals.

Science.gov (United States)

Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi

2016-12-10

The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure

Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

Science.gov (United States)

Li, Runqin; Zhang, Yinglin

2016-01-01

Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

NARCIS (Netherlands)

Oude Essink, B. B.; Das, A. T.; Berkhout, B.

1995-01-01

Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

NEW DRUGS NEW TARGETS AND NOVEL ANTIRETROVIRALS

African Journals Online (AJOL)

2005-11-02

Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).

Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.

Science.gov (United States)

Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V

2011-12-20

Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

Directory of Open Access Journals (Sweden)

Elisabeth Humphris-Narayanan

Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

DEFF Research Database (Denmark)

Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

2004-01-01

Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

Application of 3D-QSAR, Pharmacophore, and Molecular Docking in the Molecular Design of Diarylpyrimidine Derivatives as HIV-1 Nonnucleoside Reverse Transcriptase Inhibitors.

Science.gov (United States)

Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi

2018-05-11

Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.

New targets and novel antiretrovirals | Wood | Southern African ...

African Journals Online (AJOL)

Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). These ARV classes ...

Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

Science.gov (United States)

Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

2013-10-01

High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

NMR structure of the HIV-1 reverse transcriptase thumb subdomain

Energy Technology Data Exchange (ETDEWEB)

Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

2016-12-15

The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

Science.gov (United States)

Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

2016-05-01

Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

Body composition and metabolic outcomes after 96 weeks of treatment with ritonavir-boosted lopinavir plus either nucleoside or nucleotide reverse transcriptase inhibitors or raltegravir in patients with HIV with virological failure of a standard first-line antiretroviral therapy regimen: a substudy of the randomised, open-label, non-inferiority SECOND-LINE study.

Science.gov (United States)

Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A

2017-01-01

Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali

2015-11-27

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

2015-01-01

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

International Nuclear Information System (INIS)

Starnes, M.C.

1988-01-01

2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

Science.gov (United States)

Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

2018-05-03

Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

NARCIS (Netherlands)

Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

2010-01-01

Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

Directory of Open Access Journals (Sweden)

Dolores Bautista-España

Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

Science.gov (United States)

Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

2007-01-01

Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

Science.gov (United States)

Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

2012-08-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

Directory of Open Access Journals (Sweden)

Ma Bi

2017-10-01

Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

Science.gov (United States)

Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

2016-05-01

Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

Science.gov (United States)

Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

2009-01-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331

Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

Science.gov (United States)

Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

2016-04-01

Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

Reverse zymography alone does not confirm presence of a protease inhibitor.

Science.gov (United States)

Dutta, Sangita; Bhattacharyya, Debasish

2013-03-01

Reverse zymography is applied for identification and semi-quantification of protease inhibitors that are of protein in nature. However, a protein that shows band in reverse zymography against a protease used for digestion of the gel need not be an inhibitor; it might be resistant to degradation by the protease. We demonstrate that in reverse zymography, avidin, streptavidin and the leaf extract of Catharanthus roseus behave like inhibitors of proteases like papain, ficin, bromelain extracts from pineapple leaf, stem and fruit and trypsin. Still, they do not act as inhibitors of those proteases when enzyme assays were done in solution. In reverse zymography, the extract of pineapple crown leaf shows two major inhibitor bands against its own proteases. Identification of these proteins from sequences derived from MALDI TOF MS analysis indicated that they are fruit and stem bromelains. Avidin, streptavidin and bromelains are 'kinetically stable proteins' that are usually resistant to proteolysis. Thus, it is recommended that identification of an inhibitor of a protease by reverse zymography should be supported by independent assay methods for confirmation.

Safety, tolerability and pharmacokinetics of doravirine, a novel HIV non-nucleoside reverse transcriptase inhibitor, after single and multiple doses in healthy subjects.

Science.gov (United States)

Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R

2015-01-01

Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once

Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

Science.gov (United States)

Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

2009-06-01

Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

Directory of Open Access Journals (Sweden)

Weizi Liang

Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

A comparison of the ability of rilpivirine (TMC278 and selected analogues to inhibit clinically relevant HIV-1 reverse transcriptase mutants

Directory of Open Access Journals (Sweden)

Johnson Barry C

2012-12-01

Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.

HIV Protease Inhibitor Use During Pregnancy Is Associated With Decreased Progesterone Levels, Suggesting a Potential Mechanism Contributing to Fetal Growth Restriction

Science.gov (United States)

Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R.; Yudin, Mark H.; Murphy, Kellie E.; Walmsley, Sharon L.; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena

2015-01-01

Background. Protease inhibitor (PI)–based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. Methods. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. Results. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Conclusions. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. PMID:25030058

HIV protease inhibitor use during pregnancy is associated with decreased progesterone levels, suggesting a potential mechanism contributing to fetal growth restriction.

Science.gov (United States)

Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R; Yudin, Mark H; Murphy, Kellie E; Walmsley, Sharon L; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena

2015-01-01

Protease inhibitor (PI)-based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Identification of a methylated oligoribonucleotide as a potent inhibitor of HIV-1 reverse transcription complex.

Science.gov (United States)

Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc

2011-07-01

Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.

Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

Science.gov (United States)

Wang, Shuwen; Zhu, Jiyue

2003-05-23

The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

Directory of Open Access Journals (Sweden)

Yong Teng

2014-02-01

Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

Science.gov (United States)

A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

Indanones as high-potency reversible inhibitors of monoamine oxidase.

Science.gov (United States)

Mostert, Samantha; Petzer, Anél; Petzer, Jacobus P

2015-05-01

Recent reports document that α-tetralone (3,4-dihydro-2H-naphthalen-1-one) is an appropriate scaffold for the design of high-potency monoamine oxidase (MAO) inhibitors. Based on the structural similarity between α-tetralone and 1-indanone, the present study involved synthesis of 34 1-indanone and related indane derivatives as potential inhibitors of recombinant human MAO-A and MAO-B. The results show that C6-substituted indanones are particularly potent and selective MAO-B inhibitors, with IC50 values ranging from 0.001 to 0.030 μM. C5-Substituted indanone and indane derivatives are comparatively weaker MAO-B inhibitors. Although the 1-indanone and indane derivatives are selective inhibitors of the MAO-B isoform, a number of homologues are also potent MAO-A inhibitors, with three homologues possessing IC50 values 1-indanone as a reversible MAO inhibitor with a competitive mode of inhibition. It may be concluded that 1-indanones are promising leads for the design of therapies for neurodegenerative and neuropsychiatric disorders such as Parkinson's disease and depression. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 2.

Science.gov (United States)

McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

2016-06-15

Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.

The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

Directory of Open Access Journals (Sweden)

Gronenborn Angela M

2010-05-01

Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

2010-03-26

The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

The history of antiretrovirals: key discoveries over the past 25 years.

Science.gov (United States)

De Clercq, Erik

2009-09-01

Within 25 years after zidovudine (3'-azido-2',3'-dideoxythymidine, AZT) was first described as an inhibitor of HIV replication, 25 anti-HIV drugs have been formally approved for clinical use in the treatment of HIV infections: seven nucleoside reverse transcriptase inhibitors (NRTIs): zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir and emtricitabine; one nucleotide reverse transcriptase inhibitor (NtRTI): tenofovir [in its oral prodrug form: tenofovir disoproxil fumarate (TDF)]; four non-nucleoside reverse transcriptase inhibitors (NNRTIs): nevirapine, delavirdine, efavirenz and etravirine; ten protease inhibitors (PIs): saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, tipranavir and darunavir; one fusion inhibitor (FI): enfuvirtide; one co-receptor inhibitor (CRI): maraviroc and one integrase inhibitor (INI): raltegravir. These compounds are used in various drug combination (some at fixed dose) regimens so as to achieve the highest possible benefit and tolerability, and to diminish the risk of virus-drug resistance development. (c) 2009 John Wiley & Sons, Ltd.

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

Science.gov (United States)

Schuster, W; Brennicke, A

1987-01-01

We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

OpenAIRE

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-01-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

K70Q adds high-level tenofovir resistance to "Q151M complex" HIV reverse transcriptase through the enhanced discrimination mechanism.

Directory of Open Access Journals (Sweden)

Atsuko Hachiya

2011-01-01

Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.

Understanding the Molecular Determinant of Reversible Human Monoamine Oxidase B Inhibitors Containing 2H-Chromen-2-One Core: Structure-Based and Ligand-Based Derived Three-Dimensional Quantitative Structure-Activity Relationships Predictive Models.

Science.gov (United States)

Mladenović, Milan; Patsilinakos, Alexandros; Pirolli, Adele; Sabatino, Manuela; Ragno, Rino

2017-04-24

Monoamine oxidase B (MAO B) catalyzes the oxidative deamination of aryalkylamines neurotransmitters with concomitant reduction of oxygen to hydrogen peroxide. Consequently, the enzyme's malfunction can induce oxidative damage to mitochondrial DNA and mediates development of Parkinson's disease. Thus, MAO B emerges as a promising target for developing pharmaceuticals potentially useful to treat this vicious neurodegenerative condition. Aiming to contribute to the development of drugs with the reversible mechanism of MAO B inhibition only, herein, an extended in silico-in vitro procedure for the selection of novel MAO B inhibitors is demonstrated, including the following: (1) definition of optimized and validated structure-based three-dimensional (3-D) quantitative structure-activity relationships (QSAR) models derived from available cocrystallized inhibitor-MAO B complexes; (2) elaboration of SAR features for either irreversible or reversible MAO B inhibitors to characterize and improve coumarin-based inhibitor activity (Protein Data Bank ID: 2V61 ) as the most potent reversible lead compound; (3) definition of structure-based (SB) and ligand-based (LB) alignment rule assessments by which virtually any untested potential MAO B inhibitor might be evaluated; (4) predictive ability validation of the best 3-D QSAR model through SB/LB modeling of four coumarin-based external test sets (267 compounds); (5) design and SB/LB alignment of novel coumarin-based scaffolds experimentally validated through synthesis and biological evaluation in vitro. Due to the wide range of molecular diversity within the 3-D QSAR training set and derived features, the selected N probe-derived 3-D QSAR model proves to be a valuable tool for virtual screening (VS) of novel MAO B inhibitors and a platform for design, synthesis and evaluation of novel active structures. Accordingly, six highly active and selective MAO B inhibitors (picomolar to low nanomolar range of activity) were disclosed as a

Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

International Nuclear Information System (INIS)

Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

2001-01-01

Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

2-(Alkyl/aryl)amino-6-benzylpyrimidin-4(3H)-ones as inhibitors of wild-type and mutant HIV-1: enantioselectivity studies.

Science.gov (United States)

Rotili, Dante; Samuele, Alberta; Tarantino, Domenico; Ragno, Rino; Musmuca, Ira; Ballante, Flavio; Botta, Giorgia; Morera, Ludovica; Pierini, Marco; Cirilli, Roberto; Nawrozkij, Maxim B; Gonzalez, Emmanuel; Clotet, Bonaventura; Artico, Marino; Esté, José A; Maga, Giovanni; Mai, Antonello

2012-04-12

The single enantiomers of two pyrimidine-based HIV-1 non-nucleoside reverse transcriptase inhibitors, 1 (MC1501) and 2 (MC2082), were tested in both cellular and enzyme assays. In general, the R forms were more potent than their S counterparts and racemates and (R)-2 was more efficient than (R)-1 and the reference compounds, with some exceptions. Interestingly, (R)-2 displayed a faster binding to K103N RT with respect to WT RT, while (R)-1 showed the opposite behavior. © 2012 American Chemical Society

The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

Directory of Open Access Journals (Sweden)

Niu Meijuan

2004-10-01

Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression.

Science.gov (United States)

Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong

2013-01-01

In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

Reverse transcriptase directs viral evolution in a deep ocean methane seep

Science.gov (United States)

Paul, B. G.; Bagby, S. C.

2013-12-01

Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

Structural Basis for the Inhibition of RNase H Activity of HIV-1 Reverse Transcriptase by RNase H Active Site-Directed Inhibitors

Energy Technology Data Exchange (ETDEWEB)

Su, Hua-Poo; Yan, Youwei; Prasad, G. Sridhar; Smith, Robert F.; Daniels, Christopher L.; Abeywickrema, Pravien D.; Reid, John C.; Loughran, H. Marie; Kornienko, Maria; Sharma, Sujata; Grobler, Jay A.; Xu, Bei; Sardana, Vinod; Allison, Timothy J.; Williams, Peter D.; Darke, Paul L.; Hazuda, Daria J.; Munshi, Sanjeev (Merck)

2010-09-02

HIV/AIDS continues to be a menace to public health. Several drugs currently on the market have successfully improved the ability to manage the viral burden in infected patients. However, new drugs are needed to combat the rapid emergence of mutated forms of the virus that are resistant to existing therapies. Currently, approved drugs target three of the four major enzyme activities encoded by the virus that are critical to the HIV life cycle. Although a number of inhibitors of HIV RNase H activity have been reported, few inhibit by directly engaging the RNase H active site. Here, we describe structures of naphthyridinone-containing inhibitors bound to the RNase H active site. This class of compounds binds to the active site via two metal ions that are coordinated by catalytic site residues, D443, E478, D498, and D549. The directionality of the naphthyridinone pharmacophore is restricted by the ordering of D549 and H539 in the RNase H domain. In addition, one of the naphthyridinone-based compounds was found to bind at a second site close to the polymerase active site and non-nucleoside/nucleotide inhibitor sites in a metal-independent manner. Further characterization, using fluorescence-based thermal denaturation and a crystal structure of the isolated RNase H domain reveals that this compound can also bind the RNase H site and retains the metal-dependent binding mode of this class of molecules. These structures provide a means for structurally guided design of novel RNase H inhibitors.

Prediction of the binding mode and resistance profile for a dual-target pyrrolyl diketo acid scaffold against HIV-1 integrase and reverse-transcriptase-associated ribonuclease H.

Science.gov (United States)

Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng

2018-06-27

The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.

On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

Science.gov (United States)

Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

2017-07-11

Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

Management of HIV During Pregnancy

OpenAIRE

Chamma JP; Monteleone VF; V dos Reis L; Bonafe SM; Panão M

2016-01-01

According to UNAIDS, in 2015, one hundred and fifty thousand children were infected by HIV worldwide, therefore the use of antiretroviral therapy (ARV) during pregnancy is an important development for the reduction of maternal-fetal transmission. The treatment of a pregnant woman is done by combining two different ARV classes. The combination of two nucleoside reverse transcriptase inhibitors (NRTIs) with one non-nucleoside reverse transcriptase inhibitor (NNRTI) or protease inhibitor (PI) is...

Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

Science.gov (United States)

Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

2008-09-01

We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 1.

Science.gov (United States)

Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

2016-06-15

Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification and characterization of the novel reversible and selective cathepsin X inhibitors.

Science.gov (United States)

Fonović, Urša Pečar; Mitrović, Ana; Knez, Damijan; Jakoš, Tanja; Pišlar, Anja; Brus, Boris; Doljak, Bojan; Stojan, Jure; Žakelj, Simon; Trontelj, Jurij; Gobec, Stanislav; Kos, Janko

2017-09-13

Cathepsin X is a cysteine peptidase involved in the progression of cancer and neurodegenerative diseases. Targeting this enzyme with selective inhibitors opens a new possibility for intervention in several therapeutic areas. In this study triazole-based reversible and selective inhibitors of cathepsin X have been identified. Their selectivity and binding is enhanced when the 2,3-dihydrobenzo[b][1,4]dioxine moiety is present as the R 1 substituent. Of a series of selected triazole-benzodioxine derivatives, compound 22 is the most potent inhibitor of cathepsin X carboxypeptidase activity (K i  = 2.45 ± 0.05 μM) with at least 100-fold greater selectivity in comparison to cathepsin B or other related cysteine peptidases. Compound 22 is not cytotoxic to prostate cancer cells PC-3 or pheochromocytoma PC-12 cells at concentrations up to 10 μM. It significantly inhibits the migration of tumor cells and increases the outgrowth of neurites, both processes being under the control of cathepsin X carboxypeptidase activity. Compound 22 and other characterized triazole-based inhibitors thus possess a great potential for further development resulting in several in vivo applications.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

Directory of Open Access Journals (Sweden)

Warrilow David

2008-12-01

Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss.

Science.gov (United States)

Zhu, Tao; Niu, Deng-Ke

2013-03-05

Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.

Gibbs Free Energy of Hydrolytic Water Molecule in Acyl-Enzyme Intermediates of a Serine Protease: A Potential Application for Computer-Aided Discovery of Mechanism-Based Reversible Covalent Inhibitors.

Science.gov (United States)

Masuda, Yosuke; Yamaotsu, Noriyuki; Hirono, Shuichi

2017-01-01

In order to predict the potencies of mechanism-based reversible covalent inhibitors, the relationships between calculated Gibbs free energy of hydrolytic water molecule in acyl-trypsin intermediates and experimentally measured catalytic rate constants (k cat ) were investigated. After obtaining representative solution structures by molecular dynamics (MD) simulations, hydration thermodynamics analyses using WaterMap™ were conducted. Consequently, we found for the first time that when Gibbs free energy of the hydrolytic water molecule was lower, logarithms of k cat were also lower. The hydrolytic water molecule with favorable Gibbs free energy may hydrolyze acylated serine slowly. Gibbs free energy of hydrolytic water molecule might be a useful descriptor for computer-aided discovery of mechanism-based reversible covalent inhibitors of hydrolytic enzymes.

Bauhinia variegata var. variegata trypsin inhibitor: From isolation to potential medicinal applications

International Nuclear Information System (INIS)

Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun

2010-01-01

Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K i , 0.1 x 10 -9 M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.

Design and synthesis of N₁-aryl-benzimidazoles 2-substituted as novel HIV-1 non-nucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Monforte, Anna-Maria; Ferro, Stefania; De Luca, Laura; Lo Surdo, Giuseppa; Morreale, Francesca; Pannecouque, Christophe; Balzarini, Jan; Chimirri, Alba

2014-02-15

A series of novel N1-aryl-2-arylthioacetamido-benzimidazoles were synthesized and evaluated as inhibitors of human immunodeficiency virus type-1 (HIV-1). Some of them proved to be effective in inhibiting HIV-1 replication at submicromolar and nanomolar concentration acting as HIV-1 non-nucleoside RT inhibitors (NNRTIs), with low cytotoxicity. The preliminary structure-activity relationship (SAR) of these new derivatives was discussed and rationalized by docking studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

Extensive Mutagenesis of the Conserved Box E Motif in Duck Hepatitis B Virus P Protein Reveals Multiple Functions in Replication and a Common Structure with the Primer Grip in HIV-1 Reverse Transcriptase

OpenAIRE

Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael

2012-01-01

Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...

Prevalence of genotypic HIV-1 drug resistance in Thailand, 2002

Directory of Open Access Journals (Sweden)

Watitpun Chotip

2003-03-01

Full Text Available Abstract Background The prices of reverse transcriptase (RT inhibitors in Thailand have been reduced since December 1, 2001. It is expected that reduction in the price of these inhibitors may influence the drug resistance mutation pattern of HIV-1 among infected people. This study reports the frequency of HIV-1 genetic mutation associated with drug resistance in antiretroviral-treated patients from Thailand. Methods Genotypic resistance testing was performed on samples collected in 2002 from 88 HIV-1 infected individuals. Automated DNA sequencing was used to genotype the HIV-1 polymerase gene isolated from patients' plasma. Results Resistance to protease inhibitors, nucleoside and non-nucleoside reverse transcriptase inhibitors were found in 10 (12%, 42 (48% and 19 (21% patients, respectively. The most common drug resistance mutations in the protease gene were at codon 82 (8%, 90 (7% and 54 (6%, whereas resistant mutations at codon 215 (45%, 67 (40%, 41 (38% and 184 (27% were commonly found in the RT gene. This finding indicates that genotypic resistance to nucleoside reverse transcriptase inhibitors was prevalent in 2002. The frequency of resistant mutations corresponding to non-nucleoside reverse transcriptase inhibitors was three times higher-, while resistant mutation corresponding to protease inhibitors was two times lower than those frequencies determined in 2001. Conclusion This study shows that the frequencies of RT inhibitor resistance mutations have been increased after the reduction in the price of RT inhibitors since December 2001. We believe that this was an important factor that influenced the mutation patterns of HIV-1 protease and RT genes in Thailand.

Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

Science.gov (United States)

Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

2014-01-01

Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

(3,4-dihydroisoquinolin-2(1H)-yl)

Indian Academy of Sciences (India)

Administrator

HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.

High-throughput screening using pseudotyped lentiviral particles: a strategy for the identification of HIV-1 inhibitors in a cell-based assay.

Science.gov (United States)

Garcia, Jean-Michel; Gao, Anhui; He, Pei-Lan; Choi, Joyce; Tang, Wei; Bruzzone, Roberto; Schwartz, Olivier; Naya, Hugo; Nan, Fa-Jun; Li, Jia; Altmeyer, Ralf; Zuo, Jian-Ping

2009-03-01

Two decades after its discovery the human immunodeficiency virus (HIV) is still spreading worldwide and killing millions. There are 25 drugs formally approved for HIV currently on the market, but side effects as well as the emergence of HIV strains showing single or multiple resistances to current drug-therapy are causes for concern. Furthermore, these drugs target only 4 steps of the viral cycle, hence the urgent need for new drugs and also new targets. In order to tackle this problem, we have devised a cell-based assay using lentiviral particles to look for post-entry inhibitors of HIV-1. We report here the assay development, validation as well as confirmation of the hits using both wild-type and drug-resistant HIV-1 viruses. The screening was performed on an original library, rich in natural compounds and pure molecules from Traditional Chinese Medicine pharmacopoeia, which had never been screened for anti-HIV activity. The identified hits belong to four chemical sub-families that appear to be all non-nucleoside reverse transcriptase inhibitors (NNRTIs). Secondary tests with live viruses showed that there was good agreement with pseudotyped particles, confirming the validity of this approach for high-throughput drug screens. This assay will be a useful tool that can be easily adapted to screen for inhibitors of viral entry.

Diabetes mellitus in HIV-infected patients receiving antiretroviral ...

African Journals Online (AJOL)

Primary analysis using conditional logistic regression was employed to estimate univariate .... Refers to first-line regimen in Botswana – either non-nucleoside reverse transcriptase inhibitor-based regimen (NVP or. EFV) or .... Public Health.

Structure-Activity Analysis of Vinylogous Urea Inhibitors of Human Immunodeficiency Virus-Encoded Ribonuclease H ▿

OpenAIRE

Chung, Suhman; Wendeler, Michaela; Rausch, Jason W.; Beilhartz, Greg; Gotte, Matthias; O'Keefe, Barry R.; Bermingham, Alun; Beutler, John A.; Liu, Shixin; Zhuang, Xiaowei; Le Grice, Stuart F. J.

2010-01-01

Vinylogous ureas 2-amino-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxamide and N-[3-(aminocarbonyl)-4,5-dimethyl-2-thienyl]-2-furancarboxamide (compounds 1 and 2, respectively) were recently identified to be modestly potent inhibitors of the RNase H activity of HIV-1 and HIV-2 reverse transcriptase (RT). Both compounds shared a 3-CONH2-substituted thiophene ring but were otherwise structurally unrelated, which prevented a precise definition of the pharmacophore. We have therefore exa...

Bauhinia variegata var. variegata trypsin inhibitor: From isolation to potential medicinal applications

Energy Technology Data Exchange (ETDEWEB)

Fang, Evandro Fei; Wong, Jack Ho [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Bah, Clara Shui Fern [Department of Food Science, Division of Sciences, University of Otago (New Zealand); Lin, Peng [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Tsao, Sai Wah [Department of Anatomy, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Sassoon Road, Pokfulam, Hong Kong SAR (China); Ng, Tzi Bun, E-mail: b021770@mailserv.cuhk.edu.hk [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China)

2010-06-11

Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K{sub i}, 0.1 x 10{sup -9} M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.

Bauhinia variegata var. variegata trypsin inhibitor: from isolation to potential medicinal applications.

Science.gov (United States)

Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun

2010-06-11

Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K(i), 0.1 x 10(-9)M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI. (c) 2010 Elsevier Inc. All rights reserved.

Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

Science.gov (United States)

Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

2007-10-01

Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

Directory of Open Access Journals (Sweden)

Soo-Huey Yap

2007-12-01

Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

Science.gov (United States)

Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

2017-02-01

Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

Protease inhibitor associated mutations compromise the efficacy of therapy in human immunodeficiency virus – 1 (HIV-1 infected pediatric patients: a cross-sectional study

Directory of Open Access Journals (Sweden)

Petrova Anna

2007-07-01

Full Text Available Abstract Background Although the introduction of combined therapy with reverse transcriptase and protease inhibitors has resulted in considerable decrease in HIV related mortality; it has also induced the development of multiple drug-resistant HIV-1 variants. The few studies on HIV-1 mutagenesis in HIV infected children have not evaluated the impact of HIV-1 mutations on the clinical, virological and immunological presentation of HIV disease that is fundamental to optimizing the treatment regimens for these patients. Results A cross sectional study was conducted to evaluate the impact of treatment regimens and resistance mutation patterns on the clinical, virological, and immunological presentation of HIV disease in 41 children (25 male and 16 female at the Robert Wood Johnson Pediatric AIDS Program in New Brunswick, New Jersey. The study participants were symptomatic and had preceding treatment history with combined ARV regimens including protease inhibitors (PIs, nucleoside reverse transcriptase inhibitors (NRTIs and non-nucleoside reverse transcriptase inhibitors (NNRTIs. Fifteen (36.6% children were treated with NRTI+NNRTI+ PI, 6 (14.6% with NRTI+NNRTIs, 13 (31.7% with NRTI+PIs, and the remaining 7 (17.1% received NRTIs only. Combined ARV regimens did not significantly influence the incidence of NRTI and NNRTI associated mutations. The duration of ARV therapy and the child's age had no significant impact on the ARV related mutations. The clinico-immunological presentation of the HIV disease was not associated with ARV treatment regimens or number of resistance mutations. However, primary mutations in the protease (PR gene increased the likelihood of plasma viral load (PVL ≥ 10,000 copies/mL irrespective of the child's age, duration of ARV therapy, presence of NRTI and NNRTI mutation. Viremia ≥ 10,000 copies/mL was recorded in almost all the children with primary mutations in the PR region (n = 12/13, 92.3% as compared with only 50.0% (n

A reversed-phase compatible thin-layer chromatography autography for the detection of acetylcholinesterase inhibitors.

Science.gov (United States)

Ramallo, I Ayelen; García, Paula; Furlan, Ricardo L E

2015-11-01

A dual readout autographic assay to detect acetylcholinesterase inhibitors present in complex matrices adsorbed on reversed-phase or normal-phase thin-layer chromatography plates is described. Enzyme gel entrapment with an amphiphilic copolymer was used for assay development. The effects of substrate and enzyme concentrations, pH, incubation time, and incubation temperature on the sensitivity and the detection limit of the assay were evaluated. Experimental design and response surface methodology were used to optimize conditions with a minimum number of experiments. The assay allowed the detection of 0.01% w/w of physostigmine in both a spiked Sonchus oleraceus L. extract chromatographed on normal phase and a spiked Pimenta racemosa (Mill.) J.W. Moore leaf essential oil chromatographed on reversed phase. Finally, the reversed-phase thin-layer chromatography assay was applied to reveal the presence of an inhibitor in the Cymbopogon citratus (DC.) Stapf essential oil. The developed assay is able to detect acetylcholinesterase inhibitors present in complex matrixes that were chromatographed in normal phase or reversed-phase thin-layer chromatography. The detection limit for physostigmine on both normal and reversed phase was of 1×10(-4) μg. The results can be read by a change in color and/or a change in fluorescence. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

PRACTICE OF USING VIRAL PROTEASE INHIBITORS IN CHILDREN WITH HIV INFECTION

Directory of Open Access Journals (Sweden)

V.B. Denisenko

2010-01-01

Full Text Available Selection of the most effective and safest high-active antiretroviral therapies is a critical issue faced by modern HIV medicine. Authors studied 28 children with HIV infection aged from 3 to 7 divided into two groups administered a combination of two HIV reverse transcriptase nucleoside inhibitors with viral protease nelfinavir inhibitors (n = 13 and lopinavir/ritonavir (n = 15. The subjects in both groups demonstrated a decreased frequency of HIV-associated symptoms and opportunistic infections, positive dynamics of immunological indicators, suppression of HIV replication. When lopinavir/ritonavir was administered, there was more even better dynamics in clinical, immunological and virologic parameters, which allows this medication to be recommended as a antiretroviral therapy for children. Key words: HIV infection, lopinavir/ritonavir, nelfinavir, children. (Pediatric Pharmacology. – 2010; 7(1:62-67

Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors

CSIR Research Space (South Africa)

Bode, ML

2011-06-01

Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...

Measuring enzymatic HIV-1 susceptibility to two reverse transcriptase inhibitors as a rapid and simple approach to HIV-1 drug-resistance testing.

Directory of Open Access Journals (Sweden)

Dieter Hoffmann

Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.

Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

Science.gov (United States)

Spackman, Erica; Suarez, David L

2005-01-01

Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

Docking and 3-D QSAR studies on indolyl aryl sulfones. Binding mode exploration at the HIV-1 reverse transcriptase non-nucleoside binding site and design of highly active N-(2-hydroxyethyl)carboxamide and N-(2-hydroxyethyl)carbohydrazide derivatives.

Science.gov (United States)

Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano

2005-01-13

Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.

