WorldWideScience

Sample records for reverse transcriptase induces

  1. TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats

    Science.gov (United States)

    Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin

    2011-01-01

    In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

  2. Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

    NARCIS (Netherlands)

    Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

    2013-01-01

    The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

  3. Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

    International Nuclear Information System (INIS)

    Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

    2001-01-01

    Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

  4. Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

    Directory of Open Access Journals (Sweden)

    Oluwafeyisetan O. Adebiyi

    2015-12-01

    Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

  5. Reverse transcriptase inhibitors as microbicides.

    Science.gov (United States)

    Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido

    2012-01-01

    The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

  6. A trypsin inhibitor from rambutan seeds with antitumor, anti-HIV-1 reverse transcriptase, and nitric oxide-inducing properties.

    Science.gov (United States)

    Fang, Evandro Fei; Ng, Tzi Bun

    2015-04-01

    Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.

  7. Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

    Science.gov (United States)

    Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

    1972-01-01

    Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

  8. Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage.

    Science.gov (United States)

    Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X

    2014-07-01

    Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

  9. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

    Science.gov (United States)

    Li, Runqin; Zhang, Yinglin

    2016-01-01

    Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

  10. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong

    2000-01-01

    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  11. Reverse transcriptase inhibitors as potential colorectal microbicides.

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

    2009-05-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

  12. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  13. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran

    2017-01-01

    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  14. Effects of exogenous ATM gene on mRNA expression of human telomerase reverse transcriptase in AT cells induced by irradiation

    International Nuclear Information System (INIS)

    Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong

    2005-01-01

    The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)

  15. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  16. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  17. Hypoxia induces telomerase reverse transcriptase (TERT gene expression in non-tumor fish tissues in vivo: the marine medaka (Oryzias melastigma model

    Directory of Open Access Journals (Sweden)

    Mok Helen OL

    2006-09-01

    Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This

  18. A novel peptide-nucleotide dual vaccine of human telomerase reverse transcriptase induces a potent cytotoxic T-cell response in vivo

    International Nuclear Information System (INIS)

    Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun

    2007-01-01

    Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers

  19. Tetrahymena telomerase protein p65 induces conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse transcriptase and TER assembly mutants.

    Science.gov (United States)

    Berman, Andrea J; Gooding, Anne R; Cech, Thomas R

    2010-10-01

    The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.

  20. Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?

    Science.gov (United States)

    Nolan, David

    2005-01-01

    Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.

  1. [Construction of autocatalytic caspase-3 driven by amplified human telomerase reverse transcriptase promoter and its enhanced efficacy of inducing apoptosis in human ovarian carcinoma].

    Science.gov (United States)

    Song, Yue; Shen, Keng; He, Chun-Xia

    2007-09-01

    To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells

  2. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

    2016-12-15

    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  3. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    Science.gov (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  4. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    International Nuclear Information System (INIS)

    Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong

    2007-01-01

    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation

  5. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    Energy Technology Data Exchange (ETDEWEB)

    Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn

    2007-04-06

    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.

  6. [Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

    Science.gov (United States)

    Tarasova, O A; Filimonov, D A; Poroikov, V V

    2017-10-01

    Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

  7. Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Sharma, Mamta; Saravolatz, Louis D

    2013-02-01

    Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

  8. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

    Directory of Open Access Journals (Sweden)

    Ma Bi

    2017-10-01

    Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

  9. Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

    2009-01-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

  10. A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

    Science.gov (United States)

    Zanetti, Maurizio

    2017-02-01

    Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

  11. 2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

    International Nuclear Information System (INIS)

    Starnes, M.C.

    1988-01-01

    2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

  12. Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

    International Nuclear Information System (INIS)

    Spadafora, C.; Sciamanna, I.; Misteli, T.

    2009-01-01

    Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

  13. Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

    Science.gov (United States)

    Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

    2016-06-01

    Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

  14. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.

    1988-01-01

    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  15. Oxidative stress and toxicity induced by the nucleoside reverse transcriptase inhibitor (NRTI)--2',3'-dideoxycytidine (ddC): relevance to HIV-dementia.

    Science.gov (United States)

    Opii, Wycliffe O; Sultana, Rukhsana; Abdul, Hafiz Mohmmad; Ansari, Mubeen Ahmad; Nath, Avindra; Butterfield, D Allan

    2007-03-01

    Human immunodeficiency virus dementia (HIVD) is the most common form of dementia occurring among young adults. In HIVD, neuronal cell loss occurs in the absence of neuronal infection. With the advent of highly active anti-retroviral therapy (HAART), the incidence of HIVD has drastically reduced, though prevalence of milder forms of HIVD continues to rise. Though these agents have been used successfully in suppressing viral production, they have also been associated with a number of side effects. Here we examine the possible role of NRTIs, in particular 2',3'-dideoxycytidine (ddC), in the neuropathology of HIVD. Synaptosomes and isolated mitochondria treated and incubated for 6 h with CSF-achievable concentrations of ddC, i.e., 6-11 ng/ml, were found to show a significant increase in oxidative stress with 40 nM ddC as measured by protein carbonyls and 3-nitrotyrosine (3NT), effects that were not observed in the more tolerable NRTI, 3TC. Protection against protein oxidation induced by ddC was observed when brain mitochondria were isolated from gerbils 1 h after injection i.p. with the brain accessible antioxidant and glutathione mimetic, tricyclodecan-9-yl-xanthogenate (D609). In addition, there is a significant reduction in the levels of anti-apoptotic protein Bcl-2 and a significant increase in cytochrome c release and also a significant increase in the expression of pro-apoptotic protein caspase-3 after mitochondria were treated with 40 nM ddC. The results reported here show that ddC at 40 nM can induce oxidative stress, cause the release of cytochrome c, and in addition, reduce the levels of anti-apoptotic proteins, increase the levels of pro-apoptotic proteins, thereby increasing the possibility for induction of apoptosis. These findings are consistent with the notion of a possible role of the NRTIs, and in particular, ddC, in the mechanisms involved in HIVD.

  16. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  17. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

    Science.gov (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.

    1998-01-01

    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

  18. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  19. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

    DEFF Research Database (Denmark)

    Lundgren, Jens

    2008-01-01

    BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

  20. Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

    NARCIS (Netherlands)

    R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)

    2013-01-01

    textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

  1. Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

    Directory of Open Access Journals (Sweden)

    Edward J. Steele

    2017-11-01

    Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

  2. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.

    Science.gov (United States)

    Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

  3. The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

    Science.gov (United States)

    Zhao, Chen; Pyle, Anna Marie

    2017-12-01

    The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages

    Science.gov (United States)

    Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis

    2010-01-01

    Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

  5. Telomerase reverse transcriptase promoter mutations in bladder cancer

    DEFF Research Database (Denmark)

    Allory, Yves; Beukers, Willemien; Sagrera, Ana

    2014-01-01

    for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...

  6. Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

    Directory of Open Access Journals (Sweden)

    Ana Luiza Chaves Valadão

    2015-06-01

    Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

  7. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-07-01

    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  8. Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

    OpenAIRE

    DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

    2012-01-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

  9. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    OpenAIRE

    Nicolas Sluis-Cremer

    2014-01-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

  10. Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Yong Teng

    2014-02-01

    Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

  11. Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

    Science.gov (United States)

    Wang, Shuwen; Zhu, Jiyue

    2003-05-23

    The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

  12. Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

    Science.gov (United States)

    Collins, Kathleen; Nilsen, Timothy W

    2013-08-01

    Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

  13. Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

    Science.gov (United States)

    Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

    2008-09-01

    We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

  14. Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

    2013-11-01

    Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

  15. Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

    Directory of Open Access Journals (Sweden)

    Lucianna Helene Santos

    2015-11-01

    Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

  16. Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Stefanou Nikolaos

    2010-08-01

    Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

  17. Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

    Science.gov (United States)

    Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

    2015-10-01

    Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

  18. Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M

    2018-01-01

    Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

  19. Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2013-11-01

    Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

  20. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma

    OpenAIRE

    Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

  1. Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

    2010-03-26

    The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

  2. Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Anna Figueiredo

    2006-11-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

  3. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  4. Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase.

    Science.gov (United States)

    Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano

    2017-01-17

    Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

  5. Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Elisabeth Humphris-Narayanan

    Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

  6. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

    Science.gov (United States)

    Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

    2016-01-01

    Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

  7. Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

    Science.gov (United States)

    Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

    2008-10-01

    Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

  8. Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

    Science.gov (United States)

    Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

    2002-12-01

    Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

  9. Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.

    Science.gov (United States)

    Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V

    2011-12-20

    Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

  10. Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

    Science.gov (United States)

    Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

    2017-02-01

    Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

  11. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  12. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  13. Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

    Science.gov (United States)

    Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

    2018-05-03

    Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

  14. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  15. Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

    2011-01-01

    We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

    Science.gov (United States)

    Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

    2013-06-18

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations.

    Science.gov (United States)

    Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark

    2013-11-01

    BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

  18. Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

    NARCIS (Netherlands)

    Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

    2004-01-01

    Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

  19. Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

    DEFF Research Database (Denmark)

    Borges, Álvaro H; Lundh, Andreas; Tendal, Britta

    2016-01-01

    BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

  20. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

    Science.gov (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

    2011-02-01

    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  1. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

    2011-01-01

    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  2. Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice.

    Science.gov (United States)

    Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue

    2013-05-01

    To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

  3. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  4. Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

    Science.gov (United States)

    Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

    2012-08-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

  5. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali

    2015-11-27

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  6. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe

    2007-05-01

    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  7. Reverse transcriptase directs viral evolution in a deep ocean methane seep

    Science.gov (United States)

    Paul, B. G.; Bagby, S. C.

    2013-12-01

    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  8. The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors.

    Science.gov (United States)

    Sluis-Cremer, Nicolas

    2014-07-31

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  9. 3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    S. Ganguly

    2008-01-01

    Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

  10. A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

    Directory of Open Access Journals (Sweden)

    Marcin Kierczak

    2009-10-01

    Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

  11. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2014-07-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  12. 4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor.

    Science.gov (United States)

    Markowitz, Martin; Sarafianos, Stefan G

    2018-07-01

    4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

  13. Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-11-01

    Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

  14. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

    2015-01-01

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  15. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Directory of Open Access Journals (Sweden)

    Ilaria eSciamanna

    2016-02-01

    Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  16. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Science.gov (United States)

    Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

    2016-02-01

    In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  17. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

    OpenAIRE

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

    2008-01-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

  18. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

    2011-12-08

    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  19. MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

    Directory of Open Access Journals (Sweden)

    Ammad Ahmad Farooqi

    2018-04-01

    Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

  20. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2010-01-01

    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  1. The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

    Directory of Open Access Journals (Sweden)

    Meytal Galilee

    2018-01-01

    Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

  2. Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.

    Science.gov (United States)

    Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D

    2006-11-15

    TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

  3. The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients

    Science.gov (United States)

    Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita

    2018-01-01

    Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

  4. New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)

    2017-12-15

    Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

  5. HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial.

    Science.gov (United States)

    Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H

    2015-12-15

    Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

  6. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  7. Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M

    2017-12-01

    Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

  8. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

    1986-01-01

    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  9. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

    2004-01-01

    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  10. Telomerase reverse transcriptase locus polymorphisms and cancer risk: a field synopsis and meta-analysis.

    Science.gov (United States)

    Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato

    2012-06-06

    Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic

  11. [Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury].

    Science.gov (United States)

    Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B

    2018-02-06

    Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

  12. Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro.

    Science.gov (United States)

    Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L

    1999-12-17

    Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

  13. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler

    2014-12-01

    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  14. Reptin is required for the transcription of telomerase reverse transcriptase and over-expressed in gastric cancer

    Directory of Open Access Journals (Sweden)

    Liu Tiantian

    2010-05-01

    Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.

  15. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  16. In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

    Science.gov (United States)

    Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

    2004-01-01

    The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

  17. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  18. APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

    Directory of Open Access Journals (Sweden)

    Weizi Liang

    Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

  19. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.

    1995-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  20. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  1. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-01-01

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  2. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

    2015-10-23

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  3. A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity.

    Science.gov (United States)

    Li, An; Ziehr, Jessica L; Johnson, Kenneth A

    2017-04-21

    Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    NARCIS (Netherlands)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

    2011-01-01

    The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

  5. Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

    Science.gov (United States)

    Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

    2009-06-01

    Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

  6. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  7. Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

    NARCIS (Netherlands)

    I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

    2015-01-01

    textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

  8. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

    NARCIS (Netherlands)

    Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  9. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

    NARCIS (Netherlands)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  10. Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

    Czech Academy of Sciences Publication Activity Database

    Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

    2016-01-01

    Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

  11. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  12. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

    NARCIS (Netherlands)

    Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

    2010-01-01

    Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

  13. Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

    Directory of Open Access Journals (Sweden)

    Warrilow David

    2008-12-01

    Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

  14. The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family.

    Science.gov (United States)

    Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong

    2012-01-01

    1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

  15. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    Science.gov (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  16. Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

    Science.gov (United States)

    Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

    2016-09-30

    We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

  17. In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

    Directory of Open Access Journals (Sweden)

    Johannes Van Staden

    2010-10-01

    Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.

  18. Probing the communication of deoxythymidine triphosphate in HIV-1 reverse transcriptase by communication maps and interaction energy studies.

    Science.gov (United States)

    Gnanasekaran, Ramachandran

    2017-11-08

    We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.

  19. Molecular Docking Studies of Marine Diterpenes as Inhibitors of Wild-Type and Mutants HIV-1 Reverse Transcriptase

    Directory of Open Access Journals (Sweden)

    Alessandra M. T. de Souza

    2013-10-01

    Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.

  20. Inhibition of human immunodeficiency virus type 1 infection by the candidate microbicide dapivirine, a nonnucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R

    2009-02-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.

  1. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

    Science.gov (United States)

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

    2009-01-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331

  2. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Directory of Open Access Journals (Sweden)

    Madeleine Zerbato

    Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  3. Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility.

    Science.gov (United States)

    Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W

    2012-05-01

    Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

  4. Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

    2010-12-12

    Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

  5. Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

    Directory of Open Access Journals (Sweden)

    Rami Kantor

    2005-04-01

    Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

  6. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  7. The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

    Directory of Open Access Journals (Sweden)

    Gronenborn Angela M

    2010-05-01

    Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

  8. A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

    DEFF Research Database (Denmark)

    Kirk, Ole; Lundgren, Jens D; Pedersen, Court

    2003-01-01

    BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

  9. Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2010-03-01

    Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

  10. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  11. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  12. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

    OpenAIRE

    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

    2015-01-01

    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  13. Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

    OpenAIRE

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-01-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

  14. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    Science.gov (United States)

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  15. Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

    Science.gov (United States)

    Sivan, Sree Kanth; Manga, Vijjulatha

    2010-06-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

  16. Pharmacokinetics and tolerability of the new second-generation nonnucleoside reverse- transcriptase inhibitor KM-023 in healthy subjects

    Directory of Open Access Journals (Sweden)

    Cha YJ

    2014-09-01

    Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600

  17. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

    Science.gov (United States)

    Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

    2017-07-11

    Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

  18. Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

    Directory of Open Access Journals (Sweden)

    Jessica H Brehm

    Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

  19. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

    Directory of Open Access Journals (Sweden)

    Sukrit Silas

    2017-07-01

    Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

  20. Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

    Science.gov (United States)

    Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

    2003-05-01

    Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

  1. Structural and Preclinical Studies of Computationally Designed Non-Nucleoside Reverse Transcriptase Inhibitors for Treating HIV infection

    Energy Technology Data Exchange (ETDEWEB)

    Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.

    2017-02-06

    The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.

  2. Risk Factors for Incident Diabetes in a Cohort Taking First-Line Nonnucleoside Reverse Transcriptase Inhibitor-Based Antiretroviral Therapy.

    Science.gov (United States)

    Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen

    2016-03-01

    Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.

  3. Association of telomerase reverse transcriptase promoter mutations with clinicopathological features and prognosis of thyroid cancer: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Su X

    2016-11-01

    Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation

  4. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie

    2013-12-01

    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  5. Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

    LENUS (Irish Health Repository)

    Bansode, Vijay B

    2011-10-13

    Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

  6. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  7. A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

    Science.gov (United States)

    Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

    2015-08-01

    The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

  8. Risperidone-induced reversible neutropenia.

    Science.gov (United States)

    Kattalai Kailasam, Vasanth; Chima, Victoria; Nnamdi, Uchechukwu; Sharma, Kavita; Shah, Kairav

    2017-01-01

    This case report presents a 44-year-old man with a history of schizophrenia who developed neutropenia on risperidone therapy. The patient's laboratory reports showed a gradual decline of leukocytes and neutrophils after resolution and rechallenging. This was reversed with the discontinuation of risperidone and by switching to olanzapine. In this case report, we also discuss the updated evidence base for management of risperidone-induced neutropenia.

  9. Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Markus Hecht

    Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

  10. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V

    2008-12-01

    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  11. Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex That Confer Multinucleoside Drug Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy

    2017-04-10

    HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.

  12. Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

    Science.gov (United States)

    Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

    2014-01-01

    Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

  13. Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

    Directory of Open Access Journals (Sweden)

    Mark A Winters

    Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

  14. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

    Science.gov (United States)

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

    2014-01-13

    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

  15. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

    Science.gov (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

    2016-04-01

    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  16. In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection.

    Science.gov (United States)

    Giacobbi, Nicholas S; Sluis-Cremer, Nicolas

    2017-07-01

    Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.

  17. Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

    Science.gov (United States)

    Ngai, Patrick H K; Ng, T B

    2003-11-14

    From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

  18. N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

    Directory of Open Access Journals (Sweden)

    Soo-Huey Yap

    2007-12-01

    Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

  19. Expression of human telomerase reverse transcriptase protein in oral epithelial dysplasia and oral squamous cell carcinoma: An immunohistochemical study

    Science.gov (United States)

    Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao

    2016-01-01

    Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were

  20. Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

    Directory of Open Access Journals (Sweden)

    Turyadi Turyadi

    2018-01-01

    Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

  1. A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

    International Nuclear Information System (INIS)

    Ferkous, F.; Saihi, Y.

    2018-01-01

    Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

  2. Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

    Science.gov (United States)

    Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

    2000-05-18

    To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

  3. [The efficacy of autocatalytic casapse-3 driven by human telomerase reverse transcriptase promoter on human ovarian carcinoma].

    Science.gov (United States)

    Song, Yue; Shen, Keng; Yu, Jing-rong

    2007-11-06

    To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase

  4. Selective suppression of autocatalytic caspase-3 driven by two-step transcriptional amplified human telomerase reverse transcriptase promoter on ovarian carcinoma growth in vitro and in mice.

    Science.gov (United States)

    Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng

    2014-07-01

    The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.

  5. Safety, tolerability and pharmacokinetics of doravirine, a novel HIV non-nucleoside reverse transcriptase inhibitor, after single and multiple doses in healthy subjects.

    Science.gov (United States)

    Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R

    2015-01-01

    Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once

  6. Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

    Science.gov (United States)

    Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

    2017-06-16

    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) using pre-steady-state kinetics.

    Science.gov (United States)

    Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S

    2014-06-01

    The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    DEFF Research Database (Denmark)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy

    2011-01-01

    Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...

  9. Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

    DEFF Research Database (Denmark)

    Fox, Zoe; Phillips, Andrew; Cohen, Cal

    2008-01-01

    the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

  10. Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India.

    Science.gov (United States)

    Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami

    2017-06-01

    We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

  11. Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

    Science.gov (United States)

    Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

    2016-05-01

    Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

  12. Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

    Science.gov (United States)

    Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

    2016-05-01

    Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

  13. Extensive Mutagenesis of the Conserved Box E Motif in Duck Hepatitis B Virus P Protein Reveals Multiple Functions in Replication and a Common Structure with the Primer Grip in HIV-1 Reverse Transcriptase

    OpenAIRE

    Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael

    2012-01-01

    Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...

  14. Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss.

    Science.gov (United States)

    Zhu, Tao; Niu, Deng-Ke

    2013-03-05

    Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.

  15. Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression.

    Science.gov (United States)

    Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong

    2013-01-01

    In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

  16. The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

    Directory of Open Access Journals (Sweden)

    Niu Meijuan

    2004-10-01

    Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

  17. Active methamphetamine use is associated with transmitted drug resistance to non-nucleoside reverse transcriptase inhibitors in individuals with HIV infection of unknown duration.

    Science.gov (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M

    2007-01-01

    Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.

  18. Active Methamphetamine Use is Associated with Transmitted Drug Resis-tance to Non-Nucleoside Reverse Transcriptase Inhibitors in Individuals with HIV Infection of Unknown Duration

    Science.gov (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M

    2007-01-01

    Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691

  19. Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

  20. Etravirine and rilpivirine resistance in HIV-1 subtype CRF01_AE-infected adults failing non-nucleoside reverse transcriptase inhibitor-based regimens.

    Science.gov (United States)

    Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat

    2011-01-01

    We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.

  1. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

    Science.gov (United States)

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

    2013-12-23

    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  2. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    Science.gov (United States)

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  3. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

    Science.gov (United States)

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

    2017-11-22

    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  4. Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

    International Nuclear Information System (INIS)

    Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin

    2008-01-01

    Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

  5. Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

    Science.gov (United States)

    Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

    2017-11-08

    The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

  6. Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.

    Science.gov (United States)

    Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang

    2017-12-01

    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  8. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  9. Generation of thermostable Moloney murine leukemia virus reverse transcriptase variants using site saturation mutagenesis library and cell-free protein expression system.

    Science.gov (United States)

    Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi

    2017-12-01

    We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.

  10. Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations.

    Science.gov (United States)

    Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P

    2000-05-04

    Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

  11. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu

    2016-03-01

    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  12. Apoptosis and reduced cell proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA.

    Science.gov (United States)

    Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin

    2010-01-01

    The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.

  13. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

    2006-01-01

    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  14. Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

    Directory of Open Access Journals (Sweden)

    Parvathi Chary

    Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

  15. Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite of extensive proliferation

    International Nuclear Information System (INIS)

    Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha

    2005-01-01

    Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols

  16. Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission.

    Science.gov (United States)

    Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido

    2013-09-01

    Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

  17. Discovery of dapivirine, a nonnucleoside HIV-1 reverse transcriptase inhibitor, as a broad-spectrum antiviral against both influenza A and B viruses.

    Science.gov (United States)

    Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun

    2017-09-01

    The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Development and Characterization of a Vaginal Film Containing Dapivirine, a Non- nucleoside Reverse Transcriptase Inhibitor (NNRTI), for prevention of HIV-1 sexual transmission.

    Science.gov (United States)

    Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia

    2011-06-01

    Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.

  19. A comparison of the ability of rilpivirine (TMC278 and selected analogues to inhibit clinically relevant HIV-1 reverse transcriptase mutants

    Directory of Open Access Journals (Sweden)

    Johnson Barry C

    2012-12-01

    Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.

  20. Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

    International Nuclear Information System (INIS)

    Freeman-Wittig, M.J.B.

    1986-01-01

    The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

  1. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Science.gov (United States)

    Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang

    2010-01-01

    A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

  2. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Directory of Open Access Journals (Sweden)

    Yanrui Li

    2010-01-01

    Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

  3. Unique case of oligoastrocytoma with recurrence and grade progression: Exhibiting differential expression of high mobility group-A1 and human telomerase reverse transcriptase

    Science.gov (United States)

    Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni

    2016-01-01

    Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647

  4. Activation of endogenous retrovirus reverse transcriptase in multiple sclerosis patient lymphocytes by inactivated HSV-1, HHV-6 and VZV

    DEFF Research Database (Denmark)

    Brudek, Tomasz; Lühdorf, Pernille; Christensen, Tove

    2007-01-01

    Human endogenous retroviruses (HERVs) and herpesviruses have been associated with the development of multiple sclerosis (MS). These virus groups interact with each other and have been shown to induce synergistic immune responses. Here, we focus on the possible role of herpesviruses as contributing...

  5. Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors

    CSIR Research Space (South Africa)

    Bode, ML

    2011-06-01

    Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...

  6. Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-07-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

  7. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Science.gov (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Design, synthesis and antiviral evaluation of novel heteroarylcarbothioamide derivatives as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and RDDP functions.

    Science.gov (United States)

    Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo

    2017-08-31

    In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Prediction of the binding mode and resistance profile for a dual-target pyrrolyl diketo acid scaffold against HIV-1 integrase and reverse-transcriptase-associated ribonuclease H.

    Science.gov (United States)

    Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng

    2018-06-27

    The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.

  10. 3D-QSAR CoMFA of a series of DABO derivatives as HIV-1 reverse transcriptase non-nucleoside inhibitors.

    Science.gov (United States)

    de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão

    2008-08-01

    A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.

  11. Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

    International Nuclear Information System (INIS)

    Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

    1999-01-01

    We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  12. K70Q adds high-level tenofovir resistance to "Q151M complex" HIV reverse transcriptase through the enhanced discrimination mechanism.

    Directory of Open Access Journals (Sweden)

    Atsuko Hachiya

    2011-01-01

    Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.

  13. Introducing Catastrophe-QSAR. Application on Modeling Molecular Mechanisms of Pyridinone Derivative-Type HIV Non-Nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Marius Lazea

    2011-12-01

    Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.

  14. Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy.

    Science.gov (United States)

    Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N

    2005-05-01

    To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.

  15. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

    Science.gov (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  16. Pre-existing mutations in reverse transcriptase of hepatitis B virus in treatment-naive Chinese patients with chronic hepatitis B.

    Directory of Open Access Journals (Sweden)

    Jie Xu

    Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.

  17. Molecular cloning of Kuruma shrimp Marsupenaeus japonicus endonuclease-reverse transcriptase and its positive role in white spot syndrome virus and Vibrio alginolyticus infection.

    Science.gov (United States)

    Ma, Xiongchao; Sun, Baozhen; Zhu, Fei

    2018-02-01

    This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

    Science.gov (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

    2007-01-01

    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  19. Application of 3D-QSAR, Pharmacophore, and Molecular Docking in the Molecular Design of Diarylpyrimidine Derivatives as HIV-1 Nonnucleoside Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi

    2018-05-11

    Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.

  20. Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

    International Nuclear Information System (INIS)

    Lund, Kaleb C.; Wallace, Kendall B.

    2008-01-01

    Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

  1. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

    Science.gov (United States)

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-06-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  2. Development and validation of a rapid reversed-phase HPLC method for the determination of the non-nucleoside reverse transcriptase inhibitor dapivirine from polymeric nanoparticles.

    Science.gov (United States)

    das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda

    2010-06-05

    The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  3. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

    Science.gov (United States)

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

    2003-01-01

    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

  4. A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

    International Nuclear Information System (INIS)

    Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key

    2016-01-01

    Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

  5. MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Lin Bai

    Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.

  6. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

    Science.gov (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

    2013-11-05

    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  7. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    Science.gov (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  8. A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)

    2016-08-26

    Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

  9. Reversible Posterior Leukoencephalopathy Syndrome Induced by Pazopanib

    Directory of Open Access Journals (Sweden)

    Chelis Leonidas

    2012-10-01

    Full Text Available Abstract Background The reversible posterior leukoencephalopathy syndrome is a clinical/radiological syndrome characterized by headache, seizures, impaired vision, acute hypertension, and typical magnetic resonance imaging findings. There are several reports in the literature that depict its occurrence in cancer patients. The list of common anticancer and supportive care drugs that predispose to reversible posterior leukoencephalopathy syndrome is expanding and includes not only a large number of chemotherapeutic agents but also an increased number of new targeted drugs, particularly angiogenesis inhibitors such as bevacizumab,sorefenib and sunitinib. Pazopanib is an oral tyrosine kinase inhibitor targeting vascular endothelial growth factor receptor, platelet-derived growth factor receptor, and c-Kit which after a positive phase III randomized clinical trial in patients with advanced renal cell cancer received FDA approval for the treatment of advanced renal cell carcinoma. Until now no cases of reversible posterior leukoencephalopathy syndrome induced by pazopanib have been reported. Case report We present the case of a 40 years old female patient with heavily pre-treated metastatic renal cell carcinoma who received pazopanib as salvage treatment. After 21 days of pazopanib therapy the patient referred to the emergency department with epileptic seizure, impaired vision at both eyes and headache. MRI of the brain revealed subcortical oedema at the occipital and parietal lobes bilaterally. She was treated with anticonvulsants, i.v. administration of mannitol and antihypertensives and she recovered completely from her symptoms and was discharged on the tenth hospital day. A brain MRI performed 3 weeks after showed that the subcortical oedema had been subsided. Conclusion In conclusion this is the first case of pazopanib induced reversible posterior leukoencephalopathy syndrome. Although usually reversible, this syndrome is a serious and

  10. Reversible Posterior Leukoencephalopathy Syndrome Induced by Pazopanib

    International Nuclear Information System (INIS)

    Chelis, Leonidas; Kakolyris, Stylianos; Souftas, Vasilios; Amarantidis, Kiriakos; Xenidis, Nikolaos; Chamalidou, Eleni; Dimopoulos, Prokopios; Michailidis, Prodromos; Christakidis, Evagelos; Prassopoulos, Panagiotis

    2012-01-01

    The reversible posterior leukoencephalopathy syndrome is a clinical/radiological syndrome characterized by headache, seizures, impaired vision, acute hypertension, and typical magnetic resonance imaging findings. There are several reports in the literature that depict its occurrence in cancer patients. The list of common anticancer and supportive care drugs that predispose to reversible posterior leukoencephalopathy syndrome is expanding and includes not only a large number of chemotherapeutic agents but also an increased number of new targeted drugs, particularly angiogenesis inhibitors such as bevacizumab,sorefenib and sunitinib. Pazopanib is an oral tyrosine kinase inhibitor targeting vascular endothelial growth factor receptor, platelet-derived growth factor receptor, and c-Kit which after a positive phase III randomized clinical trial in patients with advanced renal cell cancer received FDA approval for the treatment of advanced renal cell carcinoma. Until now no cases of reversible posterior leukoencephalopathy syndrome induced by pazopanib have been reported. We present the case of a 40 years old female patient with heavily pre-treated metastatic renal cell carcinoma who received pazopanib as salvage treatment. After 21 days of pazopanib therapy the patient referred to the emergency department with epileptic seizure, impaired vision at both eyes and headache. MRI of the brain revealed subcortical oedema at the occipital and parietal lobes bilaterally. She was treated with anticonvulsants, i.v. administration of mannitol and antihypertensives and she recovered completely from her symptoms and was discharged on the tenth hospital day. A brain MRI performed 3 weeks after showed that the subcortical oedema had been subsided. In conclusion this is the first case of pazopanib induced reversible posterior leukoencephalopathy syndrome. Although usually reversible, this syndrome is a serious and potentially life threatening adverse effect, if untreated, that should

  11. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

    OpenAIRE

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

    2014-01-01

    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

  12. Comparison of single and boosted protease inhibitor versus nonnucleoside reverse transcriptase inhibitor-containing cART regimens in antiretroviral-naïve patients starting cART after January 1, 2000

    DEFF Research Database (Denmark)

    Mocroft, A; Horban, A; Clumeck, N

    2006-01-01

    increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)

  13. High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme

    Science.gov (United States)

    Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni

    2005-01-01

    Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

  14. Structural optimization of N1-aryl-benzimidazoles for the discovery of new non-nucleoside reverse transcriptase inhibitors active against wild-type and mutant HIV-1 strains.

    Science.gov (United States)

    Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania

    2018-02-01

    Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Resveratrol reverses morphine-induced neuroinflammation in morphine-tolerant rats by reversal HDAC1 expression

    Directory of Open Access Journals (Sweden)

    Ru-Yin Tsai

    2016-06-01

    Conclusion: Resveratrol restores the antinociceptive effect of morphine by reversing morphine infusion-induced spinal cord neuroinflammation and increase in TNFR1 expression. The reversal of the morphine-induced increase in TNFR1 expression by resveratrol is partially due to reversal of the morphine infusion-induced increase in HDAC1 expression. Resveratrol pretreatment can be used as an adjuvant in clinical pain management for patients who need long-term morphine treatment or with neuropathic pain.

  16. N-Acetylcysteine Reverses Cocaine Induced Metaplasticity

    Science.gov (United States)

    Moussawi, Khaled; Pacchioni, Alejandra; Moran, Megan; Olive, M. Foster; Gass, Justin T.; Lavin, Antonieta; Kalivas, Peter W

    2009-01-01

    Cocaine addiction is characterized by an impaired ability to develop adaptive behaviors that can compete with cocaine seeking, implying a deficit in the ability to induce plasticity in cortico-accumbens circuitry critical for regulating motivated behavior. RWe found that rats withdrawn from cocaine self-administration had a marked in vivo deficit in the ability to develop long-term potentation (LTP) and depression (LTD) in the nucleus accumbens core subregion following stimulation of prefrontal cortex. N-acetylcysteine treatment prevents relapse in animal models and craving in humans by activating cystine-glutamate exchange and thereby stimulating extrasynaptic metabotropic glutamate receptors (mGluR). N-acetylcysteine treatment restored the ability to induce LTP and LTD by indirectly stimulating mGluR2/3 and mGluR5, respectively. Cocaine self-administration induces metaplasticity that inhibits the further induction of synaptic plasticity, and this impairment can be reversed by N-acetylcysteine, a drug that also prevents relapse. PMID:19136971

  17. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  18. Immortalization of Human Fetal Hepatocyte by Ectopic Expression of Human Telomerase Reverse Transcriptase, Human Papilloma Virus (E7) and Simian Virus 40 Large T (SV40 T) Antigen Towards Bioartificial Liver Support.

    Science.gov (United States)

    Giri, Shibashish; Bader, Augustinus

    2014-09-01

    Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a

  19. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients enrolled in the D:A:D study: a multi-cohort collaboration

    DEFF Research Database (Denmark)

    Sabin, Caroline A; Worm, Signe W; Weber, Rainer

    2008-01-01

    cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...

  20. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

    Science.gov (United States)

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

    2014-01-01

    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447

  1. Molecular docking of (5E)-3-(2-aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione on HIV-1 reverse transcriptase: novel drug acting on enzyme.

    Science.gov (United States)

    Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan

    2012-01-01

    The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.

  2. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    Science.gov (United States)

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  3. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  4. Parallel screening of drug-like natural compounds using Caco-2 cell permeability QSAR model with applicability domain, lipophilic ligand efficiency index and shape property: A case study of HIV-1 reverse transcriptase inhibitors

    Science.gov (United States)

    Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.

    2017-10-01

    The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.

  5. Novel HBV recombinants between genotypes B and C in 3'-terminal reverse transcriptase (RT) sequences are associated with enhanced viral DNA load, higher RT point mutation rates and place of birth among Chinese patients.

    Science.gov (United States)

    Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong

    2018-01-01

    As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.

  6. N-Acetylcysteine Reverses Cocaine Induced Metaplasticity

    OpenAIRE

    Moussawi, Khaled; Pacchioni, Alejandra; Moran, Megan; Olive, M. Foster; Gass, Justin T.; Lavin, Antonieta; Kalivas, Peter W

    2009-01-01

    Cocaine addiction is characterized by an impaired ability to develop adaptive behaviors that can compete with cocaine seeking, implying a deficit in the ability to induce plasticity in cortico-accumbens circuitry critical for regulating motivated behavior. RWe found that rats withdrawn from cocaine self-administration had a marked in vivo deficit in the ability to develop long-term potentation (LTP) and depression (LTD) in the nucleus accumbens core subregion following stimulation of prefront...

  7. Measuring enzymatic HIV-1 susceptibility to two reverse transcriptase inhibitors as a rapid and simple approach to HIV-1 drug-resistance testing.

    Directory of Open Access Journals (Sweden)

    Dieter Hoffmann

    Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.

  8. Pridopidine Reverses Phencyclidine-Induced Memory Impairment.

    Science.gov (United States)

    Sahlholm, Kristoffer; Valle-León, Marta; Fernández-Dueñas, Víctor; Ciruela, Francisco

    2018-01-01

    Pridopidine is in clinical trials for Huntington's disease treatment. Originally developed as a dopamine D 2 receptor (D 2 R) ligand, pridopidine displays about 100-fold higher affinity for the sigma-1 receptor (sigma-1R). Interestingly, pridopidine slows disease progression and improves motor function in Huntington's disease model mice and, in preliminarily reports, Huntington's disease patients. The present study examined the anti-amnesic potential of pridopidine. Thus, memory impairment was produced in mice by administration of phencyclidine (PCP, 10 mg/kg/day) for 10 days, followed by 14 days' treatment with pridopidine (6 mg/kg/day), or saline. Finally, novel object recognition performance was assessed in the animals. Mice receiving PCP and saline exhibited deficits in novel object recognition, as expected, while pridopidine treatment counteracted PCP-induced memory impairment. The effect of pridopidine was attenuated by co-administration of the sigma receptor antagonist, NE-100 (10 mg/kg). Our results suggest that pridopidine exerts anti-amnesic and potentially neuroprotective actions. These data provide new insights into the therapeutic potential of pridopidine as a pro-cognitive drug.

  9. Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-01-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

  10. 5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase.

    Science.gov (United States)

    Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong

    2018-06-18

    We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H  = 1.77 μM, IC 50 IN  = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  11. Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel

    Science.gov (United States)

    Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella

    2005-01-01

    The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

  12. Role of the functional MNS16A VNTR-243 variant of the human telomerase reverse transcriptase gene in progression and response to therapy of patients with non-Hodgkin's B-cell lymphomas.

    Science.gov (United States)

    Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K

    2015-04-01

    MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.

  13. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

    2012-04-01

    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  14. Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues

    Science.gov (United States)

    Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang

    2006-05-01

    To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

  15. A single dose of a MIV-150/Zinc acetate gel provides 24 h of protection against vaginal simian human immunodeficiency virus reverse transcriptase infection, with more limited protection rectally 8-24 h after gel use.

    Science.gov (United States)

    Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa

    2012-11-01

    Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.

  16. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

    Science.gov (United States)

    Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

    2017-08-02

    Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

  17. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

    Science.gov (United States)

    Patick, A K; Boritzki, T J; Bloom, L A

    1997-10-01

    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

  18. Efavirenz or nevirapine in three-drug combination therapy with two nucleoside or nucleotide-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals.

    Science.gov (United States)

    Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi

    2016-12-10

    The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure

  19. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  20. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  1. Idarucizumab for Reversing Dabigatran-Induced Anticoagulation: A Systematic Review.

    Science.gov (United States)

    Thibault, Nathan; Morrill, Amanda M; Willett, Kristine C

    The approval of the oral direct thrombin inhibitor, dabigatran etexilate, gave patients an alternative to oral anticoagulation with warfarin. Like all anticoagulants, the primary adverse event (AE) associated with dabigatran is bleeding. Until the FDA approval of idarucizumab, there had been no reversal agent for dabigatran-induced anticoagulation in patients with life-threatening or uncontrollable bleeding, or those requiring emergent procedures. The primary purpose of this review is to summarize the safety and efficacy of idarucizumab, a monoclonal antibody fragment, and its use as a reversal agent for dabigatran. A literature search was conducted through MEDLINE (1946 to November week 1 2015) and Embase (1980-2015 week 46) using the search term idarucizumab. Clinicaltrials.gov was consulted for a comprehensive list of ongoing and completed studies. Additional studies were identified through bibliographical citations. Clinical trials in animals and humans published in English evaluating the safety and efficacy of idarucizumab for reversal of anticoagulant treatment with dabigatran were included for review. Idarucizumab has been shown to significantly reverse the anticoagulant effects of dabigatran in both healthy volunteers and patients requiring a reversal agent because of either overt bleeding or an emergency surgery or invasive procedure. The most common AEs were headache, nasopharyngitis, back pain, skin irritation, hypokalemia, delirium, constipation, pyrexia, and pneumonia. Deaths reported in idarucizumab studies were attributed to either the index event or a preexisting comorbidity. Most adverse effects were minor, but 21 serious AEs have been reported in the published data including thrombotic events. Given the increased use of direct oral anticoagulants, such as dabigatran, a need for specific reversal agents exists. Idarucizumab has been shown to be safe and effective in the reversal of dabigatran-induced anticoagulation in patients requiring emergent

  2. Detection of human telomerase reverse transcriptase messenger ...

    African Journals Online (AJOL)

    Introduction and Objectives: Bladder cancer is an important national health problem as it is the leading cancer in men in Egypt. Cystoscopy and biopsy, currently remains the gold standard procedure for diagnosis, yet, it is invasive and costly. Urinary cytopathology remains to be the only non-invasive alternative method for ...

  3. Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis.

    Science.gov (United States)

    Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin

    2017-04-01

    Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

  4. Sequential emergence and clinical implications of viral mutants with K70E and K65R mutation in reverse transcriptase during prolonged tenofovir monotherapy in rhesus macaques with chronic RT-SHIV infection

    Directory of Open Access Journals (Sweden)

    Pedersen Niels C

    2007-04-01

    Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be

  5. Light-induced reversible expansion of individual gold nanoplates

    Directory of Open Access Journals (Sweden)

    Jinsheng Lu

    2017-10-01

    Full Text Available Light-induced mechanical response of materials has been extensively investigated and widely utilized to convert light energy into mechanical energy directly. The metallic nanomaterials have excellent photothermal properties and show enormous potential in micromechanical actuators, etc. However, the photo-thermo-mechanical properties of individual metallic nanostructures have yet to be well investigated. Here, we experimentally demonstrate a way to realize light-induced reversible expansion of individual gold nanoplates on optical microfibers. The light-induced thermal expansion coefficient is obtained as 21.4 ± 4.6 ∼ 31.5 ± 4.2 μ·K-1 when the light-induced heating temperature of the gold nanoplates is 240 ∼ 490 °C. The photo-thermo-mechanical response time of the gold nanoplates is about 0.3 ± 0.1 s. This insight into the photo-thermo-mechanical properties of the gold nanoplates could deepen the understanding of the light-induced reversible expansion behavior in nanoscale and pave the way for applications based on this piezoelectric-like response, such as light-driven metallic micromotors.

  6. Quaternary naltrexone reverses radiogenic and morphine-induced locomotor hyperactivity

    Energy Technology Data Exchange (ETDEWEB)

    Mickley, G.A.; Stevens, K.E.; Galbraith, J.A.; White, G.A.; Gibbs, G.L.

    1984-04-01

    The present study attempted to determine the relative role of the peripheral and central nervous system in the production of morphine-induced or radiation-induced locomotor hyperactivity of the mouse. Toward this end, we used a quaternary derivative of an opiate antagonist (naltrexone methobromide), which presumably does not cross the blood-brain barrier. Quaternary naltrexone was used to challenge the stereotypic locomotor response observed in these mice after either an i.p. injection of morphine or exposure to 1500 rads /sup 60/Co. The quaternary derivative of naltrexone reversed the locomotor hyperactivity normally observed in the C57BL/6J mouse after an injection of morphine. It also significantly attenuated radiation-induced locomotion. The data reported here support the hypothesis of endorphin involvement in radiation-induced and radiogenic behaviors. However, these conclusions are contingent upon further research which more fully evaluates naltrexone methobromide's capacity to cross the blood-brain barrier.

  7. Reversal of aflatoxin induced liver damage by turmeric and curcumin.

    Science.gov (United States)

    Soni, K B; Rajan, A; Kuttan, R

    1992-09-30

    The effect of certain food additives on aflatoxin production by Aspergillus parasiticus has been studied in vitro. Extracts of turmeric (Curcuma longa), garlic (Allium sativum) and asafoetida (Ferula asafoetida) inhibited the aflatoxin production considerably (more than 90%) at concentrations of 5-10 mg/ml. Similar results were also seen using butylated hydroxytoluene, butylated hydroxyanisole and ellagic acid at concentration 0.1 mM. Curcumin, the antioxidant principle from Curcuma longa did not have any effect on aflatoxin production. Turmeric and curcumin were also found to reverse the aflatoxin induced liver damage produced by feeding aflatoxin B1 (AFB1) (5 micrograms/day per 14 days) to ducklings. Fatty changes, necrosis and biliary hyperplasia produced by AFB1 were considerably reversed by these food additives.

  8. Treatment with pioglitazone induced significant, reversible mitral regurgitation.

    Science.gov (United States)

    Dorkhan, Mozhgan; Dencker, Magnus; Frid, Anders

    2008-04-30

    There has in recent years been great concern about possible cardiac side effects of thiazolidinediones (TZDs). We present a case-report of a 60 year-old male who developed significant mitral regurgitation during six months treatment with pioglitazone in parallel with laboratory indications of fluid retention. Echocardiography six months after discontinuation of medication showed regression of mitral regurgitation and the laboratory parameters were also normalized. It is noteworthy that six months treatment with pioglitazone could induce significant valve dysfunction, which was reversible, and this underlines the importance of carefully monitoring patients when placing them on treatment with TZDs.

  9. Treatment with pioglitazone induced significant, reversible mitral regurgitation

    Directory of Open Access Journals (Sweden)

    Frid Anders

    2008-04-01

    Full Text Available Abstract There has in recent years been great concern about possible cardiac side effects of thiazolidinediones (TZDs. We present a case-report of a 60 year-old male who developed significant mitral regurgitation during six months treatment with pioglitazone in parallel with laboratory indications of fluid retention. Echocardiography six months after discontinuation of medication showed regression of mitral regurgitation and the laboratory parameters were also normalized. It is noteworthy that six months treatment with pioglitazone could induce significant valve dysfunction, which was reversible, and this underlines the importance of carefully monitoring patients when placing them on treatment with TZDs.