Effect of the scale inhibitor on ion content in reverse osmosis system for seawater desalination

Science.gov (United States)

Gao, Yuhua; Liu, Zhenfa; Zhang, Lihui; Li, Haihua

2017-09-01

A scale inhibitor was synthesized from polysuccinimide with 2-aminoethanesulfonic acid and aspartic acid. The effect of scale inhibitor on ion content in reverse osmosis system for seawater desalination was studied. The results showed that the ion content of permeate water is lower with the scale inhibitor added in RO system for seawater desalination than without scale inhibitor. On the contrary, the ion content of concentrate water is higher when with scale inhibitor in RO system.

Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

Science.gov (United States)

Ngai, Patrick H K; Ng, T B

2003-11-14

From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

Science.gov (United States)

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity.

Science.gov (United States)

Li, An; Ziehr, Jessica L; Johnson, Kenneth A

2017-04-21

Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy

DEFF Research Database (Denmark)

Bruyand, Mathias; Ryom, Lene; Shepherd, Leah

2015-01-01

-AIDS-defining cancers (NADC), AIDS-defining cancers (ADC), and the most frequently occurring ADC (Kaposi sarcoma, non-Hodgkin lymphoma) and NADC (lung, invasive anal, head/neck cancers, and Hodgkin lymphoma). RESULTS: A total of 41,762 persons contributed 241,556 person-years (PY). A total of 1832 cancers were...

Apoptosis and reduced cell proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA.

Science.gov (United States)

Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin

2010-01-01

The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.

Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

International Nuclear Information System (INIS)

Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin

2008-01-01

Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

Targeted Transgenic Overexpression of Mitochondrial Thymidine Kinase (TK2) Alters Mitochondrial DNA (mtDNA) and Mitochondrial Polypeptide Abundance : Transgenic TK2, mtDNA, and Antiretrovirals

OpenAIRE

Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

2007-01-01

Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK...

Designing robust control-based HIV-treatment

Directory of Open Access Journals (Sweden)

Fredy Andrés Olarte Dussán

2008-05-01

Full Text Available Designing a robust control-based treatment for human immunodeficiency virus (HIV-infected patients was studied. The dynamics of the immune system’s response to infection was modelled using a 5th order nonlinear model with separate efficacy coefficients for protease inhibitor (PIs and reverse transcriptase inhibitors (RTIs. The immune res-ponse has been represented as an uncertain system due to errors in parameter estimation and the existence of un-modelled dynamics. A polytopic system was constructed incorporating all possible system parameter values. A con-trol system was designed using robust pole location techniques stabilising the polytopic system around an equilibrium point having a low viral load. Numerical simulation results (including the organism’s pharmacokinetical response to anti-retroviral drugs showed that the control law could lead to long-term stable conditions, even in extreme cases.

Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice.

Science.gov (United States)

Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue

2013-05-01

To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

Probing the communication of deoxythymidine triphosphate in HIV-1 reverse transcriptase by communication maps and interaction energy studies.

Science.gov (United States)

Gnanasekaran, Ramachandran

2017-11-08

We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.

Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages

Science.gov (United States)

Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis

2010-01-01

Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

International Nuclear Information System (INIS)

Zhu Hanneng; Chen Wenying; Xiong Sidong

2000-01-01

Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

DNA-directed control of enzyme-inhibitor complex formation: a modular approach to reversibly switch enzyme activity

NARCIS (Netherlands)

Janssen, B.M.G.; Engelen, W.; Merkx, M.

2015-01-01

DNA-templated reversible assembly of an enzyme–inhibitor complex is presented as a new and highly modular approach to control enzyme activity. TEM1-ß-lactamase and its inhibitor protein BLIP were conjugated to different oligonucleotides, resulting in enzyme inhibition in the presence of template

Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

OpenAIRE

Patick, A K; Boritzki, T J; Bloom, L A

1997-01-01

Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritona...

Diagnosis, antiretroviral therapy, and emergence of resistance to antiretroviral agents in HIV-2 infection: a review

Directory of Open Access Journals (Sweden)

Maia Hightower

Full Text Available Human immunodeficiency virus type 1 (HIV-1 and type 2 (HIV-2 are the causative agents of AIDS. HIV-2 is prevalent at moderate to high rates in West African countries, such as Senegal, Guinea, Gambia, and Cape Verde. Diagnosis of HIV-2 is made with a positive HIV-1/HIV-2 ELISA or simple/rapid assay, followed by one or two confirmatory tests specific for HIV-2. Following CD4+ T cell counts, HIV-2 viral burden and clinical signs and symptoms of immunodeficiency are beneficial in monitoring HIV-2 disease progression. Although non-nucleoside reverse transcriptase inhibitors are ineffective in treating HIV-2, nucleoside reverse transcriptase inhibitors and protease inhibitors can be effective in dual and triple antiretroviral regimens. Their use can decrease HIV-2 viral load, increase CD4+ T cell counts and improve AIDS-related symptoms. HIV-2 resistance to various nucleoside reverse transcriptase inhibitors and protease inhibitors, including zidovudine, lamivudine, ritonavir and indinavir, has been identified in some HIV-2 infected patients on antiretroviral therapy. The knowledge of HIV-2 peculiarities, when compared to HIV-1, is crucial to helping diagnose and guide the clinician in the choice of the initial antiretroviral regimen and for monitoring therapy success.

Antiretroviral Drug Use in a Cross-Sectional Population Survey in Africa: NIMH Project Accept (HPTN 043).

Science.gov (United States)

Fogel, Jessica M; Clarke, William; Kulich, Michal; Piwowar-Manning, Estelle; Breaud, Autumn; Olson, Matthew T; Marzinke, Mark A; Laeyendecker, Oliver; Fiamma, Agnès; Donnell, Deborah; Mbwambo, Jessie K K; Richter, Linda; Gray, Glenda; Sweat, Michael; Coates, Thomas J; Eshleman, Susan H

2017-02-01

Antiretroviral (ARV) drug treatment benefits the treated individual and can prevent HIV transmission. We assessed ARV drug use in a community-randomized trial that evaluated the impact of behavioral interventions on HIV incidence. Samples were collected in a cross-sectional survey after a 3-year intervention period. ARV drug testing was performed using samples from HIV-infected adults at 4 study sites (Zimbabwe; Tanzania; KwaZulu-Natal and Soweto, South Africa; survey period 2009-2011) using an assay that detects 20 ARV drugs (6 nucleoside/nucleotide reverse transcriptase inhibitors, 3 nonnucleoside reverse transcriptase inhibitors, and 9 protease inhibitors; maraviroc; raltegravir). ARV drugs were detected in 2011 (27.4%) of 7347 samples; 88.1% had 1 nonnucleoside reverse transcriptase inhibitors ± 1-2 nucleoside/nucleotide reverse transcriptase inhibitors. ARV drug detection was associated with sex (women>men), pregnancy, older age (>24 years), and study site (P < 0.0001 for all 4 variables). ARV drugs were also more frequently detected in adults who were widowed (P = 0.006) or unemployed (P = 0.02). ARV drug use was more frequent in intervention versus control communities early in the survey (P = 0.01), with a significant increase in control (P = 0.004) but not in intervention communities during the survey period. In KwaZulu-Natal, a 1% increase in ARV drug use was associated with a 0.14% absolute decrease in HIV incidence (P = 0.018). This study used an objective, biomedical approach to assess ARV drug use on a population level. This analysis identified factors associated with ARV drug use and provided information on ARV drug use over time. ARV drug use was associated with lower HIV incidence at 1 study site.

Update on HIV-1 acquired and transmitted drug resistance in Africa.

Science.gov (United States)

Ssemwanga, Deogratius; Lihana, Raphael W; Ugoji, Chinenye; Abimiku, Alash'le; Nkengasong, John; Dakum, Patrick; Ndembi, Nicaise

2015-01-01

The last ten years have witnessed a significant scale-up and access to antiretroviral therapy in Africa, which has improved patient quality of life and survival. One major challenge associated with increased access to antiretroviral therapy is the development of antiretroviral resistance due to inconsistent drug supply and/or poor patient adherence. We review the current state of both acquired and transmitted drug resistance in Africa over the past ten years (2001-2011) to identify drug resistance associated with the different drug regimens used on the continent and to help guide affordable strategies for drug resistance surveillance. A total of 161 references (153 articles, six reports and two conference abstracts) were reviewed. Antiretroviral resistance data was available for 40 of 53 African countries. A total of 5,541 adult patients from 99 studies in Africa were included in this analysis. The pooled prevalence of drug resistance mutations in Africa was 10.6%, and Central Africa had the highest prevalence of 54.9%. The highest prevalence of nucleoside reverse transcriptase inhibitor mutations was in the west (55.3%) and central (54.8%) areas; nonnucleoside reverse transcriptase inhibitor mutations were highest in East Africa (57.0%) and protease inhibitors mutations highest in Southern Africa (16.3%). The major nucleoside reverse transcriptase inhibitor mutation in all four African regions was M184V. Major nonnucleoside reverse transcriptase inhibitor as well as protease inhibitor mutations varied by region. The prevalence of drug resistance has remained low in several African countries although the emergence of drug resistance mutations varied across countries. Continued surveillance of antiretroviral therapy resistance remains crucial in gauging the effectiveness of country antiretroviral therapy programs and strategizing on effective and affordable strategies for successful treatment.

Reversal of sodium pump inhibitor induced vascular smooth muscle contraction with digibind. Stoichiometry and its implications.

Science.gov (United States)

Krep, H H; Graves, S W; Price, D A; Lazarus, M; Ensign, A; Soszynski, P A; Hollenberg, N K

1996-01-01

The possibility that a circulating sodium pump inhibitor contributes to the pathogenesis of volume-dependent hypertension via an action on vascular smooth muscle (VSM) is supported by multiple lines of investigation, but remains controversial. We had two goals in this study. The first was to compare the pattern of contractile response of rabbit aorta induced by two candidates, ouabain and a labile sodium pump inhibitor that we have identified in the peritoneal dialysate of volume-expanded hypertensive patients with chronic renal failure. Our second goal was to examine the ability of Digibind, a Fab fragment of antisera directed against digoxin, to reverse VSM contraction induced by both agents. Ouabain induced a concentration-dependent contraction, which was delayed in onset, was gradual, and reached a stable plateau after many hours. The labile sodium pump inhibitor induced a qualitatively similar series of responses. Digibind rapidly reversed the contractile responses to both sodium pump inhibitors, with a rate of relaxation that matched that induced by physical removal of the pump inhibitor from the bath. For ouabain, the Digibind:ouabain stoichiometry was highly predictable. When Digibind was present in a molar concentration equivalent to that of ouabain, or less, it had no effect. When the Digibind concentration was twice that of ouabain, complete relaxation occurred. Although the concentration:VSM response relationship for ouabain was steep, the concentration:effect interaction with Digibind was even more steep. The molar concentration of Digibind required to reverse the effects of the labile endogenous inhibitor from peritoneal dialysate was consistently lower than that for ouabain, which is compatible with either greater potency of the labile factor in VSM or greater affinity for Digibind. These findings are compatible with a role for one or more endogenous sodium pump inhibitors as the determinant of vascular smooth muscle tone in the volume

Azure B, a metabolite of methylene blue, is a high-potency, reversible inhibitor of monoamine oxidase

Energy Technology Data Exchange (ETDEWEB)

Petzer, Anél, E-mail: 12264954@nwu.ac.za [Unit for Drug Research and Development, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa); Harvey, Brian H. [Division of Pharmacology, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa); Wegener, Gregers [Centre for Psychiatric Research, Aarhus University Hospital-Risskov, Skovagervej 2, 8240 Risskov (Denmark); Petzer, Jacobus P. [Division of Pharmaceutical Chemistry, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa)

2012-02-01

Methylene blue (MB) has been shown to act at multiple cellular and molecular targets and as a result possesses diverse medical applications. Among these is a high potency reversible inhibition of monoamine oxidase A (MAO-A) that may, at least in part, underlie its adverse effects but also its psycho- and neuromodulatory actions. MB is metabolized to yield N-demethylated products of which azure B, the monodemethyl species, is the major metabolite. Similar to MB, azure B also displays a variety of biological activities and may therefore contribute to the pharmacological profile of MB. Based on these observations, the present study examines the interactions of azure B with recombinant human MAO-A and -B. The results show that azure B is a potent MAO-A inhibitor (IC{sub 50} = 11 nM), approximately 6-fold more potent than is MB (IC{sub 50} = 70 nM) under identical conditions. Measurements of the time-dependency of inhibition suggest that the interaction of azure B with MAO-A is reversible. Azure B also reversibly inhibits the MAO-B isozyme with an IC{sub 50} value of 968 nM. These results suggest that azure B may be a hitherto under recognized contributor to the pharmacology and toxicology of MB by blocking central and peripheral MAO-A activity and as such needs to be considered during its use in humans and animals. Highlights: ► Methylene blue (MB) is a known potent MAO-A inhibitor. ► Azure B, the major metabolite of MB, is more potent as a MAO-A inhibitor. ► Azure B may be a contributor to the CNS pharmacology and toxicology of MB.

Staurosporine scaffold-based rational discovery of the wild-type sparing reversible inhibitors of EGFR T790M gatekeeper mutant in lung cancer with analog-sensitive kinase technology.

Science.gov (United States)

Song, Xiaoyun; Liu, Xingcai; Ding, Xi

2017-04-01

The human epidermal growth factor receptor (EGFR) has been established as an attractive target for lung cancer therapy. However, an acquired EGFR T790M gatekeeper mutation is frequently observed in patients treated with first-line anticancer agents such as gefitinib and erlotinib to cause drug resistance, largely limiting the application of small-molecule kinase inhibitors in EGFR-targeted chemotherapy. Previously, the reversible pan-kinase inhibitor staurosporine and its several analogs such as Gö6976 and K252a have been reported to selectively inhibit the EGFR T790M mutant (EGFR T790M ) over wild-type kinase (EGFR WT ), suggesting that the staurosporine scaffold is potentially to develop the wild-type sparing reversible inhibitors of EGFR T790M . Here, we systematically evaluated the inhibitor response of 28 staurosporine scaffold-based compounds to EGFR T790M mutation at structural, energetic, and molecular levels by using an integrated in silico-in vitro analog-sensitive (AS) kinase technology. With the strategy, we were able to identify 4 novel wild-type sparing inhibitors UCN-01, UCN-02, AFN941, and SB-218078 with high or moderate selectivity of 30-, 45-, 5-, and 8-fold for EGFR T790M over EGFR WT , respectively, which are comparable with or even better than that of the parent compound staurosporine (24-fold). Molecular modeling and structural analysis revealed that van der Waals contacts and hydrophobic forces can form between the side chain of mutated residue Met790 and the pyrrolidinone moiety of inhibitor ligand UCN-02, which may simultaneously improve the favorable interaction energy between the kinase and inhibitor, and reduce the unfavorable desolvation penalty upon the kinase-inhibitor binding. A hydroxyl group of UCN-02 additional to staurosporine locates at the pyrrolidinone moiety, which can largely alter the electronic distribution of pyrrolidinone moiety and thus promote the intermolecular interaction with Met790 residue. This can well explain

Long-term effectiveness of highly active antiretroviral therapy (HAART) in perinatally HIV-infected children in Denmark

DEFF Research Database (Denmark)

Bracher, Linda; Valerius, Niels Henrik; Rosenfeldt, Vibeke

2007-01-01

children treated with HAART. Initial HAART included 2 nucleoside reverse-transcriptase inhibitors in combination with either a protease inhibitor (n =38) or a non-nucleoside reverse-transcriptase inhibitor (n =12). 19 (39%) patients were previously treated with mono- or dual therapy. Baseline......The long-term impact of highly active antiretroviral therapy (HAART) on HIV-1 infected children is not well known. The Danish Paediatric HIV Cohort Study includes all patients ... characteristics were median CD4 percentage 14% and HIV-RNA viral load 4.9 log(10). Within the first 12 weeks of therapy approximately 60% achieved HIV-RNA viral load children changed the components of HAART. The proportion of children with CD4...

Indolylarylsulfones as HIV-1 non-nucleoside reverse transcriptase inhibitors: new cyclic substituents at indole-2-carboxamide.

Science.gov (United States)

La Regina, Giuseppe; Coluccia, Antonio; Brancale, Andrea; Piscitelli, Francesco; Gatti, Valerio; Maga, Giovanni; Samuele, Alberta; Pannecouque, Christophe; Schols, Dominique; Balzarini, Jan; Novellino, Ettore; Silvestri, Romano

2011-03-24

New indolylarylsulfone derivatives bearing cyclic substituents at indole-2-carboxamide linked through a methylene/ethylene spacer were potent inhibitors of the WT HIV-1 replication in CEM and PBMC cells with inhibitory concentrations in the low nanomolar range. Against the mutant L100I and K103N RT HIV-1 strains in MT-4 cells, compounds 20, 24-26, 36, and 40 showed antiviral potency superior to that of NVP and EFV. Against these mutant strains, derivatives 20, 24-26, and 40 were equipotent to ETV. Molecular docking experiments on this novel series of IAS analogues have also suggested that the H-bond interaction between the nitrogen atom in the carboxamide chain of IAS and Glu138:B is important in the binding of these compounds. These results are in accordance with the experimental data obtained on the WT and on the mutant HIV-1 strains tested.

Tenofovir-related nephrotoxicity: case report and review of the literature.

Science.gov (United States)

James, Christopher W; Steinhaus, Mary C; Szabo, Susan; Dressier, Robert M

2004-03-01

Tenofovir is a nucleotide reverse transcriptase inhibitor for treatment of human immunodeficiency virus (HIV) infection. Several cases of renal failure associated with tenofovir therapy recently have been reported. A 54-year-old man with HIV experienced decreasing renal function and Fanconi's syndrome secondary to tenofovir therapy. His condition gradually improved after discontinuation of the drug. The available medical literature for reported cases of tenofovir-related nephrotoxicity indicates that this complication is apparently rare. However, our case report and literature review underscore the importance of monitoring renal function when treating patients with any nucleotide reverse transcriptase inhibitor.

Unique case of oligoastrocytoma with recurrence and grade progression: Exhibiting differential expression of high mobility group-A1 and human telomerase reverse transcriptase

Science.gov (United States)

Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni

2016-01-01

Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647

Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage.

Science.gov (United States)

Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X

2014-07-01

Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

Directory of Open Access Journals (Sweden)

Isabel Hostettler

2014-12-01

Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

Science.gov (United States)

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients

Science.gov (United States)

Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita

2018-01-01

Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

[Predictive factors of clinically significant drug-drug interactions among regimens based on protease inhibitors, non-nucleoside reverse transcriptase inhibitors and raltegravir].

Science.gov (United States)

Cervero, Miguel; Torres, Rafael; Jusdado, Juan José; Pastor, Susana; Agud, Jose Luis

2016-04-15

To determine the prevalence and types of clinically significant drug-drug interactions (CSDI) in the drug regimens of HIV-infected patients receiving antiretroviral treatment. retrospective review of database. Centre: Hospital Universitario Severo Ochoa, Infectious Unit. one hundred and forty-two participants followed by one of the authors were selected from January 1985 to December 2014. from their outpatient medical records we reviewed information from the last available visit of the participants, in relation to HIV infection, comorbidities, demographics and the drugs that they were receiving; both antiretroviral drugs and drugs not related to HIV infection. We defined CSDI from the information sheet and/or database on antiretroviral drug interactions of the University of Liverpool (http://www.hiv-druginteractions.org) and we developed a diagnostic tool to predict the possibility of CSDI. By multivariate logistic regression analysis and by estimating the diagnostic performance curve obtained, we identified a quick tool to predict the existence of drug interactions. Of 142 patients, 39 (29.11%) had some type of CSDI and in 11.2% 2 or more interactions were detected. In only one patient the combination of drugs was contraindicated (this patient was receiving darunavir/r and quetiapine). In multivariate analyses, predictors of CSDI were regimen type (PI or NNRTI) and the use of 3 or more non-antiretroviral drugs (AUC 0.886, 95% CI 0.828 to 0.944; P=.0001). The risk was 18.55 times in those receiving NNRTI and 27,95 times in those receiving IP compared to those taking raltegravir. Drug interactions, including those defined as clinically significant, are common in HIV-infected patients treated with antiretroviral drugs, and the risk is greater in IP-based regimens. Raltegravir-based prescribing, especially in patients who receive at least 3 non-HIV drugs could avoid interactions. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

Reversibility of membrane N-glycome of HeLa cells upon treatment with epigenetic inhibitors.

Directory of Open Access Journals (Sweden)

Tomislav Horvat

Full Text Available Glycans are essential regulators of protein function and are now in the focus of research in many physiological and pathophysiological processes. There are numerous modes of regulating their biosynthesis, including epigenetic mechanisms implicated in the expression of glyco-genes. Since N-glycans located at the cell membrane define intercellular communication as well as a cellular response to a given environment, we developed a method to preferentially analyze this fraction of glycans. The method is based on incorporation of living cells into polyacrylamide gels, partial denaturation of membrane proteins with 3 M urea and subsequent release of N-glycans with PNGase F followed by HPLC analysis. Using this newly developed method, we revealed multiple effects of epigenetic inhibitors Trichostatin A, sodium butyrate and zebularine on the composition of N-glycans in human cells. The induced changes were found to be reversible after inhibitor removal. Given that many epigenetic inhibitors are currently explored as a therapeutic strategy in treatment of cancer, wherein surface glycans play an important role, the presented work contributes to our understanding of their efficiency in altering the N-glycan profile of cancer cells in culture.

Development and validation of a rapid reversed-phase HPLC method for the determination of the non-nucleoside reverse transcriptase inhibitor dapivirine from polymeric nanoparticles.

Science.gov (United States)

das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda

2010-06-05

The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Linear Discriminant Analysis for the in Silico Discovery of Mechanism-Based Reversible Covalent Inhibitors of a Serine Protease: Application of Hydration Thermodynamics Analysis and Semi-empirical Molecular Orbital Calculation.

Science.gov (United States)

Masuda, Yosuke; Yoshida, Tomoki; Yamaotsu, Noriyuki; Hirono, Shuichi

2018-01-01

We recently reported that the Gibbs free energy of hydrolytic water molecules (ΔG wat ) in acyl-trypsin intermediates calculated by hydration thermodynamics analysis could be a useful metric for estimating the catalytic rate constants (k cat ) of mechanism-based reversible covalent inhibitors. For thorough evaluation, the proposed method was tested with an increased number of covalent ligands that have no corresponding crystal structures. After modeling acyl-trypsin intermediate structures using flexible molecular superposition, ΔG wat values were calculated according to the proposed method. The orbital energies of antibonding π* molecular orbitals (MOs) of carbonyl C=O in covalently modified catalytic serine (E orb ) were also calculated by semi-empirical MO calculations. Then, linear discriminant analysis (LDA) was performed to build a model that can discriminate covalent inhibitor candidates from substrate-like ligands using ΔG wat and E orb . The model was built using a training set (10 compounds) and then validated by a test set (4 compounds). As a result, the training set and test set ligands were perfectly discriminated by the model. Hydrolysis was slower when (1) the hydrolytic water molecule has lower ΔG wat ; (2) the covalent ligand presents higher E orb (higher reaction barrier). Results also showed that the entropic term of hydrolytic water molecule (-TΔS wat ) could be used for estimating k cat and for covalent inhibitor optimization; when the rotational freedom of the hydrolytic water molecule is limited, the chance for favorable interaction with the electrophilic acyl group would also be limited. The method proposed in this study would be useful for screening and optimizing the mechanism-based reversible covalent inhibitors.

Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex That Confer Multinucleoside Drug Resistance

Energy Technology Data Exchange (ETDEWEB)

Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy

2017-04-10

HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.

Effects of exogenous ATM gene on mRNA expression of human telomerase reverse transcriptase in AT cells induced by irradiation

International Nuclear Information System (INIS)

Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong

2005-01-01

The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)

Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite of extensive proliferation

International Nuclear Information System (INIS)

Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha

2005-01-01

Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols

Generation of thermostable Moloney murine leukemia virus reverse transcriptase variants using site saturation mutagenesis library and cell-free protein expression system.

Science.gov (United States)

Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi

2017-12-01

We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.

Improved Potency of Indole-Based NorA Efflux Pump Inhibitors: From Serendipity toward Rational Design and Development.

Science.gov (United States)

Buonerba, Federica; Lepri, Susan; Goracci, Laura; Schindler, Bryan D; Seo, Susan M; Kaatz, Glenn W; Cruciani, Gabriele

2017-01-12

The NorA efflux pump is a potential drug target for reversal of resistance to selected antibacterial agents, and recently we described indole-based inhibitor candidates. Herein we report a second class of inhibitors derived from them but with significant differences in shape and size. In particular, compounds 13 and 14 are very potent inhibitors in that they demonstrated the lowest IC 50 values (2 μM) ever observed among all indole-based compounds we have evaluated.

Pharmacokinetics of antiretroviral drugs in anatomical sanctuary sites: the male and female genital tract.

Science.gov (United States)

Else, Laura J; Taylor, Stephen; Back, David J; Khoo, Saye H

2011-01-01

HIV resides within anatomical 'sanctuary sites', where local drug exposure and viral dynamics may differ significantly from the systemic compartment. Suboptimal antiretroviral concentrations in the genital tract may result in compartmentalized viral replication, selection of resistant mutations and possible re-entry of wild-type/resistant virus into the systemic circulation. Therefore, achieving adequate antiretroviral exposure in the genital tract has implications for the prevention of sexual and vertical transmission of HIV. Penetration of antiretrovirals in the genital tract is expressed by accumulation ratios derived from the measurement of drug concentrations in time-matched seminal plasma/cervicovaginal fluid and plasma samples. Penetration varies by gender and may be drug (as opposed to class) specific with high interindividual variability. Concentrations in seminal plasma are highest for nucleoside analogues and lowest for protease inhibitors and efavirenz. Seminal accumulation of newer agents, raltegravir and maraviroc, is moderate (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitors [lamivudine/zidovudine/tenofovir/didanosine > stavudine/abacavir] > raltegravir > indinavir/maraviroc/nevirapine > efavirenz/protease inhibitors [amprenavir/atazanavir/darunavir > lopinavir/ritonavir > saquinavir] > enfuvirtide). In the female genital tract, the nucleoside analogues exhibit high accumulation ratios, whereas protease inhibitors have limited penetration; however, substantial variability exists between individuals and study centres. Second generation non-nucleoside reverse transcriptase inhibitor etravirine, and maraviroc and raltegravir, demonstrate effective accumulation in cervicovaginal secretions (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitor [zidovudine/lamivudine/didanosine > emtricitabine/tenofovir] > indinavir > maraviroc/raltegravir/darunavir/etravirine > nevirapine

The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

Directory of Open Access Journals (Sweden)

Madeleine Zerbato

Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

Novel Bifunctional Quinolonyl Diketo Acid Derivatives as HIV-1 Integrase Inhibitors: Design, Synthesis, Biological Activities and Mechanism of Action

Science.gov (United States)

Di Santo, Roberto; Costi, Roberta; Roux, Alessandra; Artico, Marino; Lavecchia, Antonio; Marinelli, Luciana; Novellino, Ettore; Palmisano, Lucia; Andreotti, Mauro; Amici, Roberta; Galluzzo, Clementina Maria; Nencioni, Lucia; Palamara, Anna Teresa; Pommier, Yves; Marchand, Christophe

2008-01-01

The virally encoded integrase protein is an essential enzyme in the life cycle of the HIV-1 virus and represents an attractive and validated target in the development of therapeutics against HIV infection. Drugs that selectively inhibit this enzyme, when used in combination with inhibitors of reverse transcriptase and protease, are believed to be highly effective in suppressing the viral replication. Among the HIV-1 integrase inhibitors, the β-diketo acids (DKAs) represent a major lead for anti-HIV-1drug development. In this study, novel bifunctional quinolonyl diketo acid derivatives were designed, synthesized and tested for their inhibitory ability against HIV-1 integrase. The compounds are potent inhibitors of integrase activity. Particularly, derivative 8 is a potent IN inhibitor for both steps of the reaction (3′-processing and strand transfer) and exhibits both high antiviral activity against HIV-1 infected cells and low cytotoxicity. Molecular modeling studies provide a plausible mechanism of action, which is consistent with ligand SARs and enzyme photo-crosslinking experiments. PMID:16539381

In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

International Nuclear Information System (INIS)

Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong

2007-01-01

The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation

In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

Energy Technology Data Exchange (ETDEWEB)

Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn

2007-04-06

The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.

Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

Science.gov (United States)

Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

2013-12-23

At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

Tenofovir-based regimens associated with less drug resistance in HIV-1-infected Nigerians failing first-line antiretroviral therapy.

Science.gov (United States)

Etiebet, Mary-Ann A; Shepherd, James; Nowak, Rebecca G; Charurat, Man; Chang, Harry; Ajayi, Samuel; Elegba, Olufunmilayo; Ndembi, Nicaise; Abimiku, Alashle; Carr, Jean K; Eyzaguirre, Lindsay M; Blattner, William A

2013-02-20

In resource-limited settings, HIV-1 drug resistance testing to guide antiretroviral therapy (ART) selection is unavailable. We retrospectively conducted genotypic analysis on archived samples from Nigerian patients who received targeted viral load testing to confirm treatment failure and report their drug resistance mutation patterns. Stored plasma from 349 adult patients on non-nucleoside reverse transcriptase inhibitor (NNRTI) regimens was assayed for HIV-1 RNA viral load, and samples with more than 1000 copies/ml were sequenced in the pol gene. Analysis for resistance mutations utilized the IAS-US 2011 Drug Resistance Mutation list. One hundred and seventy-five samples were genotyped; the majority of the subtypes were G (42.9%) and CRF02_AG (33.7%). Patients were on ART for a median of 27 months. 90% had the M184V/I mutation, 62% had at least one thymidine analog mutation, and 14% had the K65R mutation. 97% had an NNRTI resistance mutation and 47% had at least two etravirine-associated mutations. In multivariate analysis tenofovir-based regimens were less likely to have at least three nucleoside reverse transcriptase inhibitor (NRTI) mutations after adjusting for subtype, previous ART, CD4, and HIV viral load [P < 0.001, odds ratio (OR) 0.04]. 70% of patients on tenofovir-based regimens had at least two susceptible NRTIs to include in a second-line regimen compared with 40% on zidovudine-based regimens (P = 0.04, OR = 3.4). At recognition of treatment failure, patients on tenofovir-based first-line regimens had fewer NRTI drug-resistant mutations and more active NRTI drugs available for second-line regimens. These findings can inform strategies for ART regimen sequencing to optimize long-term HIV treatment outcomes in low-resource settings.