  10. Reversible catecholamine-induced cardiomyopathy due to pheochromocytoma: case report.

    Science.gov (United States)

    Satendra, Milan; de Jesus, Cláudia; Bordalo e Sá, Armando L; Rosário, Luís; Rocha, José; Bicha Castelo, Henrique; Correia, Maria José; Nunes Diogo, António

    2014-03-01

    Pheochromocytoma is a tumor originating from chromaffin tissue. It commonly presents with symptoms and signs of catecholamine excess, such as hypertension, tachycardia, headache and sweating. Cardiovascular manifestations include catecholamine-induced cardiomyopathy, which may present as severe left ventricular dysfunction and congestive heart failure. We report a case of pheochromocytoma which was diagnosed following investigation of dilated cardiomyopathy. We highlight the dramatic symptomatic improvement and reversal of cardiomyopathy, with recovery of left ventricular function after treatment. Copyright © 2013 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

  11. Inducing sex reversal of the urogenital system of marsupials.

    Science.gov (United States)

    Renfree, Marilyn B; Chew, Keng Yih; Shaw, Geoff

    2014-01-01

    Marsupials differ from eutherian mammals in their reproductive strategy of delivering a highly altricial young after a short gestation. The young, with its undeveloped organ systems completes its development post-natally, usually within a pouch. The young is dependent on milk with a composition that varies through lactation to support its growth and changing needs as it matures over a lengthy period. Gonadal differentiation occurs after birth, providing a unique opportunity to examine the effects of hormonal manipulations on its sexual differentiation of the highly accessible young. In marsupials a difference in the migration of the urinary ducts around the genital ducts from eutherian mammals results in the unique tammar reproductive tract which has three vaginae and two cervices, and two distinctly separate uteri. In the tammar wallaby, a small member of the kangaroo family, we showed that virilisation of the Wolffian duct, prostate and phallus depends on an alternate androgen pathway, which has now been shown to be important for virilisation in humans. Through hormonal manipulations over differing time periods we have achieved sex reversal of both ovaries and testes, germ cells, genital ducts, prostate and phallus. Whilst we understand many of the mechanisms behind sexual differentiation there are still many lessons to be learned from understanding how sex reversal is achieved by using a model such as the tammar wallaby. This will help guide investigations into the major questions of how and why sex determination is achieved in other species. This review discusses the control and development of the marsupial urogenital system, largely drawn from our studies in the tammar wallaby and our ability to manipulate this system to induce sex reversal. Copyright © 2013 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

  12. N-Acetylcysteine reverses cocaine-induced metaplasticity.

    Science.gov (United States)

    Moussawi, Khaled; Pacchioni, Alejandra; Moran, Megan; Olive, M Foster; Gass, Justin T; Lavin, Antonieta; Kalivas, Peter W

    2009-02-01

    Cocaine addiction is characterized by an impaired ability to develop adaptive behaviors that can compete with cocaine seeking, implying a deficit in the ability to induce plasticity in cortico-accumbens circuitry crucial for regulating motivated behavior. We found that rats withdrawn from cocaine self-administration had a marked in vivo deficit in the ability to develop long-term potentiation (LTP) and long-term depression (LTD) in the nucleus accumbens core subregion after stimulation of the prefrontal cortex. N-acetylcysteine (NAC) treatment prevents relapse in animal models and craving in humans by activating cystine-glutamate exchange and thereby stimulating extrasynaptic metabotropic glutamate receptors (mGluR). NAC treatment of rats restored the ability to induce LTP and LTD by indirectly stimulating mGluR2/3 and mGluR5, respectively. Our findings show that cocaine self-administration induces metaplasticity that inhibits further induction of synaptic plasticity, and this impairment can be reversed by NAC, a drug that also prevents relapse.

  13. Reversible metronidazole-induced neurotoxicity after 10 weeks of therapy.

    Science.gov (United States)

    AlDhaleei, Wafa; AlMarzooqi, Ayesha; Gaber, Nouran

    2018-04-20

    Metronidazole is a commonly used antimicrobial worldwide. The most common side effects that have been reported are nausea, vomiting and hypersensitivity reactions. However, neurotoxicity has been reported with the use of metronidazole but rather rare. The most common neurological manifestation is peripheral neuropathy involvement in the form of sensory loss. It is worth mentioning that central neurotoxicity is a rare side effect of metronidazole use but reversible. The manifestations vary from a headache, altered mental status to focal neurological deficits. The diagnosis is mainly by neuroimaging in the setting of acute neurological change in the patient status. Here, we report a case of metronidazole-induced neurotoxicity in a 38-year-old male patient who was admitted with a brain abscess and was started on metronidazole for more than 10 weeks. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  14. A transient ischemic environment induces reversible compaction of chromatin.

    Science.gov (United States)

    Kirmes, Ina; Szczurek, Aleksander; Prakash, Kirti; Charapitsa, Iryna; Heiser, Christina; Musheev, Michael; Schock, Florian; Fornalczyk, Karolina; Ma, Dongyu; Birk, Udo; Cremer, Christoph; Reid, George

    2015-11-05

    Cells detect and adapt to hypoxic and nutritional stress through immediate transcriptional, translational and metabolic responses. The environmental effects of ischemia on chromatin nanostructure were investigated using single molecule localization microscopy of DNA binding dyes and of acetylated histones, by the sensitivity of chromatin to digestion with DNAseI, and by fluorescence recovery after photobleaching (FRAP) of core and linker histones. Short-term oxygen and nutrient deprivation of the cardiomyocyte cell line HL-1 induces a previously undescribed chromatin architecture, consisting of large, chromatin-sparse voids interspersed between DNA-dense hollow helicoid structures 40-700 nm in dimension. The chromatin compaction is reversible, and upon restitution of normoxia and nutrients, chromatin transiently adopts a more open structure than in untreated cells. The compacted state of chromatin reduces transcription, while the open chromatin structure induced upon recovery provokes a transitory increase in transcription. Digestion of chromatin with DNAseI confirms that oxygen and nutrient deprivation induces compaction of chromatin. Chromatin compaction is associated with depletion of ATP and redistribution of the polyamine pool into the nucleus. FRAP demonstrates that core histones are not displaced from compacted chromatin; however, the mobility of linker histone H1 is considerably reduced, to an extent that far exceeds the difference in histone H1 mobility between heterochromatin and euchromatin. These studies exemplify the dynamic capacity of chromatin architecture to physically respond to environmental conditions, directly link cellular energy status to chromatin compaction and provide insight into the effect ischemia has on the nuclear architecture of cells.

  15. Reverse 201Tl myocardial redistribution induced by coronary artery spasm

    International Nuclear Information System (INIS)

    Xiang Dingcheng; Yin Jilin; Gong Zhihua; Xie Zhenhong; Zhang Jinhe; Wen Yanfei; Yi Shaodong

    2010-01-01

    Objective: To investigate the mechanism of reverse redistribution (RR) on dipyridamole 201 Tl myocardial perfusion studies in the patients with coronary artery spasm. Methods: Twenty-six patients with coronary artery spasm and presented as RR on dipyridamole 201 Tl myocardial perfusion studies were enlisted as RR group, while other 16 patients with no coronary artery stenosis nor RR were enlisted as control group. Dipyridamole test was repeated during coronary angiography. Corrected thrombolysis in myocardial infarction (TIMI) frame count (CTFC) and TIMI myocardial perfusion grade (TMPG) were measured at RR related and non-RR related coronary arteries before and after dipyridamole infusion respectively. All of the data were analyzed by Student's t-test or χ 2 -test and correlation analysis. Results: Coronary artery angiography showed slower blood flow and lower myocardial perfusion in RR related vessels when compared with non-RR related vessels in RR group, but there was no significant difference among the main coronary arteries in control group. The perfusion defects of RR area at rest were positively related to slower blood velocity at corresponding coronary arteries (r = 0.79, t =10.18, P 0.05). Conclusion: RR is related to the decreased blood flow and myocardial perfusion induced by coronary artery spasm at rest, which may be improved by stress test such as intravenous dipyridamole infusion. (authors)

  16. Reversal of rocuronium-induced profound neuromuscular block by sugammadex in Duchenne muscular dystrophy.

    NARCIS (Netherlands)

    Boer, H.D. de; Egmond, J. van; Booij, L.H.D.J.; Driessen, J.J.

    2009-01-01

    A case is reported in which a child with Duchenne muscular dystrophy received a dose of sugammadex to reverse a rocuronium-induced profound neuromuscular block. Sugammadex is the first selective relaxant binding agent and reverses rocuronium- and vecuronium-induced neuromuscular block. A fast and

  17. Aminocaproic Acid and Tranexamic Acid Fail to Reverse Dabigatran-Induced Coagulopathy.

    Science.gov (United States)

    Levine, Michael; Huang, Margaret; Henderson, Sean O; Carmelli, Guy; Thomas, Stephen H

    In recent years, dabigatran has emerged as a popular alternative to warfarin for treatment of atrial fibrillation. If rapid reversal is required, however, no reversal agent has clearly been established. The primary purpose of this manuscript was to evaluate the efficacy of tranexamic acid and aminocaproic acid as agents to reverse dabigatran-induced coagulopathy. Rats were randomly assigned to 6 groups. Each rat received either dabigatran or oral placebo, followed by saline, tranexamic acid, or aminocaproic acid. An activated clotting test was used to measure the coagulopathy. Neither tranexamic acid nor aminocaproic acid successfully reversed dabigatran-induced coagulopathy. In this rodent model of dabigatran-induced coagulopathy, neither tranexamic acid nor aminocaproic acid were able to reverse the coagulopathy.

  18. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis

    NARCIS (Netherlands)

    Felten, Sandra; Leutenegger, Christian M.; Balzer, Hans Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman|info:eu-repo/dai/nl/089740890; Hartmann, Katrin

    2017-01-01

    Background: Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse

  19. Sugammadex, a new reversal agent for neuromuscular block induced by rocuronium in the anaesthetized Rhesus monkey.

    NARCIS (Netherlands)

    Boer, H.D. de; Egmond, J. van; Pol, F. van de; Bom, A.; Booij, L.H.D.J.

    2006-01-01

    BACKGROUND: Binding of the steroidal molecule of rocuronium by a cyclodextrin is a new concept for reversal of neuromuscular block. The present study evaluated the ability of Sugammadex Org 25969, a synthetic gamma-cyclodextrin derivative, to reverse constant neuromuscular block of about 90% induced

  20. Body composition and metabolic outcomes after 96 weeks of treatment with ritonavir-boosted lopinavir plus either nucleoside or nucleotide reverse transcriptase inhibitors or raltegravir in patients with HIV with virological failure of a standard first-line antiretroviral therapy regimen: a substudy of the randomised, open-label, non-inferiority SECOND-LINE study.

    Science.gov (United States)

    Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A

    2017-01-01

    Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N

  1. First interactions between hydrogen and stress-induced reverse transformation of Ni-Ti superelastic alloy

    Science.gov (United States)

    Yokoyama, Ken'ichi; Hashimoto, Tatsuki; Sakai, Jun'ichi

    2017-11-01

    The first dynamic interactions between hydrogen and the stress-induced reverse transformation have been investigated by performing an unloading test on a Ni-Ti superelastic alloy subjected to hydrogen charging under a constant applied strain in the elastic deformation region of the martensite phase. Upon unloading the specimen, charged with a small amount of hydrogen, no change in the behaviour of the stress-induced reverse transformation is observed in the stress-strain curve, although the behaviour of the stress-induced martensite transformation changes. With increasing amount of hydrogen charging, the critical stress for the reverse transformation markedly decreases. Eventually, for a larger amount of hydrogen charging, the reverse transformation does not occur, i.e. there is no recovery of the superelastic strain. The residual martensite phase on the side surface of the unloaded specimen is confirmed by X-ray diffraction. Upon training before the unloading test, the properties of the reverse transformation slightly recover after ageing in air at room temperature. The present study indicates that to change the behaviour of the reverse transformation a larger amount of hydrogen than that for the martensite transformation is necessary. In addition, it is likely that a substantial amount of hydrogen in solid solution more strongly suppresses the reverse transformation than hydrogen trapped at defects, thereby stabilising the martensite phase.

  2. Piracetam reverses haloperidol-induced catalepsy in mice

    OpenAIRE

    SALAM, Omar Abdel; NADA, Somaia

    2014-01-01

    To investigate the memory-enhancing drugs piracetam, vinpocetine, and ginkgo biloba for their ability to reduce catalepsy in mice treated with haloperidol. Haloperidol is a classic neuroleptic drug that induces motor abnormalities and cognitive impairment due to a blockade of dopamine D2 receptors in the striatum. Materials and methods: Catalepsy was induced by intraperitoneal haloperidol (2 mg/kg) administration. The drugs being tested were either administered intraperitoneally (IP) along ...

  3. Docking and 3-D QSAR studies on indolyl aryl sulfones. Binding mode exploration at the HIV-1 reverse transcriptase non-nucleoside binding site and design of highly active N-(2-hydroxyethyl)carboxamide and N-(2-hydroxyethyl)carbohydrazide derivatives.

    Science.gov (United States)

    Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano

    2005-01-13

    Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.

  4. Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A.

    Science.gov (United States)

    Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong

    2007-06-30

    Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

  5. Reversal of Stress-Induced Social Interaction Deficits by Buprenorphine.

    Science.gov (United States)

    Browne, Caroline A; Falcon, Edgardo; Robinson, Shivon A; Berton, Olivier; Lucki, Irwin

    2018-02-01

    Patients with post-traumatic stress disorder frequently report persistent problems with social interactions, emerging after a traumatic experience. Chronic social defeat stress is a widely used rodent model of stress that produces robust and sustained social avoidance behavior. The avoidance of other rodents can be reversed by 28 days of treatment with selective serotonin reuptake inhibitors, the only pharmaceutical class approved by the U.S. Food and Drug Administration for treating post-traumatic stress disorder. In this study, the sensitivity of social interaction deficits evoked by 10 days of chronic social defeat stress to prospective treatments for post-traumatic stress disorder was examined. The effects of acute and repeated treatment with a low dose of buprenorphine (0.25 mg/kg/d) on social interaction deficits in male C57BL/6 mice by chronic social defeat stress were studied. Another cohort of mice was used to determine the effects of the selective serotonin reuptake inhibitor fluoxetine (10 mg/kg/d), the NMDA antagonist ketamine (10 mg/kg/d), and the selective kappa opioid receptor antagonist CERC-501 (1 mg/kg/d). Changes in mRNA expression of Oprm1 and Oprk1 were assessed in a separate cohort. Buprenorphine significantly reversed social interaction deficits produced by chronic social defeat stress following 7 days of administration, but not after acute injection. Treatment with fluoxetine for 7 days, but not 24 hours, also reinstated social interaction behavior in mice that were susceptible to chronic social defeat. In contrast, CERC-501 and ketamine failed to reverse social avoidance. Gene expression analysis found: (1) Oprm1 mRNA expression was reduced in the hippocampus and increased in the frontal cortex of susceptible mice and (2) Oprk1 mRNA expression was reduced in the amygdala and increased in the frontal cortex of susceptible mice compared to non-stressed controls and stress-resilient mice. Short-term treatment with buprenorphine and fluoxetine

  6. 3, 4-methylenedioximethamphetamin reverses anxiety induced by chronic mild stress

    Directory of Open Access Journals (Sweden)

    Laura Andrea León A

    2013-01-01

    Full Text Available Here we report the effects of subchronic 3, 4 methylenedioximethamphetamine (MDMA on the elevated plusmaze, a widely used animal model of anxiety. Rats exposed to a mild chronic stress (MCS protocol received intracerebroventricular microinjections of the selective serotonin reuptake inhibitor (SSRI – fluoxetine (2.0 ug/ul or MDMA, (2.0 ug/ul for seven days. On the eighth day rats were tested in the elevated plus-maze. Our results showed that sub chronic MDMA interacted with MCS leading to a decrease in anxiety related behaviors including: percentage of open arms entries (F [2, 26] = 4.00; p = 0.031, time spent in the open arms (F [2, 26] = 3.656; p = 0.040 and time spent in the open arms extremities (F [2, 26] = 5.842; p = 0.008. These results suggest a potential effect of MDMA in the reversion of the emotional significance of aversive stimuli.

  7. Early reversal of profound rocuronium-induced neuromuscular blockade by sugammadex in a randomized multicenter study - Efficacy, safety, and pharmacokinetics

    NARCIS (Netherlands)

    Sparr, Harald J.; Vermeyen, Karel M.; Beaufort, Anton M.; Rietbergen, Henk; Proost, Johannes H.; Saldien, Vera; Velik-Salchner, Corinna; Wierda, J. Mark K. H.

    Background: Sugammadex reverses the neuromuscular blocking effects of rocuronium by chemical encapsulation. The efficacy, safety, and pharmacokinetics of sugammadex for reversal of profound rocuronium-induced neuromuscular blockade were evaluated. Methods: Ninety-eight male adult patients were

  8. Memantine reverses social withdrawal induced by ketamine in rats.

    Science.gov (United States)

    Uribe, Ezequiel; Landaeta, José; Wix, Richard; Eblen, Antonio

    2013-03-01

    The objective of this study was to determine the effect of memantine on schizophrenia-like symptoms in a ketamine-induced social withdrawal model in rats. We examined therapeutic effects of memantine, an NMDA antagonist, and haloperidol, a classic antipsychotic drug, on this behavioral model. Administration of memantine (10 or 15 mg·kg(-1)) significantly reduced ketamine-induced social withdrawal, and this effect was more effective than that of haloperidol (0.25 mg·kg(-1)) by restoring the social interaction between rats with no modification in general motor activity. These results suggest that memantine could have a therapeutic potential for schizophrenia.

  9. Melatonin reverses type 2 diabetes-induced cognitive deficits via ...

    African Journals Online (AJOL)

    Purpose: To evaluate the protective effect of melatonin on diabetes-induced cognitive dysfunction. Methods: Rats ... suggests that melatonin may be useful for the management of cognitive dysfunction in patients suffering ... as amyotrophic lateral sclerosis, Alzheimer's disease ..... with the inhibitory kappa beta (Iκβ) family.

  10. GRAVES’ DISEASE INDUCED REVERSIBLE SEVERE RIGHT HEART FAILURE

    Directory of Open Access Journals (Sweden)

    Kathyayani

    2015-07-01

    Full Text Available A middle aged man presented with evidence of right - sided heart failure in atrial fibrillation (AF and was found to have severe Tricuspid Regurgitation (TR with pulmonary artery hypertension (PAH, with normal left ventricular function. The common possible seconda ry causes of PAH were ruled out, but during investigation he was found to have elevated thyroid function tests compatible with the diagnosis of Graves’ disease. The treatment of Graves’ disease was started with anti - thyroid drugs and associated with a sign ificant reduction in the pulmonary arterial pressure. This case report is presented to highlight one of the rare and underdiagnosed presentations of Graves’ disease. Thyrotoxicosis can present with profound cardiovascular complications. In recent times, th ere have been few reports of secondary PAH with TR in patients with hyperthyroidism. Previously asymptomatic Graves’ disease having the signs and symptoms of right heart failure is a rare presentation and the association could be easily missed. This case p resentation emphasizes that the diagnosis of thyroid heart disease with heart failure secondary to Graves’ disease should be considered in any patient regardless of age, gender with clinical features of heart failure of unknown etiology and timely initiation of anti - thyroid drugs is necessary to treat these reversible cardiac failures.

  11. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  12. The Investigation of Strain-Induced Martensite Reverse Transformation in AISI 304 Austenitic Stainless Steel

    Science.gov (United States)

    Cios, G.; Tokarski, T.; Żywczak, A.; Dziurka, R.; Stępień, M.; Gondek, Ł.; Marciszko, M.; Pawłowski, B.; Wieczerzak, K.; Bała, P.

    2017-10-01

    This paper presents a comprehensive study on the strain-induced martensitic transformation and reversion transformation of the strain-induced martensite in AISI 304 stainless steel using a number of complementary techniques such as dilatometry, calorimetry, magnetometry, and in-situ X-ray diffraction, coupled with high-resolution microstructural transmission Kikuchi diffraction analysis. Tensile deformation was applied at temperatures between room temperature and 213 K (-60 °C) in order to obtain a different volume fraction of strain-induced martensite (up to 70 pct). The volume fraction of the strain-induced martensite, measured by the magnetometric method, was correlated with the total elongation, hardness, and linear thermal expansion coefficient. The thermal expansion coefficient, as well as the hardness of the strain-induced martensitic phase was evaluated. The in-situ thermal treatment experiments showed unusual changes in the kinetics of the reverse transformation (α' → γ). The X-ray diffraction analysis revealed that the reverse transformation may be stress assisted—strains inherited from the martensitic transformation may increase its kinetics at the lower annealing temperature range. More importantly, the transmission Kikuchi diffraction measurements showed that the reverse transformation of the strain-induced martensite proceeds through a displacive, diffusionless mechanism, maintaining the Kurdjumov-Sachs crystallographic relationship between the martensite and the reverted austenite. This finding is in contradiction to the results reported by other researchers for a similar alloy composition.

  13. Population pharmacokinetic–pharmacodynamic analysis for sugammadex-mediated reversal of rocuronium-induced neuromuscular blockade

    Science.gov (United States)

    Kleijn, Huub J; Zollinger, Daniel P; van den Heuvel, Michiel W; Kerbusch, Thomas

    2011-01-01

    AIMS An integrated population pharmacokinetic–pharmacodynamic model was developed with the following aims: to simultaneously describe pharmacokinetic behaviour of sugammadex and rocuronium; to establish the pharmacokinetic–pharmacodynamic model for rocuronium-induced neuromuscular blockade and reversal by sugammadex; to evaluate covariate effects; and to explore, by simulation, typical covariate effects on reversal time. METHODS Data (n = 446) from eight sugammadex clinical studies covering men, women, non-Asians, Asians, paediatrics, adults and the elderly, with various degrees of renal impairment, were used. Modelling and simulation techniques based on physiological principles were applied to capture rocuronium and sugammadex pharmacokinetics and pharmacodynamics and to identify and quantify covariate effects. RESULTS Sugammadex pharmacokinetics were affected by renal function, bodyweight and race, and rocuronium pharmacokinetics were affected by age, renal function and race. Sevoflurane potentiated rocuronium-induced neuromuscular blockade. Posterior predictive checks and bootstrapping illustrated the accuracy and robustness of the model. External validation showed concordance between observed and predicted reversal times, but interindividual variability in reversal time was pronounced. Simulated reversal times in typical adults were 0.8, 1.5 and 1.4 min upon reversal with sugammadex 16 mg kg−1 3 min after rocuronium, sugammadex 4 mg kg−1 during deep neuromuscular blockade and sugammadex 2 mg kg−1 during moderate blockade, respectively. Simulations indicated that reversal times were faster in paediatric patients and slightly slower in elderly patients compared with adults. Renal function did not affect reversal time. CONCLUSIONS Simulations of the therapeutic dosing regimens demonstrated limited impact of age, renal function and sevoflurane use, as predicted reversal time in typical subjects was always <2 min. PMID:21535448

  14. Stress-induced antinociception in fish reversed by naloxone.

    Directory of Open Access Journals (Sweden)

    Carla Patrícia Bejo Wolkers

    Full Text Available Pain perception in non-mammalian vertebrates such as fish is a controversial issue. We demonstrate that, in the fish Leporinus macrocephalus, an imposed restraint can modulate the behavioral response to a noxious stimulus, specifically the subcutaneous injection of 3% formaldehyde. In the first experiment, formaldehyde was applied immediately after 3 or 5 min of the restraint. Inhibition of the increase in locomotor activity in response to formaldehyde was observed, which suggests a possible restraint-induced antinociception. In the second experiment, the noxious stimulus was applied 0, 5, 10 and 15 min after the restraint, and both 3 and 5 min of restraint promoted short-term antinociception of approximately 5 min. In experiments 3 and 4, an intraperitoneal injection of naloxone (30 mg.kg(-1 was administered 30 min prior to the restraint. The 3- minute restraint-induced antinociception was blocked by pretreatment with naloxone, but the corresponding 5-minute response was not. One possible explanation for this result is that an opioid and a non-preferential μ-opioid and/or non-opioid mechanism participate in this response modulation. Furthermore, we observed that both the 3- and 5- minutes restraint were severely stressful events for the organism, promoting marked increases in serum cortisol levels. These data indicate that the response to a noxious stimulus can be modulated by an environmental stressor in fish, as is the case in mammals. To our knowledge, this study is the first evidence for the existence of an endogenous antinociceptive system that is activated by an acute standardized stress in fish. Additionally, it characterizes the antinociceptive response induced by stress in terms of its time course and the opioid mediation, providing information for understanding the evolution of nociception modulation.