Reptin is required for the transcription of telomerase reverse transcriptase and over-expressed in gastric cancer

Directory of Open Access Journals (Sweden)

Liu Tiantian

2010-05-01

Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.

Human monoamine oxidase is inhibited by tobacco smoke: β-carboline alkaloids act as potent and reversible inhibitors

International Nuclear Information System (INIS)

Herraiz, Tomas; Chaparro, Carolina

2005-01-01

Monoamine oxidase (MAO) is a mitochondrial outer-membrane flavoenzyme involved in brain and peripheral oxidative catabolism of neurotransmitters and xenobiotic amines, including neurotoxic amines, and a well-known target for antidepressant and neuroprotective drugs. Recently, positron emission tomography imaging has shown that smokers have a much lower activity of peripheral and brain MAO-A (30%) and -B (40%) isozymes compared to non-smokers. This MAO inhibition results from a pharmacological effect of smoke, but little is known about its mechanism. Working with mainstream smoke collected from commercial cigarettes we confirmed that cigarette smoke is a potent inhibitor of human MAO-A and -B isozymes. MAO inhibition was partly reversible, competitive for MAO-A, and a mixed-type inhibition for MAO-B. Two β-carboline alkaloids, norharman (β-carboline) and harman (1-methyl-β-carboline), were identified by GC-MS, quantified, and isolated from the mainstream smoke by solid phase extraction and HPLC. Kinetics analysis revealed that β-carbolines from cigarette smoke were competitive, reversible, and potent inhibitors of MAO enzymes. Norharman was an inhibitor of MAO-A (K i = 1.2 ± 0.18 μM) and MAO-B (K i = 1.12 ± 0.19 μM), and harman of MAO-A (K i = 55.54 ± 5.3 nM). β-Carboline alkaloids are psychopharmacologically active compounds that may occur endogenously in human tissues, including the brain. These results suggest that β-carboline alkaloids from cigarette smoke acting as potent reversible inhibitors of MAO enzymes may contribute to the MAO-reduced activity produced by tobacco smoke in smokers. The presence of MAO inhibitors in smoke like β-carbolines and others may help us to understand some of the purported neuropharmacological effects associated with smoking

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

Science.gov (United States)

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

International Nuclear Information System (INIS)

Freeman-Wittig, M.J.B.

1986-01-01

The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

Selective serotonin reuptake inhibitor suppression of HIV infectivity and replication.

Science.gov (United States)

Benton, Tami; Lynch, Kevin; Dubé, Benoit; Gettes, David R; Tustin, Nancy B; Ping Lai, Jian; Metzger, David S; Blume, Joshua; Douglas, Steven D; Evans, Dwight L

2010-11-01

To test the hypothesis that the selective serotonin reuptake inhibitor (SSRI) citalopram would down-regulate human immunodeficiency virus (HIV) infectivity and that the greatest effects would be seen in people with depression. Depression is a risk factor for morbidity and mortality in HIV/acquired immune deficiency syndrome. Serotonin (5-HT) neurotransmission has been implicated in the pathobiology of depression, and pharmacologic therapies for depression target this system. The 5-HT transporter and 5-HT receptors are widely distributed throughout the central nervous and immune systems. Depression has been associated with suppression of natural killer cells and CD8(+) lymphocytes, key regulators of HIV infection. Ex vivo models for acute and chronic HIV infection were used to study the effects of citalopram on HIV viral infection and replication in 48 depressed and nondepressed women. For both the acute and chronic infection models, HIV reverse transcriptase activity was measured in the citalopram treatment condition and the control condition. The SSRI significantly down-regulated the reverse transcriptase response in both the acute and chronic infection models. Specifically, citalopram significantly decreased the acute HIV infectivity of macrophages. Citalopram also significantly decreased HIV viral replication in the latently infected T-cell line and in the latently infected macrophage cell line. There was no difference in down-regulation by depression status. These studies suggest that an SSRI enhances natural killer/CD8 noncytolytic HIV suppression in HIV/acquired immune deficiency syndrome and decreases HIV viral infectivity of macrophages, ex vivo, suggesting the need for in vivo studies to determine a potential role for agents targeting serotonin in the host defense against HIV.

AZT as a telomerase inhibitor

International Nuclear Information System (INIS)

Gomez, Daniel E.; Armando, Romina G.; Alonso, Daniel F.

2012-01-01

Telomerase is a highly specialized reverse transcriptase (RT) and the maintenance of telomeric length is determined by this specific enzyme. The human holoenzyme telomerase is a ribonucleoprotein composed by a catalytic subunit, hTERT, an RNA component, hTR, and a group of associated proteins. Telomerase is normally expressed in embryonic cells and is repressed during adulthood. The enzyme is reexpressed in around 85% of solid tumors. This observation makes it a potential target for developing drugs that could be developed for therapeutic purposes. The identification of the hTERT as a functional catalytic RT prompted studies of inhibiting telomerase with the HIV RT inhibitor azidothymidine (AZT). Previously, we have demonstrated that AZT binds preferentially to telomeres, inhibits telomerase and enhances tumor cell senescence, and apoptosis after AZT treatment in breast mammary adenocarcinoma cells. Since then, several studies have considered AZT for telomerase inhibition and have led to potential clinical strategies for anticancer therapy. This review covers present thinking of the inhibition of telomerase by AZT and future treatment protocols using the drug.

Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy.

Science.gov (United States)

Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N

2005-05-01

To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.

Molecular Phylogenetics of Transmitted Drug Resistance in Newly Diagnosed HIV Type 1 Individuals in Denmark, a Nation-Wide Study

DEFF Research Database (Denmark)

Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels

2011-01-01

Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...

Molecular phylogenetics of transmitted drug resistance in newly diagnosed HIV Type 1 individuals in Denmark: a nation-wide study

DEFF Research Database (Denmark)

Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels

2011-01-01

Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...

Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

Science.gov (United States)

Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

2014-01-01

Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

Directory of Open Access Journals (Sweden)

Rami Kantor

2005-04-01

Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

Histone deacetylase inhibitors reverse age-related increases in side effects of haloperidol in mice.

Science.gov (United States)

Montalvo-Ortiz, Janitza L; Fisher, Daniel W; Rodríguez, Guadalupe; Fang, Deyu; Csernansky, John G; Dong, Hongxin

2017-08-01

Older patients can be especially susceptible to antipsychotic-induced side effects, and the pharmacodynamic mechanism underlying this phenomenon remains unclear. We hypothesized that age-related epigenetic alterations lead to decreased expression and functionality of the dopamine D2 receptor (D2R), contributing to this susceptibility. In this study, we treated young (2-3 months old) and aged (22-24 months old) C57BL/6 mice with the D2R antagonist haloperidol (HAL) once a day for 14 days to evaluate HAL-induced motor side effects. In addition, we pretreated separate groups of young and aged mice with histone deacetylase (HDAC) inhibitors valproic acid (VPA) or entinostat (MS-275) and then administered HAL. Our results show that the motor side effects of HAL are exaggerated in aged mice as compared to young mice and that HDAC inhibitors are able to reverse the severity of these deficits. HAL-induced motor deficits in aged mice are associated with an age- and drug-dependent decrease in striatal D2R protein levels and functionality. Further, histone acetylation was reduced while histone tri-methylation was increased at specific lysine residues of H3 and H4 within the Drd2 promoter in the striatum of aged mice. HDAC inhibitors, particularly VPA, restored striatal D2R protein levels and functionality and reversed age- and drug-related histone modifications at the Drd2 promoter. These results suggest that epigenetic changes at the striatal Drd2 promoter drive age-related increases in antipsychotic side effect susceptibility, and HDAC inhibitors may be an effective adjunct treatment strategy to reduce side effects in aged populations.

Risk of triple-class virological failure in children with HIV: a retrospective cohort study

DEFF Research Database (Denmark)

Castro, Hannah; Judd, Ali; Gibb, Diana M

2011-01-01

In adults with HIV treated with antiretroviral drug regimens from within the three original drug classes (nucleoside or nucleotide reverse transcriptase inhibitors [NRTIs], non-NRTIs [NNRTIs], and protease inhibitors), virological failure occurs slowly, suggesting that long-term virological...... failure to the three original drugs classes in children....

Class of Antiretroviral Drugs and the Risk of Myocardial Infarction

DEFF Research Database (Denmark)

Friis-Møller, Nina; Reiss, P.; Sabin, C.A.

2007-01-01

of myocardial infarction, which is partly explained by dyslipidemia. We found no evidence of such an association for nonnucleoside reverse-transcriptase inhibitors; however, the number of person-years of observation for exposure to this class of drug was less than that for exposure to protease inhibitors...

Executive summary of the GESIDA/National AIDS Plan Consensus Document on Antiretroviral Therapy in Adults Infected by the Human Immunodeficiency Virus (Updated January 2016).

Science.gov (United States)

2016-01-01

In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise 3 drugs, namely, 2 nucleoside reverse transcriptase inhibitors (NRTI), and 1 drug from another family. Four of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further 6 regimens, which are based on an INSTI, a non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with cobicistat or ritonavir (PI/COBI, PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include 3 (or at least 2) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

Directory of Open Access Journals (Sweden)

Sukrit Silas

2017-07-01

Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

Directory of Open Access Journals (Sweden)

Stefanou Nikolaos

2010-08-01

Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

Energy Technology Data Exchange (ETDEWEB)

Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)

2017-12-15

Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

Postexposure protection of macaques from vaginal SHIV infection by topical integrase inhibitors.

Science.gov (United States)

Dobard, Charles; Sharma, Sunita; Parikh, Urvi M; West, Rolieria; Taylor, Andrew; Martin, Amy; Pau, Chou-Pong; Hanson, Debra L; Lipscomb, Jonathan; Smith, James; Novembre, Francis; Hazuda, Daria; Garcia-Lerma, J Gerardo; Heneine, Walid

2014-03-12

Coitally delivered microbicide gels containing antiretroviral drugs are important for HIV prevention. However, to date, microbicides have contained entry or reverse transcriptase inhibitors that block early steps in virus infection and thus need to be given as a preexposure dose that interferes with sexual practices and may limit compliance. Integrase inhibitors block late steps after virus infection and therefore are more suitable for post-coital dosing. We first determined the kinetics of strand transfer in vitro and confirmed that integration begins about 6 hours after infection. We then used a repeat-challenge macaque model to assess efficacy of vaginal gels containing integrase strand transfer inhibitors when applied before or after simian/human immunodeficiency virus (SHIV) challenge. We showed that gel containing the strand transfer inhibitor L-870812 protected two of three macaques when applied 30 min before SHIV challenge. We next evaluated the efficacy of 1% raltegravir gel and demonstrated its ability to protect macaques when applied 3 hours after SHIV exposure (five of six protected; P infections showed no evidence of drug resistance in plasma or vaginal secretions despite continued gel dosing after infection. We documented rapid vaginal absorption reflecting a short pharmacological lag time and noted that vaginal, but not plasma, virus load was substantially reduced in the breakthrough infection after raltegravir gel treatment. We provide a proof of concept that topically applied integrase inhibitors protect against vaginal SHIV infection when administered shortly before or 3 hours after virus exposure.

Preclinical profile of befloxatone, a new reversible MAO-A inhibitor.

Science.gov (United States)

Curet, O; Damoiseau-Ovens, G; Sauvage, C; Sontag, N; Avenet, P; Depoortere, H; Caille, D; Bergis, O; Scatton, B

1998-12-01

Befloxatone, a novel oxazolidinone derivative, is a potent, selective and reversible monoamine oxidase A (MAO-A) inhibitor in vitro (K1A = 1.9-3.6 nM) and ex vivo (ED50 MAO-A = 0.02 mg/kg, p.o.). It does not interact with a large number of receptors, monoamine transporters or other amine oxidases. Binding studies with [3H]-befloxatone in rat brain sections show that it labels with high affinity (Kd = 1.3 nM) a single population of sites with the pharmacological characteristics and regional distribution of MAO-A. In the rat brain, befloxatone (0.75 mg/kg, i.p.) increases tissue levels of monoamines and decreases levels of their deaminated metabolites. Acute administration of befloxatone (0.75 mg/kg, i.p.) induces an increase in extracellular striatal dopamine and cortical norepinephrine but not cortical serotonin levels in the rat. Befloxatone (1 mg/kg, i.p.) potently inhibits the firing rate of serotonergic neurons, partially decreases the firing of noradrenergic neurons and has no effect on the firing of dopaminergic neurons (a mirror image of its effects on monoamine release in terminal regions), suggesting that the relative effects of befloxatone on monoamine release may be governed by autoreceptor-mediated control of monoaminergic neurons at the cell body level. Befloxatone (0.03-0.3 mg/kg, p.o.) exhibits potent activity in behavioural models predictive of antidepressant activity. Befloxatone (up to 1.5 mg/kg, p.o.) does not potentiate the pressor effects of orally administered tyramine at centrally active doses and duodenal [3H]-befloxatone binding is displaced by increasing doses of orally administered tyramine (0.1-40 mg/kg, i.p.). These results suggest that befloxatone is a potent reversible MAO-A inhibitor with antidepressant potential and a wide safety margin with regard to the potentiation of the pressor effect of tyramine.

Backup_of_7. The Prevalence of Kidney Dysfunction and ...

African Journals Online (AJOL)

user

3University of Zambia, School of Public Health, Lusaka, Zambia. 176 .... Nucleoside Reverse Transcriptase Inhibitors. (NRTIs), and a ... Multivariate logistic regression was used to determine ... the Ethics Committee of ERES Converge approval.

Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

Science.gov (United States)

Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

2017-09-01

It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

Telomerase reverse transcriptase locus polymorphisms and cancer risk: a field synopsis and meta-analysis.

Science.gov (United States)

Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato

2012-06-06

Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic

Tetrahymena telomerase protein p65 induces conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse transcriptase and TER assembly mutants.

Science.gov (United States)

Berman, Andrea J; Gooding, Anne R; Cech, Thomas R

2010-10-01

The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.

Lower genetic variability of HIV-1 and antiretroviral drug resistance in pregnant women from the state of Pará, Brazil.

Science.gov (United States)

Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães

2017-04-12

The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.

Reversible Cysteine Protease Inhibitors Show Promise for a Chagas Disease Cure

Science.gov (United States)

Beaulieu, Christian; Black, W. Cameron; Isabel, Elise; Vasquez-Camargo, Fabio; Nath-Chowdhury, Milli; Massé, Frédéric; Mellon, Christophe; Methot, Nathalie

2014-01-01

The cysteine protease cruzipain is essential for the viability, infectivity, and virulence of Trypanosoma cruzi, the causative agent of Chagas disease. Thus, inhibitors of cruzipain are considered promising anti-T. cruzi chemotherapeutic agents. Reversible cruzipain inhibitors containing a nitrile “warhead” were prepared and demonstrated 50% inhibitory concentrations (IC50s) as potent as 1 nM in baculovirus-generated cruzipain enzyme assays. In epimastigote and intracellular amastigote in vitro assays, the most potent compounds demonstrated antiparasitic behavior in the 5 to 10 μM IC50 range; however, trypomastigote production from the amastigote form was ∼90 to 95% inhibited at 2 μM. Two key compounds, Cz007 and Cz008, with IC50s of 1.1 and 1.8 nM, respectively, against the recombinant enzyme were tested in a murine model of acute T. cruzi infection, with oral dosing in chow for 28 days at doses from 3 to 50 mg/kg of body weight. At 3 mg/kg of Cz007 and 3 mg/kg of Cz008, the blood parasitemia areas under the concentration-time curves were 16% and 25% of the untreated group, respectively. At sacrifice, 24 days after immunosuppression with cyclophosphamide, parasite presence in blood, heart, and esophagus was evaluated. Based on negative quantitative PCR results in all three tissues, cure rates in surviving animals were 90% for Cz007 at 3 mg/kg, 78% for Cz008 at 3 mg/kg, and 71% for benznidazole, the control compound, at 50 mg/kg. PMID:24323474

A novel peptide-nucleotide dual vaccine of human telomerase reverse transcriptase induces a potent cytotoxic T-cell response in vivo

International Nuclear Information System (INIS)

Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun

2007-01-01

Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers

Lactic acidosis, risk factors and predictive laboratory markers: a ...

African Journals Online (AJOL)

2013-12-21

Dec 21, 2013 ... due to nucleoside reverse transcriptase inhibitors (NRTIs) ... of Public Health Medicine, School of Nursing and Public Health, University of KwaZulu-Natal, Durban ... Conditional logistic regression modelling was used to.

ORIGINAL ARTICLES Symptomatic hyperlactataemia in adults on ...

African Journals Online (AJOL)

2008-09-29

Sep 29, 2008 ... in combination with other antiretroviral drugs in a schedule .... males developed gynaecomastia without other symptoms of ..... nucleoside reverse transcriptase inhibitor (NRTI)-induced lactic acidosis in HIV-infected patients in ...

Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

Science.gov (United States)

Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

2017-02-01

Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

Telomerase Inhibitors from Natural Products and Their Anticancer Potential

Directory of Open Access Journals (Sweden)

Kumar Ganesan

2017-12-01

Full Text Available Telomeres and telomerase are nowadays exploring traits on targets for anticancer therapy. Telomerase is a unique reverse transcriptase enzyme, considered as a primary factor in almost all cancer cells, which is mainly responsible to regulate the telomere length. Hence, telomerase ensures the indefinite cell proliferation during malignancy—a hallmark of cancer—and this distinctive feature has provided telomerase as the preferred target for drug development in cancer therapy. Deactivation of telomerase and telomere destabilization by natural products provides an opening to succeed new targets for cancer therapy. This review aims to provide a fundamental knowledge for research on telomere, working regulation of telomerase and its various binding proteins to inhibit the telomere/telomerase complex. In addition, the review summarizes the inhibitors of the enzyme catalytic subunit and RNA component, natural products that target telomeres, and suppression of transcriptional and post-transcriptional levels. This extensive understanding of telomerase biology will provide indispensable information for enhancing the efficiency of rational anti-cancer drug design.

Population-based monitoring of emerging HIV-1 drug resistance on antiretroviral therapy and associated factors in a sentinel site in Cameroon: low levels of resistance but poor programmatic performance.

Directory of Open Access Journals (Sweden)

Serge C Billong

Full Text Available BACKGROUND: Scale-up of antiretroviral therapy (ART in resource-limited settings has drastically reduced HIV-related morbidity and mortality. However, challenges in long-term ART, adherence and HIV drug resistance (HIVDR itself, require monitoring to limit HIVDR emergence among ART-experienced populations, in order to ensure regimen efficacy. METHODS: A longitudinal study was conducted from 2009-2011 in a cohort of 141 HIV-infected adult patients (aged >21 at the national social insurance centre hospital in Yaounde, Cameroon. As per-WHO HIVDR protocol, HIV-1 protease-reverse transcriptase genotyping was performed at baseline and at endpoint (12 months on first-line ART using ViroSeq™ Genotyping kit. RESULTS: At baseline, a prevalence of 3.6% (5/139 HIVDR was observed [protease inhibitors M46I (1/5, G73A (1/5, L90LM (1/5; nucleoside reverse transcriptase inhibitors: M184V (1/5, T215F (1/5; non-nucleoside reverse transcriptase inhibitors: K103N (1/5, Y181Y/C (2/5, M230ML (1/5]. At endpoint, 54.0% (76 patients were followed-up, 9.2% (13 died, and 3.5% (5 transferred, 38.5% (47 lost to follow-up (LTFU. 69.7% (53/76 of those followed-up had viremia <40 copies/ml and 90.8% (69/76 <1000 copies/ml. 4/7 patients with viremia ≥1000 copies/ml harbored HIVDR (prevalence: 5.3%; 4/76, with M184V/I (4/4 and K103K/N (3/4 being the most prevalent mutations. LTFU was favored by costs for consultation/laboratory tests, drug shortages, workload (physician/patient ratio: 1/180 and community disengagement. CONCLUSIONS: Low levels of HIVDR at baseline and at endpoint suggest a probable effectiveness of ART regimens used in Cameroon. However the possible high rate of HIVDR among LTFUs limited the strengths of our findings. Evaluating HIVDR among LTFU, improving adherence, task shifting, subsidizing/harmonizing costs for routine follow-up, are urgent measures to ensure an improved success of the country ART performance.

Self-reported adverse effects as barriers to adherence to ...

African Journals Online (AJOL)

School of Public Health, University of Limpopo, Medunsa Campus. Correspondence to: Dr .... variables were performed using logistic regression. The findings .... non-reverse transcriptase inhibitors.11 The implication of this finding is that the ...

A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

Science.gov (United States)

Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang

2010-01-01

A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

Directory of Open Access Journals (Sweden)

Yanrui Li

2010-01-01

Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

Docking mode of delvardine and its analogues into the p66 domain ...

Indian Academy of Sciences (India)

SEARCHU

Delvardine and its structural derivatives are important non-nucleoside HIV-1 reverse transcriptase inhibitors (NNRTIs). .... [PDB ID:1REV] was taken from the Protein Data Bank ... Water molecules were removed and H atoms were added.

Challenges in Initiating Antiretroviral Therapy in 2010

Directory of Open Access Journals (Sweden)

Cécile L Tremblay

2010-01-01

Full Text Available Many clinical trials have shown that initiating antiretroviral therapy (ART at higher rather than lower CD4 T cell-positive counts results in survival benefit. Early treatment can help prevent end-organ damage associated with HIV replication and can decrease infectivity. The mainstay of treatment is either a non-nucleoside reverse transcriptase inhibitor or a ritonavir-boosted protease inhibitor in combination with two nucleoside reverse transcriptase inhibitors. While effective at combating HIV, ART can produce adverse alterations of lipid parameters, with some studies suggesting a relationship between some anti-retroviral agents and cardiovascular disease. As the HIV-positive population ages, issues such as hypertension and diabetes must be taken into account when initiating ART. Adhering to ART can be difficult; however, nonoptimal adherence to ART can result in the development of resistance; thus, drug characteristics and the patient’s preparedness to begin therapy must be considered. Reducing the pill burden through the use of fixed-dose antiretroviral drug combinations can facilitate adherence.

The future of pre-exposure prophylaxis (PrEP) for human immunodeficiency virus (HIV) infection.

Science.gov (United States)

Özdener, Ayşe Elif; Park, Tae Eun; Kalabalik, Julie; Gupta, Rachna

2017-05-01

People at high risk for HIV acquisition should be offered pre-exposure prophylaxis (PrEP). Tenofovir disoproxil fumarate (TDF)/emtricitabine (FTC) is currently the only medication recommended for pre-exposure prophylaxis (PrEP) by the Centers for Disease Control and Prevention (CDC) in people at high risk for HIV acquisition. This article will review medications currently under investigation and the future landscape of PrEP therapy. Areas covered: This article will review clinical trials that have investigated nontraditional regimens of TDF/FTC, antiretroviral agents from different drug classes such as integrase strand transfer inhibitors (INSTI), nucleoside reverse transcriptase inhibitors (NRTI), and non-nucleoside reverse transcriptase inhibitors (NNRTI) as potential PrEP therapies. Expert commentary: Currently, there are several investigational drugs in the pipeline for PrEP against HIV infection. Increased utilization of PrEP therapy depends on provider identification of people at high risk for HIV transmission. Advances in PrEP development will expand options and access for people and reduce the risk of HIV acquisition.

6-(1-Benzyl-1H-pyrrol-2-yl)-2,4-dioxo-5-hexenoic acids as dual inhibitors of recombinant HIV-1 integrase and ribonuclease H, synthesized by a parallel synthesis approach.

Science.gov (United States)

Costi, Roberta; Métifiot, Mathieu; Esposito, Francesca; Cuzzucoli Crucitti, Giuliana; Pescatori, Luca; Messore, Antonella; Scipione, Luigi; Tortorella, Silvano; Zinzula, Luca; Novellino, Ettore; Pommier, Yves; Tramontano, Enzo; Marchand, Christophe; Di Santo, Roberto

2013-11-14

The increasing efficiency of HAART has helped to transform HIV/AIDS into a chronic disease. Still, resistance and drug-drug interactions warrant the development of new anti-HIV agents. We previously discovered hit 6, active against HIV-1 replication and targeting RNase H in vitro. Because of its diketo-acid moiety, we speculated that this chemotype could serve to develop dual inhibitors of both RNase H and integrase. Here, we describe a new series of 1-benzyl-pyrrolyl diketohexenoic derivatives, 7a-y and 8a-y, synthesized following a parallel solution-phase approach. Those 50 analogues have been tested on recombinant enzymes (RNase H and integrase) and in cell-based assays. Approximately half (22) exibited inhibition of HIV replication. Compounds 7b, 7u, and 8g were the most active against the RNase H activity of reverse-transcriptase, with IC50 values of 3, 3, and 2.5 μM, respectively. Compound 8g was also the most potent integrase inhibitor with an IC50 value of 26 nM.

Executive summary of the GeSIDA/National AIDS Plan consensus document on antiretroviral therapy in adults infected by the human immunodeficiency virus (updated January 2014).

Science.gov (United States)

Berenguer, Juan; Polo, Rosa; Lozano, Fernando; López Aldeguer, José; Antela, Antonio; Arribas, José Ramón; Asensi, Víctor; Blanco, José Ramón; Clotet, Bonaventura; Domingo, Pere; Galindo, María José; Gatell, José María; González-García, Juan; Iribarren, José Antonio; Locutura, Jaime; López, Juan Carlos; Mallolas, Josep; Martínez, Esteban; Miralles, Celia; Miró, José M; Moreno, Santiago; Palacios, Rosario; Pérez Elías, María Jesús; Pineda, Juan Antonio; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz, Jesús; Tuset, Montserrat; Vidal, Francesc; Rivero, Antonio

2014-01-01

In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation varies with clinical circumstances, number of CD4 cells, comorbid conditions and prevention of transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load. Initial ART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors and a third drug from a different family (non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or integrase inhibitor). This update presents the causes and criteria for switching ART in patients with undetectable plasma viral load and in cases of virological failure. An update is also provided for the specific criteria for ART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid conditions (tuberculosis or other opportunistic infections, kidney disease, liver disease, and cancer). Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

Science.gov (United States)

Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

2003-05-01

Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

Association of telomerase reverse transcriptase promoter mutations with clinicopathological features and prognosis of thyroid cancer: a meta-analysis

Directory of Open Access Journals (Sweden)

Su X

2016-11-01

Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation

Telomerase reverse transcriptase promoter mutations in bladder cancer

DEFF Research Database (Denmark)

Allory, Yves; Beukers, Willemien; Sagrera, Ana

2014-01-01

for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...

Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

Directory of Open Access Journals (Sweden)

Parvathi Chary

Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

Synthesis of the highly selective p38 MAPK inhibitor UR-13756 for possible therapeutic use in Werner syndrome.

Science.gov (United States)

Bagley, Mark C; Davis, Terence; Rokicki, Michal J; Widdowson, Caroline S; Kipling, David

2010-02-01

UR-13756 is a potent and selective p38 mitogen-activated protein kinase (MAPK) inhibitor, reported to have good bioavailability and pharmacokinetic properties and, thus, is of potential use in the treatment of accelerated aging in Werner syndrome. Irradiation of 2-chloroacrylonitrile and methylhydrazine in ethanol at 100 °C gives 1-methyl-3-aminopyrazole, which reacts with 4-fluorobenzaldehyde and a ketone, obtained by Claisen condensation of 4-picoline, in a Hantzsch-type 3-component hereocyclocondensation, to give the pyrazolopyridine UR-13756. UR-13756 shows p38 MAPK inhibitory activity in human telomerase reverse transcriptase-immortalized HCA2 dermal fibroblasts, with an IC(50) of 80 nm, as shown by ELISA, is 100% efficacious for up to 24 h at 1.0 μm and displays excellent kinase selectivity over the related stress-activated c-Jun kinases. In addition, UR-13756 is an effective p38 inhibitor at 1.0 μm in Werner syndrome cells, as shown by immunoblot. The convergent synthesis of UR-13756 is realized using microwave dielectric heating and provides a highly selective inhibitor that shows excellent selectivity for p38 MAPK over c-Jun N-terminal kinase.

Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro.