  15. Arginase Inhibition Reverses Monocrotaline-Induced Pulmonary Hypertension

    Directory of Open Access Journals (Sweden)

    Christian Jung

    2017-07-01

    Full Text Available Pulmonary hypertension (PH is a heterogeneous disorder associated with a poor prognosis. Thus, the development of novel treatment strategies is of great interest. The enzyme arginase (Arg is emerging as important player in PH development. The aim of the current study was to determine the expression of ArgI and ArgII as well as the effects of Arg inhibition in a rat model of PH. PH was induced in 35 Sprague–Dawley rats by monocrotaline (MCT, 60 mg/kg as single-dose. There were three experimental groups: sham-treated controls (control group, n = 11, MCT-induced PH (MCT group, n = 11 and MCT-induced PH treated with the Arg inhibitor Nω-hydroxy-nor-l-arginine (nor-NOHA; MCT/NorNoha group, n = 13. ArgI and ArgII expression was determined by immunohistochemistry and Western blot. Right ventricular systolic pressure (RVPsys was measured and lung tissue remodeling was determined. Induction of PH resulted in an increase in RVPsys (81 ± 16 mmHg compared to the control group (41 ± 15 mmHg, p = 0.002 accompanied by a significant elevation of histological sum-score (8.2 ± 2.4 in the MCT compared to 1.6 ± 1.6 in the control group, p < 0.001. Both, ArgI and ArgII were relevantly expressed in lung tissue and there was a significant increase in the MCT compared to the control group (p < 0.01. Arg inhibition resulted in a significant reduction of RVPsys to 52 ± 19 mmHg (p = 0.006 and histological sum-score to 5.8 ± 1.4 compared to the MCT group (p = 0.022. PH leads to increased expression of Arg. Arg inhibition leads to reduction of RVPsys and diminished lung tissue remodeling and therefore represents a potential treatment strategy in PH.

  16. Clinically Relevant Pharmacological Strategies That Reverse MDMA-Induced Brain Hyperthermia Potentiated by Social Interaction.

    Science.gov (United States)

    Kiyatkin, Eugene A; Ren, Suelynn; Wakabayashi, Ken T; Baumann, Michael H; Shaham, Yavin

    2016-01-01

    MDMA-induced hyperthermia is highly variable, unpredictable, and greatly potentiated by the social and environmental conditions of recreational drug use. Current strategies to treat pathological MDMA-induced hyperthermia in humans are palliative and marginally effective, and there are no specific pharmacological treatments to counteract this potentially life-threatening condition. Here, we tested the efficacy of mixed adrenoceptor blockers carvedilol and labetalol, and the atypical antipsychotic clozapine, in reversing MDMA-induced brain and body hyperthermia. We injected rats with a moderate non-toxic dose of MDMA (9 mg/kg) during social interaction, and we administered potential treatment drugs after the development of robust hyperthermia (>2.5 °C), thus mimicking the clinical situation of acute MDMA intoxication. Brain temperature was our primary focus, but we also simultaneously recorded temperatures from the deep temporal muscle and skin, allowing us to determine the basic physiological mechanisms of the treatment drug action. Carvedilol was modestly effective in attenuating MDMA-induced hyperthermia by moderately inhibiting skin vasoconstriction, and labetalol was ineffective. In contrast, clozapine induced a marked and immediate reversal of MDMA-induced hyperthermia via inhibition of brain metabolic activation and blockade of skin vasoconstriction. Our findings suggest that clozapine, and related centrally acting drugs, might be highly effective for reversing MDMA-induced brain and body hyperthermia in emergency clinical situations, with possible life-saving results.

  17. Photon-Induced Magnetization Reversal in Single Molecule Magnets

    Science.gov (United States)

    Bal, Mustafa

    2005-03-01

    Single-molecule magnets (SMM) have been the subject of intensive research for more than a decade now because of their unique properties such as macroscopic quantum tunneling. Recent work in this area is focused on whether SMM are potential qubits, as proposed theoretically [1]. We use continuous millimeter wave radiation to manipulate the populations of the energy levels of a single crystal molecular magnet Fe8 [2]. When radiation is in resonance with the transitions between energy levels, the steady state magnetization exhibits dips. As expected, the magnetic field locations of these dips vary linearly with the radiation frequency. We will describe our experimental results, which provide a lower bound of 0.17 ns for transverse relaxation time. Transitions between excited states are found even though these states have negligible population at the experimental temperature. We find evidence that the sample heating is significant when the resonance condition is satisfied. Recent experiments are concentrated on the spin dynamics of Fe8 induced by pulsed radiation and results of these studies will also be presented. [1] Leuenberger, M. N. and Loss, D., Nature 410, 789 (2001). [2] M. Bal et al., Phys. Rev. B 70, 100408(R) (2004).

  18. Reversible cold-induced abnormalities in myocardial perfusion and function in systemic sclerosis

    International Nuclear Information System (INIS)

    Alexander, E.L.; Firestein, G.S.; Weiss, J.L.; Heuser, R.R.; Leitl, G.; Wagner, H.N. Jr.; Brinker, J.A.; Ciuffo, A.A.; Becker, L.C.

    1986-01-01

    The effects of peripheral cold exposure on myocardial perfusion and function were studied in 13 patients with scleroderma without clinically evident myocardial disease. Ten patients had at least one transient, cold-induced, myocardial perfusion defect visualized by thallium-201 scintigraphy, and 12 had reversible, cold-induced, segmental left ventricular hypokinesis by two-dimensional echocardiography. The 10 patients with transient perfusion defects all had anatomically corresponding ventricular wall motion abnormalities. No one in either of two control groups (9 normal volunteers and 7 patients with chest pain and normal coronary arteriograms) had cold-induced abnormalities. This study is the first to show the simultaneous occurrence of cold-induced abnormalities in myocardial perfusion and function in patients with scleroderma. The results suggest that cold exposure in such patients may elicit transient reflex coronary vasoconstriction resulting in reversible myocardial ischemia and dysfunction. Chronic recurrent episodes of coronary spasm may lead to focal myocardial fibrosis

  19. Seizure-induced brain lesions: A wide spectrum of variably reversible MRI abnormalities

    International Nuclear Information System (INIS)

    Cianfoni, A.; Caulo, M.; Cerase, A.; Della Marca, G.; Falcone, C.; Di Lella, G.M.; Gaudino, S.; Edwards, J.; Colosimo, C.

    2013-01-01

    Introduction MRI abnormalities in the postictal period might represent the effect of the seizure activity, rather than its structural cause. Material and Methods Retrospective review of clinical and neuroimaging charts of 26 patients diagnosed with seizure-related MR-signal changes. All patients underwent brain-MRI (1.5-Tesla, standard pre- and post-contrast brain imaging, including DWI-ADC in 19/26) within 7 days from a seizure and at least one follow-up MRI, showing partial or complete reversibility of the MR-signal changes. Extensive clinical work-up and follow-up, ranging from 3 months to 5 years, ruled out infection or other possible causes of brain damage. Seizure-induced brain-MRI abnormalities remained a diagnosis of exclusion. Site, characteristics and reversibility of MRI changes, and association with characteristics of seizures were determined. Results MRI showed unilateral (13/26) and bilateral abnormalities, with high (24/26) and low (2/26) T2-signal, leptomeningeal contrast-enhancement (2/26), restricted diffusion (9/19). Location of abnormality was cortical/subcortical, basal ganglia, white matter, corpus callosum, cerebellum. Hippocampus was involved in 10/26 patients. Reversibility of MRI changes was complete in 15, and with residual gliosis or focal atrophy in 11 patients. Reversibility was noted between 15 and 150 days (average, 62 days). Partial simple and complex seizures were associated with hippocampal involvement (p = 0.015), status epilepticus with incomplete reversibility of MRI abnormalities (p = 0.041). Conclusions Seizure or epileptic status can induce transient, variably reversible MRI brain abnormalities. Partial seizures are frequently associated with hippocampal involvement and status epilepticus with incompletely reversible lesions. These seizure-induced MRI abnormalities pose a broad differential diagnosis; increased awareness may reduce the risk of misdiagnosis and unnecessary intervention

  20. Seizure-induced brain lesions: A wide spectrum of variably reversible MRI abnormalities

    Energy Technology Data Exchange (ETDEWEB)

    Cianfoni, A., E-mail: acianfoni@hotmail.com [Neuroradiology, Neurocenter of Italian Switzerland–Ospedale regionale Lugano, Via Tesserete 46, Lugano, 6900, CH (Switzerland); Caulo, M., E-mail: caulo@unich.it [Department of Neuroscience and Imaging, University of Chieti, Via dei Vestini 33, 6610 Chieti. Italy (Italy); Cerase, A., E-mail: alfonsocerase@gmail.com [Unit of Neuroimaging and Neurointervention NINT, Department of Neurological and Sensorineural Sciences, Azienda Ospedaliera Universitaria Senese, Policlinico “Santa Maria alle Scotte”, V.le Bracci 16, Siena (Italy); Della Marca, G., E-mail: dellamarca@rm.unicatt.it [Neurology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy); Falcone, C., E-mail: carlo_falc@libero.it [Radiology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy); Di Lella, G.M., E-mail: gdilella@rm.unicatt.it [Radiology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy); Gaudino, S., E-mail: sgaudino@sirm.org [Radiology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy); Edwards, J., E-mail: edwardjc@musc.edu [Neuroscience Dept., Medical University of South Carolina, 96J Lucas st, 29425, Charleston, SC (United States); Colosimo, C., E-mail: colosimo@rm.unicatt.it [Radiology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy)

    2013-11-01

    Introduction MRI abnormalities in the postictal period might represent the effect of the seizure activity, rather than its structural cause. Material and Methods Retrospective review of clinical and neuroimaging charts of 26 patients diagnosed with seizure-related MR-signal changes. All patients underwent brain-MRI (1.5-Tesla, standard pre- and post-contrast brain imaging, including DWI-ADC in 19/26) within 7 days from a seizure and at least one follow-up MRI, showing partial or complete reversibility of the MR-signal changes. Extensive clinical work-up and follow-up, ranging from 3 months to 5 years, ruled out infection or other possible causes of brain damage. Seizure-induced brain-MRI abnormalities remained a diagnosis of exclusion. Site, characteristics and reversibility of MRI changes, and association with characteristics of seizures were determined. Results MRI showed unilateral (13/26) and bilateral abnormalities, with high (24/26) and low (2/26) T2-signal, leptomeningeal contrast-enhancement (2/26), restricted diffusion (9/19). Location of abnormality was cortical/subcortical, basal ganglia, white matter, corpus callosum, cerebellum. Hippocampus was involved in 10/26 patients. Reversibility of MRI changes was complete in 15, and with residual gliosis or focal atrophy in 11 patients. Reversibility was noted between 15 and 150 days (average, 62 days). Partial simple and complex seizures were associated with hippocampal involvement (p = 0.015), status epilepticus with incomplete reversibility of MRI abnormalities (p = 0.041). Conclusions Seizure or epileptic status can induce transient, variably reversible MRI brain abnormalities. Partial seizures are frequently associated with hippocampal involvement and status epilepticus with incompletely reversible lesions. These seizure-induced MRI abnormalities pose a broad differential diagnosis; increased awareness may reduce the risk of misdiagnosis and unnecessary intervention.

  1. Reversible Age-Related Phenotypes Induced during Larval Quiescence in C. elegans

    Science.gov (United States)

    Roux, Antoine E.; Langhans, Kelley; Huynh, Walter; Kenyon, Cynthia

    2017-01-01

    Summary Cells can enter quiescent states in which cell cycling and growth are suspended. We find that during a long developmental arrest (quiescence) induced by starvation, newly-hatched C. elegans acquire features associated with impaired proteostasis and aging: mitochondrial fission, ROS production, protein aggregation, decreased proteotoxic-stress resistance, and at the organismal level, decline of mobility and high mortality. All signs of aging but one, the presence of protein aggregates, were reversed upon return to development induced by feeding. The endoplasmic reticulum receptor IRE-1 is completely required for recovery, and the downstream transcription factor XBP-1, as well as a protein kinase, KGB-1, are partially required. Interestingly, kgb-1(−) mutants that do recover fail to reverse aging-like mitochondrial phenotypes and have a short adult lifespan. Our study describes the first pathway that reverses phenotypes of aging at the exit of prolonged quiescence. PMID:27304510

  2. Hypoinsulinemia regulates amphetamine-induced reverse transport of dopamine.

    Directory of Open Access Journals (Sweden)

    Jason M Williams

    2007-10-01

    Full Text Available The behavioral effects of psychomotor stimulants such as amphetamine (AMPH arise from their ability to elicit increases in extracellular dopamine (DA. These AMPH-induced increases are achieved by DA transporter (DAT-mediated transmitter efflux. Recently, we have shown that AMPH self-administration is reduced in rats that have been depleted of insulin with the diabetogenic agent streptozotocin (STZ. In vitro studies suggest that hypoinsulinemia may regulate the actions of AMPH by inhibiting the insulin downstream effectors phosphotidylinositol 3-kinase (PI3K and protein kinase B (PKB, or Akt, which we have previously shown are able to fine-tune DAT cell-surface expression. Here, we demonstrate that striatal Akt function, as well as DAT cell-surface expression, are significantly reduced by STZ. In addition, our data show that the release of DA, determined by high-speed chronoamperometry (HSCA in the striatum, in response to AMPH, is severely impaired in these insulin-deficient rats. Importantly, selective inhibition of PI3K with LY294002 within the striatum results in a profound reduction in the subsequent potential for AMPH to evoke DA efflux. Consistent with our biochemical and in vivo electrochemical data, findings from functional magnetic resonance imaging experiments reveal that the ability of AMPH to elicit positive blood oxygen level-dependent signal changes in the striatum is significantly blunted in STZ-treated rats. Finally, local infusion of insulin into the striatum of STZ-treated animals significantly recovers the ability of AMPH to stimulate DA release as measured by high-speed chronoamperometry. The present studies establish that PI3K signaling regulates the neurochemical actions of AMPH-like psychomotor stimulants. These data suggest that insulin signaling pathways may represent a novel mechanism for regulating DA transmission, one which may be targeted for the treatment of AMPH abuse and potentially other dopaminergic disorders.

  3. Intrinsic torque reversals induced by magnetic shear effects on the turbulence spectrum in tokamak plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Z. X.; Tynan, G. [Center for Energy Research and Department of Mechanical and Aerospace Engineering, University of California at San Diego, San Diego, California 92093 (United States); Center for Momentum Transport and Flow Organization and Center for Astrophysics and Space Science, University of California, San Diego, California 92093 (United States); Wang, W. X.; Ethier, S. [Princeton Plasma Physics Laboratory, Princeton, New Jersey 08540 (United States); Diamond, P. H. [Center for Momentum Transport and Flow Organization and Center for Astrophysics and Space Science, University of California, San Diego, California 92093 (United States); Gao, C.; Rice, J. [Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

    2015-05-15

    Intrinsic torque, which can be generated by turbulent stresses, can induce toroidal rotation in a tokamak plasma at rest without direct momentum injection. Reversals in intrinsic torque have been inferred from the observation of toroidal velocity changes in recent lower hybrid current drive (LHCD) experiments. This work focuses on understanding the cause of LHCD-induced intrinsic torque reversal using gyrokinetic simulations and theoretical analyses. A new mechanism for the intrinsic torque reversal linked to magnetic shear (s{sup ^}) effects on the turbulence spectrum is identified. This reversal is a consequence of the ballooning structure at weak s{sup ^}. Based on realistic profiles from the Alcator C-Mod LHCD experiments, simulations demonstrate that the intrinsic torque reverses for weak s{sup ^} discharges and that the value of s{sup ^}{sub crit} is consistent with the experimental results s{sup ^}{sub crit}{sup exp}≈0.2∼0.3 [Rice et al., Phys. Rev. Lett. 111, 125003 (2013)]. The consideration of this intrinsic torque feature in our work is important for the understanding of rotation profile generation at weak s{sup ^} and its consequent impact on macro-instability stabilization and micro-turbulence reduction, which is crucial for ITER. It is also relevant to internal transport barrier formation at negative or weakly positive s{sup ^}.

  4. Olanzapine Reverses MK-801-Induced Cognitive Deficits and Region-Specific Alterations of NMDA Receptor Subunits

    Science.gov (United States)

    Liu, Xiao; Li, Jitao; Guo, Chunmei; Wang, Hongli; Sun, Yaxin; Wang, Han; Su, Yun-Ai; Li, Keqing; Si, Tianmei

    2018-01-01

    Cognitive dysfunction constitutes an essential component in schizophrenia for its early presence in the pathophysiology of the disease and close relatedness to life quality of patients. To develop effective treatment of cognitive deficits, it is important to understand their neurobiological causes and to identify potential therapeutic targets. In this study, adopting repeated MK-801 treatment as an animal model of schizophrenia, we investigated whether antipsychotic drugs, olanzapine and haloperidol, can reverse MK-801-induced cognitive deficits and how the reversal processes recruited proteins involved in glutamate neurotransmission in rat medial prefrontal cortex (mPFC) and hippocampus. We found that low-dose chronic MK-801 treatment impaired object-in-context recognition memory and reversal learning in the Morris water maze, leaving reference memory relatively unaffected, and that these cognitive deficits can be partially reversed by olanzapine, not haloperidol, treatment. At the molecular level, chronic MK-801 treatment resulted in the reduction of multiple N-methyl-D-aspartate (NMDA) receptor subunits in rat mPFC and olanzapine, not haloperidol, treatment restored the levels of GluN1 and phosphorylated GluN2B in this region. Taken together, MK-801-induced cognitive deficits may be associated with region-specific changes in NMDA receptor subunits and the reversal of specific NMDA receptor subunits may underlie the cognition-enhancing effects of olanzapine. PMID:29375333

  5. Photoreactivation reverses ultraviolet radition induced premutagenic lesions leading to frameshift mutations in Escherichia coli

    International Nuclear Information System (INIS)

    Yamamoto, Kazuo

    1985-01-01

    The effect of photoreactivation of the ultraviolet radiation induced reversion of a trpE9777 frameshift mutation was studied in a uvr A6 derivative of Escherichia coli K12. Two different photoreactivation treatments were used, one providing a single flash of photoreactivating light and another providing 10 min of light from fluorescent lamps. The reversion frequency of the trpE9777 frameshift mutation was strongly reduced when subsueqently exposed to visible light. The dose modification factor (the ratio of equally effective doses), for cells challenged with single-flash photoreactivation, for survival and induction of reversion to Trp + was 3.6 and 3.4, respectively. UV induction of RecA protein synthesis was not reversed by a single flash of photoreactivation. The dose modification factor for 10 min of fluorescent lamp photoreactivation for survival and for induction of reversion to Trp + was 6.5 and 6.3, respectively. The dose modification factor for 10 min of photoreactivation for induction of RecA protein was 1.7-2.5. Photoreactivation decreased the reversion of trpE9777 and increased survival to the same extent. We concluded that cyclobutyl pyrimidine dimers are the premutagenic lesions of UV mutagenesis of the trpE9777 allele in a uvr A6 background. (orig.)

  6. Mouth reversal extinguishes mismatch negativity induced by the McGurk illusion

    DEFF Research Database (Denmark)

    Eskelund, Kasper; Andersen, Tobias

    2013-01-01

    The sight of articulatory mouth movements (visual speech) influences auditory speech perception. This is demonstrated by the McGurk illusion in which incongruent visual speech alters the auditory phonetic percept. In behavioral studies, reversal of the vertical mouth direction has been reported...... by visual speech with either upright (unaltered) or vertically reversed mouth area. In a preliminary analysis, we found a Mismatch Negativity component induced by the McGurk illusion for 6 of 17 participants at electrode Cz when the mouth area was upright. In comparison, these participants produced...

  7. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  8. Inhibition of protein kinase A and GIRK channel reverses fentanyl-induced respiratory depression.

    Science.gov (United States)

    Liang, Xiaonan; Yong, Zheng; Su, Ruibin

    2018-06-11

    Opioid-induced respiratory depression is a major obstacle to improving the clinical management of moderate to severe chronic pain. Opioids inhibit neuronal activity via various pathways, including calcium channels, adenylyl cyclase, and potassium channels. Currently, the underlying molecular pathway of opioid-induced respiratory depression is only partially understood. This study aimed to investigate the mechanisms of opioid-induced respiratory depression in vivo by examining the effects of different pharmacological agents on fentanyl-induced respiratory depression. Respiratory parameters were detected using whole body plethysmography in conscious rats. We show that pre-treatment with the protein kinase A (PKA) inhibitor H89 reversed the fentanyl-related effects on respiratory rate, inspiratory time, and expiratory time. Pre-treatment with the G protein-gated inwardly rectifying potassium (GIRK) channel blocker Tertiapin-Q dose-dependently reversed the fentanyl-related effects on respiratory rate and inspiratory time. A phosphodiesterase 4 (PDE4) inhibitor and cyclic adenosine monophosphate (cAMP) analogs did not affect fentanyl-induced respiratory depression. These findings suggest that PKA and GIRK may be involved in fentanyl-induced respiratory depression and could represent useful therapeutic targets for the treatment of fentanyl-induced ventilatory depression. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus

    Directory of Open Access Journals (Sweden)

    Crumpacker Clyde S

    2011-01-01

    Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus

  10. Effects of spin-polarized current on pulse field-induced precessional magnetization reversal

    Directory of Open Access Journals (Sweden)

    Guang-fu Zhang

    2012-12-01

    Full Text Available We investigate effects of a small DC spin-polarized current on the pulse field-induced precessional magnetization reversal in a thin elliptic magnetic element by micromagnetic simulations. We find that the spin-polarized current not only broadens the time window of the pulse duration, in which a successful precessional reversal is achievable, but also significantly suppresses the magnetization ringing after the reversal. The pulse time window as well as the decay rate of the ringing increase with increasing the current density. When a spin-polarized current with 5 MA/cm2 is applied, the time window increases from 80 ps to 112 ps, and the relaxation time of the ringing decreases from 1.1 ns to 0.32 ns. Our results provide useful information to achieve magnetic nanodevices based on precessional switching.

  11. Magnetic field induced flow pattern reversal in a ferrofluidic Taylor-Couette system.

    Science.gov (United States)

    Altmeyer, Sebastian; Do, Younghae; Lai, Ying-Cheng

    2015-12-21

    We investigate the dynamics of ferrofluidic wavy vortex flows in the counter-rotating Taylor-Couette system, with a focus on wavy flows with a mixture of the dominant azimuthal modes. Without external magnetic field flows are stable and pro-grade with respect to the rotation of the inner cylinder. More complex behaviors can arise when an axial or a transverse magnetic field is applied. Depending on the direction and strength of the field, multi-stable wavy states and bifurcations can occur. We uncover the phenomenon of flow pattern reversal as the strength of the magnetic field is increased through a critical value. In between the regimes of pro-grade and retrograde flow rotations, standing waves with zero angular velocities can emerge. A striking finding is that, under a transverse magnetic field, a second reversal in the flow pattern direction can occur, where the flow pattern evolves into pro-grade rotation again from a retrograde state. Flow reversal is relevant to intriguing phenomena in nature such as geomagnetic reversal. Our results suggest that, in ferrofluids, flow pattern reversal can be induced by varying a magnetic field in a controlled manner, which can be realized in laboratory experiments with potential applications in the development of modern fluid devices.

  12. X-ray irradiation induced reversible resistance change in Pt/TiO2/Pt cells.

    Science.gov (United States)

    Chang, Seo Hyoung; Kim, Jungho; Phatak, Charudatta; D'Aquila, Kenneth; Kim, Seong Keun; Kim, Jiyoon; Song, Seul Ji; Hwang, Cheol Seong; Eastman, Jeffrey A; Freeland, John W; Hong, Seungbum

    2014-02-25

    The interaction between X-rays and matter is an intriguing topic for both fundamental science and possible applications. In particular, synchrotron-based brilliant X-ray beams have been used as a powerful diagnostic tool to unveil nanoscale phenomena in functional materials. However, it has not been widely investigated how functional materials respond to the brilliant X-rays. Here, we report the X-ray-induced reversible resistance change in 40-nm-thick TiO2 films sandwiched by Pt top and bottom electrodes, and propose the physical mechanism behind the emergent phenomenon. Our findings indicate that there exists a photovoltaic-like effect, which modulates the resistance reversibly by a few orders of magnitude, depending on the intensity of impinging X-rays. We found that this effect, combined with the X-ray irradiation induced phase transition confirmed by transmission electron microscopy, triggers a nonvolatile reversible resistance change. Understanding X-ray-controlled reversible resistance changes can provide possibilities to control initial resistance states of functional materials, which could be useful for future information and energy storage devices.

  13. Antivenom reversal of biochemical alterations induced by black scorpion Heterometrus fastigiousus Couzijn venom in mice

    Directory of Open Access Journals (Sweden)

    MK Chaubey

    2009-01-01

    Full Text Available In the present study, Heterometrus fastigiousus venom (HFV was employed as antigen to produce species-specific scorpion antivenom (SAV in albino mice (NIH strain. To determine SAV efficacy, it was pre-incubated with 10 LD50 of HFV and then injected subcutaneously into mice. Subsequently, mortality was observed after 24 hours. Minimum effective dose (MED was 12.5 LD50 of HFV/mL of SAV. SAV effectiveness to reverse HFV-induced biochemical alterations in mice was analyzed by challenge method. Simultaneously, mice received subcutaneously 40% of 24-hour-LD50 of HFV and intravenously SAV. After four hours, changes in serum glucose, free amino acids, uric acids, pyruvic acid, cholesterol, total protein, alkaline phosphatase, acid phosphatase, lactic dehydrogenase and glutamate-pyruvate transaminase enzyme level were determined. Treatment with species-specific SAV resulted in the reversal of HFV-induced biochemical alterations.

  14. Sugammadex 4.0 mg kg-1 reversal of deep rocuronium-induced neuromuscular blockade

    DEFF Research Database (Denmark)

    Yu, Buwei; Wang, Xiangrui; Hansen, Søren Helbo

    2014-01-01

    Objective: Maintenance of deep Neuro Muscular Blockade (NMB) until the end of surgery may be beneficial in some surgical procedures. The selective relaxant binding agent sugammadex rapidly reverses deep levels of rocuronium-induced NMB. The purpose of this study was to evaluate the efficacy...... and safety of sugammadex 4.0 mg kg-1 for reversal of deep rocuronium-induced NMB in Chinese and Caucasian patients. Methods: This was an open-label, multicenter, prospective Phase III efficacy study in adult American Society of Anesthesiologists Class 1-3 patients scheduled for surgery under general...... anesthesia and requiring deep NMB. All patients received intravenous propofol and opioids for induction and maintenance of anesthesia, and a single intubation dose of rocuronium 0.6 mg/kg, with maintenance doses of 0.1-0.2 mg/kg as required. Sugammadex 4.0 mg/kg was administered after the last dose...

  15. Negative Pressure Pulmonary Edema after Reversing Rocuronium-Induced Neuromuscular Blockade by Sugammadex

    Directory of Open Access Journals (Sweden)

    Manzo Suzuki

    2014-01-01

    Full Text Available Negative pressure pulmonary edema (NPPE is a rare complication that accompanies general anesthesia, especially after extubation. We experienced a case of negative pressure pulmonary edema after tracheal extubation following reversal of rocuronium-induced neuromuscular blockade by sugammadex. In this case, the contribution of residual muscular block on the upper airway muscle as well as large inspiratory forces created by the respiratory muscle which has a low response to muscle relaxants, is suspected as the cause.

  16. Nicotine Prevents and Reverses Paclitaxel-Induced Mechanical Allodynia in a Mouse Model of CIPN.

    Science.gov (United States)

    Kyte, S Lauren; Toma, Wisam; Bagdas, Deniz; Meade, Julie A; Schurman, Lesley D; Lichtman, Aron H; Chen, Zhi-Jian; Del Fabbro, Egidio; Fang, Xianjun; Bigbee, John W; Damaj, M Imad; Gewirtz, David A

    2018-01-01

    Chemotherapy-induced peripheral neuropathy (CIPN), a consequence of peripheral nerve fiber dysfunction or degeneration, continues to be a dose-limiting and debilitating side effect during and/or after cancer chemotherapy. Paclitaxel, a taxane commonly used to treat breast, lung, and ovarian cancers, causes CIPN in 59-78% of cancer patients. Novel interventions are needed due to the current lack of effective CIPN treatments. Our studies were designed to investigate whether nicotine can prevent and/or reverse paclitaxel-induced peripheral neuropathy in a mouse model of CIPN, while ensuring that nicotine will not stimulate lung tumor cell proliferation or interfere with the antitumor properties of paclitaxel. Male C57BL/6J mice received paclitaxel every other day for a total of four injections (8 mg/kg, i.p.). Acute (0.3-0.9 mg/kg, i.p.) and chronic (24 mg/kg per day, s.c.) administration of nicotine respectively reversed and prevented paclitaxel-induced mechanical allodynia. Blockade of the antinociceptive effect of nicotine with mecamylamine and methyllycaconitine suggests that the reversal of paclitaxel-induced mechanical allodynia is primarily mediated by the α 7 nicotinic acetylcholine receptor subtype. Chronic nicotine treatment also prevented paclitaxel-induced intraepidermal nerve fiber loss. Notably, nicotine neither promoted proliferation of A549 and H460 non-small cell lung cancer cells nor interfered with paclitaxel-induced antitumor effects, including apoptosis. Most importantly, chronic nicotine administration did not enhance Lewis lung carcinoma tumor growth in C57BL/6J mice. These data suggest that the nicotinic acetylcholine receptor-mediated pathways may be promising drug targets for the prevention and treatment of CIPN. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  17. Reversal of haloperidol induced motor deficits in rats exposed to repeated immobilization stress.

    Science.gov (United States)

    Shireen, Erum; Pervez, Sidra; Masroor, Maria; Ali, Wafa Binte; Rais, Qudsia; Khalil, Samira; Tariq, Anum; Haleem, Darakshan Jabeen

    2014-09-01

    Stress is defined as a non specific response of body to any physiological and psychological demand. Preclinical studies have shown that an uncontrollable stress condition produces neurochemical and behavioral deficits. The present study was conducted to test the hypothesis that a decrease in the responsiveness of somatodendritic 5-hydroxytryptamine (5-HT)-1A receptors following adaptation to stress could attenuate haloperidol induced acute parkinsonian like effect. Results showed that single exposure (2h) to immobilization stress markedly decreased food intake, growth rate and locomotor activity but these stress-induced behavioral deficits were not observed following repeated (2h/day for 5 days) exposure of immobilization stress suggesting behavioral tolerance occurs to similar stress. An important finding of present study is a reversal of haloperidol-induced motor deficits in animals exposed to repeated immobilization stress than respective control animals. It is suggested that stress induced possible desensitization of somatodendritic 5-HT-1A as well as 5-HT-2C receptors could release dopamine system from the inhibitory influence of serotonin. On the other hand, an increase in the effectiveness of postsynaptic 5-HT-1A receptors elicits a direct stimulatory influence on the activity of dopaminergic neuron and is possibly involved in the reversal of haloperidol-induced parkinsonian like symptoms in repeatedly immobilized rats.

  18. Dexamethasone Does Not Inhibit Sugammadex Reversal After Rocuronium-Induced Neuromuscular Block.

    Science.gov (United States)

    Buonanno, Pasquale; Laiola, Anna; Palumbo, Chiara; Spinelli, Gianmario; Servillo, Giuseppe; Di Minno, Raffaele Maria; Cafiero, Tullio; Di Iorio, Carlo

    2016-06-01

    Sugammadex is a relatively new molecule that reverses neuromuscular block induced by rocuronium. The particular structure of sugammadex traps the cyclopentanoperhydrophenanthrene ring of rocuronium in its hydrophobic cavity. Dexamethasone shares the same steroidal structure with rocuronium. Studies in vitro have demonstrated that dexamethasone interacts with sugammadex, reducing its efficacy. In this study, we investigated the clinical relevance of this interaction and its influence on neuromuscular reversal. In this retrospective case-control study, we analyzed data from 45 patients divided into 3 groups: dexamethasone after induction group (15 patients) treated with 8 mg dexamethasone as an antiemetic drug shortly after induction of anesthesia; dexamethasone before reversal group (15 patients) treated with dexamethasone just before sugammadex injection; and control group (15 patients) treated with 8 mg ondansetron. All groups received 0.6 mg/kg rocuronium at induction, 0.15 mg/kg rocuronium at train-of-four ratio (TOF) 2 for neuromuscular relaxation, and 2 mg/kg sugammadex for reversal at the end of the procedure at TOF2. Neuromuscular relaxation was monitored with a TOF-Watch® system. The control group had a recovery time of 154 ± 54 seconds (mean ± SD), the dexamethasone after induction group 134 ± 55 seconds, and the dexamethasone before reversal group 131 ± 68 seconds. The differences among groups were not statistically significant (P = 0.5141). Our results show that the use of dexamethasone as an antiemetic drug for the prevention of postoperative nausea and vomiting does not interfere with reversal of neuromuscular blockade with sugammadex in patients undergoing elective surgery with general anesthesia in contrast to in vitro studies that support this hypothesis.

  19. Reversal of rocuronium-induced (1.2 mg/kg) profound neuromuscular block by sugammadex: a multicenter, dose-finding and safety study.

    NARCIS (Netherlands)

    Boer, H.D. de; Driessen, J.J.; Marcus, M.A.; Kerkkamp, H.E.M.; Heeringa, M.; Klimek, M.

    2007-01-01

    BACKGROUND: Reversal of rocuronium-induced neuromuscular blockade can be accomplished by chemical encapsulation of rocuronium by sugammadex, a modified gamma-cyclodextrin derivative. This study investigated the efficacy and safety of sugammadex in reversing rocuronium-induced profound neuromuscular

  20. Exercise reverses metabolic syndrome in high-fat diet-induced obese rats.

    Science.gov (United States)

    Touati, Sabeur; Meziri, Fayçal; Devaux, Sylvie; Berthelot, Alain; Touyz, Rhian M; Laurant, Pascal

    2011-03-01

    Chronic consumption of a high-fat diet induces obesity. We investigated whether exercise would reverse the cardiometabolic disorders associated with obesity without it being necessary to change from a high- to normal-fat diet. Sprague-Dawley rats were placed on a high-fat (HFD) or control diet (CD) for 12 wk. HFD rats were then divided into four groups: sedentary HFD (HFD-S), exercise trained (motor treadmill for 12 wk) HFD (HFD-Ex), modified diet (HFD to CD; HF/CD-S), and exercise trained with modified diet (HF/CD-Ex). Cardiovascular risk parameters associated with metabolic syndrome were measured, and contents of aortic Akt, phospho-Akt at Ser (473), total endothelial nitric oxide synthase (eNOS), and phospho-eNOS at Ser (1177) were determined by Western blotting. Chronic consumption of HFD induced a metabolic syndrome. Exercise and dietary modifications reduced adiposity, improved glucose and insulin levels and plasma lipid profile, and exerted an antihypertensive effect. Exercise was more effective than dietary modification in improving plasma levels of thiobarbituric acid-reacting substance and in correcting the endothelium-dependent relaxation to acetylcholine and insulin. Furthermore, independent of the diet used, exercise increased Akt and eNOS phosphorylation. Metabolic syndrome induced by HFD is reversed by exercise and diet modification. It is demonstrated that exercise training induces these beneficial effects without the requirement for dietary modification, and these beneficial effects may be mediated by shear stress-induced Akt/eNOS pathway activation. Thus, exercise may be an effective strategy to reverse almost all the atherosclerotic risk factors linked to obesity, particularly in the vasculature.

  1. Reversal of sodium pump inhibitor induced vascular smooth muscle contraction with digibind. Stoichiometry and its implications.

    Science.gov (United States)

    Krep, H H; Graves, S W; Price, D A; Lazarus, M; Ensign, A; Soszynski, P A; Hollenberg, N K

    1996-01-01

    The possibility that a circulating sodium pump inhibitor contributes to the pathogenesis of volume-dependent hypertension via an action on vascular smooth muscle (VSM) is supported by multiple lines of investigation, but remains controversial. We had two goals in this study. The first was to compare the pattern of contractile response of rabbit aorta induced by two candidates, ouabain and a labile sodium pump inhibitor that we have identified in the peritoneal dialysate of volume-expanded hypertensive patients with chronic renal failure. Our second goal was to examine the ability of Digibind, a Fab fragment of antisera directed against digoxin, to reverse VSM contraction induced by both agents. Ouabain induced a concentration-dependent contraction, which was delayed in onset, was gradual, and reached a stable plateau after many hours. The labile sodium pump inhibitor induced a qualitatively similar series of responses. Digibind rapidly reversed the contractile responses to both sodium pump inhibitors, with a rate of relaxation that matched that induced by physical removal of the pump inhibitor from the bath. For ouabain, the Digibind:ouabain stoichiometry was highly predictable. When Digibind was present in a molar concentration equivalent to that of ouabain, or less, it had no effect. When the Digibind concentration was twice that of ouabain, complete relaxation occurred. Although the concentration:VSM response relationship for ouabain was steep, the concentration:effect interaction with Digibind was even more steep. The molar concentration of Digibind required to reverse the effects of the labile endogenous inhibitor from peritoneal dialysate was consistently lower than that for ouabain, which is compatible with either greater potency of the labile factor in VSM or greater affinity for Digibind. These findings are compatible with a role for one or more endogenous sodium pump inhibitors as the determinant of vascular smooth muscle tone in the volume

  2. Inactivation of Ca2+-induced ciliary reversal by high-salt extraction in the cilia of Paramecium.

    Science.gov (United States)

    Kutomi, Osamu; Seki, Makoto; Nakamura, Shogo; Kamachi, Hiroyuki; Noguchi, Munenori

    2013-10-01

    Intracellular Ca(2+) induces ciliary reversal and backward swimming in Paramecium. However, it is not known how the Ca(2+) signal controls the motor machinery to induce ciliary reversal. We found that demembranated cilia on the ciliated cortical sheets from Paramecium caudatum lost the ability to undergo ciliary reversal after brief extraction with a solution containing 0.5 M KCl. KNO(3), which is similar to KCl with respect to chaotropic effect; it had the same effect as that of KCl on ciliary response. Cyclic AMP antagonizes Ca(2+)-induced ciliary reversal. Limited trypsin digestion prevents endogenous A-kinase and cAMP-dependent phosphorylation of an outer arm dynein light chain and induces ciliary reversal. However, the trypsin digestion prior to the high-salt extraction did not affect the inhibition of Ca(2+)-induced ciliary reversal caused by the high-salt extraction. Furthermore, during the course of the high-salt extraction, some axonemal proteins were extracted from ciliary axonemes, suggesting that they may be responsible for Ca(2+)-induced ciliary reversal.

  3. Efficacy of the chelating agent CaEDTA in reversing lead-induced changes in behavior.

    Science.gov (United States)

    Cory-Slechta, D A; Weiss, B

    1989-01-01

    The chelating agent CaEDTA has been reported to reverse the deficits in intellectual function and performance associated with Pb (lead) exposure in children. However, such studies have not included rigorous controls for the intervention procedures per se. The experiments reported here examined reversibility of performance changes in a rat model based on behavior sensitive to low-level Pb exposure. Rats were exposed to 50 ppm sodium or Pb acetate in drinking water from weaning. Performance maintained under a Fixed-Interval schedule of food reinforcement began at 55 days of age. Following the onset of the characteristic increase in short interresponse times (IRTs) associated with low-level Pb exposure after 35 experimental sessions, Pb treatment was terminated. Animals within both the control and Pb groups were then matched on the basis of performance indices and injected daily for 5 days with either saline, 75 mg/kg or 150 mg/kg CaEDTA. Subsequent changes in F1 performance were monitored for 35-60 sessions. No consistent effects of CaEDTA were detected in control animals. CaEDTA treatment failed to reverse the behavioral effects in Pb-exposed animals. If anything, it tended to further increase the proportion of short IRTs. These data suggest that better controlled clinical studies are warranted to evaluate the efficacy of CaEDTA in reversing Pb-induced behavioral effects before its application for these purposes becomes widespread.

  4. Reversal of CRF- and stress-induced anorexia by an ayurvedic formulation

    Directory of Open Access Journals (Sweden)

    V. S. Kulkarni

    2012-04-01

    Full Text Available Trikatu churna is one of the commonly used Ayurvedic formulations in the traditional system of medicine in India for the treatment of agnimandya, i.e. anorexia. Trikatu contains equal amounts of finely powdered rhizomes of Zingiber officinale Roscoe (Zingiberaceae and fruits of Piper longum L. and Piper nigrum L. (Piperaceae. The chief objective of the study was to determine the antianorectic effects of three drugs individually and to compare these effects with the effect of Trikatu. The activity of the drugs was studied after anorexia was induced in rats by (1 physical stress arising from immobilization for 60 min; (2 intraperitoneal injection of Escherichia coli lipopolysaccharide (LPS, 100 μg/kg body weight; and (3 intraperitoneal administration of fluoxetine (8 mg/kg body weight. Similar doses of the extracts were tested on freely feeding rats and on rats that had been deprived of food for 20 h. Corticotrophin-releasing factor (CRF, 0.3 μg/rat can induce anxiogenic-like behavior and reduced food intake. This model was also studied, and the results were compared. The components of Trikatu churna failed to individually reverse the inhibition of feeding. In contrast, Trikatu churna pretreatment reversed stress-, fluoxetine- and CRF-induced anorexia. The study provides strong evidence of the synergistic action of Ayurvedic formulas and also proves the ability of Trikatu churna to reduce stress and CRF-induced anorexia.

  5. Reversal of CRF- and stress-induced anorexia by an ayurvedic formulation

    Directory of Open Access Journals (Sweden)

    V. S. Kulkarni

    2011-09-01

    Full Text Available Trikatu churna is one of the commonly used Ayurvedic formulations in the traditional system of medicine in India for the treatment of agnimandya, i.e. anorexia. Trikatu contains equal amounts of finely powdered rhizomes of Zingiber officinale Roscoe (Zingiberaceae and fruits of Piper longum L. and Piper nigrum L. (Piperaceae. The chief objective of the study was to determine the antianorectic effects of three drugs individually and to compare these effects with the effect of Trikatu. The activity of the drugs was studied after anorexia was induced in rats by (1 physical stress arising from immobilization for 60 min; (2 intraperitoneal injection of Escherichia coli lipopolysaccharide (LPS, 100 μg/kg body weight; and (3 intraperitoneal administration of fluoxetine (8 mg/kg body weight. Similar doses of the extracts were tested on freely feeding rats and on rats that had been deprived of food for 20 h. Corticotrophin-releasing factor (CRF, 0.3 μg/rat can induce anxiogenic-like behavior and reduced food intake. This model was also studied, and the results were compared. The components of Trikatu churna failed to individually reverse the inhibition of feeding. In contrast, Trikatu churna pretreatment reversed stress-, fluoxetine- and CRF-induced anorexia. The study provides strong evidence of the synergistic action of Ayurvedic formulas and also proves the ability of Trikatu churna to reduce stress and CRF-induced anorexia.

  6. Cladribine and Fludarabine Nucleotides Induce Distinct Hexamers Defining a Common Mode of Reversible RNR Inhibition.

    Science.gov (United States)

    Wisitpitthaya, Somsinee; Zhao, Yi; Long, Marcus J C; Li, Minxing; Fletcher, Elaine A; Blessing, William A; Weiss, Robert S; Aye, Yimon

    2016-07-15

    The enzyme ribonucleotide reductase (RNR) is a major target of anticancer drugs. Until recently, suicide inactivation in which synthetic substrate analogs (nucleoside diphosphates) irreversibly inactivate the RNR-α2β2 heterodimeric complex was the only clinically proven inhibition pathway. For instance, this mechanism is deployed by the multifactorial anticancer agent gemcitabine diphosphate. Recently reversible targeting of RNR-α-alone coupled with ligand-induced RNR-α-persistent hexamerization has emerged to be of clinical significance. To date, clofarabine nucleotides are the only known example of this mechanism. Herein, chemoenzymatic syntheses of the active forms of two other drugs, phosphorylated cladribine (ClA) and fludarabine (FlU), allow us to establish that reversible inhibition is common to numerous drugs in clinical use. Enzyme inhibition and fluorescence anisotropy assays show that the di- and triphosphates of the two nucleosides function as reversible (i.e., nonmechanism-based) inhibitors of RNR and interact with the catalytic (C site) and the allosteric activity (A site) sites of RNR-α, respectively. Gel filtration, protease digestion, and FRET assays demonstrate that inhibition is coupled with formation of conformationally diverse hexamers. Studies in 293T cells capable of selectively inducing either wild-type or oligomerization-defective mutant RNR-α overexpression delineate the central role of RNR-α oligomerization in drug activity, and highlight a potential resistance mechanism to these drugs. These data set the stage for new interventions targeting RNR oligomeric regulation.

  7. Local Peltier-effect-induced reversible metal–insulator transition in VO2 nanowires

    International Nuclear Information System (INIS)

    Takami, Hidefumi; Kanki, Teruo; Tanaka, Hidekazu

    2016-01-01

    We report anomalous resistance leaps and drops in VO 2 nanowires with operating current density and direction, showing reversible and nonvolatile switching. This event is associated with the metal–insulator phase transition (MIT) of local nanodomains with coexistence states of metallic and insulating phases induced by thermoelectric cooling and heating effects. Because the interface of metal and insulator domains has much different Peltier coefficient, it is possible that a significant Peltier effect would be a source of the local MIT. This operation can be realized by one-dimensional domain configuration in VO 2 nanowires because one straight current path through the electronic domain-interface enables theoretical control of thermoelectric effects. This result will open a new method of reversible control of electronic states in correlated electron materials.