Science.gov (United States)

Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L

1999-12-17

Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

Resistance Analyses of Integrase Strand Transfer Inhibitors within Phase 3 Clinical Trials of Treatment-Naive Patients

Directory of Open Access Journals (Sweden)

Kirsten L. White

2014-07-01

Full Text Available The integrase (IN strand transfer inhibitors (INSTIs, raltegravir (RAL, elvitegravir (EVG and dolutegravir (DTG, comprise the newest drug class approved for the treatment of HIV-1 infection, which joins the existing classes of reverse transcriptase, protease and binding/entry inhibitors. The efficacy of first-line regimens has attained remarkably high levels, reaching undetectable viral loads in 90% of patients by Week 48; however, there remain patients who require a change in regimen due to adverse events, virologic failure with emergent resistance or other issues of patient management. Large, randomized clinical trials conducted in antiretroviral treatment-naive individuals are required for drug approval in this population in the US, EU and other countries, with the primary endpoint for virologic success at Week 48. However, there are differences in the definition of virologic failure and the evaluation of drug resistance among the trials. This review focuses on the methodology and tabulation of resistance to INSTIs in phase 3 clinical trials of first-line regimens and discusses case studies of resistance.

In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

Directory of Open Access Journals (Sweden)

Johannes Van Staden

2010-10-01

Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.

Reverse Zymography: Overview and Pitfalls.

Science.gov (United States)

Sharma, Kanika; Bhattacharyya, Debasish

2017-01-01

Reverse zymography is a technique by which protease inhibitor(s) in a sample could be electrophoretically separated in a substrate-impregnated acrylamide gel and their relative abundance could be semi-quantified. The gel after electrophoresis is incubated with a protease when the impregnated substrate and all other proteins of the sample are degraded into small peptides except the inhibitor(s) that show clear bands against a white background. Since reverse zymography cannot distinguish between a protease inhibitor and a protein that is resistant against proteolysis, the results should be confirmed from inhibition of protease activity by solution state assay.

Drug resistance mutations in HIV type 1 isolates from naive patients eligible for first line antiretroviral therapy in JJ Hospital, Mumbai, India.

Science.gov (United States)

Deshpande, Alake; Karki, Surendra; Recordon-Pinson, Patricia; Fleury, Herve J

2011-12-01

More than 50 HIV-1-infected patients, naive of antiretroviral therapy (ART) but eligible for first line ART in JJ Hospital, Mumbai, India were investigated for surveillance drug resistance mutations (SDRMs); all but one virus belonged to subtype C; we could observe SDRMs to nonnucleoside reverse transcriptase inhibitors and protease inhibitors in 9.6% of the patients.

Real-time zymography and reverse zymography: a method for detecting activities of matrix metalloproteinases and their inhibitors using FITC-labeled collagen and casein as substrates.

Science.gov (United States)

Hattori, Shunji; Fujisaki, Hitomi; Kiriyama, Tomomi; Yokoyama, Tsukao; Irie, Shinkichi

2002-02-01

Zymography and reverse zymography are widely used techniques for identifying the proteolytic activity of enzymes and the presence of protease inhibitors in polyacrylamide gels. In the current studies, we utilized a fluorescein-isothiocyanate-labeled substrate to develop novel zymographic and reverse zymographic methods for detecting matrix metalloproteinases and tissue inhibitors of the metalloproteinases, respectively. Using a transilluminator, the results can be observed visually without stopping the enzymatic reaction. For this reason, we have named these methods real-time zymography and real-time reverse zymography. These methods have the following advantages compared with conventional protocols: (1) because the reaction can be repeatedly monitored on the polyacrylamide gels, optimization of the incubation time can be achieved without preliminary analyses; (2) higher sensitivity is achieved with a lower amount of substrate than with conventional methods; (3) a semi-quantitative analysis of matrix metalloproteinases is possible. An additional advantage of the real-time reverse zymography is that, because the fluorescence detection is specific for substrate digestion, the inhibitor bands can be easily distinguished from contaminating proteins.

Cost-effectiveness of public-health policy options in the presence of pretreatment NNRTI drug resistance in sub-Saharan Africa: A modelling study

NARCIS (Netherlands)

A. Phillips (Andrew); V. Cambiano (Valentina); F. Nakagawa (Fumiyo); P. Revill (Paul); M.R. Jordan (Michael); T.B. Hallett (Timothy); M.C. Doherty (Meg); A. de Luca (Andrea); Lundgren, J.D. (Jens D.); Mhangara, M. (Mutsa); Apollo, T. (Tsitsi); J.W. Mellors (John W.); B.E. Nichols (Brooke); Parikh, U. (Urvi); D. Pillay (Deenan); T.F. Rinke de Wit (Tobias); K.C. Sigaloff (Kim); Havlir, D. (Diane); D.R. Kuritzkes (Daniel); A. Pozniak (Anton); D.A.M.C. van de Vijver (David); M. Vitoria (Marco); Wainberg, M.A. (Mark A.); E. Raizes (Elliot); S. Bertagnolio (Silvia)

2017-01-01

textabstractBackground: There is concern over increasing prevalence of non-nucleoside reverse-transcriptase inhibitor (NNRTI) resistance in people initiating antiretroviral therapy (ART) in low-income and middle-income countries. We assessed the effectiveness and cost-effectiveness of alternative

Determinants of virological outcome and adverse events in African children treated with paediatric nevirapine fixed-dose-combination tablets

NARCIS (Netherlands)

Bienczak, A.; Denti, P.; Cook, A.; Wiesner, L.; Mulenga, V.; Kityo, C.; Kekitiinwa, A.; Gibb, D.M.; Burger, D.M.; Walker, A.S.; McIlleron, H.

2017-01-01

BACKGROUND: Nevirapine is the only nonnucleoside reverse transcriptase inhibitor currently available as a paediatric fixed-dose-combination tablet and is widely used in African children. Nonetheless, the number of investigations into pharmacokinetic determinants of virological suppression in African

The effect of efavirenz versus nevirapine-containing regimens on immunologic, virologic and clinical outcomes in a prospective observational study

NARCIS (Netherlands)

Collaboration, H.-C.; Koopmans †, P.P.; Brouwer, A.M.; Dofferhoff, A.S.M.; Flier, M. van der; Groot, R. de; Hofstede, H.J.M. ter; Keuter, M.; Ven, A.J.A.M. van der; et al.,

2012-01-01

OBJECTIVE: To compare regimens consisting of either efavirenz or nevirapine and two or more nucleoside reverse transcriptase inhibitors (NRTIs) among HIV-infected, antiretroviral-naive, and AIDS-free individuals with respect to clinical, immunologic, and virologic outcomes. DESIGN: Prospective

Kinetic analysis of enzyme systems with suicide substrate in the presence of a reversible competitive inhibitor, tested by simulated progress curves.

Science.gov (United States)

Moruno-Dávila, M A; Garrido-del Solo, C; García-Moreno, M; Havsteen, B H; Garcia-Sevilla, F; Garcia-Cánovas, F; Varón, R

2001-02-01

The use of suicide substrates remains a very important and useful method in enzymology for studying enzyme mechanisms and designing potential drugs. Suicide substrates act as modified substrates for the target enzymes and bind to the active site. Therefore the presence of a competitive reversible inhibitor decreases the rate of substrate-induced inactivation and protects the enzyme from this inactivation. This lowering on the inactivation rate has evident physiological advantages, since it allows the easy acquisition of experimental data and facilitates kinetic data analysis by providing another variable (inhibitor concentration). However despite the importance of the simultaneous action of a suicide substrate and a competitive reversible inhibition, to date no corresponding kinetic analysis has been carried out. Therefore we present a general kinetic analysis of a Michaelis-Menten reaction mechanism with double inhibition caused by both, a suicide substrate and a competitive reversible inhibitor. We assume rapid equilibrium of the reversible reaction steps involved, while the time course equations for the reaction product have been derived with the assumption of a limiting enzyme. The goodness of the analytical solutions has been tested by comparison with the simulated curves obtained by numerical integration. A kinetic data analysis to determine the corresponding kinetic parameters from the time progress curve of the product is suggested. In conclusion, we present a complete kinetic analysis of an enzyme reaction mechanism as described above in an attempt to fill a gap in the theoretical treatment of this type of system.

Identification of cysteine proteases and screening of cysteine protease inhibitors in biological samples by a two-dimensional gel system of zymography and reverse zymography.

Science.gov (United States)

Saitoh, Eiichi; Yamamoto, Shinya; Okamoto, Eishiro; Hayakawa, Yoshimi; Hoshino, Takashi; Sato, Ritsuko; Isemura, Satoko; Ohtsubo, Sadami; Taniguchi, Masayuki

2007-11-18

We have developed a two-dimensional (2D-) gel system of zymography and reverse zymography for the detection and characterization of proteases and protease inhibitors. Isoelectric focusing (IEF) agarose gels with pH gradients were employed for separation in the first-dimension and sodium dodecyl sulfate (SDS)-polyacrylamide gel copolymerized with gelatin used for the second dimension. Proteases and protease inhibitors separated by IEF gel were applied on the second gel without trichloroacetic acid (TCA) fixation. Protease activity in the 2D-gel was visualized as transparent spots where gelatin substrate was digested after commassie brilliant blue (CBB) staining. Some of the transparent spots from the skin mucus extract of rainbow trout were determined to be a cysteine protease through use of E-64 or CA-074. In the reverse zymography technique, the gel was incubated with papain solution at 37 degrees C for 18 h. Cysteine protease inhibitors from broad bean seeds were detected as clear blue spots after CBB staining. The amino (N-) terminal sequences of four papain inhibitor spots thus detected were demonstrated to be identical to that of favin beta chain, a broad bean lectin. Taken together, our system can be considered to be an efficient technique for discovering and characterizing new proteases and protease inhibitors in biological samples. This is the first report describing a 2D-gel system of zymography and reverse zymography.

Comparison of genotypic resistance profiles and virological response between patients starting nevirapine and efavirenz in EuroSIDA

DEFF Research Database (Denmark)

Bannister, Wendy P; Ruiz, Lidia; Cozzi-Lepri, Alessandro

2008-01-01

OBJECTIVE: To compare virological outcome and genotypic resistance profiles in HIV-1-infected patients starting non-nucleoside reverse transcriptase inhibitor (NNRTI)-containing regimens. METHODS: NNRTI-naive patients were included who started treatment with nevirapine (NVP) or efavirenz (EFV) wi...

Characterizing Class‐Specific Exposure‐Viral Load Suppression Response of HIV Antiretrovirals Using A Model‐Based Meta‐Analysis

Science.gov (United States)

Xu, Y; Li, YF; Zhang, D; Dockendorf, M; Tetteh, E; Rizk, ML; Grobler, JA; Lai, M‐T; Gobburu, J

2016-01-01

We applied model‐based meta‐analysis of viral suppression as a function of drug exposure and in vitro potency for short‐term monotherapy in human immunodeficiency virus type 1 (HIV‐1)‐infected treatment‐naïve patients to set pharmacokinetic targets for development of nonnucleoside reverse transcriptase inhibitors (NNRTIs) and integrase strand transfer inhibitors (InSTIs). We developed class‐specific models relating viral load kinetics from monotherapy studies to potency normalized steady‐state trough plasma concentrations. These models were integrated with a literature assessment of doses which demonstrated to have long‐term efficacy in combination therapy, in order to set steady‐state trough concentration targets of 6.17‐ and 2.15‐fold above potency for NNRTIs and InSTIs, respectively. Both the models developed and the pharmacokinetic targets derived can be used to guide compound selection during preclinical development and to predict the dose–response of new antiretrovirals to inform early clinical trial design. PMID:27171172

The allosteric HIV-1 integrase inhibitor BI-D affects virion maturation but does not influence packaging of a functional RNA genome.

Directory of Open Access Journals (Sweden)

Nikki van Bel

Full Text Available The viral integrase (IN is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs. Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.

The allosteric HIV-1 integrase inhibitor BI-D affects virion maturation but does not influence packaging of a functional RNA genome.

Science.gov (United States)

van Bel, Nikki; van der Velden, Yme; Bonnard, Damien; Le Rouzic, Erwann; Das, Atze T; Benarous, Richard; Berkhout, Ben

2014-01-01

The viral integrase (IN) is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs). Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.

Antiretroviral drug susceptibility among drug-naive adults with recent HIV infection in Rakai, Uganda.

Science.gov (United States)

Eshleman, Susan H; Laeyendecker, Oliver; Parkin, Neil; Huang, Wei; Chappey, Colombe; Paquet, Agnes C; Serwadda, David; Reynolds, Steven J; Kiwanuka, Noah; Quinn, Thomas C; Gray, Ronald; Wawer, Maria

2009-04-27

To analyze antiretroviral drug susceptibility in HIV from recently infected adults in Rakai, Uganda, prior to the availability of antiretroviral drug treatment. Samples obtained at the time of HIV seroconversion (1998-2003) were analyzed using the GeneSeq HIV and PhenoSense HIV assays (Monogram Biosciences, Inc., South San Francisco, California, USA). Test results were obtained for 104 samples (subtypes: 26A, 1C, 66D, 9A/D, 1C/D, 1 intersubtype recombinant). Mutations used for genotypic surveillance of transmitted antiretroviral drug resistance were identified in six samples: three had nucleoside reverse transcriptase inhibitor (NRTI) surveillance mutations (two had M41L, one had K219R), and three had protease inhibitor surveillance mutations (I47V, F53L, N88D); none had nonnucleoside reverse transcriptase inhibitor (NNRTI) surveillance mutations. Other resistance-associated mutations were identified in some samples. However, none of the samples had a sufficient number of mutations to predict reduced antiretroviral drug susceptibility. Ten (9.6%) of the samples had reduced phenotypic susceptibility to at least one drug (one had partial susceptibility to didanosine, one had nevirapine resistance, and eight had resistance or partial susceptibility to at least one protease inhibitor). Fifty-three (51%) of the samples had hypersusceptibility to at least one drug (seven had zidovudine hypersusceptibility, 28 had NNRTI hypersusceptibility, 34 had protease inhibitor hypersusceptibility). Delavirdine hypersusceptibility was more frequent in subtype A than D. In subtype D, efavirenz hypersusceptibility was associated with substitutions at codon 11 in HIV-reverse transcriptase. Phenotyping detected reduced antiretroviral drug susceptibility and hypersusceptibility in HIV from some antiretroviral-naive Ugandan adults that was not predicted by genotyping. Phenotyping may complement genotyping for analysis of antiretroviral drug susceptibility in populations with nonsubtype B

Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

LENUS (Irish Health Repository)

Bansode, Vijay B

2011-10-13

Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

Role of hTERT in apoptosis of cervical cancer induced by histone deacetylase inhibitor

International Nuclear Information System (INIS)

Wu, Peng; Meng, Li; Wang, Hui; Zhou, Jianfeng; Xu, Gang; Wang, Shixuan; Xi, Ling; Chen, Gang; Wang, Beibei; Zhu, Tao; Lu, Yunping; Ma, Ding

2005-01-01

Human telomerase reverse transcriptase (hTERT) is the catalytic subunit of telomerase holoenzyme as well as the rate-limiting component of the telomerase enzyme complex. However, the role of the hTERT in apoptosis induced by histone deacetylase inhibitor has only been marginally addressed. For the first time, our study demonstrated that trichostatin A (TSA) briefly activated the proliferation of cervical cancer cell lines, HeLa and SiHa, within 12 h, but then inhibited cell growth after that time point. In response to TSA, hTERT expression, telomerase activity, and telomere length also underwent similar changes during the same time frame. Furthermore, the data in our study showed that cells transfected with dominant negative hTERT were more likely to undergo apoptosis induced by TSA than cells transfected with wild-type hTERT. The cyclin/cdk inhibitor p21 waf1 was down-regulated by hTERT without changing the expression of p53. Results from this study suggest that the hTERT might be a primary target of TSA and the anti-apoptosis effect of hTERT might be carried out through a p21 waf1 -dependent and p53-independent pathway

Detection of hepatitis C virus RNA using reverse transcription PCR

International Nuclear Information System (INIS)

Yap, S.F.

1998-01-01

Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

Towards novel therapeutics for HIV through fragment-based screening and drug design.

Science.gov (United States)

Tiefendbrunn, Theresa; Stout, C David

2014-01-01

Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.

Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

Directory of Open Access Journals (Sweden)

Mengjuan Zhu

2016-03-01

Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

Increasing HIV-1 Drug Resistance Between 2010 and 2012 in Adults Participating in Population-Based HIV Surveillance in Rural KwaZulu-Natal, South Africa.

Science.gov (United States)

Manasa, Justen; Danaviah, Siva; Lessells, Richard; Elshareef, Muna; Tanser, Frank; Wilkinson, Eduan; Pillay, Sureshnee; Mthiyane, Hloniphile; Mwambi, Henry; Pillay, Deenan; de Oliveira, Tulio

2016-08-01

As more human immunodeficiency virus (HIV)-infected patients access combination antiretroviral therapy (cART), higher proportions of newly infected patients may be infected with drug-resistant viruses. Regular surveillance of transmitted drug resistance (TDR) is required in southern Africa where high rates of transmission persist despite rapid expansion of ART. Dried blood spot samples from cART-naive participants from two rounds of an annual population-based HIV surveillance program in rural KwaZulu-Natal were tested for HIV RNA, and samples with HIV RNA >10,000 copies/ml were genotyped for drug resistance. The 2009 surveillance of drug resistance mutation (SDRM) list was used for drug resistance interpretation. The data were added to previously published data from the same program, and the χ(2) test for trend was used to test for trend in estimated prevalence of any TDR. Seven hundred and one participants' data were analyzed: 67 (2010), 381 (2011), and 253 (2012). No TDR was detected in 2010. Years 2011 and 2012 had 18 participants with SDRMs 4.7% and 7.1%, respectively (p = .02, χ(2) test for trend). The nonnucleoside reverse transcriptase inhibitor mutation, K103N, was the most common mutation, occurring in 27 (3.8%) of the participants, while nucleoside reverse transcriptase inhibitor (NRTI) SDRMs were detected in 10 (1.4%) of the participants, of whom eight had only a single NRTI SDRM. The increase in levels of drug resistance observed in this population could be a signal of increasing transmission of drug-resistant HIV. Thus, continued surveillance is critical to inform public health policies around HIV treatment and prevention.

Development of potential selective and reversible pyrazoline based MAO-B inhibitors as MAO-B PET tracer precursors and reference substances for the early detection of Alzheimer's disease.

Science.gov (United States)

Neudorfer, Catharina; Shanab, Karem; Jurik, Andreas; Schreiber, Veronika; Neudorfer, Carolina; Vraka, Chrysoula; Schirmer, Eva; Holzer, Wolfgang; Ecker, Gerhard; Mitterhauser, Markus; Wadsak, Wolfgang; Spreitzer, Helmut

2014-09-15

Since high MAO-B levels are present in early stages of AD, the MAO-B system can be designated as an appropriate and prospective tracer target of molecular imaging biomarkers for the detection of early AD. According to the preceding investigations of Mishra et al. the aim of this work was the development of a compound library of selective and reversible MAO-B inhibitors by performing bioisosteric modifications of the core structure of 3-(anthracen-9-yl)-5-phenyl-4,5-dihydro-1H-pyrazoles. In conclusion, 13 new pyrazoline based derivatives have been prepared, which will serve as precursor substances for future radiolabeling as well as reference compounds for the investigation of increased MAO-B levels in AD. Copyright © 2014 Elsevier Ltd. All rights reserved.

HIV-1 drug resistance before initiation or re-initiation of first-line antiretroviral therapy in low-income and middle-income countries: a systematic review and meta-regression analysis

NARCIS (Netherlands)

Gupta, Ravindra K.; Gregson, John; Parkin, Neil; Haile-Selassie, Hiwot; Tanuri, Amilcar; Andrade Forero, Liliana; Kaleebu, Pontiano; Watera, Christine; Aghokeng, Avelin; Mutenda, Nicholus; Dzangare, Janet; Hone, San; Hang, Zaw Zaw; Garcia, Judith; Garcia, Zully; Marchorro, Paola; Beteta, Enrique; Giron, Amalia; Hamers, Raph; Inzaule, Seth; Frenkel, Lisa M.; Chung, Michael H.; de Oliveira, Tulio; Pillay, Deenan; Naidoo, Kogie; Kharsany, Ayesha; Kugathasan, Ruthiran; Cutino, Teresa; Hunt, Gillian; Avila Rios, Santiago; Doherty, Meg; Jordan, Michael R.; Bertagnolio, Silvia

2018-01-01

Pretreatment drug resistance in people initiating or re-initiating antiretroviral therapy (ART) containing non-nucleoside reverse transcriptase inhibitors (NNRTIs) might compromise HIV control in low-income and middle-income countries (LMICs). We aimed to assess the scale of this problem and whether

Executive summary of the GESIDA/National AIDS Plan Consensus Document on antiretroviral therapy in adults infected by the human immunodeficiency virus (updated January 2015).

Science.gov (United States)

Berenguer, Juan; Polo, Rosa; Aldeguer, José López; Lozano, Fernando; Aguirrebengoa, Koldo; Arribas, José Ramón; Blanco, José Ramón; Boix, Vicente; Casado, José Luis; Clotet, Bonaventura; Crespo, Manuel; Domingo, Pere; Estrada, Vicente; García, Federico; Gatell, José María; González-García, Juan; Gutiérrez, Félix; Iribarren, José Antonio; Knobel, Hernando; Llibre, Josep María; Locutura, Jaime; López, Juan Carlos; Miró, José M; Moreno, Santiago; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz-Moreno, José; Sanz, Jesús; Téllez, María Jesús; Tuset, Montserrat; Rivero, Antonio

2015-10-01

In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation vary depending on the CD4+ T-lymphocyte count, the presence of opportunistic infections or comorbid conditions, age, and the efforts to prevent the transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise three drugs, namely, two nucleoside reverse transcriptase inhibitors (NRTI) and one drug from another family. Three of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further seven regimens, which are based on an INSTI, an non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with ritonavir (PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include three (or at least two) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

[Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury].

Science.gov (United States)

Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B

2018-02-06

Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

The selective serotonin reuptake inhibitor, escitalopram, enhances inhibition of prepotent responding and spatial reversal learning

Science.gov (United States)

Brown, Holden D.; Amodeo, Dionisio A.; Sweeney, John A.; Ragozzino, Michael E.

2011-01-01

Previous findings indicate treatment with a selective serotonin reuptake inhibitor (SSRI) facilitates behavioral flexibility when conditions require inhibition of a learned response pattern. The present experiment investigated whether acute treatment with the SSRI, escitalopram, affects behavioral flexibility when conditions require inhibition of a naturally-biased response pattern (elevated conflict test) and/or reversal of a learned response pattern (spatial reversal learning). An additional experiment was carried out to determine whether escitalopram, at doses that affected behavioral flexibility, also reduced anxiety as tested in the elevated plus-maze. In each experiment, Long-Evans rats received an intraperitoneal injection of either saline or escitalopram (0.03, 0.3 or 1.0 mg/kg) 30 minutes prior to behavioral testing. Escitalopram, at all doses tested, enhanced acquisition in the elevated conflict test, but did not affect performance in the elevated plus-maze. Escitalopram (0.3 and 1.0 mg/kg) did not alter acquisition of the spatial discrimination, but facilitated reversal learning. In the elevated conflict and spatial reversal learning test, escitalopram enhanced the ability to maintain the relevant strategy after being initially selected. The present findings suggest that enhancing serotonin transmission with a SSRI facilitates inhibitory processes when conditions require a shift away from either a naturally-biased response pattern or a learned choice pattern. PMID:22219222

Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

Science.gov (United States)

Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

2005-01-01

Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

Ritonavir-boosted darunavir combined with raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults infected with HIV-1: 96 week results from the NEAT001/ANRS143 randomised non-inferiority trial

NARCIS (Netherlands)

Raffi, François; Babiker, Abdel G.; Richert, Laura; Molina, Jean-Michel; George, Elizabeth C.; Antinori, Andrea; Arribas, Jose R.; Grarup, Jesper; Hudson, Fleur; Schwimmer, Christine; Saillard, Juliette; Wallet, Cédrick; Jansson, Per O.; Allavena, Clotilde; van Leeuwen, Remko; Delfraissy, Jean-François; Vella, Stefano; Chêne, Geneviève; Pozniak, Anton; Dedes, Nikos; Autran, Brigitte; Bucciardini, Raffaella; Horban, Andrzej; Arribas, José; Boffito, Marta; Pillay, Deenan; Franquet, Xavier; Schwarze, Siegfried; Fischer, Aurélie; Diallo, Alpha; Moecklinghoff, Christiane; Stellbrink, Hans-Jürgen; Gatell, José; Sandström, Eric; Flepp, Markus; Ewings, Fiona; Pearce, Gillian; Quercia, Romina; Rogatto, Felipe; Leavitt, Randi; Nguyen, Bach-Yen; Goebel, Frank; Marcotullio, Simone; Kaur, Navrup; Sasieni, Peter; Spencer-Drake, Christina; Peto, Tim; Miller, Veronica; Arnault, Fabien; Boucherie, Céline; Jean, Delphine; Paniego, Virginie; Paraina, Felasoa; Rouch, Elodie; Soussi, Malika; Taieb, Audrey; Touzeau, Guillaume; Cursley, Adam; Dodds, Wendy; Hoppe, Anne; Kummeling, Ischa; Pacciarini, Filippo; Paton, Nick; Russell, Charlotte; Taylor, Kay; Ward, Denise; Aagaard, Bitten; Eid, Marius; Gey, Daniela; Jensen, Birgitte Gram; Jakobsen, Marie-Louise; Jensen, Karoline; Joensen, Zillah Maria; Larsen, Ellen Moseholm; Pahl, Christiane; Pearson, Mary; Nielsen, Birgit Riis; Reilev, Søren Stentoft; Christ, Ilse; Lathouwers, Desiree; Manting, Corry; Mendy, Bienvenu Yves; Metro, Annie; Couffin-Cadiergues, Sandrine; Knellwolf, Anne-Laure; Palmisano, Lucia; Aznar, Esther; Barea, Cristina; Cotarelo, Manuel; Esteban, Herminia; Girbau, Iciar; Moyano, Beatriz; Ramirez, Miriam; Saiz, Carmen; Sanchez, Isabel; Yllescas, Maria; Binelli, Andrea; Colasanti, Valentina; Massella, Maurizio; Anagnostou, Olga; Gioukari, Vicky; Touloumi, Giota; Schmied, Brigitte; Rieger, Armin; Vetter, Norbert; de Wit, Stephane; Florence, Eric; Vandekerckhove, Linos; Gerstoft, Jan; Mathiesen, Lars; Katlama, Christine; Cabie, André; Cheret, Antoine; Dupon, Michel; Ghosn, Jade; Girard, Pierre-Marie; Goujard, Cécile; Lévy, Yves; Morlat, Philippe; Neau, Didier; Obadia, Martine; Perre, Philippe; Piroth, Lionel; Reynes, Jacques; Tattevin, Pierre; Raffi, Francois; Ragnaud, Jean Marie; Weiss, Laurence; Yazdanpanah, Yazdan; Yeni, Patrick; Zucman, David; Behrens, Georg; Esser, Stefan; Fätkenheuer, Gerd; Hoffmann, Christian; Jessen, Heiko; Rockstroh, Jürgen; Schmidt, Reinhold; Stephan, Christoph; Unger, Stefan; Hatzakis, Angelos; Daikos, George L.; Papadopoulos, Antonios; Skoutelis, Athamasios; Banhegyi, Denes; Mallon, Paddy; Mulcahy, Fiona; Andreoni, Massimo; Bonora, Stefano; Castelli, Francesco; Monforte, Antonella D.'Arminio; Galli, Massimo; Lazzarin, Adriano; Mazzotta, Francesco; Vullo, Vincenzo; Prins, Jan; Richter, Clemens; Verhagen, Dominique; Eeden, Van; Doroana, Manuela; Antunes, Francisco; Maltez, Fernando; Sarmento-Castro, Rui; Gonzalez Garcia, Juan; López Aldeguer, José; Clotet, Bonaventura; Domingo, Pere; Gatell, Jose M.; Knobel, Hernando; Marquez, Manuel; Pilar Miralles, Martin; Portilla, Joaquin; Soriano, Vicente; Tellez, Maria-Jesus; Thalme, Anders; Blaxhult, Anders; Gisslen, Magnus; Winston, Alan; Fox, Julie; Gompels, Mark; Herieka, Elbushra; Johnson, Margaret; Leen, Clifford; Teague, Alastair; Williams, Ian; Boyd, Mark Alastair; Møller, Nina Friis; Larsen, Ellen Frøsig Moseholm; Le Moing, Vincent; Wit, Ferdinand W. N. M.; Kowalska, Justyna; Berenguer, Juan; Moreno, Santiago; Müller, Nicolas J.; Török, Estée; Post, Frank; Angus, Brian; Boucher, Charles; Calvez, Vincent; Collins, Simon; Dunn, David; Fox, Zoe; Perno, Carlo Federico; Ammassari, Adriana; Stoehr, Wolgang; Schmidt, Reinhold Ernst; Odermarsky, Michal; Smith, Colette; Thiébaut, Rodolphe; Arribas, Jose; de La Serna, Jose Ignacio Bernardino; Castagna, Antonella; Furrer, Hans-Jackob; Mocroft, Amanda; Reiss, Peter; Fragola, Vincenzo; Lauriola, Marco; Murri, Rita; Nieuwkerk, Pythia; Spire, Bruno; Volny-Anne, Alain; West, Brian; Amieva, Hélène; Llibre Codina, Josep Maria

2014-01-01

Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. Between August, 2010, and September, 2011, we

Efficacy and durability of nevirapine in antiretroviral drug naive patients

NARCIS (Netherlands)

Lange, Joep M. A.