  8. Local Peltier-effect-induced reversible metal–insulator transition in VO{sub 2} nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Takami, Hidefumi; Kanki, Teruo, E-mail: kanki@sanken.osaka-u.ac.jp, E-mail: h-tanaka@sanken.osaka-u.ac.jp; Tanaka, Hidekazu, E-mail: kanki@sanken.osaka-u.ac.jp, E-mail: h-tanaka@sanken.osaka-u.ac.jp [Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan)

    2016-06-15

    We report anomalous resistance leaps and drops in VO{sub 2} nanowires with operating current density and direction, showing reversible and nonvolatile switching. This event is associated with the metal–insulator phase transition (MIT) of local nanodomains with coexistence states of metallic and insulating phases induced by thermoelectric cooling and heating effects. Because the interface of metal and insulator domains has much different Peltier coefficient, it is possible that a significant Peltier effect would be a source of the local MIT. This operation can be realized by one-dimensional domain configuration in VO{sub 2} nanowires because one straight current path through the electronic domain-interface enables theoretical control of thermoelectric effects. This result will open a new method of reversible control of electronic states in correlated electron materials.

  9. Restoration of hippocampal growth hormone reverses stress-induced hippocampal impairment

    Directory of Open Access Journals (Sweden)

    Caitlin M. Vander Weele

    2013-06-01

    Full Text Available Though growth hormone (GH is synthesized by hippocampal neurons, where its expression is influenced by stress exposure, its function is poorly characterized. Here, we show that a regimen of chronic stress that impairs hippocampal function in rats also leads to a profound decrease in hippocampal GH levels. Restoration of hippocampal GH in the dorsal hippocampus via viral-mediated gene transfer completely reversed stress-related impairment of two hippocampus-dependent behavioral tasks, auditory trace fear conditioning and contextual fear conditioning, without affecting hippocampal function in unstressed control rats. GH overexpression reversed stress-induced decrements in both fear acquisition and long-term fear memory. These results suggest that loss of hippocampal GH contributes to hippocampal dysfunction following prolonged stress and demonstrate that restoring hippocampal GH levels following stress can promote stress resilience.

  10. [Comparison of neostigmine induced reversal of rocuronium in different age children].

    Science.gov (United States)

    Liu, Jinzhu; Cheng, Zhaoyu

    2016-03-15

    To compare the effectiveness of neostigmine induced reversal of rocuronium in neonates, infants, young children and children. One hundred and sixty ASA I or II pediatric patients undergoings elective surgical procedures under total intravenous anesthesia were enrolled during July 2014 to April 2015 in Tianjin Children's Hospital. The patients were divided into four groups according to ages: neonate group, infant group, young children group and children group.Then control subgroup and neostigmine reversal subgroup including twenty patients were randomly selected from every different age groups by the method of random number table. After induction of anesthesia, 0.6 mg/kg rocuronium was administered, and 0.2 mg/kg maintenance doses given as required during period of operation. Neuromuscular block was monitored using acceleromyographic train of four (TOF). When T1/control returned to 15%, 0.03 mg/kg neostigmine and 0.01 mg/kg atropine were given to patients of reversal subgroups, and saline 0.1 ml/kg was given to patients of control subgroups. The recovery time of T25, T75, TR0.7, recovery index, blood pressure, heart rate and adverse reactions were observed and recorded. In control subgroups, the recovery time of T75 for neonates, infants, young children and children were (27.10±8.72), (16.70±6.35), (13.05±1.96), (14.40±3.08) min, respectively (F=25.052, P0.05). But the recovery time of T75, TR0.7 and recovery index in neonate group were longer than other age groups (all Procuronium are comparable in infant, young children and children. There are obviously reversal effects in all of age groups when neostigmine is given to antagonize rocuronium. Either spontaneous recovery time or reversal recovery time of neostigmine to rocuronium is longer for neonates than other age's children.

  11. Reversal of profound vecuronium-induced neuromuscular block under sevoflurane anesthesia: sugammadex versus neostigmine.

    Directory of Open Access Journals (Sweden)

    Lemmens Hendrikus JM

    2010-09-01

    Full Text Available Abstract Background Acetylcholinesterase inhibitors cannot rapidly reverse profound neuromuscular block. Sugammadex, a selective relaxant binding agent, reverses the effects of rocuronium and vecuronium by encapsulation. This study assessed the efficacy of sugammadex compared with neostigmine in reversal of profound vecuronium-induced neuromuscular block under sevoflurane anesthesia. Methods Patients aged ≥18 years, American Society of Anesthesiologists class 1-4, scheduled to undergo surgery under general anesthesia were enrolled in this phase III, multicenter, randomized, safety-assessor blinded study. Sevoflurane anesthetized patients received vecuronium 0.1 mg/kg for intubation, with maintenance doses of 0.015 mg/kg as required. Patients were randomized to receive sugammadex 4 mg/kg or neostigmine 70 μg/kg with glycopyrrolate 14 μg/kg at 1-2 post-tetanic counts. The primary efficacy variable was time from start of study drug administration to recovery of the train-of-four ratio to 0.9. Safety assessments included physical examination, laboratory data, vital signs, and adverse events. Results Eighty three patients were included in the intent-to-treat population (sugammadex, n = 47; neostigmine, n = 36. Geometric mean time to recovery of the train-of-four ratio to 0.9 was 15-fold faster with sugammadex (4.5 minutes compared with neostigmine (66.2 minutes; p Conclusions Recovery from profound vecuronium-induced block is significantly faster with sugammadex, compared with neostigmine. Neostigmine did not rapidly reverse profound neuromuscular block (Trial registration number: NCT00473694.

  12. Pituitary Adenylate Cyclase-Activating Polypeptide Reverses Ammonium Metavanadate-Induced Airway Hyperresponsiveness in Rats

    Directory of Open Access Journals (Sweden)

    Mounira Tlili

    2015-01-01

    Full Text Available The rate of atmospheric vanadium is constantly increasing due to fossil fuel combustion. This environmental pollution favours vanadium exposure in particular to its vanadate form, causing occupational bronchial asthma and bronchitis. Based on the well admitted bronchodilator properties of the pituitary adenylate cyclase-activating polypeptide (PACAP, we investigated the ability of this neuropeptide to reverse the vanadate-induced airway hyperresponsiveness in rats. Exposure to ammonium metavanadate aerosols (5 mg/m3/h for 15 minutes induced 4 hours later an array of pathophysiological events, including increase of bronchial resistance and histological alterations, activation of proinflammatory alveolar macrophages, and increased oxidative stress status. Powerfully, PACAP inhalation (0.1 mM for 10 minutes alleviated many of these deleterious effects as demonstrated by a decrease of bronchial resistance and histological restoration. PACAP reduced the level of expression of mRNA encoding inflammatory chemokines (MIP-1α, MIP-2, and KC and cytokines (IL-1α and TNF-α in alveolar macrophages and improved the antioxidant status. PACAP reverses the vanadate-induced airway hyperresponsiveness not only through its bronchodilator activity but also by counteracting the proinflammatory and prooxidative effects of the metal. Then, the development of stable analogs of PACAP could represent a promising therapeutic alternative for the treatment of inflammatory respiratory disorders.

  13. Acute food deprivation reverses morphine-induced locomotion deficits in M5 muscarinic receptor knockout mice.

    Science.gov (United States)

    Steidl, Stephan; Lee, Esther; Wasserman, David; Yeomans, John S

    2013-09-01

    Lesions of the pedunculopontine tegmental nucleus (PPT), one of two sources of cholinergic input to the ventral tegmental area (VTA), block conditioned place preference (CPP) for morphine in drug-naïve rats. M5 muscarinic cholinergic receptors, expressed by midbrain dopamine neurons, are critical for the ability of morphine to increase nucleus accumbens dopamine levels and locomotion, and for morphine CPP. This suggests that M5-mediated PPT cholinergic inputs to VTA dopamine neurons critically contribute to morphine-induced dopamine activation, reward and locomotion. In the current study we tested whether food deprivation, which reduces PPT contribution to morphine CPP in rats, could also reduce M5 contributions to morphine-induced locomotion in mice. Acute 18-h food deprivation reversed the phenotypic differences usually seen between non-deprived wild-type and M5 knockout mice. That is, food deprivation increased morphine-induced locomotion in M5 knockout mice but reduced morphine-induced locomotion in wild-type mice. Food deprivation increased saline-induced locomotion equally in wild-type and M5 knockout mice. Based on these findings, we suggest that food deprivation reduces the contribution of M5-mediated PPT cholinergic inputs to the VTA in morphine-induced locomotion and increases the contribution of a PPT-independent pathway. The contributions of cholinergic, dopaminergic and GABAergic neurons to the effects of acute food deprivation are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Effect of dimethyl sulfoxide (DMSO) on radiation-induced heteroallelic reversion in diploid yeast

    International Nuclear Information System (INIS)

    Singh, D.R.; Mahajan, J.M.; Krishnan, D.

    1976-01-01

    Dimethyl sulfoxide has cryoprotective and radioprotective properties. It is also an efficient scavenger of radicals produced by radiolysis of water. Gamma-induced reversion of diploid yeast in the presence of this chemical during irradiation have been studied. The dose-modifying factor was in the same range as for survival. When the yeast was irradiated in the frozen state, the observed protection by DMSO disappeared. The results are discussed in terms of direct and indirect actions of radiations and the radical-scavenging ability of this chemical

  15. Age-Dependent Cellular and Behavioral Deficits Induced by Molecularly Targeted Drugs Are Reversible.

    Science.gov (United States)

    Scafidi, Joseph; Ritter, Jonathan; Talbot, Brooke M; Edwards, Jorge; Chew, Li-Jin; Gallo, Vittorio

    2018-04-15

    Newly developed targeted anticancer drugs inhibit signaling pathways commonly altered in adult and pediatric cancers. However, as these pathways are also essential for normal brain development, concerns have emerged of neurologic sequelae resulting specifically from their application in pediatric cancers. The neural substrates and age dependency of these drug-induced effects in vivo are unknown, and their long-term behavioral consequences have not been characterized. This study defines the age-dependent cellular and behavioral effects of these drugs on normally developing brains and determines their reversibility with post-drug intervention. Mice at different postnatal ages received short courses of molecularly targeted drugs in regimens analagous to clinical treatment. Analysis of rapidly developing brain structures important for sensorimotor and cognitive function showed that, while adult administration was without effect, earlier neonatal administration of targeted therapies attenuated white matter oligodendroglia and hippocampal neuronal development more profoundly than later administration, leading to long-lasting behavioral deficits. This functional impairment was reversed by rehabilitation with physical and cognitive enrichment. Our findings demonstrate age-dependent, reversible effects of these drugs on brain development, which are important considerations as treatment options expand for pediatric cancers. Significance: Targeted therapeutics elicit age-dependent long-term consequences on the developing brain that can be ameliorated with environmental enrichment. Cancer Res; 78(8); 2081-95. ©2018 AACR . ©2018 American Association for Cancer Research.

  16. Reversal or protection by light of the ethidium bromide induced petite mutation in yeast

    International Nuclear Information System (INIS)

    Hixon, S.C.; Burnham, A.D.; Irons, R.L.

    1979-01-01

    An intermediate in the ethidium bromide (EB) induced petite mutation pathway may be destabilized by daylight light to cause a reversion to the normal grande phenotype. Starved cells preincubated in the dark for up to 6 h with 100μg/ml EB could be reverted to grandes after one hour of light exposure, whereas similarly treated cells maintained in the dark expresse the petite mutation in more than 80 percent of the population. In addition, the production of petite mutants by EB in buffer could be prevented if cell suspensions were exposed to light immediately upon the addition of EB. Photoreversal of the EB-derived petite mutation in growing cells as less efficient presumably because the availability of an energy source caused a continuation of mutation events beyond the light revertible step to a non-reversible fixation of the mutation. Cells treated with EB in growth and reversal of the mutation. This may be due to the cold inhibition of an enzyme which comes into play beyond the light sensitive step in the mutation pathway. (orig.) [de

  17. Lactobacillus rhamnosus strain JB-1 reverses restraint stress-induced gut dysmotility.

    Science.gov (United States)

    West, C; Wu, R Y; Wong, A; Stanisz, A M; Yan, R; Min, K K; Pasyk, M; McVey Neufeld, K-A; Karamat, M I; Foster, J A; Bienenstock, J; Forsythe, P; Kunze, W A

    2017-01-01

    Environmental stress affects the gut with dysmotility being a common consequence. Although a variety of microbes or molecules may prevent the dysmotility, none reverse the dysmotility. We have used a 1 hour restraint stress mouse model to test for treatment effects of the neuroactive microbe, L. rhamnosus JB-1 ™ . Motility of fluid-filled ex vivo gut segments in a perfusion organ bath was recorded by video and migrating motor complexes measured using spatiotemporal maps of diameter changes. Stress reduced jejunal and increased colonic propagating contractile cluster velocities and frequencies, while increasing contraction amplitudes for both. Luminal application of 10E8 cfu/mL JB-1 restored motor complex variables to unstressed levels within minutes of application. L. salivarius or Na.acetate had no treatment effects, while Na.butyrate partially reversed stress effects on colonic frequency and amplitude. Na.propionate reversed the stress effects for jejunum and colon except on jejunal amplitude. Our findings demonstrate, for the first time, a potential for certain beneficial microbes as treatment of stress-induced intestinal dysmotility and that the mechanism for restoration of function occurs within the intestine via a rapid drug-like action on the enteric nervous system. © 2016 John Wiley & Sons Ltd.

  18. Speman®, A Proprietary Ayurvedic Formulation, Reverses Cyclophosphamide-Induced Oligospermia In Rats.

    Directory of Open Access Journals (Sweden)

    Mohd. Azeemuddin Mukram

    2013-04-01

    Full Text Available Background: This investigation was aimed to evaluate the effect of Speman®, a well known ayurvedic proprietary preparation, in an experimental model of cyclophosphamide-(CP induced oligospermia in rats.Materials and Methods: Thirty male rats were randomized in to five, equally-sized groups. Rats in group 1 served as a normal control; group 2 served as an untreated positive control; groups 3, 4, 5 received  Speman® granules  at doses of 300, 600, and 900mg/kg body weight p.o. respectively, once daily for 13 days. On day four, one hour after the respective treatment, oligospermia was induced by administering a single dose of CP (100mg/kg body weight p.o.  to all the groups except group1. At the end of the study period the rats were euthanised and accessory reproductive organs were weighed and subjected to histopathological examination. The semen samples were subject to enumeration of sperms.  Weight of the reproductive organs, histopathological examination of the tissues, and sperm count were the parameters studied to understand the effect of Speman® on rats with CP-induced oligospermia.Results: Changes that occurred due to the administration of CP at a dose of 100 mg/kg body weight were dose dependently reversed with Speman® at a dose of 300, 600, and 900 mg/kg body weight. There was a statistically significant increase in sperm count and the weight of the seminal vesicle, epididymis, and prostate.Conclusion: Findings of this investigation indicate that Speman® dose dependently reversed the CP-induced derangement of various parameters pertaining to the reproductive system.  This could explain the total beneficial actions of Speman® reported in several other clinical trials.

  19. Free radical scavenging reverses fructose-induced salt-sensitive hypertension

    Directory of Open Access Journals (Sweden)

    Zenner ZP

    2017-12-01

    Full Text Available Zachary P Zenner, Kevin L Gordish, William H Beierwaltes Department of Internal Medicine, Hypertension and Vascular Research Division, Henry Ford Hospital, Detroit, MI, USA Abstract: We have previously reported that a moderate dietary supplementation of 20% fructose but not glucose leads to a salt-sensitive hypertension related to increased proximal sodium–hydrogen exchanger activity and increased renal sodium retention. We also found that while high salt increased renal nitric oxide formation, this was retarded in the presence of fructose intake. We hypothesized that at least part of the pathway leading to fructose-induced salt-sensitive hypertension could be due to fructose-induced formation of reactive oxygen species and inappropriate stimulation of renin secretion, all of which would contribute to an increase in blood pressure. We found that both 20% fructose intake and a high-salt diet stimulated 8-isoprostane excretion. The superoxide dismutase (SOD mimetic tempol significantly reduced this elevated excretion. Next, we placed rats on a high-salt diet (4% for 1 week in combination with normal rat chow or 20% fructose with or without chronic tempol administration. A fructose plus high-salt diet induced a rapid increase (15 mmHg in systolic blood pressure and reversed high salt suppression of plasma renin activity. Tempol treatment reversed the pressor response and restored high salt suppression of renin. We conclude that fructose-induced salt-sensitive hypertension is driven by increased renal reactive oxygen species formation associated with salt retention and an enhanced renin–angiotensin system. Keywords: reactive oxygen species, tempol, sodium, renin, oxidative stress

  20. Quetiapine reverse paclitaxel-induced neuropathic pain in mice: Role of Alpha2- adrenergic receptors

    Directory of Open Access Journals (Sweden)

    Alireza Abed

    2017-11-01

    Full Text Available Objective(s: Paclitaxel-induced peripheral neuropathy is a common adverse effect of cancer chemo -therapy. This neuropathy has a profound impact on quality of life and patient’s survival. Preventing and treating paclitaxel-induced peripheral neuropathy is a major concern. First- and second-generation antipsychotics have shown analgesic effects both in humans and animals. Quetiapine is a novel atypical antipsychotic with low propensity to induce extrapyramidal or hyperprolactinemia side effects. The present study was designed to investigate the effects of quetiapine on the development and expression of neuropathic pain induced by paclitaxel in mice and the role of α2-adrenoceptors on its antinociception. Materials and Methods: Paclitaxel (2 mg/kg IP was injected for five consecutive days which resulted in thermal hyperalgesia and mechanical and cold allodynia. Results: Early administration of quetiapine from the 1st day until the 5th day (5, 10, and 15 mg/kg PO did not affect thermal, mechanical, and cold stimuli and could not prevent the development of neuropathic pain. In contrast, when quetiapine (10 and 15 mg/kg PO administration was started on the 6th day after the first paclitaxel injections, once the model had been established, and given daily until the 10th day, heat hyperalgesia and mechanical and cold allodynia were significantly attenuated. Also, the effect of quetiapine on heat hyperalgesia was reversed by pretreatment with yohimbine, as an alpha-2 adrenergic receptor antagonist. Conclusion: These results indicate that quetiapine, when administered after nerve injury can reverse the expression of neuropathic pain. Also, we conclude that α2-adrenoceptors participate in the antinociceptive effects of quetiapine.

  1. Measurement of the efficacy of 2% lipid in reversing bupivacaine- induced asystole in isolated rat hearts

    Science.gov (United States)

    2014-01-01

    Background The reversal efficacy of 2% lipid emulsion in cardiac asystole induced by different concentrations of bupivacaine is poorly defined and needs to be determined. Methods Forty-two male Sprague–Dawley rats were randomly divided into seven groups: B40, B60, B80, B100, B120, B140 and B160, n = 6. The Langendorff isolated heart perfusion model was used, which consisted of a balanced perfusion with Krebs-Henseleit solution for 25 minutes and a continuous infusion of 100 μmol/L bupivacaine until asystole had been induced for 3 minutes. The hearts in the seven groups were perfused with Krebs-Henseleit solution containing a 2% lipid emulsion, and 40, 60, 80, 100, 120, 140 or 160 μmol/L bupivacaine, respectively. Cardiac recovery was defined as a spontaneous and regular rhythm with a rate-pressure product > 10% of the baseline value for more than 1 minute. Our primary outcome was the rate-pressure product 25 minutes after cardiac recovery. Other cardiac function parameters were also recorded. Results All groups demonstrated cardiac recovery. During the recovery phase, heart rate, rate-pressure product, the maximum left ventricular pressure rise and decline in heart rate in the B120-B160 groups was significantly lower than those in the B40-B80 groups (P bupivacaine and the reversal effects of a 2% lipid emulsion showed a typical transoid S-shaped curve, R2 = 0.9983, IC50 value was 102.5 μmol/L (95% CI: 92.44 - 113.6). Conclusions There is a concentration-response relationship between the concentrations of bupivacaine and the reversal effects of 2% lipid emulsion. PMID:25089118

  2. Cadmium induces apoptosis in anterior pituitary cells that can be reversed by treatment with antioxidants

    International Nuclear Information System (INIS)

    Poliandri, Ariel H.B.; Cabilla, Jimena P.; Velardez, Miguel O.; Bodo, Cristian C.A.; Duvilanski, Beatriz H.

    2003-01-01

    Cadmium (Cd 2+ ) is an ubiquitous toxic metal that is involved in a variety of pathological conditions. Several reports indicate that Cd 2+ alters normal pituitary hormone secretion; however, little is known about the mechanisms that induce this misregulation. This paper reports the effect of Cd 2+ on anterior pituitary cell viability and its relation to prolactin secretion. Cd 2+ concentrations above 10 μM were found to be cytotoxic for pituitary cells. Morphological studies as well as DNA ladder fragmentation and caspase activation showed that Cd 2+ -treated cells undergo apoptosis. Even though several hours were needed to detect Cd 2+ -induced cytotoxicity, the effect of the metal became irreversible very quickly, requiring only 3 h of treatment. Prolactin release (measured at 48 h) was inhibited when the cells were exposed to Cd 2+ for 1 h, before any change in cell viability was observed. The antioxidants N-acetyl-cysteine and Trolox (a hydrosoluble derivative of vitamin E), but not ascorbic acid, reversed both Cd 2+ -mediated cytotoxicity and the inhibition of prolactin release, supporting the involvement of oxidative stress in the mechanism of Cd 2+ action. In summary, the present work demonstrates that Cd 2+ is cytotoxic for anterior pituitary cells, that this effect is due to an induction of apoptosis, and that it can be reversed by antioxidants

  3. Reversible photo-induced trap formation in mixed-halide hybrid perovskites for photovoltaics.

    Science.gov (United States)

    Hoke, Eric T; Slotcavage, Daniel J; Dohner, Emma R; Bowring, Andrea R; Karunadasa, Hemamala I; McGehee, Michael D

    2015-01-01

    We report on reversible, light-induced transformations in (CH 3 NH 3 )Pb(Br x I 1- x ) 3 . Photoluminescence (PL) spectra of these perovskites develop a new, red-shifted peak at 1.68 eV that grows in intensity under constant, 1-sun illumination in less than a minute. This is accompanied by an increase in sub-bandgap absorption at ∼1.7 eV, indicating the formation of luminescent trap states. Light soaking causes a splitting of X-ray diffraction (XRD) peaks, suggesting segregation into two crystalline phases. Surprisingly, these photo-induced changes are fully reversible; the XRD patterns and the PL and absorption spectra revert to their initial states after the materials are left for a few minutes in the dark. We speculate that photoexcitation may cause halide segregation into iodide-rich minority and bromide-enriched majority domains, the former acting as a recombination center trap. This instability may limit achievable voltages from some mixed-halide perovskite solar cells and could have implications for the photostability of halide perovskites used in optoelectronics.