2003-01-01

Nevirapine is a non-nucleoside reverse transcriptase inhibitor (NNRTI) that was first reported in the scientific literature in 1990. Varying doses of nevirapine (NVP) and a number of regimens containing this NNRTI have been studied in antiretroviral (ARV) naive patients. Four key studies have

Bone mineral density and inflammatory and bone biomarkers after darunavir-ritonavir combined with either raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults with HIV-1: a substudy of the NEAT001/ANRS143 randomised trial

NARCIS (Netherlands)

Bernardino, Jose I.; Mocroft, Amanda; Mallon, Patrick W.; Wallet, Cedrick; Gerstoft, Jan; Russell, Charlotte; Reiss, Peter; Katlama, Christine; de Wit, Stephane; Richert, Laura; Babiker, Abdel; Buño, Antonio; Castagna, Antonella; Girard, Pierre-Marie; Chene, Genevieve; Raffi, Francois; Arribas, Jose R.; Dedes, Nikos; Allavena, Clotilde; Autran, Brigitte; Antinori, Andrea; Bucciardini, Raffaella; Vella, Stefano; Horban, Andrzej; Arribas, Jose; Babiker, Abdel G.; Boffito, Marta; Pillay, Deenan; Pozniak, Anton; Franquet, Xavier; Schwarze, Siegfried; Grarup, Jesper; Fischer, Aurelie; Diallo, Alpha; Molina, Jean-Michel; Saillard, Juliette; Moecklinghoff, Christiane; Stellbrink, Hans-Jurgen; van Leeuwen, Remko; Gatell, Jose; Sandstrom, Eric; Flepp, Markus; Ewings, Fiona; George, Elizabeth C.; Hudson, Fleur; Pearce, Gillian; Quercia, Romina; Prins, Jan; Wit, Ferdinand W. N. M.; Nieuwkerk, Pythia

2015-01-01

Osteopenia, osteoporosis, and low bone mineral density are frequent in patients with HIV. We assessed the 96 week loss of bone mineral density associated with a nucleoside or nucleotide reverse transcriptase inhibitor (NtRTI)-sparing regimen. Antiretroviral-naive adults with HIV were enrolled in 78

Efficacy and safety of rilpivirine in treatment-naive, HIV-1-infected patients with hepatitis B virus/hepatitis C virus coinfection enrolled in the Phase III randomized, double-blind ECHO and THRIVE trials

DEFF Research Database (Denmark)

Nelson, Mark; Amaya, Gerardo; Clumeck, Nathan

2012-01-01

OBJECTIVES: The efficacy and hepatic safety of the non-nucleoside reverse transcriptase inhibitors rilpivirine (TMC278) and efavirenz were compared in treatment-naive, HIV-infected adults with concurrent hepatitis B virus (HBV) and/or hepatitis C virus (HCV) infection in the pooled week 48 analys...

Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

DEFF Research Database (Denmark)

Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

2012-01-01

We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

Directory of Open Access Journals (Sweden)

Jessica H Brehm

Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

Pre-existing mutations in reverse transcriptase of hepatitis B virus in treatment-naive Chinese patients with chronic hepatitis B.

Directory of Open Access Journals (Sweden)

Jie Xu

Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.

High Levels of Transmitted HIV Drug Resistance in a Study in Papua New Guinea.

Science.gov (United States)

Lavu, Evelyn; Kave, Ellan; Mosoro, Euodia; Markby, Jessica; Aleksic, Eman; Gare, Janet; Elsum, Imogen A; Nano, Gideon; Kaima, Petronia; Dala, Nick; Gurung, Anup; Bertagnolio, Silvia; Crowe, Suzanne M; Myatt, Mark; Hearps, Anna C; Jordan, Michael R

2017-01-01

Papua New Guinea is a Pacific Island nation of 7.3 million people with an estimated HIV prevalence of 0.8%. ART initiation and monitoring are guided by clinical staging and CD4 cell counts, when available. Little is known about levels of transmitted HIV drug resistance in recently infected individuals in Papua New Guinea. Surveillance of transmitted HIV drug resistance in a total of 123 individuals recently infected with HIV and aged less than 30 years was implemented in Port Moresby (n = 62) and Mount Hagen (n = 61) during the period May 2013-April 2014. HIV drug resistance testing was performed using dried blood spots. Transmitted HIV drug resistance was defined by the presence of one or more drug resistance mutations as defined by the World Health Organization surveillance drug resistance mutations list. The prevalence of non-nucleoside reverse transcriptase inhibitor transmitted HIV drug resistance was 16.1% (95% CI 8.8%-27.4%) and 8.2% (95% CI 3.2%-18.2%) in Port Moresby and Mount Hagen, respectively. The prevalence of nucleoside reverse transcriptase inhibitor transmitted HIV drug resistance was 3.2% (95% CI 0.2%-11.7%) and 3.3% (95% CI 0.2%-11.8%) in Port Moresby and Mount Hagen, respectively. No protease inhibitor transmitted HIV drug resistance was observed. The level of non-nucleoside reverse transcriptase inhibitor drug resistance in antiretroviral drug naïve individuals recently infected with HIV in Port Moresby is amongst the highest reported globally. This alarming level of transmitted HIV drug resistance in a young sexually active population threatens to limit the on-going effective use of NNRTIs as a component of first-line ART in Papua New Guinea. To support the choice of nationally recommended first-line antiretroviral therapy, representative surveillance of HIV drug resistance among antiretroviral therapy initiators in Papua New Guinea should be urgently implemented.

The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

NARCIS (Netherlands)

Oude Essink, B. B.; Berkhout, B.

1999-01-01

Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

Phorate can reverse P450 metabolism-based herbicide resistance in Lolium rigidum.

Science.gov (United States)

Busi, Roberto; Gaines, Todd Adam; Powles, Stephen

2017-02-01

Organophosphate insecticides can inhibit specific cytochrome P450 enzymes involved in metabolic herbicide resistance mechanisms, leading to synergistic interactions between the insecticide and the herbicide. In this study we report synergistic versus antagonistic interactions between the organophosphate insecticide phorate and five different herbicides observed in a population of multiple herbicide-resistant Lolium rigidum. Phorate synergised with three different herbicide modes of action, enhancing the activity of the ALS inhibitor chlorsulfuron (60% LD 50 reduction), the VLCFAE inhibitor pyroxasulfone (45% LD 50 reduction) and the mitosis inhibitor trifluralin (70% LD 50 reduction). Conversely, phorate antagonised the two thiocarbamate herbicides prosulfocarb and triallate with a 12-fold LD 50 increase. We report the selective reversal of P450-mediated metabolic multiple resistance to chlorsulfuron and trifluralin in the grass weed L. rigidum by synergistic interaction with the insecticide phorate, and discuss the putative mechanistic basis. This research should encourage diversity in herbicide use patterns for weed control as part of a long-term integrated management effort to reduce the risk of selection of metabolism-based multiple herbicide resistance in L. rigidum. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Rethinking the risk-benefit ratio of efavirenz in HIV-infected children

NARCIS (Netherlands)

Wijer, L van de; Schellekens, A.F.A.; Burger, D.M.; Homberg, J.R.; Mast, Q. de; Ven, A.J.A.M. van der

2016-01-01

The non-nucleoside reverse transcriptase inhibitor efavirenz is part of the WHO guidelines for preferred first-line treatment of HIV-1-infected adults, pregnant and lactating women, and children. Efavirenz is well known to cause CNS toxicity. Although good data for CNS toxicity are available for

Continued indinavir versus switching to indinavir/ritonavir in HIV-infected patients with suppressed viral load.

NARCIS (Netherlands)

Arnaiz, J.A.; Mallolas, J.; Podzamczer, D.; Gerstoft, J.; Lundgren, J.D.; Cahn, P.; Fatkenheuer, G.; D'Arminio-Monforte, A.; Casiro, A.; Reiss, P.; Burger, D.M.; Stek Jr, M.; Gatell, J.M.

2003-01-01

OBJECTIVE: To compare continued indinavir (IDV) 8-hourly (q8h) with switching to indinavir/ritonavir (IDV/RTV) 12-hourly (q12h) in HIV-positive patients having suppressed viral load with IDV q8h plus two nucleoside reverse transcriptase inhibitors (NRTI). DESIGN: Multicentre, international,

Continued indinavir versus switching to indinavir/ritonavir in HIV-infected patients with suppressed viral load

NARCIS (Netherlands)

Arnaiz, Juan A.; Mallolas, Josep; Podzamczer, Daniel; Gerstoft, Jan; Lundgren, Jens D.; Cahn, Pedro; Fätkenheuer, Gerd; D'Arminio-Monforte, Antonella; Casiró, Arnaldo; Reiss, Peter; Burger, David M.; Stek, Michael; Gatell, José M.

2003-01-01

Objective: To compare continued indinavir (IDV) 8-hourly (q8h) with switching to indinavir/ritonavir (IDV/RTV) 12-hourly (q12h) in HIV-positive patients having suppressed viral load with IDV q8h plus two nucleoside reverse transcriptase inhibitors (NRTI). Design: Multicentre, international,

A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

International Nuclear Information System (INIS)

Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key

2016-01-01

Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

Energy Technology Data Exchange (ETDEWEB)

Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)

2016-08-26

Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

Reversible Inhibitors of Monoamine Oxidase-A (RIMAs): Robust, Reversible Inhibition of Human Brain MAO-A by CX157

Science.gov (United States)

Fowler, Joanna S; Logan, Jean; Azzaro, Albert J; Fielding, Robert M; Zhu, Wei; Poshusta, Amy K; Burch, Daniel; Brand, Barry; Free, James; Asgharnejad, Mahnaz; Wang, Gene-Jack; Telang, Frank; Hubbard, Barbara; Jayne, Millard; King, Payton; Carter, Pauline; Carter, Scott; Xu, Youwen; Shea, Colleen; Muench, Lisa; Alexoff, David; Shumay, Elena; Schueller, Michael; Warner, Donald; Apelskog-Torres, Karen

2010-01-01

Reversible inhibitors of monoamine oxidase-A (RIMA) inhibit the breakdown of three major neurotransmitters, serotonin, norepinephrine and dopamine, offering a multi-neurotransmitter strategy for the treatment of depression. CX157 (3-fluoro-7-(2,2,2-trifluoroethoxy)phenoxathiin-10,10-dioxide) is a RIMA, which is currently in development for the treatment of major depressive disorder. We examined the degree and reversibility of the inhibition of brain monoamine oxidase-A (MAO-A) and plasma CX157 levels at different times after oral dosing to establish a dosing paradigm for future clinical efficacy studies, and to determine whether plasma CX157 levels reflect the degree of brain MAO-A inhibition. Brain MAO-A levels were measured with positron emission tomography (PET) imaging and [11C]clorgyline in 15 normal men after oral dosing of CX157 (20–80 mg). PET imaging was conducted after single and repeated doses of CX157 over a 24-h time course. We found that 60 and 80 mg doses of CX157 produced a robust dose-related inhibition (47–72%) of [11C]clorgyline binding to brain MAO-A at 2 h after administration and that brain MAO-A recovered completely by 24 h post drug. Plasma CX157 concentration was highly correlated with the inhibition of brain MAO-A (EC50: 19.3 ng/ml). Thus, CX157 is the first agent in the RIMA class with documented reversible inhibition of human brain MAO-A, supporting its classification as a RIMA, and the first RIMA with observed plasma levels that can serve as a biomarker for the degree of brain MAO-A inhibition. These data were used to establish the dosing regimen for a current clinical efficacy trial with CX157. PMID:19890267

TMC125 exerts similar initial antiviral potency as a five-drug, triple class antiretroviral regimen

NARCIS (Netherlands)

Sankatsing, Sanjay U. C.; Weverling, Gerrit J.; Peeters, Monika; van't Klooster, Gerben; Gruzdev, Boris; Rakhmanova, Aza; Danner, Sven A.; Jurriaans, Suzanne; Prins, Jan M.; Lange, Joep M. A.

2003-01-01

Objective: TMC125, a next generation, non-nucleoside reverse transcriptase inhibitor (NNRTI), demonstrated a remarkable decline of plasma HIV-1 RNA during a phase IIa study. We compared the initial rate of decline of plasma HIV-1 RNA achieved by TMC125 monotherapy with that of a triple class,

Characterizing Class-Specific Exposure-Viral Load Suppression Response of HIV Antiretrovirals Using A Model-Based Meta-Analysis.

Science.gov (United States)

Xu, Y; Li, Y F; Zhang, D; Dockendorf, M; Tetteh, E; Rizk, M L; Grobler, J A; Lai, M-T; Gobburu, J; Ankrom, W

2016-08-01

We applied model-based meta-analysis of viral suppression as a function of drug exposure and in vitro potency for short-term monotherapy in human immunodeficiency virus type 1 (HIV-1)-infected treatment-naïve patients to set pharmacokinetic targets for development of nonnucleoside reverse transcriptase inhibitors (NNRTIs) and integrase strand transfer inhibitors (InSTIs). We developed class-specific models relating viral load kinetics from monotherapy studies to potency normalized steady-state trough plasma concentrations. These models were integrated with a literature assessment of doses which demonstrated to have long-term efficacy in combination therapy, in order to set steady-state trough concentration targets of 6.17- and 2.15-fold above potency for NNRTIs and InSTIs, respectively. Both the models developed and the pharmacokinetic targets derived can be used to guide compound selection during preclinical development and to predict the dose-response of new antiretrovirals to inform early clinical trial design. © 2016 The Authors. Clinical and Translational Science published by Wiley Periodicals, Inc. on behalf of American Society for Clinical Pharmacology and Therapeutics.

Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

Directory of Open Access Journals (Sweden)

Winny Xie

2013-12-01

Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

International Nuclear Information System (INIS)

Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

1999-01-01

We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

Population-based surveillance of HIV drug resistance emerging on treatment and associated factors at sentinel antiretroviral therapy sites in Namibia.

Science.gov (United States)

Hong, Steven Y; Jonas, Anna; DeKlerk, Michael; Shiningavamwe, Andreas; Desta, Tiruneh; Badi, Alfons; Morris, Lynn; Hunt, Gillian M; Ledwaba, Johanna; Sheehan, Heidi B; Lau, Kiger; Trotter, Andrew; Tang, Alice M; Wanke, Christine; Jordan, Michael R

2015-04-01

The World Health Organization (WHO) prospective surveys of acquired HIV drug resistance (HIVDR) evaluate HIVDR emerging after the first year of antiretroviral therapy (ART) and associated factors. Consecutive ART starters in 2009 were enrolled at 3 sentinel sites in Namibia. Genotyping was performed at start and after 12 months in patients with HIV viral load (VL) >1000 copies per mL. HIVDR outcomes were: HIVDR prevention (VL ≤1000 copies/mL), possible HIVDR (VL >1000 copies/mL without detectable HIVDR or loss to follow-up or ART stop), and HIVDR (VL >1000 copies/mL with detectable HIVDR). Adherence was assessed using medication possession ratio (MPR). Of 394 starters, at 12 months, 80% were on first-line ART, 1% died, 4% transferred out, 1% stopped ART, <1% switched to second-line, and 15% were lost to follow-up. Among patients on first-line, 77% had VL testing, and 94% achieved VL ≤1000 copies per mL. At baseline, 7% had HIVDR. After 12 months, among patients with VL testing, 5% had HIVDR. A majority of patients failing therapy had high-level resistance to nonnucleoside reverse transcriptase inhibitors but none to protease inhibitors. All sites achieved the WHO target of ≥70% HIVDR prevention. Factors associated with not achieving HIVDR prevention were: baseline resistance to nonnucleoside reverse transcriptase inhibitors [odds ratio (OR) 3.0, P = 0.023], WHO stage 3 or 4 at baseline (OR 2.0, P = 0.012), and MPR <75% (OR 4.9, P = 0.021). Earlier ART initiation and removal of barriers to on-time drug pickups may help to prevent HIVDR. These data inform decisions at national and global levels on the effectiveness of first- and second-line regimens.

Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

Science.gov (United States)

Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

2011-07-01

Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

HIV drug resistance following a decade of the free antiretroviral therapy programme in India: A review.

Science.gov (United States)

Karade, Santosh; Chaturbhuj, Devidas N; Sen, Sourav; Joshi, Rajneesh K; Kulkarni, Smita S; Shankar, Subramanian; Gangakhedkar, Raman R

2018-01-01

The objective of this review was to assess the burden of HIV drug resistance mutations (DRM) in Indian adults exposed to first-line antiretroviral therapy (ART) as per national guidelines. An advanced search of the published literature on HIV drug resistance in India was performed in the PubMed and Scopus databases. Data pertaining to age, sex, CD4 count, viral load, and prevalence of nucleoside reverse transcriptase inhibitor (NRTI)/non-nucleoside reverse transcriptase inhibitor (NNRTI) DRM were extracted from each publication. Year-wise Indian HIV-1 reverse transcriptase (RT) sequences were retrieved from the Los Alamos HIV database and mutation analyses were performed. A time trend analysis of the proportion of sequences showing NRTI resistance mutations among individuals exposed to first-line ART was conducted. Overall, 23 studies (1046 unique RT sequences) were identified indicating a prevalence of drug resistance to NRTI and NNRTI. The proportion of RT sequences with any DRM, any NRTI DRM, and any NNRTI DRM was 78.39%, 68.83%, and 73.13%, respectively. The temporal trend analysis of individual DRM from sequences retrieved during 2004-2014 indicated a rising trend in K65R mutations (p=0.013). Although the overall burden of resistance against first-line ART agents remained steady over the study decade, periodic monitoring is essential. There is the need to develop an HIV-1 subtype C-specific resistance database in India. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

HIV drug resistance in infants increases with changing prevention of mother-to-child transmission regimens.

Science.gov (United States)

Poppe, Lisa K; Chunda-Liyoka, Catherine; Kwon, Eun H; Gondwe, Clement; West, John T; Kankasa, Chipepo; Ndongmo, Clement B; Wood, Charles

2017-08-24

The objectives of this study were to determine HIV drug resistance (HIVDR) prevalence in Zambian infants upon diagnosis, and to determine how changing prevention of mother-to-child transmission (PMTCT) drug regimens affect drug resistance. Dried blood spot (DBS) samples from infants in the Lusaka District of Zambia, obtained during routine diagnostic screening, were collected during four different years representing three different PMTCT drug treatment regimens. DNA extracted from dried blood spot samples was used to sequence a 1493 bp region of the reverse transcriptase gene. Sequences were analyzed via the Stanford HIVDRdatabase (http://hivdb.standford.edu) to screen for resistance mutations. HIVDR in infants increased from 21.5 in 2007/2009 to 40.2% in 2014. Nonnucleoside reverse transcriptase inhibitor resistance increased steadily over the sampling period, whereas nucleoside reverse transcriptase inhibitor resistance and dual class resistance both increased more than threefold in 2014. Analysis of drug resistance scores in each group revealed increasing strength of resistance over time. In 2014, children with reported PMTCT exposure, defined as infant prophylaxis and/or maternal treatment, showed a higher prevalence and strength of resistance compared to those with no reported exposure. HIVDR is on the rise in Zambia and presents a serious problem for the successful lifelong treatment of HIV-infected children. PMTCT affects both the prevalence and strength of resistance and further research is needed to determine how to mitigate its role leading to resistance.

Adipocytes Impair Efficacy of Antiretroviral Therapy

Science.gov (United States)

Couturier, Jacob; Winchester, Lee C.; Suliburk, James W.; Wilkerson, Gregory K.; Podany, Anthony T.; Agarwal, Neeti; Chua, Corrine Ying Xuan; Nehete, Pramod N.; Nehete, Bharti P.; Grattoni, Alessandro; Sastry, K. Jagannadha; Fletcher, Courtney V.; Lake, Jordan E.; Balasubramanyan, Ashok; Lewis, Dorothy E.

2018-01-01

Adequate distribution of antiretroviral drugs to infected cells in HIV patients is critical for viral suppression. In humans and primates, HIV- and SIV-infected CD4 T cells in adipose tissues have recently been identified as reservoirs for infectious virus. To better characterize adipose tissue as a pharmacological sanctuary for HIV-infected cells, in vitro experiments were conducted to assess antiretroviral drug efficacy in the presence of adipocytes, and drug penetration in adipose tissue cells (stromal-vascular-fraction cells and mature adipocytes) was examined in treated humans and monkeys. Co-culture experiments between HIV-1-infected CD4 T cells and primary human adipocytes showed that adipocytes consistently reduced the antiviral efficacy of the nucleotide reverse transcriptase inhibitor tenofovir and its prodrug forms tenofovir disoproxil fumarate (TDF) and tenofovir alafenamide (TAF). In HIV-infected persons, LC-MS/MS analysis of intracellular lysates derived from adipose tissue stromal-vascular-fraction cells or mature adipocytes suggested that integrase inhibitors penetrate adipose tissue, whereas penetration of nucleoside/nucleotide reverse transcriptase inhibitors such as TDF, emtricitabine, abacavir, and lamivudine is restricted. The limited distribution and functions of key antiretroviral drugs within fat depots may contribute to viral persistence in adipose tissue. PMID:29630975

Long-term analysis of resistance development in HIV-1 positive patients treated with protease and reverse transcriptase inhibitors: Correlation of the genotype and disease progression

Czech Academy of Sciences Publication Activity Database

Prejdová, Jana; Weber, Jan; Machala, L.; Reiniš, Milan; Linka, M.; Brůčková, M.; Vandasová, M.; Staňková, M.; Konvalinka, Jan

2005-01-01

Roč. 49, č. 1 (2005), 29-36 ISSN 0001-723X R&D Projects: GA MZd(CZ) NI6339 Grant - others:5th Framework(XE) QLK2-CT-2001-02360 Institutional research plan: CEZ:AV0Z4055905 Keywords : HIV * protease inhibitors * resistance development Subject RIV: CE - Biochemistry Impact factor: 0.696, year: 2005

Approaches to tenofovir and abacavir drug shortages in South Africa: A guide for clinicians

Directory of Open Access Journals (Sweden)

Laurie Schowalter

2012-06-01

Full Text Available Shortages of the nucleoside reverse transcriptase inhibitors (NRTI abacavir and tenofovir have been reported recently at health facilities across South Africa. The Society issued the following clinical advice to healthcare providers experiencing shortages on 29 March 2012. These recommendations are intended only as a guide to clinical therapy, based on expert consensus and best available evidence. Treatment decisions for patients should be made by their responsible clinicians, with due consideration for individual circumstances. S Afr J HIV Med 2012;13(2:56-57.

A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

Directory of Open Access Journals (Sweden)

Meng Shuang

2010-06-01

Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

International Nuclear Information System (INIS)

Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

2006-01-01

Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

2-acetylphenol analogs as potent reversible monoamine oxidase inhibitors

Directory of Open Access Journals (Sweden)

Legoabe LJ

2015-07-01

Full Text Available Lesetja J Legoabe,1 Anél Petzer,1 Jacobus P Petzer1,21Centre of Excellence for Pharmaceutical Sciences, 2Department of Pharmaceutical Chemistry, School of Pharmacy, North-West University, Potchefstroom, South AfricaAbstract: Based on a previous report that substituted 2-acetylphenols may be promising leads for the design of novel monoamine oxidase (MAO inhibitors, a series of C5-substituted 2-acetylphenol analogs (15 and related compounds (two were synthesized and evaluated as inhibitors of human MAO-A and MAO-B. Generally, the study compounds exhibited inhibitory activities against both MAO-A and MAO-B, with selectivity for the B isoform. Among the compounds evaluated, seven compounds exhibited IC50 values <0.01 µM for MAO-B inhibition, with the most selective compound being 17,000-fold selective for MAO-B over the MAO-A isoform. Analyses of the structure–activity relationships for MAO inhibition show that substitution on the C5 position of the 2-acetylphenol moiety is a requirement for MAO-B inhibition, and the benzyloxy substituent is particularly favorable in this regard. This study concludes that C5-substituted 2-acetylphenol analogs are potent and selective MAO-B inhibitors, appropriate for the design of therapies for neurodegenerative disorders such as Parkinson’s disease.Keywords: monoamine oxidase, MAO, inhibition, 2-acetylphenol, structure–activity relationship

Incidence of nevirapine-associated hepatitis in an antenatal clinic

African Journals Online (AJOL)

2008-01-22

Jan 22, 2008 ... together with a non-nucleoside reverse transcriptase inhibitor, either efavirenz or nevirapine.1 As efavirenz is thought to be a teratogen and is classified as a Food and Drug Administration. (FDA) category D drug, nevirapine is the preferred agent for use in pregnant women, for women planning a pregnancy ...

Efavirenz poisoning in a 12 year old HIV negative African boy ...

African Journals Online (AJOL)

Efavirenz is an oral antiretroviral drug in the class of non nucleoside reverse transcriptase inhibitors. Toxicity at therapeutic doses has been documented but there is scarcity of data on presentation and management of Efavirenz overdose. We describe a case of Efavirenz poisoning in a 12-year old HIV Negative African boy ...

In vitro resistance profile of the candidate HIV-1 microbicide drug dapivirine.

Science.gov (United States)

Schader, Susan M; Oliveira, Maureen; Ibanescu, Ruxandra-Ilinca; Moisi, Daniela; Colby-Germinario, Susan P; Wainberg, Mark A

2012-02-01

Antiretroviral-based microbicides may offer a means to reduce the sexual transmission of HIV-1. Suboptimal use of a microbicide may, however, lead to the development of drug resistance in users that are already, or become, infected with HIV-1. In such cases, the efficacy of treatments may be compromised since the same (or similar) antiretrovirals used in treatments are being developed as microbicides. To help predict which drug resistance mutations may develop in the context of suboptimal use, HIV-1 primary isolates of different subtypes and different baseline resistance profiles were used to infect primary cells in vitro in the presence of increasing suboptimal concentrations of the two candidate microbicide antiretrovirals dapivirine (DAP) and tenofovir (TFV) alone or in combination. Infections were ongoing for 25 weeks, after which reverse transcriptase genotypes were determined and scrutinized for the presence of any clinically recognized reverse transcriptase drug resistance mutations. Results indicated that suboptimal concentrations of DAP alone facilitated the emergence of common nonnucleoside reverse transcriptase inhibitor resistance mutations, while suboptimal concentrations of DAP plus TFV gave rise to fewer mutations. Suboptimal concentrations of TFV alone did not frequently result in the development of resistance mutations. Sensitivity evaluations for stavudine (d4T), nevirapine (NVP), and lamivudine (3TC) revealed that the selection of resistance as a consequence of suboptimal concentrations of DAP may compromise the potential for NVP to be used in treatment, a finding of potential relevance in developing countries.

Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

Science.gov (United States)

Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

2017-11-22

Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P ＜ 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

NSC23925, identified in a high-throughput cell-based screen, reverses multidrug resistance.

Directory of Open Access Journals (Sweden)

Zhenfeng Duan

2009-10-01

Full Text Available Multidrug resistance (MDR is a major factor which contributes to the failure of cancer chemotherapy, and numerous efforts have been attempted to overcome MDR. To date, none of these attempts have yielded a tolerable and effective therapy to reverse MDR; thus, identification of new agents would be useful both clinically and scientifically.To identify small molecule compounds that can reverse chemoresistance, we developed a 96-well plate high-throughput cell-based screening assay in a paclitaxel resistant ovarian cancer cell line. Coincubating cells with a sublethal concentration of paclitaxel in combination with each of 2,000 small molecule compounds from the National Cancer Institute Diversity Set Library, we identified a previously uncharacterized molecule, NSC23925, that inhibits Pgp1 and reverses MDR1 (Pgp1 but does not inhibit MRP or BCRP-mediated MDR. The cytotoxic activity of NSC23925 was further evaluated using a panel of cancer cell lines expressing Pgp1, MRP, and BCRP. We found that at a concentration of >10 microM NSC23925 moderately inhibits the proliferation of both sensitive and resistant cell lines with almost equal activity, but its inhibitory effect was not altered by co-incubation with the Pgp1 inhibitor, verapamil, suggesting that NSC23925 itself is not a substrate of Pgp1. Additionally, NSC23925 increases the intracellular accumulation of Pgp1 substrates: calcein AM, Rhodamine-123, paclitaxel, mitoxantrone, and doxorubicin. Interestingly, we further observed that, although NSC23925 directly inhibits the function of Pgp1 in a dose-dependent manner without altering the total expression level of Pgp1, NSC23925 actually stimulates ATPase activity of Pgp, a phenomenon seen in other Pgp inhibitors.The ability of NSC23925 to restore sensitivity to the cytotoxic effects of chemotherapy or to prevent resistance could significantly benefit cancer patients.

Identification of Cysteine Proteases and Screening of Cysteine Protease Inhibitors in Biological Samples by a Two-Dimensional Gel System of Zymography and Reverse Zymography

OpenAIRE

Saitoh, Eiichi; Yamamoto, Shinya; Okamoto, Eishiro; Hayakawa, Yoshimi; Hoshino, Takashi; Sato, Ritsuko; Isemura, Satoko; Ohtsubo, Sadami; Taniguchi, Masayuki

2007-01-01

We have developed a two-dimensional (2D-) gel system of zymography and reverse zymography for the detection and characterization of proteases and protease inhibitors. Isoelectric focusing (IEF) agarose gels with pH gradients were employed for separation in the fi rst-dimension and sodium dodecyl sulfate (SDS)-polyacrylamide gel copolymerized with gelatin used for the second dimension. Proteases and protease inhibitors separated by IEF gel were applied on the second gel without trichloroacetic...

Neutralizing antibody and anti-retroviral drug sensitivities of HIV-1 isolates resistant to small molecule CCR5 inhibitors

International Nuclear Information System (INIS)

Pugach, Pavel; Ketas, Thomas J.; Michael, Elizabeth; Moore, John P.