  4. Injection-induced gluteus muscle contractures: diagnosis with the "reverse Ober test" and surgical management.

    Science.gov (United States)

    Scully, William F; White, Klane K; Song, Kit M; Mosca, Vincent S

    2015-03-01

    Adoption rates are increasing in the United States and other developed countries. A large proportion of adopted children have been found to have unsuspected medical diagnoses, including orthopedic problems. One condition, termed injection-induced gluteus maximus contracture, has been previously described in several case series and can be difficult to diagnose if unfamiliar with this condition. By reviewing the etiology and pathoanatomy of this problem, as well as the typical examination findings, including the near-pathognomonic-positive "reverse Ober test," treating providers will be better prepared to recognize and properly treat this condition. This is a retrospective review of 4 patients treated at our institution for injection-induced gluteus maximus contracture. Patient history, physical examination findings, and treatment outcomes were recorded. All had undergone surgical treatment through a longitudinal incision along the posterior margin of the iliotibial band, with division of thickened, contracted gluteus tissue down to the ischial tuberosity. All 4 of the patients were adopted from orphanages in developing countries. Chief complaints of the patients varied, but physical examination findings were very consistent. Three of the 4 patients had undergone rotational osteotomies for presumed femoral retroversion before their diagnosis and treatment for injection-induced gluteus maximus contracture. All patients had concave, atrophic buttock contours and numerous punctate buttock scars. All walked with an out-toed gait and had marked apparent femoral retroversion. Each patient was found to have full hip adduction when the hip was extended but a hip abduction contracture when the hip was flexed. This finding of increasing abduction as an extended/adducted hip is flexed to 90 degrees is described as a positive "reverse Ober test." After surgical treatment, all hips could adduct to neutral from full extension to full flexion. Although common in some countries

  5. Lactobacillus salivarius reverse diabetes-induced intestinal defense impairment in mice through non-defensin protein.

    Science.gov (United States)

    Chung, Pei-Hsuan; Wu, Ying-Ying; Chen, Pei-Hsuan; Fung, Chang-Phone; Hsu, Ching-Mei; Chen, Lee-Wei

    2016-09-01

    Altered intestinal microbiota and subsequent endotoxemia play pathogenic roles in diabetes. We aimed to study the mechanisms of intestinal defense impairment in type 1 diabetes and the effects of Lactobacillus salivarius as well as fructooligosaccharides (FOS) supplementation on diabetes-induced bacterial translocation. Alterations in the enteric microbiome, expression of mucosal antibacterial proteins and bacteria-killing activity of the intestinal mucosa in streptozotocin (STZ)-induced diabetic mice and Ins2(Akita) mice were investigated. The effects of dead L. salivarius (2×10(8)CFU/ml) and FOS (250 mg per day) supplementation for 1 week on endotoxin levels and Klebsiella pneumoniae translocation were also examined. Finally, germ-free mice were cohoused with wild-type or Ins2(Akita) mice for 2 weeks to examine the contribution of microbiota on the antibacterial protein expression. STZ-induced diabetic mice developed intestinal defense impairment as demonstrated by decreased mucosal bacteria-killing activity; reduction of non-defensin family proteins, such as Reg3β, Reg3γ, CRP-ductin and RELMβ, but not the defensin family proteins; and increased bacterial translocation. Intestinal bacteria overgrowth, enteric dysbiosis and increased intestinal bacterial translocation, particularly pathogenic K. pneumoniae in STZ-induced diabetic mice and Ins2(Akita) mice, were noted. Treating diabetic mice with dead L. salivarius or FOS reversed enteric dysbiosis, restored mucosal antibacterial protein and lessened endotoxin levels as well as K. pneumoniae translocation. Moreover, germ-free mice cohoused with wild-type mice demonstrated more intestinal Reg3β and RELMβ expression than those cohoused with Ins2(Akita) mice. These results indicate that hyperglycemia induces enteric dysbiosis, reduction of non-defensin proteins as well as bacteria-killing activity of the intestinal mucosa and intestinal defense impairment. Reversal of enteric dysbiosis with dead L. salivarius or

  6. Selective Inducible Nitric Oxide Synthase Inhibitor Reversed Zinc Chloride-Induced Spatial Memory Impairment via Increasing Cholinergic Marker Expression.

    Science.gov (United States)

    Tabrizian, Kaveh; Azami, Kian; Belaran, Maryam; Soodi, Maliheh; Abdi, Khosrou; Fanoudi, Sahar; Sanati, Mehdi; Mottaghi Dastjerdi, Negar; Soltany Rezaee-Rad, Mohammad; Sharifzadeh, Mohammad

    2016-10-01

    Zinc, an essential micronutrient and biochemical element of the human body, plays structural, catalytic, and regulatory roles in numerous physiological functions. In the current study, the effects of a pretraining oral administration of zinc chloride (10, 25, and 50 mg/kg) for 14 consecutive days and post-training bilateral intra-hippocampal infusion of 1400W as a selective inducible nitric oxide synthase (iNOS) inhibitor (10, 50, and 100 μM/side), alone and in combination, on the spatial memory retention in Morris water maze (MWM) were investigated. Animals were trained for 4 days and tested 48 h after completion of training. Also, the molecular effects of these compounds on the expression of choline acetyltransferase (ChAT), as a cholinergic marker in the CA1 region of the hippocampus and medial septal area (MSA), were evaluated. Behavioral and molecular findings of this study showed that a 2-week oral administration of zinc chloride (50 mg/kg) impaired spatial memory retention in MWM and decreased ChAT expression. Immunohistochemical analysis of post-training bilateral intra-hippocampal infusion of 1400W revealed a significant increase in ChAT immunoreactivity. Furthermore, post-training bilateral intra-hippocampal infusion of 1400W into the CA1 region of the hippocampus reversed zinc chloride-induced spatial memory impairment in MWM and significantly increased ChAT expression in comparison with zinc chloride-treated animals. Taken together, these results emphasize the role of selective iNOS inhibitors in reversing zinc chloride-induced spatial memory deficits via modulation of cholinergic marker expression.

  7. 5-HT(1A) receptor antagonism reverses and prevents fluoxetine-induced sexual dysfunction in rats.

    Science.gov (United States)

    Sukoff Rizzo, Stacey J; Pulicicchio, Claudine; Malberg, Jessica E; Andree, Terrance H; Stack, Gary P; Hughes, Zoë A; Schechter, Lee E; Rosenzweig-Lipson, Sharon

    2009-09-01

    Sexual dysfunction associated with antidepressant treatment continues to be a major compliance issue for antidepressant therapies. 5-HT(1A) antagonists have been suggested as beneficial adjunctive treatment in respect of antidepressant efficacy; however, the effects of 5-HT(1A) antagonism on antidepressant-induced side-effects has not been fully examined. The present study was conducted to evaluate the ability of acute or chronic treatment with 5-HT(1A) antagonists to alter chronic fluoxetine-induced impairments in sexual function. Chronic 14-d treatment with fluoxetine resulted in a marked reduction in the number of non-contact penile erections in sexually experienced male rats, relative to vehicle-treated controls. Acute administration of the 5-HT(1A) antagonist WAY-101405 resulted in a complete reversal of chronic fluoxetine-induced deficits on non-contact penile erections at doses that did not significantly alter baselines. Chronic co-administration of the 5-HT(1A) antagonists WAY-100635 or WAY-101405 with fluoxetine prevented fluoxetine-induced deficits in non-contact penile erections in sexually experienced male rats. Moreover, withdrawal of WAY-100635 from co-treatment with chonic fluoxetine, resulted in a time-dependent reinstatement of chronic fluoxetine-induced deficits in non-contact penile erections. Additionally, chronic administration of SSA-426, a molecule with dual activity as both a SSRI and 5-HT(1A) antagonist, did not produce deficits in non-contact penile erections at doses demonstrated to have antidepressant-like activity in the olfactory bulbectomy model. Taken together, these data suggest that 5-HT(1A) antagonist treatment may have utility for the management of SSRI-induced sexual dysfunction.

  8. Sugammadex for reversal of rocuronium-induced neuromuscular blockade in pediatric patients

    Science.gov (United States)

    Won, Young Ju; Lim, Byung Gun; Lee, Dong Kyu; Kim, Heezoo; Kong, Myoung Hoon; Lee, Il Ok

    2016-01-01

    Abstract Background: Previous studies have shown that sugammadex, a modified γ-cyclodextrin, is a well-tolerated agent for the reversal of neuromuscular blockade (NMB) induced by a steroidal neuromuscular blocking drug in adult patients. However, its use has not been reviewed in pediatric patients. The aim of this meta-analysis was to evaluate the efficacy and safety of sugammadex in the reversal of rocuronium-induced NMB during surgery under general anesthesia in pediatric patients. Methods: A literature search was performed using the Pubmed, EMBASE: Drugs and pharmacology, Cochrane Central Register of Controlled Trials, and Cochrane Database of Systematic Reviews. Analysis was conducted using RevMan 5.3. Data collected from different trials were pooled; the weighted mean difference or the pooled risk ratio and the corresponding 95% confidence interval (CI) were used for analysis, and heterogeneity (I2) assessment was performed. Results: Six randomized controlled trials comparing 253 pediatric patients (age range, 2–18 years) were included in the final analysis. The mean time taken to reach a train-of-four ratio of ≥0.9 was significantly shorter in the sugammadex groups (2 and 4 mg/kg) than in the control group (neostigmine or placebo), although the heterogeneity was high. The weighted mean differences of the 2 and 4 mg/kg sugammadex groups were −7.15 (95% CI: −10.77 to −3.54; I2 = 96%; P = 0.0001) and −17.32 (95% CI: −29.31 to −5.32; I2 = 98%; P = 0.005), respectively. The extubation time in the sugammadex group was shorter than that in the control group; the weighted mean difference of the sugammadex group was −6.00 (95% CI: −11.46 to −0.53; I2 = 99%; P = 0.03). There was no significant difference between the groups in terms of the incidence of postanesthetic adverse events; the pooled risk ratio was 0.67 (95% CI: 0.27–1.71; I2 = 59%; P = 0.41). Conclusion: We suggest that sugammadex is fast and

  9. Reversal of rocuronium-induced neuromuscular block by the selective relaxant binding agent sugammadex: a dose-finding and safety study

    DEFF Research Database (Denmark)

    Sorgenfrei, Iben F; Norrild, Kathrine; Larsen, Per Bo

    2006-01-01

    Sugammadex (Org 25969) forms a complex with steroidal neuromuscular blocking agents, thereby reversing neuromuscular block. This study investigated the dose-response relation, safety, and pharmacokinetics of sugammadex to reverse rocuronium-induced block.......Sugammadex (Org 25969) forms a complex with steroidal neuromuscular blocking agents, thereby reversing neuromuscular block. This study investigated the dose-response relation, safety, and pharmacokinetics of sugammadex to reverse rocuronium-induced block....

  10. Reversion of pH-induced physiological drug resistance: a novel function of copolymeric nanoparticles.

    Directory of Open Access Journals (Sweden)

    Rutian Li

    Full Text Available AIMS: The extracellular pH of cancer cells is lower than the intracellular pH. Weakly basic anticancer drugs will be protonated extracellularly and display a decreased intracellular concentration. In this study, we show that copolymeric nanoparticles (NPs are able to overcome this "pH-induced physiological drug resistance" (PIPDR by delivering drugs to the cancer cells via endocytosis rather than passive diffussion. MATERIALS AND METHODS: As a model nanoparticle, Tetradrine (Tet, Pka 7.80 was incorporated into mPEG-PCL. The effectiveness of free Tet and Tet-NPs were compared at different extracellular pHs (pH values 6.8 and 7.4, respectively by MTT assay, morphological observation and apoptotic analysis in vitro and on a murine model by tumor volume measurement, PET-CT scanning and side effect evaluation in vivo. RESULTS: The cytotoxicity of free Tet decreased prominently (P<0.05 when the extracellular pH decreased from 7.4 to 6.8. Meanwhile, the cytotoxicity of Tet-NPs was not significantly influenced by reduced pH. In vivo experiment also revealed that Tet-NPs reversed PIPDR more effectively than other existing methods and with much less side effects. CONCLUSION: The reversion of PIPDR is a new discovered mechanism of copolymeric NPs. This study emphasized the importance of cancer microenvironmental factors in anticancer drug resistance and revealed the superiority of nanoscale drug carrier from a different aspect.

  11. Curcumin reverses the depressive-like behavior and insulin resistance induced by chronic mild stress.

    Science.gov (United States)

    Shen, Ji-Duo; Wei, Yu; Li, Yu-Jie; Qiao, Jing-Yi; Li, Yu-Cheng

    2017-08-01

    Increasing evidence has demonstrated that patients with depression have a higher risk of developing type 2 diabetes. Insulin resistance has been identified as the key mechanism linking depression and diabetes. The present study established a rat model of depression complicated by insulin resistance using a 12-week exposure to chronic mild stress (CMS) and investigated the therapeutic effects of curcumin. Sucrose intake tests were used to evaluate depressive-like behaviors, and oral glucose tolerance tests (OGTT) and intraperitoneal insulin tolerance tests (IPITT) were performed to evaluate insulin sensitivity. Serum parameters were detected using commercial kits. Real-time quantitative PCR was used to examine mRNA expression. CMS rats exhibited reduced sucrose consumption, increased serum glucose, insulin, triglyceride (TG), low density lipoprotein-cholesterol (LDL-C), non-esterified fatty acid (NEFA), glucagon, leptin, and corticosterone levels, as well as impaired insulin sensitivity. Curcumin upregulated the phosphorylation of insulin receptor substrate (IRS)-1 and protein kinase B (Akt) in the liver, enhanced insulin sensitivity, and reversed the metabolic abnormalities and depressive-like behaviors mentioned above. Moreover, curcumin increased the hepatic glycogen content by inhibiting glycogen synthase kinase (GSK)-3β and prevented gluconeogenesis by inhibiting phosphoenolpyruvate carboxykinase (PEPCK) and glucose 6-phosphatase (G6Pase). These results suggest that curcumin not only exerted antidepressant-like effects, but also reversed the insulin resistance and metabolic abnormalities induced by CMS. These data may provide evidence to support the potential use of curcumin against depression and/or metabolic disorders.

  12. Reversible Heat-Induced Inactivation of Chimeric β-Glucuronidase in Transgenic Plants1

    Science.gov (United States)

    Almoguera, Concepción; Rojas, Anabel; Jordano, Juan

    2002-01-01

    We compared the expression patterns in transgenic tobacco (Nicotiana tabacum) of two chimeric genes: a translational fusion to β-glucuronidase (GUS) and a transcriptional fusion, both with the same promoter and 5′-flanking sequences of Ha hsp17.7 G4, a small heat shock protein (sHSP) gene from sunflower (Helianthus annuus). We found that immediately after heat shock, the induced expression from the two fusions in seedlings was similar, considering chimeric mRNA or GUS protein accumulation. Surprisingly, we discovered that the chimeric GUS protein encoded by the translational fusion was mostly inactive in such conditions. We also found that this inactivation was fully reversible. Thus, after returning to control temperature, the GUS activity was fully recovered without substantial changes in GUS protein accumulation. In contrast, we did not find differences in the in vitro heat inactivation of the respective GUS proteins. Insolubilization of the chimeric GUS protein correlated with its inactivation, as indicated by immunoprecipitation analyses. The inclusion in another chimeric gene of the 21 amino-terminal amino acids from a different sHSP lead to a comparable reversible inactivation. That effect not only illustrates unexpected post-translational problems, but may also point to sequences involved in interactions specific to sHSPs and in vivo heat stress conditions. PMID:12011363

  13. Coupled Reversible and Irreversible Bistable Switches Underlying TGFβ-induced Epithelial to Mesenchymal Transition

    Science.gov (United States)

    Tian, Xiao-Jun; Zhang, Hang; Xing, Jianhua

    2013-01-01

    Epithelial to mesenchymal transition (EMT) plays an important role in embryonic development, tissue regeneration, and cancer metastasis. Whereas several feedback loops have been shown to regulate EMT, it remains elusive how they coordinately modulate EMT response to TGF-β treatment. We construct a mathematical model for the core regulatory network controlling TGF-β-induced EMT. Through deterministic analyses and stochastic simulations, we show that EMT is a sequential two-step program in which an epithelial cell first is converted to partial EMT then to the mesenchymal state, depending on the strength and duration of TGF-β stimulation. Mechanistically the system is governed by coupled reversible and irreversible bistable switches. The SNAIL1/miR-34 double-negative feedback loop is responsible for the reversible switch and regulates the initiation of EMT, whereas the ZEB/miR-200 feedback loop is accountable for the irreversible switch and controls the establishment of the mesenchymal state. Furthermore, an autocrine TGF-β/miR-200 feedback loop makes the second switch irreversible, modulating the maintenance of EMT. Such coupled bistable switches are robust to parameter variation and molecular noise. We provide a mechanistic explanation on multiple experimental observations. The model makes several explicit predictions on hysteretic dynamic behaviors, system response to pulsed stimulation, and various perturbations, which can be straightforwardly tested. PMID:23972859

  14. Surviving bacterial sibling rivalry: inducible and reversible phenotypic switching in Paenibacillus dendritiformis.

    Science.gov (United States)

    Be'er, Avraham; Florin, E-L; Fisher, Carolyn R; Swinney, Harry L; Payne, Shelley M

    2011-01-01

    Natural habitats vary in available nutrients and room for bacteria to grow, but successful colonization can lead to overcrowding and stress. Here we show that competing sibling colonies of Paenibacillus dendritiformis bacteria survive overcrowding by switching between two distinct vegetative phenotypes, motile rods and immotile cocci. Growing colonies of the rod-shaped bacteria produce a toxic protein, Slf, which kills cells of encroaching sibling colonies. However, sublethal concentrations of Slf induce some of the rods to switch to Slf-resistant cocci, which have distinct metabolic and resistance profiles, including resistance to cell wall antibiotics. Unlike dormant spores of P. dendritiformis, the cocci replicate. If cocci encounter conditions that favor rods, they secrete a signaling molecule that induces a switch to rods. Thus, in contrast to persister cells, P. dendritiformis bacteria adapt to changing environmental conditions by inducible and reversible phenotypic switching. In favorable environments, species may face space and nutrient limits due to overcrowding. Bacteria provide an excellent model for analyzing principles underlying overcrowding and regulation of density in nature, since their population dynamics can be easily and accurately assessed under controlled conditions. We describe a newly discovered mechanism for survival of a bacterial population during overcrowding. When competing with sibling colonies, Paenibacillus dendritiformis produces a lethal protein (Slf) that kills cells at the interface of encroaching colonies. Slf also induces a small proportion of the cells to switch from motile, rod-shaped cells to nonmotile, Slf-resistant, vegetative cocci. When crowding is reduced and nutrients are no longer limiting, the bacteria produce a signal that induces cocci to switch back to motile rods, allowing the population to spread. Genes encoding components of this phenotypic switching pathway are widespread among bacterial species, suggesting

  15. Induced Pluripotent Stem Cell Models of Progranulin-Deficient Frontotemporal Dementia Uncover Specific Reversible Neuronal Defects

    Directory of Open Access Journals (Sweden)

    Sandra Almeida

    2012-10-01

    Full Text Available The pathogenic mechanisms of frontotemporal dementia (FTD remain poorly understood. Here we generated multiple induced pluripotent stem cell lines from a control subject, a patient with sporadic FTD, and an FTD patient with a novel heterozygous GRN mutation (progranulin [PGRN] S116X. In neurons and microglia differentiated from PGRN S116X induced pluripotent stem cells, the levels of intracellular and secreted PGRN were reduced, establishing patient-specific cellular models of PGRN haploinsufficiency. Through a systematic screen of inducers of cellular stress, we found that PGRN S116X neurons, but not sporadic FTD neurons, exhibited increased sensitivity to staurosporine and other kinase inhibitors. Moreover, the serine/threonine kinase S6K2, a component of the phosphatidylinositol 3-kinase and mitogen-activated protein kinase pathways, was specifically downregulated in PGRN S116X neurons. Both increased sensitivity to kinase inhibitors and reduced S6K2 were rescued by PGRN expression. Our findings identify cell-autonomous, reversible defects in patient neurons with PGRN deficiency, and provide a compelling model for studying PGRN-dependent pathogenic mechanisms and testing potential therapies.

  16. Hall magnetohydrodynamics simulations of end-shorting induced rotation in field-reversed configurations

    International Nuclear Information System (INIS)

    Macnab, A. I. D.; Milroy, R. D.; Kim, C. C.; Sovinec, C. R.

    2007-01-01

    End-shorting of the open field lines that surround a field-reversed configuration (FRC) is believed to contribute to its observed rotation. In this study, nonlinear extended magnetohydrodynamics (MHD) simulations were performed that detail the end-shorting process and the resulting spin-up of the FRC. The tangential component of the electric field E T is set to zero at the axial boundaries in an extended MHD model that includes the Hall and ∇P e terms. This shorting of the electric field leads to the generation of toroidal fields on the open field lines, which apply a torque leading to a rotation of the ions on the open field lines. The FRC then gains angular momentum through a viscous transfer from the open field line region. In addition, it is shown that spin-up is still induced when insulating boundaries are assumed

  17. Strategies for reversing the effects of metabolic disorders induced as a consequence of developmental programming

    Directory of Open Access Journals (Sweden)

    Mark H Vickers

    2012-07-01

    Full Text Available Obesity and the metabolic syndrome have reached epidemic proportions worldwide with far-reaching health care and economic implications. The rapid increase in the prevalence of these disorders suggests that environmental and behavioural influences, rather than genetic causes, are fuelling the epidemic. The developmental origins of health and disease hypothesis has highlighted the link between the periconceptual, fetal and early infant phases of life and the subsequent development of metabolic disorders in later life. In particular, the impact of poor maternal nutrition on susceptibility to later life metabolic disease in offspring is now well documented. Several studies have now shown, at least in experimental animal models, that some components of the metabolic syndrome, induced as a consequence of developmental programming, are potentially reversible by nutritional or targeted therapeutic interventions during windows of developmental plasticity. This review will focus on critical windows of development and possible therapeutic avenues that may reduce metabolic and obesogenic risk following an adverse early life environment.

  18. HDAC inhibition induces HIV-1 protein and enables immune-based clearance following latency reversal

    DEFF Research Database (Denmark)

    Wu, Guoxin; Swanson, Michael; Talla, Aarthi

    2017-01-01

    Promising therapeutic approaches for eradicating HIV include transcriptional activation of provirus from latently infected cells using latency-reversing agents (LRAs) and immune-mediated clearance to purge reservoirs. Accurate detection of cells capable of producing viral antigens and virions......, and the measurement of clearance of infected cells, is essential to assessing therapeutic efficacy. Here, we apply enhanced methodology extending the sensitivity limits for the rapid detection of subfemtomolar HIV gag p24 capsid protein in CD4+ T cells from ART-suppressed HIV+ individuals, and we show viral protein...... induction following treatment with LRAs. Importantly, we demonstrate that clinical administration of histone deacetylase inhibitors (HDACis; vorinostat and panobinostat) induced HIV gag p24, and ex vivo stimulation produced sufficient viral antigen to elicit immune-mediated cell killing using anti-gp120/CD3...