2008-01-01

The small molecule CCR5 inhibitors are a new class of drugs for treating infection by human immunodeficiency virus type 1 (HIV-1). They act by binding to the CCR5 co-receptor and preventing its use during HIV-1-cell fusion. Escape mutants can be raised against CCR5 inhibitors in vitro and will arise when these drugs are used clinically. Here, we have assessed the responses of CCR5 inhibitor-resistant viruses to other anti-retroviral drugs that act by different mechanisms, and their sensitivities to neutralizing antibodies (NAbs). The rationale for the latter study is that the resistance pathway for CCR5 inhibitors involves changes in the HIV-1 envelope glycoproteins (Env), which are also targets for NAbs. The escape mutants CC101.19 and D1/85.16 were selected for resistance to AD101 and vicriviroc (VVC), respectively, from the primary R5 HIV-1 isolate CC1/85. Each escape mutant was cross-resistant to other small molecule CCR5 inhibitors (aplaviroc, maraviroc, VVC, AD101 and CMPD 167), but sensitive to protein ligands of CCR5: the modified chemokine PSC-RANTES and the humanized MAb PRO-140. The resistant viruses also retained wild-type sensitivity to the nucleoside reverse transcriptase inhibitor (RTI) zidovudine, the non-nucleoside RTI nevirapine, the protease inhibitor atazanavir and other attachment and fusion inhibitors that act independently of CCR5 (BMS-806, PRO-542 and enfuvirtide). Of note is that the escape mutants were more sensitive than the parental CC1/85 isolate to a subset of neutralizing monoclonal antibodies and to some sera from HIV-1-infected people, implying that sequence changes in Env that confer resistance to CCR5 inhibitors can increase the accessibility of some NAb epitopes. The need to preserve NAb resistance may therefore be a constraint upon how escape from CCR5 inhibitors occurs in vivo

Reverse engineering of the robot base platform

International Nuclear Information System (INIS)

Anwar A Rahman; Azizul Rahman A Aziz; Mohd Arif Hamzah; Muhd Nor Atan; Fadil Ismail; Rosli Darmawan

2009-01-01

The robot base platform used to place the robotic arm version 2 was imported through a local company. The robot base platform is used as a reference for reverse egineering development for a smaller size robot. The paper will discuss the reverse engineering design process and parameters involved in the development of the robot base platform. (Author)

The Prevalence of Transmitted Drug Resistance in Newly Diagnosed HIV-Infected Individuals in Croatia: The Role of Transmission Clusters of Men Who Have Sex with Men Carrying the T215S Surveillance Drug Resistance Mutation

Science.gov (United States)

Grgic, Ivana; Lunar, Maja M.; Poljak, Mario; Vince, Adriana; Vrakela, Ivana Baca; Planinic, Ana; Seme, Katja; Begovac, Josip

2013-01-01

Abstract The aim of this study was to determine the prevalence of transmitted drug resistance (TDR) in newly diagnosed and treatment-naive HIV-infected patients from Croatia and evaluate a possible contribution of transmission clusters to the spread of resistant virus. The study enrolled treatment-naive HIV-infected patients that entered clinical care at the Croatian Reference Center for HIV/AIDS between 2006 and 2008. The protease gene and a part of the reverse transcriptase gene of the HIV-1 genome were sequenced by using the Trugene HIV-1 Genotyping System. The prevalence of transmitted drug resistance was analyzed by using the surveillance drug resistance mutations (SDRM) list recommended by the WHO in 2009. We report findings for 118 of 180 eligible patients (65.6% coverage). SDRM were detected in 26 of 118 patients (22.0%) who were infected with subtype B and belonged mostly to the men having sex with men (MSM). The majority of patients with primary resistance carried SDRM associated with resistance to nucleoside analogues reverse transcriptase inhibitors (NRTIs, 23 of 118 patients, 19.5%). The most frequently found NRTI SDRM was T215S (17 of 118 patients, 14.4%). SDRM associated with resistance to nonnucleoside reverse transcriptase inhibitors were detected in three (2.5%) patients and primary resistance to protease inhibitors was not detected. Non-B subtypes were detected in 13/118 patients (11%). A total of 12 transmission pairs and eight distinct transmission clusters were identified with the largest cluster harboring sequences from 19 patients; among them all but two were carrying the T215S mutation. This study showed a high prevalence of TDR in newly diagnosed MSM from Croatia and is an important contribution concerning the relationship between local transmission clusters and the spread of resistant virus. PMID:22906365

1-Benzyl-2-(1H-indol-3-yl-5-oxopyrrolidine-2-carbonitrile

Directory of Open Access Journals (Sweden)

Raymond Schinazi

2008-02-01

Full Text Available In the title compound, C20H17N3O, a potential anti-human immunodeficiency virus type 1 (HIV-1 non-nucleoside reverse-transcriptase inhibitor, the pyrrolidine ring has an envelope conformation. In the crystal structure, adjacent molecules are connected into infinite chains via an N—H...O hydrogen bond.

Structure-Based Search for New Inhibitors of Cholinesterases

Directory of Open Access Journals (Sweden)

Barbara Malawska

2013-03-01

Full Text Available Cholinesterases are important biological targets responsible for regulation of cholinergic transmission, and their inhibitors are used for the treatment of Alzheimer’s disease. To design new cholinesterase inhibitors, of different structure-based design strategies was followed, including the modification of compounds from a previously developed library and a fragment-based design approach. This led to the selection of heterodimeric structures as potential inhibitors. Synthesis and biological evaluation of selected candidates confirmed that the designed compounds were acetylcholinesterase inhibitors with IC50 values in the mid-nanomolar to low micromolar range, and some of them were also butyrylcholinesterase inhibitors.

Reversible targeting of noncatalytic cysteines with chemically tuned electrophiles

DEFF Research Database (Denmark)

Serafimova, Iana M; Pufall, Miles A; Krishnan, Shyam

2012-01-01

Targeting noncatalytic cysteine residues with irreversible acrylamide-based inhibitors is a powerful approach for enhancing pharmacological potency and selectivity. Nevertheless, concerns about off-target modification motivate the development of reversible cysteine-targeting strategies. Here we...... of these electrophiles into a noncovalent kinase-recognition scaffold produced slowly dissociating, covalent inhibitors of the p90 ribosomal protein S6 kinase RSK2. A cocrystal structure revealed specific noncovalent interactions that stabilize the complex by positioning the electrophilic carbon near the targeted...

Pyrroloaryls and pyrroloheteroaryls: Inhibitors of the HIV fusion/attachment, reverse transcriptase and integrase

Czech Academy of Sciences Publication Activity Database

Patel, Rahul V.; Park, S.W.

2015-01-01

Roč. 23, č. 17 (2015), s. 5247-5263 ISSN 0968-0896 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Pyrrole * Arylthiopyrrole * Triciribine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.923, year: 2015

Suicide Inhibitors of Reverse Transcriptase in the Therapy of AIDS and Other Retroviruses

Science.gov (United States)

1989-07-01

are shown below. One of the first, [N-(L-3-tran carboxyxiran-2-carbonyl)-L-leucyl]-amido (4-guanido) butane was isolated from Asperg /II japonicus and...using uridine nucleosides to enhance the antiviral selectivity. j, Synthesis of Uridine 2’ and 3*-Ribosoiroxr’es 3*-uridine spiroxirane was...system used (Figure 2). Also shown in this figure is the enhanced sensitivity of the vaccif recombinant HIV-RT to Foscarnet when expressed in monkey kidney

Cyclic GMP-AMP Synthase is an Innate Immune Sensor of HIV and Other Retroviruses

OpenAIRE

Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J.

2013-01-01

Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic-GMP-AMP (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type-I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse transcribed HIV DNA triggers the...

Reversing the Effect of Oral Anticoagulant Drugs: Established and Newer Options.

Science.gov (United States)

Ansell, Jack E

2016-06-01

The vitamin K antagonists (VKAs) have been the standard (and only) oral anticoagulants used for the long-term treatment or prevention of venous thromboembolism or stroke in patients with atrial fibrillation. The coagulopathy induced by VKAs can be reversed with vitamin K, and in urgent situations, the vitamin K-dependent coagulation factors can be replaced by transfusion. In the last decade, a new class of oral anticoagulants has been developed, direct oral anticoagulants that bind to a specific coagulation factor and neutralize it. These compounds were shown to be effective and safe compared with the VKAs and were licensed for specific indications, but without a specific reversal agent. The absence of a reversal agent is a barrier to more widespread use of these agents. Currently, for the management of major life-threatening bleeding with the direct oral anticoagulants, most authorities recommend the use of four factor prothrombin complex concentrates. There are now three reversal agents in development and poised to enter the market. Idarucizumab is a specific antidote targeted to reverse the direct thrombin inhibitor, dabigatran, which was recently approved for use in the USA. Andexanet alfa is an antidote targeted to reverse the oral direct factor Xa inhibitors as well as the indirect inhibitor enoxaparin. Ciraparantag is an antidote targeted to reverse the direct thrombin and factor Xa inhibitors as well as the indirect inhibitor enoxaparin.

Prevalence of HIV Antiretroviral Drug Resistance and Its Impacts on HIV-1 Virological Failures in Jiangsu, China: A Cross-Sectional Study

Directory of Open Access Journals (Sweden)

Ying Zhou

2016-01-01

Full Text Available Antiretroviral therapy (ART has been shown to improve survival of patients with Human Immunodeficiency Virus (HIV infection and to reduce HIV-1 transmission. Therefore, the Chinese central government initiated a national program to provide ART free of charge to HIV-1 patients. We conducted a cross-sectional survey in Jiangsu province to determine the level of drug resistance (DR in HIV-1 infected patients and the correlates of DR in virological failures in 2012. Approximately 10.4% of the HIV-1 patients in the study experienced virological failure after one year of ART and were divided into drug sensitive and drug resistant groups based on genotype determination. The viral loads (VLs in the drug resistant group were significantly lower than the drug sensitive group. There were two independent predictors of virological failure: male gender and increasing duration of treatment. The primary mutations observed in the study were against nucleoside reverse transcriptase inhibitors (NRTIs which were M184V (79.45% and K103N (33.70% in nonnucleoside reverse transcriptase inhibitors (NNRTIs. The overall rate of DR in Jiangsu province is still relatively low among treated patients. However, close monitoring of drug resistance in male patients in the early stages of treatment is vital to maintaining and increasing the benefits of HIV ART achieved to date.

Menin-MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.

Science.gov (United States)

Grembecka, Jolanta; He, Shihan; Shi, Aibin; Purohit, Trupta; Muntean, Andrew G; Sorenson, Roderick J; Showalter, Hollis D; Murai, Marcelo J; Belcher, Amalia M; Hartley, Thomas; Hess, Jay L; Cierpicki, Tomasz

2012-01-29

Translocations involving the mixed lineage leukemia (MLL) gene result in human acute leukemias with very poor prognosis. The leukemogenic activity of MLL fusion proteins is critically dependent on their direct interaction with menin, a product of the multiple endocrine neoplasia (MEN1) gene. Here we present what are to our knowledge the first small-molecule inhibitors of the menin-MLL fusion protein interaction that specifically bind menin with nanomolar affinities. These compounds effectively reverse MLL fusion protein-mediated leukemic transformation by downregulating the expression of target genes required for MLL fusion protein oncogenic activity. They also selectively block proliferation and induce both apoptosis and differentiation of leukemia cells harboring MLL translocations. Identification of these compounds provides a new tool for better understanding MLL-mediated leukemogenesis and represents a new approach for studying the role of menin as an oncogenic cofactor of MLL fusion proteins. Our findings also highlight a new therapeutic strategy for aggressive leukemias with MLL rearrangements.

Lipid profile of HIV-infected patients in relation to antiretroviral therapy: a review.

Science.gov (United States)

Souza, Suelen Jorge; Luzia, Liania Alves; Santos, Sigrid Sousa; Rondó, Patrícia Helen Carvalho

2013-01-01

This study reviewed the lipid profile of human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) patients in relation to use of antiretroviral therapy (ART), and its different classes of drugs. A total of 190 articles published in peer-reviewed journals were retrieved from PubMed and LILACS databases; 88 of them met the selection criteria and were included in the review. Patients with HIV/AIDS without ART presented an increase of triglycerides and decreases of total cholesterol, low density lipoprotein (LDL-c), and high density lipoprotein (HDL-c) levels. Distinct ART regimens appear to promote different alterations in lipid metabolism. Protease inhibitors, particularly indinavir and lopinavir, were commonly associated with hypercholesterolemia, high LDL-c, low HDL-c, and hypertriglyceridemia. The protease inhibitor atazanavir is apparently associated with a more advantageous lipid profile. Some nucleoside reverse-transcriptase inhibitors (didanosine, stavudine, and zidovudine) induced lipoatrophy and hypertriglyceridemia, whereas abacavir increased the risk of cardiovascular diseases even in the absence of apparent lipid disorders, and tenofovir resulted in lower levels of cholesterol and triglycerides. Although non-nucleoside reverse-transcriptase inhibitors predisposed to hypertriglyceridemia and hypercholesterolemia, nevirapine was particularly associated with high HDL-c levels, a protective factor against cardiovascular diseases. Therefore, the infection itself, different classes of drugs, and some drugs from the same class of ART appear to exert distinct alterations in lipid metabolism. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.

Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡

Science.gov (United States)

Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

2011-01-01

Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR

Directory of Open Access Journals (Sweden)

Nagaraju Anreddy

2014-06-01

Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.

Prevalence and patterns of HIV transmitted drug resistance in Guatemala.

Science.gov (United States)

Avila-Ríos, Santiago; Mejía-Villatoro, Carlos R; García-Morales, Claudia; Soto-Nava, Maribel; Escobar, Ingrid; Mendizabal, Ricardo; Girón, Amalia; García, Leticia; Reyes-Terán, Gustavo

2011-12-01

To assess human immunodeficiency virus (HIV) diversity and the prevalence of transmitted drug resistance (TDR) in Guatemala. One hundred forty-five antiretroviral treatment-naïve patients referred to the Roosevelt Hospital in Guatemala City were enrolled from October 2010 to March 2011. Plasma HIV pol sequences were obtained and TDR was assessed with the Stanford algorithm and the World Health Organization (WHO) TDR surveillance mutation list. HIV subtype B was highly prevalent in Guatemala (96.6%, 140/145), and a 2.8% (4/145) prevalence of BF1 recombinants and 0.7% (1/145) prevalence of subtype C viruses were found. TDR prevalence for the study period was 8.3% (12/145) with the Stanford database algorithm (score > 15) and the WHO TDR surveillance mutation list. Most TDR cases were associated with non-nucleoside reverse transcriptase inhibitors (NNRTIs) (83.3%, 10/12); a low prevalence of nucleoside reverse transcriptase inhibitors and protease inhibitors was observed in the cohort (Guatemala. TDR prevalence in Guatemala was at the intermediate level. Most TDR cases were associated with NNRTIs. Further and continuous TDR surveillance is necessary to gain more indepth knowledge about TDR spread and trends in Guatemala and to optimize treatment outcomes in the country.

Hypoxia induces telomerase reverse transcriptase (TERT gene expression in non-tumor fish tissues in vivo: the marine medaka (Oryzias melastigma model

Directory of Open Access Journals (Sweden)

Mok Helen OL

2006-09-01

Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This

Human Immunodeficiency Virus Type 1 Protease and the Emergence of Drug Resistance

DEFF Research Database (Denmark)

Poulsen, Nina Rødtness

in multi-drug-resistant PRs. Computational analysis of a vast number of inhibitor-resistant HIV-1 PR variants can broaden the knowledge of how and why the mutations arise, which would be a great advantage in the design on resistance-evading inhibitors. Here we present a diverse system to select...... in the virus life cycle has made it a major target for drug development and active site competitive inhibitors have been successful in the battle against HIV. Unfortunately, the massive drug pressure along with high-level replication and lack of proofreading by the viral reverse transcriptase have resulted...... for catalytically active HIV-1 PR in the presence of inhibitor. The system is based on the protein AraC, which regulates transcription of the araA, araB and araD genes necessary for arabinose catabolism in Escherichia coli, and its effectiveness was demonstrated by the isolation of both known and unknown inhibitor-resistant...

High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

Science.gov (United States)

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Molecular cloning of Kuruma shrimp Marsupenaeus japonicus endonuclease-reverse transcriptase and its positive role in white spot syndrome virus and Vibrio alginolyticus infection.

Science.gov (United States)

Ma, Xiongchao; Sun, Baozhen; Zhu, Fei

2018-02-01

This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.

Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

Directory of Open Access Journals (Sweden)

Turyadi Turyadi

2018-01-01

Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

In-situ hybridization based quantification of hTR: a possible biomarker in malignant melanoma

DEFF Research Database (Denmark)

Vagner, Josephine; Steiniche, Torben; Stougaard, Magnus

2015-01-01

thickness suggesting that hTR might be a valuable biomarker in MM. Furthermore, as ISH-based detection requires presence of both hTR and the reverse transcriptase (hTERT) it might be an indicator of active telomerase and thus have future relevance as a predictive biomarker for anti-telomerase treatment....

Impact of switching antiretroviral therapy on lipodystrophy and other metabolic complications: a review

DEFF Research Database (Denmark)

Hansen, Birgitte R; Haugaard, Steen B; Iversen, Johan

2004-01-01

with the disfiguring body-alterations known as HALS. More recently, however, regimens containing nucleoside reverse-transcriptase inhibitors (NRTI) have attracted attention. Reviewing switch studies regarding metabolic parameters and body shape changes, certain trends emerge. Switching from PI, the metabolic...... complications such as dyslipidaemia and insulin resistance seem to be partly reversible, whereas the morphologic alterations appear to be unchanged. In studies in which NRTI's are switched, dyslipidaemia appears unaffected, but a modest improvement in peripheral lipoatrophy has been reported. However...

In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants

Directory of Open Access Journals (Sweden)

Mokhtar Nosrati

2017-08-01

Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.

Selective and membrane-permeable small molecule inhibitors of nicotinamide N-methyltransferase reverse high fat diet-induced obesity in mice.

Science.gov (United States)

Neelakantan, Harshini; Vance, Virginia; Wetzel, Michael D; Wang, Hua-Yu Leo; McHardy, Stanton F; Finnerty, Celeste C; Hommel, Jonathan D; Watowich, Stanley J

2018-01-01

reverse diet-induced obesity and validate NNMT as a viable target to treat obesity and related metabolic conditions. Increased flux of key cellular energy regulators, including NAD + and SAM, may potentially define the therapeutic mechanism-of-action of NNMT inhibitors. Copyright © 2017 Elsevier Inc. All rights reserved.

Simulated Analysis of Linear Reversible Enzyme Inhibition with SCILAB

Science.gov (United States)

Antuch, Manuel; Ramos, Yaquelin; Álvarez, Rubén

2014-01-01

SCILAB is a lesser-known program (than MATLAB) for numeric simulations and has the advantage of being free software. A challenging software-based activity to analyze the most common linear reversible inhibition types with SCILAB is described. Students establish typical values for the concentration of enzyme, substrate, and inhibitor to simulate…

Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

Directory of Open Access Journals (Sweden)

Tandale Babasaheb V

2008-12-01

Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

Universal, class-specific and drug-specific reversal agents for the new oral anticoagulants.

Science.gov (United States)

Ansell, Jack E

2016-02-01

Although there is controversy about the absolute need for a reversal agent for the new direct oral anticoagulants (DOACs), the absence of such an agent is a barrier to more widespread use of these agents. For the management of major life-threatening bleeding with the DOACs, most authorities recommend the use of four factor prothrombin complex concentrates, although the evidence to support their use in terms of improving outcomes is meager. At the present time, there are three antidotes in development and poised to enter the market. Idarucizumab is a drug-specific antidote targeted to reverse the direct thrombin inhibitor, dabigatran. Andexanet alfa is a class-specific antidote targeted to reverse the oral direct factor Xa inhibitors as well as the indirect inhibitor, enoxaparin. Ciraparantag is a universal antidote targeted to reverse the direct thrombin and factor Xa inhibitors as well as the indirect inhibitor, enoxaparin.

Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

Science.gov (United States)

Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

2014-01-01

During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

Microarray-based screening of heat shock protein inhibitors.

Science.gov (United States)

Schax, Emilia; Walter, Johanna-Gabriela; Märzhäuser, Helene; Stahl, Frank; Scheper, Thomas; Agard, David A; Eichner, Simone; Kirschning, Andreas; Zeilinger, Carsten

2014-06-20

Based on the importance of heat shock proteins (HSPs) in diseases such as cancer, Alzheimer's disease or malaria, inhibitors of these chaperons are needed. Today's state-of-the-art techniques to identify HSP inhibitors are performed in microplate format, requiring large amounts of proteins and potential inhibitors. In contrast, we have developed a miniaturized protein microarray-based assay to identify novel inhibitors, allowing analysis with 300 pmol of protein. The assay is based on competitive binding of fluorescence-labeled ATP and potential inhibitors to the ATP-binding site of HSP. Therefore, the developed microarray enables the parallel analysis of different ATP-binding proteins on a single microarray. We have demonstrated the possibility of multiplexing by immobilizing full-length human HSP90α and HtpG of Helicobacter pylori on microarrays. Fluorescence-labeled ATP was competed by novel geldanamycin/reblastatin derivatives with IC50 values in the range of 0.5 nM to 4 μM and Z(*)-factors between 0.60 and 0.96. Our results demonstrate the potential of a target-oriented multiplexed protein microarray to identify novel inhibitors for different members of the HSP90 family. Copyright © 2014 Elsevier B.V. All rights reserved.

In vitro HIV-1 evolution in response to triple reverse transcriptase inhibitors & in silico phenotypic analysis.

Directory of Open Access Journals (Sweden)

Barbara A Rath

Full Text Available Effectiveness of ART regimens strongly depends upon complex interactions between the selective pressure of drugs and the evolution of mutations that allow or restrict drug resistance.Four clinical isolates from NRTI-exposed, NNRTI-naive subjects were passaged in increasing concentrations of NVP in combination with 1 µM 3 TC and 2 µM ADV to assess selective pressures of multi-drug treatment. A novel parameter inference procedure, based on a stochastic viral growth model, was used to estimate phenotypic resistance and fitness from in vitro combination passage experiments.Newly developed mathematical methods estimated key phenotypic parameters of mutations arising through selective pressure exerted by 3 TC and NVP. Concentrations of 1 µM 3 TC maintained the M184V mutation, which was associated with intrinsic fitness deficits. Increasing NVP concentrations selected major NNRTI resistance mutations. The evolutionary pathway of NVP resistance was highly dependent on the viral genetic background, epistasis as well as stochasticity. Parameter estimation indicated that the previously unrecognized mutation L228Q was associated with NVP resistance in some isolates.Serial passage of viruses in the presence of multiple drugs may resemble the selection of mutations observed among treated individuals and populations in vivo and indicate evolutionary preferences and restrictions. Phenotypic resistance estimated here "in silico" from in vitro passage experiments agreed well with previous knowledge, suggesting that the unique combination of "wet-" and "dry-lab" experimentation may improve our understanding of HIV-1 resistance evolution in the future.

Class 1-Selective Histone Deacetylase (HDAC) Inhibitors Enhance HIV Latency Reversal while Preserving the Activity of HDAC Isoforms Necessary for Maximal HIV Gene Expression.

Science.gov (United States)

Zaikos, Thomas D; Painter, Mark M; Sebastian Kettinger, Nadia T; Terry, Valeri H; Collins, Kathleen L

2018-03-15

Combinations of drugs that affect distinct mechanisms of HIV latency aim to induce robust latency reversal leading to cytopathicity and elimination of the persistent HIV reservoir. Thus far, attempts have focused on combinations of protein kinase C (PKC) agonists and pan-histone deacetylase inhibitors (HDIs) despite the knowledge that HIV gene expression is regulated by class 1 histone deacetylases. We hypothesized that class 1-selective HDIs would promote more robust HIV latency reversal in combination with a PKC agonist than pan-HDIs because they preserve the activity of proviral factors regulated by non-class 1 histone deacetylases. Here, we show that class 1-selective agents used alone or with the PKC agonist bryostatin-1 induced more HIV protein expression per infected cell. In addition, the combination of entinostat and bryostatin-1 induced viral outgrowth, whereas bryostatin-1 combinations with pan-HDIs did not. When class 1-selective HDIs were used in combination with pan-HDIs, the amount of viral protein expression and virus outgrowth resembled that of pan-HDIs alone, suggesting that pan-HDIs inhibit robust gene expression induced by class 1-selective HDIs. Consistent with this, pan-HDI-containing combinations reduced the activity of NF-κB and Hsp90, two cellular factors necessary for potent HIV protein expression, but did not significantly reduce overall cell viability. An assessment of viral clearance from in vitro cultures indicated that maximal protein expression induced by class 1-selective HDI treatment was crucial for reservoir clearance. These findings elucidate the limitations of current approaches and provide a path toward more effective strategies to eliminate the HIV reservoir. IMPORTANCE Despite effective antiretroviral therapy, HIV evades eradication in a latent form that is not affected by currently available drug regimens. Pharmacologic latency reversal that leads to death of cellular reservoirs has been proposed as a strategy for

1-(4-Bromobenzoyl-2-phenylpyrrolidine-2-carboxamide

Directory of Open Access Journals (Sweden)

Vahan Martirosyan

2008-03-01

Full Text Available In the title compound, C18H17BrN2O2, which is a potential human immunodeficiency virus type 1 (HIV-1 non-nucleoside reverse transcriptase inhibitor, the pyrrolidine ring exhibits an envelope conformation. In the crystal structure, intermolecular N—H...O hydrogen bonds [N...O = 2.861 (3 Å] link the molecules into centrosymmetric dimers.

7-Chloro-11a-phenyl-2,3,5,10,11,11a-hexahydro-1H-pyrrolo[2,1-c][1,4]benzodiazepine-5,11-dione

Directory of Open Access Journals (Sweden)

Vahan Martirosyan

2008-03-01

Full Text Available The title compound, C18H15ClN2O2, is a potential human immunodeficiency virus type-1 (HIV-1 non-nucleoside reverse transcriptase inhibitor. The pyrrolidine ring adopts an envelope and the diazepine ring a boat conformation. In the crystal structure, two isomers (R and S form centrosymmetric dimers via N—H...O hydrogen bonds.

Scaffold hopping: exploration of acetanilide-containing uracil analogues as potential NNRTIs.

Science.gov (United States)

Babkov, Denis A; Valuev-Elliston, Vladimir T; Paramonova, Maria P; Ozerov, Alexander A; Ivanov, Alexander V; Chizhov, Alexander O; Khandazhinskaya, Anastasia L; Kochetkov, Sergey N; Balzarini, Jan; Daelemans, Dirk; Pannecouque, Christophe; Seley-Radtke, Katherine L; Novikov, Mikhail S

2015-03-01

In order to identify novel nonnucleoside inhibitors of HIV-1 reverse transcriptase two series of amide-containing uracil derivatives were designed as hybrids of two scaffolds of previously reported inhibitors. Subsequent biological evaluation confirmed acetamide uracil derivatives 15a-k as selective micromolar NNRTIs with a first generation-like resistance profile. Molecular modeling of the most active compounds 15c and 15i was employed to provide insight on their inhibitory properties and direct future design efforts. Copyright © 2015 Elsevier Ltd. All rights reserved.

Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

Science.gov (United States)

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-06-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Tranexamic Acid Failed to Reverse the Anticoagulant Effect and Bleeding by an Oral Direct Factor Xa Inhibitor Edoxaban.

Science.gov (United States)

Honda, Yuko; Furugohri, Taketoshi; Morishima, Yoshiyuki

2018-01-01

Agents to reverse the anticoagulant effect of edoxaban, an oral direct factor Xa inhibitor, would be desirable in emergency situations. The aim of this study is to determine the effect of tranexamic acid, an antifibrinolytic agent, on the anticoagulant activity and bleeding by edoxaban in rats. A supratherapeutic dose of edoxaban (3 mg/kg) was intravenously administered to rats. Three minutes after dosing, tranexamic acid (100 mg/kg) was given intravenously. Bleeding was induced by making an incision with a blade on the planta 8 min after edoxaban injection and bleeding time was measured. Prothrombin time (PT) and clot lysis were examined. A supratherapeutic dose of edoxaban significantly prolonged PT and bleeding time. Tranexamic acid did not affect PT or bleeding time prolonged by edoxaban, although tranexamic acid significantly inhibited clot lysis in rat plasma. An antifibrinolytic agent tranexamic acid failed to reverse the anticoagulant effect and bleeding by edoxaban in rats. © 2017 S. Karger AG, Basel.

Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

Science.gov (United States)

Mo, Yiqun; Wan, Rong; Zhang, Qunwei

2012-01-01

Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

Development and validation of reversed-phase HPLC gradient method for the estimation of efavirenz in plasma.

Directory of Open Access Journals (Sweden)

Shweta Gupta

Full Text Available Efavirenz is an anti-viral agent of non-nucleoside reverse transcriptase inhibitor category used as a part of highly active retroviral therapy for the treatment of infections of human immune deficiency virus type-1. A simple, sensitive and rapid reversed-phase high performance liquid chromatographic gradient method was developed and validated for the determination of efavirenz in plasma. The method was developed with high performance liquid chromatography using Waters X-Terra Shield, RP18 50 x 4.6 mm, 3.5 μm column and a mobile phase consisting of phosphate buffer pH 3.5 and Acetonitrile. The elute was monitored with the UV-Visible detector at 260 nm with a flow rate of 1.5 mL/min. Tenofovir disoproxil fumarate was used as internal standard. The method was validated for linearity, precision, accuracy, specificity, robustness and data obtained were statistically analyzed. Calibration curve was found to be linear over the concentration range of 1-300 μg/mL. The retention times of efavirenz and tenofovir disoproxil fumarate (internal standard were 5.941 min and 4.356 min respectively. The regression coefficient value was found to be 0.999. The limit of detection and the limit of quantification obtained were 0.03 and 0.1 μg/mL respectively. The developed HPLC method can be useful for quantitative pharmacokinetic parameters determination of efavirenz in plasma.

L-Chicoric acid inhibits human immunodeficiency virus type 1 integration in vivo and is a noncompetitive but reversible inhibitor of HIV-1 integrase in vitro

International Nuclear Information System (INIS)

Reinke, Ryan A.; Lee, Deborah J.; McDougall, Brenda R.; King, Peter J.; Victoria, Joseph; Mao Yingqun; Lei Xiangyang; Reinecke, Manfred G.; Robinson, W. Edward

2004-01-01

The human immunodeficiency virus (HIV) integrase (IN) must covalently join the viral cDNA into a host chromosome for productive HIV infection. L-Chicoric acid (L-CA) enters cells poorly but is a potent inhibitor of IN in vitro. Using quantitative real-time polymerase chain reaction (PCR), L-CA inhibits integration at concentrations from 500 nM to 10 μM but also inhibits entry at concentrations above 1 μM. Using recombinant HIV IN, steady-state kinetic analyses with L-CA were consistent with a noncompetitive or irreversible mechanism of inhibition. IN, in the presence or absence of L-CA, was successively washed. Inhibition of IN diminished, demonstrating that L-CA was reversibly bound to the protein. These data demonstrate that L-CA is a noncompetitive but reversible inhibitor of IN in vitro and of HIV integration in vivo. Thus, L-CA likely interacts with amino acids other than those which bind substrate

MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

DEFF Research Database (Denmark)

Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.

2015-01-01

Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors...... as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult...... zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance...

Selective Inducible Nitric Oxide Synthase Inhibitor Reversed Zinc Chloride-Induced Spatial Memory Impairment via Increasing Cholinergic Marker Expression.

Science.gov (United States)

Tabrizian, Kaveh; Azami, Kian; Belaran, Maryam; Soodi, Maliheh; Abdi, Khosrou; Fanoudi, Sahar; Sanati, Mehdi; Mottaghi Dastjerdi, Negar; Soltany Rezaee-Rad, Mohammad; Sharifzadeh, Mohammad

2016-10-01

Zinc, an essential micronutrient and biochemical element of the human body, plays structural, catalytic, and regulatory roles in numerous physiological functions. In the current study, the effects of a pretraining oral administration of zinc chloride (10, 25, and 50 mg/kg) for 14 consecutive days and post-training bilateral intra-hippocampal infusion of 1400W as a selective inducible nitric oxide synthase (iNOS) inhibitor (10, 50, and 100 μM/side), alone and in combination, on the spatial memory retention in Morris water maze (MWM) were investigated. Animals were trained for 4 days and tested 48 h after completion of training. Also, the molecular effects of these compounds on the expression of choline acetyltransferase (ChAT), as a cholinergic marker in the CA1 region of the hippocampus and medial septal area (MSA), were evaluated. Behavioral and molecular findings of this study showed that a 2-week oral administration of zinc chloride (50 mg/kg) impaired spatial memory retention in MWM and decreased ChAT expression. Immunohistochemical analysis of post-training bilateral intra-hippocampal infusion of 1400W revealed a significant increase in ChAT immunoreactivity. Furthermore, post-training bilateral intra-hippocampal infusion of 1400W into the CA1 region of the hippocampus reversed zinc chloride-induced spatial memory impairment in MWM and significantly increased ChAT expression in comparison with zinc chloride-treated animals. Taken together, these results emphasize the role of selective iNOS inhibitors in reversing zinc chloride-induced spatial memory deficits via modulation of cholinergic marker expression.

High Rates of Baseline Drug Resistance and Virologic Failure Among ART-naive HIV-infected Children in Mali.

Science.gov (United States)

Crowell, Claudia S; Maiga, Almoustapha I; Sylla, Mariam; Taiwo, Babafemi; Kone, Niaboula; Oron, Assaf P; Murphy, Robert L; Marcelin, Anne-Geneviève; Traore, Ban; Fofana, Djeneba B; Peytavin, Gilles; Chadwick, Ellen G

2017-11-01

Limited data exist on drug resistance and antiretroviral treatment (ART) outcomes in HIV-1-infected children in West Africa. We determined the prevalence of baseline resistance and correlates of virologic failure (VF) in a cohort of ART-naive HIV-1-infected children baseline (before ART) and at 6 months. Resistance was defined according to the Stanford HIV Genotypic Resistance database. VF was defined as viral load ≥1000 copies/mL after 6 months of ART. Logistic regression was used to evaluate factors associated with VF or death >1 month after enrollment. Post hoc, antiretroviral concentrations were assayed on baseline samples of participants with baseline resistance. One-hundred twenty children with a median age 2.6 years (interquartile range: 1.6-5.0) were included. Eighty-eight percent reported no prevention of mother-to-child transmission exposure. At baseline, 27 (23%), 4 (3%) and none had non-nucleoside reverse transcriptase inhibitor (NNRTI), nucleoside reverse transcriptase inhibitor or protease inhibitor resistance, respectively. Thirty-nine (33%) developed VF and 4 died >1 month post-ART initiation. In multivariable analyses, poor adherence [odds ratio (OR): 6.1, P = 0.001], baseline NNRTI resistance among children receiving NNRTI-based ART (OR: 22.9, P baseline NNRTI resistance (OR: 5.8, P = 0.018) were significantly associated with VF/death. Ten (38%) with baseline resistance had detectable levels of nevirapine or efavirenz at baseline; 7 were currently breastfeeding, but only 2 reported maternal antiretroviral use. Baseline NNRTI resistance was common in children without reported NNRTI exposure and was associated with increased risk of treatment failure. Detectable NNRTI concentrations were present despite few reports of maternal/infant antiretroviral use.

Clinical and virological efficacy of etravirine plus two active Nucleos(tide analogs in an heterogeneous HIV-infected population.

Directory of Open Access Journals (Sweden)

Luis F López-Cortés

Full Text Available Etravirine (ETV is recommended in combination with a boosted protease inhibitor plus an optimized background regimen for salvage therapy, but there is limited experience with its use in combination with two nucleos(tide reverse-transcriptase inhibitors (NRTIs. This multicenter study aimed to assess the efficacy of this combination in two scenarios: group A subjects without virologic failure on or no experience with non-nucleoside reverse-transcriptase inhibitors (NNRTIs switched due to adverse events and group B subjects switched after a virologic failure on an efavirenz- or nevirapine-based regimen. The primary endpoint was efficacy at 52 weeks analysed by intention-to-treat. Virologic failure was defined as the inability to suppress plasma HIV-RNA to 200 copies/mL in patients who had previously achieved a viral suppression or had an undetectable viral load at inclusion. Two hundred eighty seven patients were included. Treatment efficacy rates in group A and B were 88.0% (CI95, 83.9-92.1% and 77.4% (CI95, 65.0-89.7%, respectively; the rates reached 97.2% (CI95, 95.1-99.3% and 90.5% (CI95, 81.7-99.3, by on-treatment analysis. The once-a-day ETV treatment was as effective as the twice daily dosing regimen. Grade 1-2 adverse events were observed motivating a treatment switch in 4.2% of the subjects. In conclusion, ETV (once- or twice daily plus two analogs is a suitable, well-tolerated combination both as a switching strategy and after failure with first generation NNRTIs, ensuring full drug activity.ClinicalTrials.gov NCT01437241.

Exploiting the anti-HIV 6-desfluoroquinolones to design multiple ligands.

Science.gov (United States)

Sancineto, Luca; Iraci, Nunzio; Barreca, Maria Letizia; Massari, Serena; Manfroni, Giuseppe; Corazza, Gianmarco; Cecchetti, Violetta; Marcello, Alessandro; Daelemans, Dirk; Pannecouque, Christophe; Tabarrini, Oriana

2014-09-01

It is getting clearer that many drugs effective in different therapeutic areas act on multiple rather than single targets. The application of polypharmacology concepts might have numerous advantages especially for disease such as HIV/AIDS, where the rapid emergence of resistance requires a complex combination of more than one drug. In this paper, we have designed three hybrid molecules combining WM5, a quinolone derivative we previously identified as HIV Tat-mediated transcription (TMT) inhibitor, with the tricyclic core of nevirapine and BILR 355BS (BILR) non-nucleoside reverse transcriptase inhibitors (NNRTIs) to investigate whether it could be possible to obtain molecules acting on both transcription steps of the HIV replicative cycle. One among the three designed multiple ligands, reached this goal. Indeed, compound 1 inhibited both TMT and reverse transcriptase (RT) activity. Unexpectedly, while the anti-TMT activity exerted by compound 1 resulted into a selective inhibition of HIV-1 reactivation from latently infected OM10.1 cells, the anti-RT properties shown by all of the synthesized compounds did not translate into an anti-HIV activity in acutely infected cells. Thus, we have herein produced the proof of concept that the design of dual TMT-RT inhibitors is indeed possible, but optimization efforts are needed to obtain more potent derivatives. Copyright © 2014 Elsevier Ltd. All rights reserved.

Prevalence of Drug-Resistance Mutations and Non–Subtype B Strains Among HIV-Infected Infants From New York State

Science.gov (United States)

Karchava, Marine; Pulver, Wendy; Smith, Lou; Philpott, Sean; Sullivan, Timothy J.; Wethers, Judith; Parker, Monica M.

2010-01-01

Summary Prevalence studies indicate that transmission of drug-resistant HIV has been rising in the adult population, but data from the perinatally infected pediatric population are limited. In this retrospective study, we sequenced the pol region of HIV from perinatally infected infants diagnosed in New York State in 2001–2002. Analyses of drug resistance, subtype diversity, and perinatal antiretroviral exposure were conducted, and the results were compared with those from a previous study of HIV-infected infants identified in 1998–1999. Eight of 42 infants (19.1%) had provirus carrying at least 1 drug-resistance mutation, an increase of 58% over the 1998–1999 results. Mutations conferring resistance to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and protease inhibitors were detected in 7.1%, 11.9%, and 2.4% of specimens, respectively. Consistent with previous results, perinatal antiretroviral exposure was not associated with drug resistance (P = 0.70). Phylogenetic analysis indicated that 16.7% of infants were infected with a non–subtype B strain of HIV. It seems that drug-resistant and non–subtype B strains of HIV are becoming increasingly common in the perinatally infected population. Our results highlight the value of resistance testing for all HIV-infected infants upon diagnosis and the need to consider subtype diversity in diagnostic and treatment strategies. PMID:16868498

Low prevalence of primary HIV resistance in western Massachusetts.

Science.gov (United States)

Iarikov, Dmitri E; Irizarry-Acosta, Melina; Martorell, Claudia; Hoffman, Robert P; Skiest, Daniel J

2010-01-01

Most studies of primary antiretroviral (ARV) resistance have been conducted in large metropolitan areas with reported rates of 8% to 25%. We collected data on 99 HIV-1-infected antiretroviral-naive patients from several sites in Springfield, MA, who underwent genotypic resistance assay between 2004 and 2008. Only major resistance mutations per International AIDS Society-USA (IAS-USA) drug resistance mutations list were considered. The prevalence of resistance was 5% (5 of 99). Three patients had one nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation: 103N, 103N, and 190A, 1 patient had a protease inhibitor (PI) mutation: 90M; and 1 patient had 3-class resistance with NNRTI: 181C, 190A, PI: 90M, and nucleoside analogue reverse transcriptase inhibitor (NRTI): 41L, 210W. Mean time from HIV diagnosis to resistance testing was shorter in patients with resistance versus those without: 9 (range 0.3-42 months) versus 27 (range 0.1-418 months), P = .11. There was a trend to lower mean CD4 count in those with resistance, 170 versus 318 cells/mm(3), P = .06. No differences were noted in gender, age, HIV risk category, or HIV RNA level. The low prevalence of primary resistance may be explained by differences in demographic and risk factors or may reflect the time from infection to resistance testing. Our findings emphasize the importance of continued resistance surveillance.

Vitamin E concentrations in adults with HIV/AIDS on highly active antiretroviral therapy.

Science.gov (United States)

Itinoseki Kaio, Daniella J Itinoseki; Rondó, Patricia Helen C; Luzia, Liania Alves; Souza, José Maria P; Firmino, Aline Vale; Santos, Sigrid Sousa

2014-09-15

HIV/AIDS patients are probably more predisposed to vitamin E deficiency, considering that they are more exposed to oxidative stress. Additionally, there are an extensive number of drugs in the highly active antiretroviral therapy (HAART) regimens that may interfere with vitamin E concentrations. The objective of this study was to compare serum concentrations of alpha-tocopherol in 182 HIV/AIDS patients receiving different HAART regimens. The patients were divided into three groups according to regimen: nucleoside analog reverse-transcriptase inhibitors (NRTIs) + non-nucleoside analog reverse-transcriptase inhibitors (NNRTIs); NRTIs + protease inhibitors + ritonavir; NRTIs + other classes. Alpha-tocopherol was assessed by high-performance liquid chromatography. Multiple linear regression analysis was used to evaluate the effects of HAART regimen, time of use, and compliance with the regimen on alpha-tocopherol concentrations. Alpha-tocopherol concentrations were on average 4.12 μmol/L lower for the NRTIs + other classes regimen when compared to the NRTIs + NNRTIs regimen (p = 0.037). A positive association (p < 0.001) was observed between alpha-tocopherol and cholesterol concentrations, a finding due, in part, to the relationship between liposoluble vitamins and lipid profile. This study demonstrated differences in alpha-tocopherol concentrations between patients using different HAART regimens, especially regimens involving the use of new drugs. Long-term prospective cohort studies are needed to monitor vitamin E status in HIV/AIDS patients since the beginning of treatment.

HIV-1 transmitted drug resistance and genetic diversity among patients from Piauí State, Northeast Brazil.

Science.gov (United States)

Moura, Maria Edileuza Soares; da Guarda Reis, Mônica Nogueira; Lima, Yanna Andressa Ramos; Eulálio, Kelsen Dantas; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo

2015-05-01

HIV-1 transmitted-drug-resistance and genetic diversity are dynamic and may differ in distinct locations/risk groups. In Brazil, increased AIDS incidence and related mortality have been detected in the Northeast region, differently from the epicenter in the Southeast. This cross-sectional study describes transmitted-dru- resistance and HIV-1 subtypes in protease/PR and reverse transcriptase/RT regions among antiretroviral naïve patients from Piauí State, Northeast Brazil. Among 96 patients recruited 89 (92.7%) had HIV-1 PR/RT regions sequenced: 44 females and 45 males, 22 self-declared as men who have sex with men. Transmitted-drug-resistance was investigated by CPR tool (Stanford HIV-1 Drug Resistance/SDRM). HIV-1 subtypes were assigned by REGA and phylogenetic inference. Overall, transmitted-drug-resistance rate was 11.2% (10/89; CI 95%: 5.8-19.1%); 22.7% among men who have sex with men (5/22; CI 95%: 8.8-43.4%), 10% in heterosexual men (2/20; CI 95%: 1.7-29.3%) and 6.8% in women (3/44; CI 95%: 1.8-17.4%). Singleton mutations to protease-inhibitor/PI, nucleoside-reverse-transcriptase-inhibitor/NRTI or non-nucleoside-reverse-transcriptase-inhibitor/NNRTI predominated (8/10): PI mutations (M46L, V82F, L90M); NRTI mutations (M41L, D67N) and NNRTI mutations (K103N/S). Dual class resistance mutations to NRTI and NNRTI were observed: T215L (NRTI), Y188L (NNRTI) and T215N (NRTI), F227L (NNRTI). Subtype B prevailed (86.6%; 77/89), followed by subtype F1 (1.1%, 1/89) and subtype C (1.1%, 1/89). B/F1 and B/C intersubtype recombinants represented 11.2% (10/89). In Piauí State extensive testing of incidence and transmitted-drug-resistance in all populations with risk behaviors may help control AIDS epidemic locally. © 2015 Wiley Periodicals, Inc.

An intravaginal ring that releases the NNRTI MIV-150 reduces SHIV transmission in macaques.

Science.gov (United States)

Singer, Rachel; Mawson, Paul; Derby, Nina; Rodriguez, Aixa; Kizima, Larisa; Menon, Radhika; Goldman, Daniel; Kenney, Jessica; Aravantinou, Meropi; Seidor, Samantha; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Robbiani, Melissa; Zydowsky, Thomas M

2012-09-05

Microbicides may prevent HIV and sexually transmitted infections (STIs) in women; however, determining the optimal means of delivery of active pharmaceutical ingredients remains a major challenge. We previously demonstrated that a vaginal gel containing the non-nucleoside reverse transcriptase inhibitor MIV-150 partially protected macaques from SHIV-RT (simian/HIV reverse transcriptase) infection, and the addition of zinc acetate rendered the gel significantly protective. We test the activity of MIV-150 without the addition of zinc acetate when delivered from either ethylene vinyl acetate (EVA) or silicone intravaginal rings (IVRs). MIV-150 was successfully delivered, because it was detected in vaginal fluids and tissues by radioimmunoassay in pharmacokinetic studies. Moreover, EVA IVRs significantly protected macaques from SHIV-RT infection. Our results demonstrate that MIV-150-containing IVRs have the potential to prevent HIV infection and highlight the possible use of IVRs for delivering drugs that block HIV and other STIs.

Intracytoplasmic maturation of the human immunodeficiency virus type 1 reverse transcription complexes determines their capacity to integrate into chromatin

Directory of Open Access Journals (Sweden)

Kashanchi Fatah

2006-01-01

Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their

Regression of fibrosis and reversal of cirrhosis in rats by galectin inhibitors in thioacetamide-induced liver disease.

Directory of Open Access Journals (Sweden)

Peter G Traber

Full Text Available Galectin-3 protein is critical to the development of liver fibrosis because galectin-3 null mice have attenuated fibrosis after liver injury. Therefore, we examined the ability of novel complex carbohydrate galectin inhibitors to treat toxin-induced fibrosis and cirrhosis. Fibrosis was induced in rats by intraperitoneal injections with thioacetamide (TAA and groups were treated with vehicle, GR-MD-02 (galactoarabino-rhamnogalaturonan or GM-CT-01 (galactomannan. In initial experiments, 4 weeks of treatment with GR-MD-02 following completion of 8 weeks of TAA significantly reduced collagen content by almost 50% based on Sirius red staining. Rats were then exposed to more intense and longer TAA treatment, which included either GR-MD-02 or GM-CT-01 during weeks 8 through 11. TAA rats treated with vehicle developed extensive fibrosis and pathological stage 6 Ishak fibrosis, or cirrhosis. Treatment with either GR-MD-02 (90 mg/kg ip or GM-CT-01 (180 mg/kg ip given once weekly during weeks 8-11 led to marked reduction in fibrosis with reduction in portal and septal galectin-3 positive macrophages and reduction in portal pressure. Vehicle-treated animals had cirrhosis whereas in the treated animals the fibrosis stage was significantly reduced, with evidence of resolved or resolving cirrhosis and reduced portal inflammation and ballooning. In this model of toxin-induced liver fibrosis, treatment with two galectin protein inhibitors with different chemical compositions significantly reduced fibrosis, reversed cirrhosis, reduced galectin-3 expressing portal and septal macrophages, and reduced portal pressure. These findings suggest a potential role of these drugs in human liver fibrosis and cirrhosis.

The VMAT-2 inhibitor tetrabenazine affects effort-related decision making in a progressive ratio/chow feeding choice task: reversal with antidepressant drugs.

Directory of Open Access Journals (Sweden)

Patrick A Randall

Full Text Available Behavioral activation is a fundamental feature of motivation, and organisms frequently make effort-related decisions based upon evaluations of reinforcement value and response costs. Furthermore, people with major depression and other disorders often show anergia, psychomotor retardation, fatigue, and alterations in effort-related decision making. Tasks measuring effort-based decision making can be used as animal models of the motivational symptoms of depression, and the present studies characterized the effort-related effects of the vesicular monoamine transport (VMAT-2 inhibitor tetrabenazine. Tetrabenazine induces depressive symptoms in humans, and also preferentially depletes dopamine (DA. Rats were assessed using a concurrent progressive ratio (PROG/chow feeding task, in which they can either lever press on a PROG schedule for preferred high-carbohydrate food, or approach and consume a less-preferred lab chow that is freely available in the chamber. Previous work has shown that the DA antagonist haloperidol reduced PROG work output on this task, but did not reduce chow intake, effects that differed substantially from those of reinforcer devaluation or appetite suppressant drugs. The present work demonstrated that tetrabenazine produced an effort-related shift in responding on the PROG/chow procedure, reducing lever presses, highest ratio achieved and time spent responding, but not reducing chow intake. Similar effects were produced by administration of the subtype selective DA antagonists ecopipam (D1 and eticlopride (D2, but not by the cannabinoid CB1 receptor neutral antagonist and putative appetite suppressant AM 4413, which suppressed both lever pressing and chow intake. The adenosine A2A antagonist MSX-3, the antidepressant and catecholamine uptake inhibitor bupropion, and the MAO-B inhibitor deprenyl, all reversed the impairments induced by tetrabenazine. This work demonstrates the potential utility of the PROG/chow procedure as a

Dissection of membrane protein degradation mechanisms by reversible inhibitors

International Nuclear Information System (INIS)

Hare, J.F.

1988-01-01

The degradation of slowly turning over 125I-lactoperoxidase-labeled plasma membrane polypeptides in response to reversible temperature and lysosomotropic inhibitors was studied in rat hepatoma cultures. Cells were radiolabeled and left for 24 h to allow the removal of rapidly degraded proteins. Remaining trichloroacetic acid-precipitable protein was degraded (t 1/2 = 40-68 h) by an apparent first order process 60-86% sensitive to 10 mM NH4Cl or 5 mM methylamine and greater than 95% inhibited by temperature reduction to 18 degrees C. Thus, membrane proteins are selected for degradation in a time-dependent manner by a system which is sensitive to both 18 degrees C and to lysosomotropic amines. When inhibitory conditions were removed after 40-48 h, degradation of 125I-labeled protein resumed at the same rate as that seen in their absence. Since membrane proteins do not exhibit accelerated degradation after removal of inhibitory conditions, there can be no marking or sorting of those proteins destined for degradation during the 40-h exposure to inhibitory conditions. Exposure to amines or 18 degrees C did not affect the position of two-dimensionally resolved labeled polypeptides. Fractionation of labeled cells on Percoll gradients after 40 h of exposure to low temperature or amines showed that labeled protein remained in the plasma membrane fractions of the gradient although shifted to a slightly lower buoyant density in the presence of amines. These results support the notion that selection of plasma membrane proteins for degradation requires their internalization into acidic vesicles. Lysosomotropic amines and reduced temperature interfere with the selection process by preventing membrane fusion events

Novel ROCK inhibitors for the treatment of pulmonary arterial hypertension

Energy Technology Data Exchange (ETDEWEB)

Shaw, Duncan; Hollingworth, Greg; Soldermann, Nicolas; Sprague, Elizabeth; Schuler, Walter; Vangrevelinghe, Eric; Duggan, Nicholas; Thomas, Matthew; Kosaka, Takatoshi; Waters, Nigel; van Eis, Maurice J. (Novartis)

2014-10-01

A novel class of selective inhibitors of ROCK1 and ROCK2 has been identified by structural based drug design. PK/PD experiments using a set of highly selective Rho kinase inhibitors suggest that systemic Rho kinase inhibition is linked to a reversible reduction in lymphocyte counts. These results led to the consideration of topical delivery of these molecules, and to the identification of a lead molecule 7 which shows promising PK and PD in a murine model of pulmonary hypertension after intra-tracheal dosing.

Sex-Dependent Effects of the Histone Deacetylase Inhibitor, Sodium Valproate, on Reversal Learning After Developmental Arsenic Exposure

Directory of Open Access Journals (Sweden)

Christina R. Steadman Tyler

2018-06-01

Full Text Available Several studies have demonstrated that exposure to arsenic in drinking water adversely affects brain development and cognitive function in adulthood. While the mechanism by which arsenic induces adverse neurological outcomes remains elusive, studies suggest a link between reduced levels of histone acetylation and impaired performance on a variety of behavioral tasks following arsenic exposure. Using our developmental arsenic exposure (DAE paradigm, we have previously reported reduced histone acetylation and associated histone acetyltransferase enzyme expression in the frontal cortex of C57BL/6J adult male mice, with no changes observed in the female frontal cortex. In the present study, we sought to determine if DAE produced sex-dependent deficits in frontal cortical executive function using the Y-maze acquisition and reversal learning tasks, which are specific for assessing cognitive flexibility. Further, we tested whether the administration of valproic acid, a class I–IIa histone deacetylase inhibitor, was able to mitigate behavioral and biochemical changes resulting from DAE. As anticipated, DAE inhibited acquisition and reversal learning performance in adult male, but not female, mice. Valproate treatment for 2 weeks restored reversal performance in the male arsenic-exposed offspring, while not affecting female performance. Protein levels of HDACs 1, 2, and 5 were elevated following behavioral assessment but only in DAE male mice; restoration of appropriate HDAC levels occurred after valproate treatment and was concurrent with improved behavioral performance, particularly during reversal learning. Female frontal cortical levels of HDAC enzymes were not impacted by DAE or valproate treatment. Finally, mRNA expression levels of brain-derived neurotrophic factor, Bdnf, which has been implicated in the control of frontal cortical flexibility and is regulated by HDAC5, were elevated in DAE male mice and restored to normal levels following HDACi

Discovery of 8-Amino-imidazo[1,5- a ]pyrazines as Reversible BTK Inhibitors for the Treatment of Rheumatoid Arthritis

Energy Technology Data Exchange (ETDEWEB)

Liu, Jian; Guiadeen, Deodial; Krikorian, Arto; Gao, Xiaolei; Wang, James; Boga, Sobhana Babu; Alhassan, Abdul-Basit; Yu, Younong; Vaccaro, Henry; Liu, Shilan; Yang, Chundao; Wu, Hao; Cooper, Alan; de Man, Jos; Kaptein, Allard; Maloney, Kevin; Hornak, Viktor; Gao, Ying-Duo; Fischmann, Thierry O.; Raaijmakers, Hans; Vu-Pham, Diep; Presland, Jeremy; Mansueto, My; Xu, Zangwei; Leccese, Erica; Zhang-Hoover, Jie; Knemeyer, Ian; Garlisi, Charles G.; Bays, Nathan; Stivers, Peter; Brandish, Philip E.; Hicks, Alexandra; Kim, Ronald; Kozlowski, Joseph A. (Merck); (WuXi App Tec)

2016-02-11

Bruton’s tyrosine kinase (BTK) is a Tec family kinase with a well-defined role in the B cell receptor (BCR) pathway. It has become an attractive kinase target for selective B cell inhibition and for the treatment of B cell related diseases. We report a series of compounds based on 8-amino-imidazo[1,5-a]pyrazine that are potent reversible BTK inhibitors with excellent kinase selectivity. Selectivity is achieved through specific interactions of the ligand with the kinase hinge and driven by aminopyridine hydrogen bondings with Ser538 and Asp539, and by hydrophobic interaction of trifluoropyridine in the back pocket. These interactions are evident in the X-ray crystal structure of the lead compounds 1 and 3 in the complex with the BTK enzyme. Our lead compounds show desirable PK profiles and efficacy in the preclinical rat collagen induced arthritis model.

Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

Science.gov (United States)

Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

2003-01-01

Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

Design, Conformation, and Crystallography of 2-Naphthyl Phenyl Ethers as Potent Anti-HIV Agents

Energy Technology Data Exchange (ETDEWEB)

Lee, Won-Gil; Chan, Albert H.; Spasov, Krasimir A.; Anderson, Karen S.; Jorgensen, William L.

2016-12-08

Catechol diethers that incorporate a 7-cyano-2-naphthyl substituent are reported as non-nucleoside inhibitors of HIV-1 reverse transcriptase (NNRTIs). Many of the compounds have 1–10 nM potencies toward wild-type HIV-1. An interesting conformational effect allows two unique conformers for the naphthyl group in complexes with HIV-RT. X-ray crystal structures for 4a and 4f illustrate the alternatives.

HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia

OpenAIRE

Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin

2014-01-01

Introduction: First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods: We investigated patterns and factors associated with multi-NRTI RAMs at first-line failu...

Performance of 3 Rapid Tests for Discrimination Between HIV-1 and HIV-2 in Guinea-Bissau, West Africa

DEFF Research Database (Denmark)

Hønge, Bo Langhoff; Bjarnason Obinah, Magnús Pétur; Jespersen, Sanne

2014-01-01

As HIV-2 is intrinsically resistant to nonnucleoside reverse transcriptase inhibitors, it is mandatory to discriminate between HIV types before initiating antiretroviral treatment. Guinea-Bissau has the world's highest prevalence of HIV-2 and HIV-1/HIV-2 dually infected individuals. We evaluated ...... (agreement 90.9%) and SD Bioline HIV-1/2 3.0 (agreement 84.5%). Our results underscore the need for evaluation of tests in relevant populations before implementation....

Novel diamide-based inhibitors of IMPDH.

Science.gov (United States)

Gu, Henry H; Iwanowicz, Edwin J; Guo, Junqing; Watterson, Scott H; Shen, Zhongqi; Pitts, William J; Dhar, T G Murali; Fleener, Catherine A; Rouleau, Katherine; Sherbina, N Z; Witmer, Mark; Tredup, Jeffrey; Hollenbaugh, Diane

2002-05-06

A series of novel amide-based small molecule inhibitors of inosine monophosphate dehydrogenase is described. The synthesis and the structure-activity relationships (SARs) derived from in vitro studies are presented.

Ensemble-based ADME-Tox profiling and virtual screening for the discovery of new inhibitors of the Leishmania mexicana cysteine protease CPB2.8ΔCTE.

Science.gov (United States)

Scala, Angela; Rescifina, Antonio; Micale, Nicola; Piperno, Anna; Schirmeister, Tanja; Maes, Louis; Grassi, Giovanni

2018-02-01

In an effort to identify novel molecular warheads able to inhibit Leishmania mexicana cysteine protease CPB2.8ΔCTE, fused benzo[b]thiophenes and β,β'-triketones emerged as covalent inhibitors binding the active site cysteine residue. Enzymatic screening showed a moderate-to-excellent activity (12%-90% inhibition of the target enzyme at 20 μm). The most promising compounds were selected for further profiling including in vitro cell-based assays and docking studies. Computational data suggest that benzo[b]thiophenes act immediately as non-covalent inhibitors and then as irreversible covalent inhibitors, whereas a reversible covalent mechanism emerged for the 1,3,3'-triketones with a Y-topology. Based on the predicted physicochemical and ADME-Tox properties, compound 2b has been identified as a new drug-like, non-mutagen, non-carcinogen, and non-neurotoxic lead candidate. © 2017 John Wiley & Sons A/S.

Novel peptide-based protease inhibitors

DEFF Research Database (Denmark)

Roodbeen, Renée

of novel peptide-based protease inhibitors, efforts were made towards improved methods for peptide synthesis. The coupling of Fmoc-amino acids onto N-methylated peptidyl resins was investigated. These couplings can be low yielding and the effect of the use of microwave heating combined with the coupling...

Protecting the fetus against HIV infection: a systematic review of placental transfer of antiretrovirals.

Science.gov (United States)

McCormack, Shelley A; Best, Brookie M

2014-11-01

Maternal-to-fetal transfer of antiretroviral drugs contributes to prevention of vertical transmission of HIV. This systematic review discusses published studies containing data pertaining to the pharmacokinetics of placental transfer of antiretrovirals in humans, including paired cord and maternal plasma samples collected at the time of delivery as well as ex vivo placental perfusion models. Articles pertaining to placental transfer of antiretrovirals were identified from PubMed, from references of included articles, and from US Department of Health and Human Services Panel on Treatment of HIV-infected Pregnant Women and Prevention of Perinatal Transmission guidelines. Articles from non-human animal models or that had no original maternal-to-fetal transfer data were excluded. PRISMA guidelines were followed. A total of 103 published studies were identified. Data across studies appeared relatively consistent for the nucleoside reverse transcriptase inhibitors (NRTIs) and the non-nucleotide reverse transcriptase inhibitors (NNRTIs), with cord to maternal ratios approaching 1 for many of these agents. The protease inhibitors atazanavir and lopinavir exhibited consistent maternal-to-fetal transfer across studies, although the transfer may be influenced by variations in drug-binding proteins. The protease inhibitors indinavir, nelfinavir, and saquinavir exhibited unreliable placental transport, with cord blood concentrations that were frequently undetectable. Limited data, primarily from case reports, indicate that darunavir and raltegravir provide detectable placental transfer. These findings appear consistent with current guidelines of using two NRTIs plus an NNRTI, atazanavir/ritonavir, or lopinavir/ritonavir to maximize placental transfer as well as to optimally suppress maternal viral load. Darunavir/ritonavir and raltegravir may reasonably serve as second-line agents.

APOBEC3G inhibits elongation of HIV-1 reverse transcripts.

Directory of Open Access Journals (Sweden)

Kate N Bishop

2008-12-01

Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.

[Comparative cost-effectiveness analysis between darunavir/ritonavir and other protease inhibitors in treatment-naive human immunodeficiency syndrome type 1-infected patients in Spain].

Science.gov (United States)

Smets, Erik; Brogan, Anita J; Hill, Andrew; Adriaenssen, Ines; Sawyer, Anthony W; Domingo-Pedrol, Pere; Gostkorzewicz, Joana; Ledesma, Francisco

2013-01-01

GESIDA (AIDS Study Group) has proposed preferred regimens of antiretroviral treatment as initial therapy in HIV infected patients. The objective of this analysis is to compare the costs and effectiveness of darunavir/r QD and other ritonavir-boosted (/r) protease inhibitors (PIs) currently recommended in GESIDA guidelines for treatment-naïve patients. A cost-efficacy model compared the boosted PIs recommended as preferred or alternative treatment choices, each used with a nucleoside reverse transcriptase inhibitor backbone. Efficacy was measured by 48-week virological response (viral load < 50 copies/mL) adjusted by baseline viral load and CD4 cell count. To generate efficiency frontiers and cost-efficacy ratios, one-year antiretroviral therapy costs in Spain, and 48-week efficacy values were used. The model estimated that starting treatment with darunavir/r QD was the most cost-effective choice compared with the other preferred PI/r based therapies. The average cost per patient with a virological response was lower for darunavir/r QD (13,420€) than for atazanavir/r QD (14,000€), or lopinavir/r BID (13,815€). Among the preferred PI/r-based therapies, darunavir/r QD also was estimated to be the most efficient option for treatment-naïve patients. Atazanavir/r QD and lopinavir/r BID were found to be «dominated» by darunavir/r) and, consequently, were outside the efficiency frontier of PI/r-based first-line treatment. Given a fixed budget of 10 million euros for PI/r-based first-line therapy, the model estimated that darunavir/r QD would yield more responders (745) than atazanavir/r QD (714), or lopinavir/r BID (724). At the same time, darunavir/r QD would reduce the number of individuals failing treatment (150) compared with atazanavir/r QD (172) and lopinavir/r BID (286). In this model, darunavir/r QD was found to be the most cost-effective choice, among the preferred PI/r-based therapies recommended in the Spanish guidelines for treatment-naïve patients

Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

Science.gov (United States)

Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

2013-11-05

Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

Effects of treatment with suppressive combination antiretroviral drug therapy and the histone deacetylase inhibitor suberoylanilide hydroxamic acid; (SAHA on SIV-infected Chinese rhesus macaques.

Directory of Open Access Journals (Sweden)

Binhua Ling

Full Text Available Viral reservoirs-persistent residual virus despite combination antiretroviral therapy (cART-remain an obstacle to cure of HIV-1 infection. Difficulty studying reservoirs in patients underscores the need for animal models that mimics HIV infected humans on cART. We studied SIV-infected Chinese-origin rhesus macaques (Ch-RM treated with intensive combination antiretroviral therapy (cART and 3 weeks of treatment with the histone deacetyalse inhibitor, suberoylanilide hydroxamic acid (SAHA.SIVmac251 infected Ch-RM received reverse transcriptase inhibitors PMPA and FTC and integrase inhibitor L-870812 beginning 7 weeks post infection. Integrase inhibitor L-900564 and boosted protease inhibitor treatment with Darunavir and Ritonavir were added later. cART was continued for 45 weeks, with daily SAHA administered for the last 3 weeks, followed by euthanasia/necropsy. Plasma viral RNA and cell/tissue-associated SIV gag RNA and DNA were quantified by qRT-PCR/qPCR, with flow cytometry monitoring changes in immune cell populations.Upon cART initiation, plasma viremia declined, remaining <30 SIV RNA copy Eq/ml during cART, with occasional blips. Decreased viral replication was associated with decreased immune activation and partial restoration of intestinal CD4+ T cells. SAHA was well tolerated but did not result in demonstrable treatment-associated changes in plasma or cell associated viral parameters.The ability to achieve and sustain virological suppression makes cART-suppressed, SIV-infected Ch-RM a potentially useful model to evaluate interventions targeting residual virus. However, despite intensive cART over one year, persistent viral DNA and RNA remained in tissues of all three animals. While well tolerated, three weeks of SAHA treatment did not demonstrably impact viral RNA levels in plasma or tissues; perhaps reflecting dosing, sampling and assay limitations.

Current concepts of metabolic abnormalities in HIV patients: focus on lipodystrophy.

Science.gov (United States)

Kolter, Donald P

2003-12-01

HIV infection is associated with a number of metabolic abnormalities, including lipodystrophy, a difficult-to-define disorder whose characteristics include hyperlipidemia, insulin resistance, and fat redistribution. Current data suggest that lipodystrophy is caused by multiple factors. Dual-nucleoside reverse transcriptase inhibitor therapy combined with protease inhibitor therapy has been shown to increase the risk of metabolic abnormalities, but susceptibility independent of drug effects has also been shown. While many of the treatments for the broad range of signs and symptoms of lipodystrophy bring about improvements in patient status, none have been demonstrated to bring about a return to baseline levels.

Differences in Lipid Measurements by Antiretroviral Regimen Exposure in Cohorts from Asia and Australia

Directory of Open Access Journals (Sweden)

Amit C. Achhra

2012-01-01

Full Text Available We explored the mean differences in routinely measured lipids (total cholesterol, triglycerides, and high-density lipoprotein cholesterol according to exposure to different combination antiretroviral regimens in Asian (n=2051 and Australian (predominantly Caucasian, n=794 cohorts. The regimen was defined as at least 3 antiretroviral drugs with at least 2 nucleoside-reverse transcriptases (NRTIs and either of at least one protease inhibitor (PI or non-nucleoside-reverse transcriptases (NNRTIs. We categorised cART regimens as: NRTIs as tenofovir based or not; NNRTIs as nevirapine or efavirenz (but not both; and PI as atazanavir based or not. We found that the impact of various antiretroviral regimens on lipids in Asian and Australian cohorts was only different by cohort for total cholesterol (P for interaction between regimen and cohort: 0.05. The differences in total cholesterol were however small and unlikely to be of clinical significance. Overall, tenofovir with nevirapine or atazanavir was associated with the most favorable lipids, while the PI regimens without tenofovir and atazanavir were associated with least favorable lipids. We conclude that the impact of various ART regimens on lipids is largely similar in Asian and Australian cohorts and that the newer drugs such as tenofovir and atazanavir are likely to provide similar benefit in terms of lipid profiles in both populations.

Molecular insights into human monoamine oxidase (MAO) inhibition by 1,4-naphthoquinone: evidences for menadione (vitamin K3) acting as a competitive and reversible inhibitor of MAO.

Science.gov (United States)

Coelho Cerqueira, Eduardo; Netz, Paulo Augusto; Diniz, Cristiane; Petry do Canto, Vanessa; Follmer, Cristian

2011-12-15

Monoamine oxidase (MAO) catalyzes the oxidative deamination of biogenic and exogenous amines and its inhibitors have therapeutic value for several conditions including affective disorders, stroke, neurodegenerative diseases and aging. The discovery of 2,3,6-trimethyl-1,4-naphthoquinone (TMN) as a nonselective and reversible inhibitor of MAO, has suggested 1,4-naphthoquinone (1,4-NQ) as a potential scaffold for designing new MAO inhibitors. Combining molecular modeling tools and biochemical assays we evaluate the kinetic and molecular details of the inhibition of human MAO by 1,4-NQ, comparing it with TMN and menadione. Menadione (2-methyl-1,4-naphthoquinone) is a multitarget drug that acts as a precursor of vitamin K and an inducer of mitochondrial permeability transition. Herein we show that MAO-B was inhibited competitively by 1,4-NQ (K(i)=1.4 μM) whereas MAO-A was inhibited by non-competitive mechanism (K(i)=7.7 μM). Contrasting with TMN and 1,4-NQ, menadione exhibited a 60-fold selectivity for MAO-B (K(i)=0.4 μM) in comparison with MAO-A (K(i)=26 μM), which makes it as selective as rasagiline. Fluorescence and molecular modeling data indicated that these inhibitors interact with the flavin moiety at the active site of the enzyme. Additionally, docking studies suggest the phenyl side groups of Tyr407 and Tyr444 (for MAO-A) or Tyr398 and Tyr435 (for MAO-B) play an important role in the interaction of the enzyme with 1,4-NQ scaffold through forces of dispersion as verified for menadione, TMN and 1,4-NQ. Taken together, our findings reveal the molecular details of MAO inhibition by 1,4-NQ scaffold and show for the first time that menadione acts as a competitive and reversible inhibitor of human MAO. Copyright © 2011 Elsevier Ltd. All rights reserved.

An integrated chemical biology approach reveals the mechanism of action of HIV replication inhibitors.

Science.gov (United States)

Pagano, Nicholas; Teriete, Peter; Mattmann, Margrith E; Yang, Li; Snyder, Beth A; Cai, Zhaohui; Heil, Marintha L; Cosford, Nicholas D P

2017-12-01

Continuous flow (microfluidic) chemistry was employed to prepare a small focused library of dihydropyrimidinone (DHPM) derivatives. Compounds in this class have been reported to exhibit activity against the human immunodeficiency virus (HIV), but their molecular target had not been identified. We tested the initial set of DHPMs in phenotypic assays providing a hit (1i) that inhibited the replication of the human immunodeficiency virus HIV in cells. Flow chemistry-driven optimization of 1i led to the identification of HIV replication inhibitors such as 1l with cellular potency comparable with the clinical drug nevirapine (NVP). Mechanism of action (MOA) studies using cellular and biochemical assays coupled with 3D fingerprinting and in silico modeling demonstrated that these drug-like probe compounds exert their effects by inhibiting the viral reverse transcriptase polymerase (RT). This led to the design and synthesis of the novel DHPM 1at that inhibits the replication of drug resistant strains of HIV. Our work demonstrates that combining flow chemistry-driven analogue refinement with phenotypic assays, in silico modeling and MOA studies is a highly effective strategy for hit-to-lead optimization applicable to the discovery of future therapeutic agents. Copyright © 2017. Published by Elsevier Ltd.

An overview of the molecular and epidemiological features of HIV-1 infection in two major cities of Bahia state, Brazil.

Science.gov (United States)

Amaral, Amanda Gm; Oliveira, Isabele B; Carneiro, Diego C; Alcantara, Luiz Cj; Monteiro-Cunha, Joana P

2017-06-01

The high mutation rate of the human immunodeficiency virus (HIV) has created a public health challenge because the use of antiretroviral drugs can generate selective pressure that drives resistance in these viruses. The aim of this work was to characterise the molecular and epidemiological profile of HIV in Bahia, Brazil. DNA sequences from regions of HIV gag, pol, and env genes were obtained from previous studies performed in this area between 2002 and 2012. Their genotype and drug-resistance mutations were identified using bioinformatics tools. Clinical and epidemiological data were analysed. Among 263 individuals (46.4% male), 97.5% were asymptomatic and 49.1% were receiving treatment. Most of the individuals were 31 to 40 years old (36.9%) and infected through heterosexual contact (40.7%). The predominant genotype was B (68.1%) followed by BF recombinants (18.6%). Among the individuals infected with either F or BF genotypes, 68.4% were women and 76.8% were infected through heterosexual transmission. The prevalence of associated mutations conferring antiretroviral resistance was 14.2%, with 3.8% of all mutations conferring resistance to protease inhibitors, 9.43% to nucleoside reverse transcriptase inhibitors, and 8.5% to non-nucleoside reverse transcriptase inhibitors. Drug resistance was higher in individuals receiving treatment (26.1%) than in the drug-naïve (4.3%) individuals. This study will contribute to the understanding and monitoring of HIV epidemic in this Brazilian region.

Evaluation of inadequate anti-retroviral treatment in patients with HIV/AIDS

Directory of Open Access Journals (Sweden)

Leonardo Carvalho da Fonseca

2012-04-01

Full Text Available INTRODUCTION: Since the emergence of antiretroviral therapy, the survival of patients infected with human immunodeficiency virus has increased. Non-adherence to this therapy is directly related to treatment failure, which allows the emergence of resistant viral strains. METHODS: A retrospective descriptive study of the antiretroviral dispensing records of 229 patients from the Center for Health Care, University Hospital, Federal University of Juiz de Fora, Brazil, was conducted between January and December 2009. RESULTS: The study aimed to evaluate patient compliance and determine if there was an association between non-adherence and the therapy. Among these patients, 63.8% were men with an average age of 44.0 ± 9.9 years. The most used treatment was a combination of 2 nucleoside reverse transcriptase inhibitors with 1 non-nucleoside reverse transcriptase inhibitor (55.5% or with 2 protease inhibitors (28.8%. It was found that patients taking lopinavir/ritonavir with zidovudine and lamivudine had a greater frequency of inadequate treatment than those taking atazanavir with zidovudine and lamivudine (85% and 83.3%, respectively. Moreover, when the combination of zidovudine/ lamivudine was used, the patients were less compliant (χ2 = 4.468, 1 degree of freedom, p = 0.035. CONCLUSIONS: The majority of patients failed to correctly adhere to their treatment; therefore, it is necessary to implement strategies that lead to improved compliance, thus ensuring therapeutic efficacy and increased patient survival.

Short communication: high prevalence of drug resistance in HIV type 1-infected children born in Honduras and Belize 2001 to 2004.

Science.gov (United States)

Parham, Leda; de Rivera, Ivette Lorenzana; Murillo, Wendy; Naver, Lars; Largaespada, Natalia; Albert, Jan; Karlsson, Annika C

2011-10-01

Antiretroviral therapy has had a great impact on the prevention of mother-to-child transmission (MTCT) of HIV-1. However, development of drug resistance, which could be subsequently transmitted to the child, is a major concern. In Honduras and Belize the prevalence of drug resistance among HIV-1-infected children remains unknown. A total of 95 dried blood spot samples was obtained from HIV-1-infected, untreated children in Honduras and Belize born during 2001 to 2004, when preventive antiretroviral therapy was often suboptimal and consisted of monotherapy with nevirapine or zidovudine. Partial HIV-1 pol gene sequences were successfully obtained from 66 children (Honduras n=55; Belize n=11). Mutations associated with drug resistance were detected in 13% of the Honduran and 27% of the Belizean children. Most of the mutations detected in Honduras (43%) and all mutations detected in Belize were associated with resistance to nonnucleoside reverse transcriptase inhibitors, which was expected from the wide use of nevirapine to prevent MTCT during the study period. In addition, although several mothers reported that they had not received antiretroviral therapy, mutations associated with resistance to nucleoside reverse transcriptase inhibitors and protease inhibitors were found in Honduras. This suggests prior and unreported use of these drugs, or that these women had been infected with resistant virus. The present study demonstrates, for the first time, the presence of drug resistance-associated mutations in HIV-1-infected Honduran and Belizean children.

Cardiovascular risk reduction by reversing endothelial dysfunction: ARBs, ACE inhibitors,  or both? Expectations from The ONTARGET  Trial Programme

Directory of Open Access Journals (Sweden)

Luis Miguel  Ruilope

2007-03-01

Full Text Available Luis Miguel  Ruilope1, Josep Redón2, Roland Schmieder31Servicio de Nefrologia, Unidad de Hipertension Hospital, 12 de Octubre, Madrid, Spain; 2Department of Internal Medicine, Hospital Clinico University of Valencia, Valencia, Spain; 3Department of Nephrology and Hypertension, Friedrich-Alexander-Universitat, Erlangen-Nurnberg, GermanyAbstract: Endothelial dysfunction is the initial pathophysiological step in a progression of vascular damage that leads to overt cardiovascular and chronic kidney disease. Angiotensin II, the primary agent of the renin–angiotensin system (RAS, has a central role in endothelial dysfunction. Therefore, RAS blockade with an angiotensin receptor blocker (ARB and/or angiotensin-converting enzyme (ACE inhibitor provides a rational approach to reverse endothelial dysfunction, reduce microalbuminuria, and, thus, improves cardiovascular and renal prognosis. ARBs and ACE inhibitors act at different points in the RAS pathway and recent evidence suggests that there are differences regarding their effects on endothelial dysfunction. In addition to blood pressure lowering, studies have shown that ARBs reduce target-organ damage, including improvements in endothelial dysfunction, arterial stiffness, the progression of renal dysfunction in patients with type 2 diabetes, proteinuria, and left ventricular hypertrophy. The ONgoing Telmisartan Alone in combination with Ramipril Global Endpoint Trial (ONTARGET Programme is expected to provide the ultimate evidence of whether improved endothelial func tion translates into reduced cardiovascular and renal events in high-risk patients, and to assess possible differential outcomes with telmisartan, the ACE inhibitor ramipril, or a combination of both (dual RAS blockade. Completion of ONTARGET is expected in 2008. Keywords: angiotensin-converting enzyme inhibitor, angiotensin receptor blocker, endothelial dysfunction, ONTARGET, renin–angiotensin system, telmisartan

Novel guanidine-based inhibitors of inosine monophosphate dehydrogenase.

Science.gov (United States)

Iwanowicz, Edwin J; Watterson, Scott H; Liu, Chunjian; Gu, Henry H; Mitt, Toomas; Leftheris, Katerina; Barrish, Joel C; Fleener, Catherine A; Rouleau, Katherine; Sherbina, N Z; Hollenbaugh, Diane L

2002-10-21

A series of novel guanidine-based small molecule inhibitors of inosine monophosphate dehydrogenase (IMPDH) was explored. IMPDH catalyzes the rate determining step in guanine nucleotide biosynthesis and is a target for anticancer, immunosuppressive and antiviral therapy. The synthesis and the structure-activity relationships (SARs), derived from in vitro studies, for this new series of inhibitors is given.

Testing of viscous anti-HIV microbicides using Lactobacillus

OpenAIRE

Moncla, B.J.; Pryke, K.; Rohan, L. C.; Yang, H.

2011-01-01

The development of topical microbicides for intravaginal use to prevent HIV infection requires that the drugs and formulated products be nontoxic to the endogenous vaginal Lactobacillus. In 30 min exposure tests we found dapivirine, tenofovir and UC781 (reverse transcriptase inhibitor anti-HIV drugs) as pure drugs or formulated as film or gel products were not deleterious to Lactobacillus species; however, PSC-RANTES (a synthetic CCR5 antagonist) killed 2 strains of Lactobacillus jensenii. To...

Concentrations of Dapivirine in the Rhesus Macaque and Rabbit following Once Daily Intravaginal Administration of a Gel Formulation of [14C]Dapivirine for 7 Days▿

OpenAIRE

Nuttall, Jeremy P.; Thake, Daryl C.; Lewis, Mark G.; Ferkany, John W.; Romano, Joseph W.; Mitchnick, Mark A.

2007-01-01

Dapivirine is a nonnucleoside reverse transcriptase inhibitor being developed as a topical microbicide for the prevention of human immunodeficiency virus infection. The distribution of radioactivity and drug in plasma and in vaginal, cervical, and draining lymph node tissues was investigated after daily application of a vaginal gel formulation of [14C]dapivirine to rhesus macaques. This was preceded by a preliminary study with rabbits. Following the intravaginal administration of [14C]dapivir...

Synthesis of a novel series of 4-arylpiperazinyl derivatives linked to a 2-(pyridin-3-yl)-1H-benzimidazole as new Delavirdine analogues

International Nuclear Information System (INIS)

Pessoa-Mahana, David; Nunez, Andres; Espinosa, Christian; Mella-Raipn, Jaime; Pessoa-Mahana, Hernan

2010-01-01

The synthesis of a series of substituted arylpiperazines linked to a 2-(pyridin-3-yl)-1H-benzo[d]imidazole scaffold through an alkylic linker is reported. The novel 1-(2-(4-arylpiperazin-1-yl)alkyl)-2-(pyridin-3-yl)-1H-benzimidazole derivatives are structurally related to the anti-HIV-1 drug Delavirdine and belong to the bis(heteroaryl)piperazines family (BHAPs), a well known HIV-1 reverse transcriptase inhibitors group. (author)

Naphthalocyanine-based time reversal mirror at 800 nm

International Nuclear Information System (INIS)

Galaup, Jean-Pierre; Fraigne, Sebastien; Le Goueet, Jean-Louis; Likforman, Jean-Pierre; Joffre, Manuel

2004-01-01

We performed pulse shaping and time reversal experiments using spectral holography based on persistent spectral hole burning in free-base naphthalocyanine-doped films. The application of a new pulse re-compression scheme based on a programmable hole burning material acting as a time reversal mirror is considered. In this work, we adapted the Fourier transform spectral interferometry technique for measuring the amplitude and phase of photon echo signals produced by diffraction of femtosecond pulses on a spectral hologram. We therefore demonstrated that we could control the pulses diffracted from the hologram by shaping and then characterizing these pulses in both amplitude and phase by spectral interferometry

Ebselen Reversibly Inhibits Human Glutamate Dehydrogenase at the Catalytic Site.

Science.gov (United States)

Jin, Yanhong; Li, Di; Lu, Shiying; Zhao, Han; Chen, Zhao; Hou, Wei; Ruan, Benfang Helen

Human glutamate dehydrogenase (GDH) plays an important role in neurological diseases, tumor metabolism, and hyperinsulinism-hyperammonemia syndrome (HHS). However, there are very few inhibitors known for human GDH. Recently, Ebselen was reported to crosslink with Escherichia coli GDH at the active site cysteine residue (Cys321), but the sequence alignment showed that the corresponding residue is Ala329 in human GDH. To investigate whether Ebselen could be an inhibitor for human GDH, we cloned and expressed an N-terminal His-tagged human GDH in E. coli. The recombinant human GDH enzyme showed expected properties such as adenosine diphosphate activation and nicotinamide adenine dinucleotide/nicotinamide adenine dinucleotide phosphate dual recognition. Further, we developed a 2-(3-(2-methoxy-4-nitrophenyl)-2-(4-nitrophenyl)-2H-tetrazol-3-ium-5-yl) benzenesulfonate sodium salt (EZMTT)-based assay for human GDH, which was highly sensitive and is suitable for high-throughput screening for potent GDH inhibitors. In addition, ForteBio binding assays demonstrated that Ebselen is a reversible active site inhibitor for human GDH. Since Ebselen is a multifunctional organoselenium compound in Phase III clinical trials for inflammation, an Ebselen-based GDH inhibitor might be valuable for future drug discovery for HHS patients.

Tubulin Inhibitor-Based Antibody-Drug Conjugates for Cancer Therapy

Directory of Open Access Journals (Sweden)

Hao Chen

2017-08-01

Full Text Available Antibody-drug conjugates (ADCs are a class of highly potent biopharmaceutical drugs generated by conjugating cytotoxic drugs with specific monoclonal antibodies through appropriate linkers. Specific antibodies used to guide potent warheads to tumor tissues can effectively reduce undesired side effects of the cytotoxic drugs. An in-depth understanding of antibodies, linkers, conjugation strategies, cytotoxic drugs, and their molecular targets has led to the successful development of several approved ADCs. These ADCs are powerful therapeutics for cancer treatment, enabling wider therapeutic windows, improved pharmacokinetic/pharmacodynamic properties, and enhanced efficacy. Since tubulin inhibitors are one of the most successful cytotoxic drugs in the ADC armamentarium, this review focuses on the progress in tubulin inhibitor-based ADCs, as well as lessons learned from the unsuccessful ADCs containing tubulin inhibitors. This review should be helpful to facilitate future development of new generations of tubulin inhibitor-based ADCs for cancer therapy.

Reversal of collapsing glomerulopathy in mice with the cyclin-dependent kinase inhibitor CYC202.

Science.gov (United States)

Gherardi, Dana; D'Agati, Vivette; Chu, Te-Hua Tearina; Barnett, Anna; Gianella-Borradori, Athos; Gelman, Irwin H; Nelson, Peter J

2004-05-01

Collapsing glomerulopathy (CG) has become an important cause of end-stage renal disease. Whether associated with HIV-1 or other potential etiologies, the pathogenesis of CG converges to induce aberrant proliferation of renal epithelium along the entire nephron. This raises the possibility that targeting cell-cycle progression may be an effective therapeutic strategy for CG. Here, we ask whether the cyclin-dependent kinase (CDK) inhibitor, CYC202 (R-roscovitine), could attenuate or reverse existing renal disease in Tg26 mice, a well characterized HIV-1 transgenic mouse model of CG. Tg26 mice were age and disease matched through analysis of urine (protein/creatinine) to generate 12 treatment pairs covering a range of mild to severe CG. One mouse from each pair received either vehicle or 75 mg/kg of CYC202 every 12 h for 20 d, a dose 20% above that needed to prevent the development of CG. After treatment, urinary, serologic, and histopathologic indices of nephrosis showed reversal of CG in 8 of 12 CYC202-treated mice compared with progression of CG in 10 of 12 vehicle-treated mice, demonstrating a significant therapeutic benefit from CYC202 (P < 0.05). Pharmacokinetic profiles showed that concentrations of CYC202 known to inhibit cell-cycle and transcriptional CDK in vitro were achieved in plasma at efficacious doses. However, amelioration of CG by CYC202 did not correlate with decreases in kidney HIV-1 transgene expression, indicating that suppression of HIV-1 transcription was not a prerequisite for the antiproliferative activity of CYC202. These results demonstrate a novel therapeutic strategy for CG.

Profits in reverse? An examination of the decisive factors for reverse supply chain profitability

DEFF Research Database (Denmark)

Larsen, Samuel; Jacobsen, Peter

2015-01-01

Although the concept of the reverse supply chain (RSC) is not unknown in industry, an inhibitor for its successful use is low (or no) profitability. A research challenge is investigating ways to establish the RSC as a profit-creating center in the organization. This paper contributes...