  19. Targeted reversion of induced pluripotent stem cells from patients with human cleidocranial dysplasia improves bone regeneration in a rat calvarial bone defect model.

    Science.gov (United States)

    Saito, Akiko; Ooki, Akio; Nakamura, Takashi; Onodera, Shoko; Hayashi, Kamichika; Hasegawa, Daigo; Okudaira, Takahito; Watanabe, Katsuhito; Kato, Hiroshi; Onda, Takeshi; Watanabe, Akira; Kosaki, Kenjiro; Nishimura, Ken; Ohtaka, Manami; Nakanishi, Mahito; Sakamoto, Teruo; Yamaguchi, Akira; Sueishi, Kenji; Azuma, Toshifumi

    2018-01-22

    Runt-related transcription factor 2 (RUNX2) haploinsufficiency causes cleidocranial dysplasia (CCD) which is characterized by supernumerary teeth, short stature, clavicular dysplasia, and osteoporosis. At present, as a therapeutic strategy for osteoporosis, mesenchymal stem cell (MSC) transplantation therapy is performed in addition to drug therapy. However, MSC-based therapy for osteoporosis in CCD patients is difficult due to a reduction in the ability of MSCs to differentiate into osteoblasts resulting from impaired RUNX2 function. Here, we investigated whether induced pluripotent stem cells (iPSCs) properly differentiate into osteoblasts after repairing the RUNX2 mutation in iPSCs derived from CCD patients to establish normal iPSCs, and whether engraftment of osteoblasts derived from properly reverted iPSCs results in better regeneration in immunodeficient rat calvarial bone defect models. Two cases of CCD patient-derived induced pluripotent stem cells (CCD-iPSCs) were generated using retroviral vectors (OCT3/4, SOX2, KLF4, and c-MYC) or a Sendai virus SeVdp vector (KOSM302L). Reverted iPSCs were established using programmable nucleases, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas-derived RNA-guided endonucleases, to correct mutations in CCD-iPSCs. The mRNA expressions of osteoblast-specific markers were analyzed using quantitative reverse-transcriptase polymerase chain reaction. iPSCs-derived osteoblasts were transplanted into rat calvarial bone defects, and bone regeneration was evaluated using microcomputed tomography analysis and histological analysis. Mutation analysis showed that both contained nonsense mutations: one at the very beginning of exon 1 and the other at the initial position of the nuclear matrix-targeting signal. The osteoblasts derived from CCD-iPSCs (CCD-OBs) expressed low levels of several osteoblast differentiation markers, and transplantation of these osteoblasts into calvarial bone defects created in rats with

  20. Sulforaphane reverses glucocorticoid-induced apoptosis in osteoblastic cells through regulation of the Nrf2 pathway

    Directory of Open Access Journals (Sweden)

    Lin H

    2014-07-01

    Full Text Available Hao Lin,1,* Bo Wei,1,* Guangsheng Li,1 Jinchang Zheng,1 Jiecong Sun,1 Jiaqi Chu,2 Rong Zeng,1 Yanru Niu21Department of Spinal Surgery, Affiliated Hospital of Guangdong Medical College, Zhanjiang, People’s Republic of China; 2Laboratory Institute of Minimally Invasive Orthopedic Surgery, Affiliated Hospital of Guangdong Medical College, Zhanjiang, People’s Republic of China *These authors contributed equally to this work Abstract: Apoptosis of osteoblasts triggered by high-dose glucocorticoids (GCs has been identified as a major cause of osteoporosis. However, the underlying molecular mechanisms accounting for this action remain elusive, which has impeded the prevention and cure of this side effect. Sulforaphane (SFP is a naturally occurring isothiocyanate that has huge health benefits for humans. In this study, by using osteoblastic MC3T3-E1 cells as a model, we demonstrate the protective effects of SFP against dexamethasone (Dex-induced apoptosis and elucidate the underlying molecular mechanisms. The results show that SFP could effectively inhibit the Dex-induced growth inhibition and release of lactate dehydrogenase in MC3T3-E1 cells. Treatment with Dex induced caspase-dependent apoptosis in MC3T3-E1 cells, as evidenced by an increase in the Sub-G1 phase, chromatin condensation, and deoxyribonucleic acid fragmentation, which were significantly suppressed by coincubation with SFP. Mitochondria-mediated apoptosis pathway contributed importantly to Dex-induced apoptosis, as revealed by the activation of caspase-3/-9 and subsequent cleavage of poly adenosine diphosphate ribose polymerase, which was also effectively blocked by SFP. Moreover, treatments of Dex strongly induced overproduction of reactive oxygen species and inhibited the expression of nuclear factor erythroid 2-related factor 2 (Nrf2 and the downstream effectors HO1 and NQO1. However, cotreatment with SFP effectively reversed this action of Dex. Furthermore, silencing of Nrf2 by

  1. D-cycloserine in prelimbic cortex reverses scopolamine-induced deficits in olfactory memory in rats.

    Directory of Open Access Journals (Sweden)

    Marta Portero-Tresserra

    Full Text Available A significant interaction between N-methyl-D-aspartate (NMDA and muscarinic receptors has been suggested in the modulation of learning and memory processes. The present study further investigates this issue and explores whether d-cycloserine (DCS, a partial agonist at the glycine binding site of the NMDA receptors that has been regarded as a cognitive enhancer, would reverse scopolamine (SCOP-induced amnesia in two olfactory learning tasks when administered into the prelimbic cortex (PLC. Thus, in experiment 1, DCS (10 µg/site was infused prior to acquisition of odor discrimination (ODT and social transmission of food preference (STFP, which have been previously characterized as paradigms sensitive to PLC muscarinic blockade. Immediately after learning such tasks, SCOP was injected (20 µg/site and the effects of both drugs (alone and combined were tested in 24-h retention tests. To assess whether DCS effects may depend on the difficulty of the task, in the STFP the rats expressed their food preference either in a standard two-choice test (experiment 1 or a more challenging three-choice test (experiment 2. The results showed that bilateral intra-PLC infusions of SCOP markedly disrupted the ODT and STFP memory tests. Additionally, infusions of DCS alone into the PLC enhanced ODT but not STFP retention. However, the DCS treatment reversed SCOP-induced memory deficits in both tasks, and this effect seemed more apparent in ODT and 3-choice STFP. Such results support the interaction between the glutamatergic and the cholinergic systems in the PLC in such a way that positive modulation of the NMDA receptor/channel, through activation of the glycine binding site, may compensate dysfunction of muscarinic neurotransmission involved in stimulus-reward and relational learning tasks.

  2. D-cycloserine in prelimbic cortex reverses scopolamine-induced deficits in olfactory memory in rats.

    Science.gov (United States)

    Portero-Tresserra, Marta; Cristóbal-Narváez, Paula; Martí-Nicolovius, Margarita; Guillazo-Blanch, Gemma; Vale-Martínez, Anna

    2013-01-01

    A significant interaction between N-methyl-D-aspartate (NMDA) and muscarinic receptors has been suggested in the modulation of learning and memory processes. The present study further investigates this issue and explores whether d-cycloserine (DCS), a partial agonist at the glycine binding site of the NMDA receptors that has been regarded as a cognitive enhancer, would reverse scopolamine (SCOP)-induced amnesia in two olfactory learning tasks when administered into the prelimbic cortex (PLC). Thus, in experiment 1, DCS (10 µg/site) was infused prior to acquisition of odor discrimination (ODT) and social transmission of food preference (STFP), which have been previously characterized as paradigms sensitive to PLC muscarinic blockade. Immediately after learning such tasks, SCOP was injected (20 µg/site) and the effects of both drugs (alone and combined) were tested in 24-h retention tests. To assess whether DCS effects may depend on the difficulty of the task, in the STFP the rats expressed their food preference either in a standard two-choice test (experiment 1) or a more challenging three-choice test (experiment 2). The results showed that bilateral intra-PLC infusions of SCOP markedly disrupted the ODT and STFP memory tests. Additionally, infusions of DCS alone into the PLC enhanced ODT but not STFP retention. However, the DCS treatment reversed SCOP-induced memory deficits in both tasks, and this effect seemed more apparent in ODT and 3-choice STFP. Such results support the interaction between the glutamatergic and the cholinergic systems in the PLC in such a way that positive modulation of the NMDA receptor/channel, through activation of the glycine binding site, may compensate dysfunction of muscarinic neurotransmission involved in stimulus-reward and relational learning tasks.

  3. Selective activation of M4 muscarinic acetylcholine receptors reverses MK-801-induced behavioral impairments and enhances associative learning in rodents

    DEFF Research Database (Denmark)

    Bubser, Michael; Bridges, Thomas M; Dencker, Ditte

    2014-01-01

    PAMs, enabling a more extensive characterization of M4 actions in rodent models. We used VU0467154 to test the hypothesis that selective potentiation of M4 receptor signaling could ameliorate the behavioral, cognitive, and neurochemical impairments induced by the noncompetitive NMDAR antagonist MK-801....... VU0467154 produced a robust dose-dependent reversal of MK-801-induced hyperlocomotion and deficits in preclinical models of associative learning and memory functions, including the touchscreen pairwise visual discrimination task in wild-type mice, but failed to reverse these stimulant...

  4. Bacterial lipoprotein-induced tolerance is reversed by overexpression of IRAK-1.

    LENUS (Irish Health Repository)

    Li, Chong Hui

    2012-03-01

    Tolerance to bacterial cell wall components including bacterial lipoprotein (BLP) represents an essential regulatory mechanism during bacterial infection. Reduced Toll-like receptor 2 (TLR2) and IL-1 receptor-associated kinase 1 (IRAK-1) expression is a characteristic of the downregulated TLR signaling pathway observed in BLP-tolerised cells. In this study, we attempted to clarify whether TLR2 and\\/or IRAK-1 are the key molecules responsible for BLP-induced tolerance. Transfection of HEK293 cells and THP-1 cells with the plasmid encoding TLR2 affected neither BLP tolerisation-induced NF-κB deactivation nor BLP tolerisation-attenuated pro-inflammatory cytokine tumor necrosis factor alpha (TNF-α) production, indicating that BLP tolerance develops despite overexpression of TLR2 in these cells. In contrast, overexpression of IRAK-1 reversed BLP-induced tolerance, as transfection of IRAK-1 expressing vector resulted in a dose-dependent NF-κB activation and TNF-α release in BLP-tolerised cells. Furthermore, BLP-tolerised cells exhibited markedly repressed NF-κB p65 phosphorylation and impaired binding of p65 to several pro-inflammatory cytokine gene promoters including TNF-α and interleukin-6 (IL-6). Overexpression of IRAK-1 restored the nuclear transactivation of p65 at both TNF-α and IL-6 promoters. These results indicate a crucial role for IRAK-1 in BLP-induced tolerance, and suggest IRAK-1 as a potential target for manipulation of the TLR-mediated inflammatory response during microbial sepsis.

  5. Reversible and irreversible vascular bioeffects induced by ultrasound and microbubbles in chorioallantoic membrane model

    Science.gov (United States)

    Tarapacki, Christine; Kuebler, Wolfgang M.; Tabuchi, Arata; Karshafian, Raffi

    2017-03-01

    Background: The application of ultrasound and microbubbles at therapeutic conditions has been shown to improve delivery of molecules, cause vasoconstriction, modulate blood flow and induce a vascular shut down in in vivo cancerous tissues. The underlying mechanism has been associated with the interaction of ultrasonically-induced microbubble oscillation and cavitation with the blood vessel wall. In this study, the effect of ultrasound and microbubbles on blood flow and vascular architecture was studied using a fertilized chicken egg CAM (chorioallantoic membrane) model. Methods: CAM at day 12 of incubation (Hamburger-Hamilton stage 38-40) were exposed to ultrasound at varying acoustic pressures (160, 240 and 320 kPa peak negative pressure) in the presence of Definity microbubbles and 70 kDa FITC dextran fluorescent molecules. A volume of 50 µL Definity microbubbles were injected into a large anterior vein of the CAM prior to ultrasound exposure. The ultrasound treatment sequence consisted of 5 s exposure at 500 kHz frequency, 8 cycles and 1 kHz pulse repetition frequency with 5 s off for a total exposure of 2 minutes. Fluorescent videos and images of the CAM vasculature were acquired using intravital microscopy prior, during and following the ultrasound exposure. Perfusion was quantified by measuring the length of capillaries in a region of interest using Adobe Illustrator. Results and Discussion: The vascular bioeffects induced by USMB increased with acoustic peak negative pressure. At 160 kPa, no visible differences were observed compared to the control. At 240 kPa, a transient decrease in perfusion with subsequent recovery within 15 minutes was observed, whereas at 320 kPa, the fluorescent images showed an irreversible vascular damage. The study indicates that a potential mechanism for the transient decrease in perfusion may be related to blood coagulation. The results suggest that ultrasound and microbubbles can induce reversible and irreversible vascular

  6. Progressive myopia or hyperopia can be induced in chicks and reversed by manipulation of the chromaticity of ambient light.

    Science.gov (United States)

    Foulds, Wallace S; Barathi, Veluchamy A; Luu, Chi D

    2013-12-09

    To determine whether progressive ametropia can be induced in chicks and reversed by manipulation of the chromaticity of ambient light. One-day-old chicks were raised in red light (90% red, 10% yellow-green) or in blue light (85% blue, 15% green) with a 12 hour on/off cycle for 14 to 42 days. Refraction was determined by streak retinoscopy, and by automated infrared photoretinoscopy and ocular biometry by A-scan ultrasonography. Red light induced progressive myopia (mean refraction ± SD at 28 days, -2.83 ± 0.25 diopters [D]). Progressive hyperopia was induced by blue light (mean refraction at 28 days, +4.55 ± 0.21 D). The difference in refraction between the groups was highly significant at P light (-2.21 ± 0.21 D) was reversed to hyperopia (+2.50 ± 0.29 D) by subsequent 21 days of blue light. Hyperopia induced by 21 days of blue light (+4.21 ± 0.19 D) was reversed to myopia (-1.23 ± 0.12 D) by 21 days of red light. Rearing chicks in red light caused progressive myopia, while rearing in blue light caused progressive hyperopia. Light-induced myopia or hyperopia in chicks can be reversed to hyperopia or myopia, respectively, by an alteration in the chromaticity of ambient light. Manipulation of chromaticity may be applicable to the management of human childhood myopia.

  7. Induced Pluripotent Stem Cell Models of Progranulin-Deficient Frontotemporal Dementia Uncover Specific Reversible Neuronal Defects

    Science.gov (United States)

    Almeida, Sandra; Zhang, Zhijun; Coppola, Giovanni; Mao, Wenjie; Futai, Kensuke; Karydas, Anna; Geschwind, Michael D.; Tartaglia, M. Carmela; Gao, Fuying; Gianni, Davide; Sena-Esteves, Miguel; Geschwind, Daniel H.; Miller, Bruce L.; Farese, Robert V.; Gao, Fen-Biao

    2012-01-01

    SUMMARY The pathogenic mechanisms of frontotemporal dementia (FTD) remain poorly understood. Here we generated multiple induced pluripotent stem cell (iPSC) lines from a control subject, a patient with sporadic FTD, and an FTD patient with a novel GRN mutation (PGRN S116X). In neurons and microglia differentiated from PGRN S116X iPSCs, the levels of intracellular and secreted progranulin were reduced, establishing patient-specific cellular models of progranulin haploinsufficiency. Through a systematic screen of inducers of cellular stress, we found that PGRN S116X neurons, but not sporadic FTD neurons, exhibited increased sensitivity to staurosporine and other kinase inhibitors. Moreover, the serine/threonine kinase S6K2, a component of the PI3K and MAPK pathways, was specifically downregulated in PGRN S116X neurons. Both increased sensitivity to kinase inhibitors and reduced S6K2 were rescued by progranulin expression. Our findings identify cell-autonomous, reversible defects in patient neurons with progranulin deficiency and provide a new model for studying progranulin-dependent pathogenic mechanisms and testing potential therapies. PMID:23063362

  8. Liver fibrosis in mice induced by carbon tetrachloride and its reversion by luteolin

    International Nuclear Information System (INIS)

    Domitrovic, Robert; Jakovac, Hrvoje; Tomac, Jelena; Sain, Ivana

    2009-01-01

    Hepatic fibrosis is effusive wound healing process in which excessive connective tissue builds up in the liver. Because specific treatments to stop progressive fibrosis of the liver are not available, we have investigated the effects of luteolin on carbon tetrachloride (CCl 4 )-induced hepatic fibrosis. Male Balb/C mice were treated with CCl 4 (0.4 ml/kg) intraperitoneally (i.p.), twice a week for 6 weeks. Luteolin was administered i.p. once daily for next 2 weeks, in doses of 10, 25, and 50 mg/kg of body weight. The CCl 4 control group has been observed for spontaneous reversion of fibrosis. CCl 4 -intoxication increased serum aminotransferase and alkaline phosphatase levels and disturbed hepatic antioxidative status. Most of these parameters were spontaneously normalized in the CCl 4 control group, although the progression of liver fibrosis was observed histologically. Luteolin treatment has increased hepatic matrix metalloproteinase-9 levels and metallothionein (MT) I/II expression, eliminated fibrinous deposits and restored architecture of the liver in a dose-dependent manner. Concomitantly, the expression of glial fibrillary acidic protein and α-smooth muscle actin indicated deactivation of hepatic stellate cells. Our results suggest the therapeutic effects of luteolin on CCl 4 -induced liver fibrosis by promoting extracellular matrix degradation in the fibrotic liver tissue and the strong enhancement of hepatic regenerative capability, with MTs as a critical mediator of liver regeneration.

  9. Reversal of reflex pulmonary vasoconstriction induced by main pulmonary arterial distension.

    Science.gov (United States)

    Juratsch, C E; Grover, R F; Rose, C E; Reeves, J T; Walby, W F; Laks, M M

    1985-04-01

    Distension of the main pulmonary artery (MPA) induces pulmonary hypertension, most probably by neurogenic reflex pulmonary vasoconstriction, although constriction of the pulmonary vessels has not actually been demonstrated. In previous studies in dogs with increased pulmonary vascular resistance produced by airway hypoxia, exogenous arachidonic acid has led to the production of pulmonary vasodilator prostaglandins. Hence, in the present study, we investigated the effect of arachidonic acid in seven intact anesthetized dogs after pulmonary vascular resistance was increased by MPA distention. After steady-state pulmonary hypertension was established, arachidonic acid (1.0 mg/min) was infused into the right ventricle for 16 min; 15-20 min later a 16-mg bolus of arachidonic acid was injected. MPA distension was maintained throughout the study. Although the infusion of arachidonic acid significantly lowered the elevated pulmonary vascular resistance induced by MPA distension, the pulmonary vascular resistance returned to control levels only after the bolus injection of arachidonic acid. Notably, the bolus injection caused a biphasic response which first increased the pulmonary vascular resistance transiently before lowering it to control levels. In dogs with resting levels of pulmonary vascular resistance, administration of arachidonic acid in the same manner did not alter the pulmonary vascular resistance. It is concluded that MPA distension does indeed cause reflex pulmonary vasoconstriction which can be reversed by vasodilator metabolites of arachidonic acid. Even though this reflex may help maintain high pulmonary vascular resistance in the fetus, its function in the adult is obscure.

  10. Gabapentin reverses central pain sensitization following a collagenase-induced intrathalamic hemorrhage in rats

    Directory of Open Access Journals (Sweden)

    Castel A

    2013-12-01

    Full Text Available Aude Castel, Pascal VachonFaculty of Veterinary Medicine, Department of Veterinary Biomedicine, University of Montreal, Saint-Hyacinthe, QC, CanadaPurpose: The treatment of central neuropathic pain remains amongst the biggest challenges for pain specialists. The main objective of this study was to assess gabapentin (GBP, amitriptyline (AMI, and carbamazepine (CARBA for the treatment of a rodent central neuropathic pain model.Methods: Male Sprague Dawley rats were trained on the rotarod, Hargreaves, Von Frey and acetone behavioral tests, and baseline values were obtained prior to surgery. A stereotaxic injection of either a collagenase solution or saline was made in the right ventral posterolateral thalamic nucleus. The rats were tested on days 2, 4, 8, and 11 postsurgery. They were retested at regular intervals from day 15 to day 25 postsurgery, after oral administration of either the vehicle (n=7 and n=8 rats with intracerebral injections of collagenase and saline, respectively or the different drugs (GBP [60 mg/kg], AMI [10 mg/kg], CARBA [100 mg/kg]; n=8 rats/drug.Results: A significant decrease in the mechanical thresholds and no change in heat threshold were observed in both hind limbs in the collagenase group, as we had previously shown elsewhere. Reversal of the mechanical hypersensitivity was achieved only with GBP (P<0.05. AMI and CARBA, at the dosages used, failed to show any effect on mechanical thresholds. Transient cold allodynia was observed in some collagenase-injected rats but failed to be statistically significant.Conclusion: Intrathalamic hemorrhaging in the ventrolateral thalamic nucleus induced a bilateral mechanical allodynia, which was reversed by GBP but not AMI or CARBA.Keywords: central pain, thalamus, amitriptyline, carbamazepine

  11. Reversibility of ecstasy-induced reduction in serotonin transporter availability in polydrug ecstasy users

    International Nuclear Information System (INIS)

    Buchert, Ralph; Wilke, Florian; Nebeling, Bruno; Clausen, Malte; Thomasius, Rainer; Petersen, Kay; Obrocki, Jost; Wartberg, Lutz; Zapletalova, Pavlina

    2006-01-01

    Animal data suggest that the synthetic drug ecstasy may damage brain serotonin neurons. Previously we reported protracted reductions in the availability of the serotonin transporter (SERT), an index of integrity of the axon terminals of brain serotonergic neurons, in SERT-rich brain regions in current human ecstasy users. Comparison of current ecstasy users and former ecstasy users yielded some evidence that this reduction might be reversible. However, participant selection effects could not be ruled out. Therefore, follow-up examinations were performed in these subjects to test the following a priori hypothesis in a prospective longitudinal design that eliminates participant selection effects to a large extent: availability of the SERT increases towards normal levels when ecstasy use is stopped, and remains unchanged or is further decreased if use is continued. Two follow-up positron emission tomography measurements using the SERT ligand [ 11 C](+)McN5652 were completed by 15 current and nine former ecstasy users. All subjects used illicit drugs other than ecstasy, too. The time interval between repeated measurements was about 1 year. The time course of the availability of the SERT was analysed in the following SERT-rich regions: mesencephalon, putamen, caudate and thalamus. Current ecstasy users showed a consistent increase in the availability of the SERT in the mesencephalon during the study (Friedman test: p=0.010), which most likely was caused by a decrease in the intensity of ecstasy consumption (Spearman correlation coefficient -0.725, p=0.002). Former ecstasy users showed a consistent increase in SERT availability in the thalamus (Friedman test: p=0.006). Ecstasy-induced protracted alterations in the availability of the SERT might be reversible. (orig.)

  12. Reversibility of ecstasy-induced reduction in serotonin transporter availability in polydrug ecstasy users

    Energy Technology Data Exchange (ETDEWEB)

    Buchert, Ralph; Wilke, Florian; Nebeling, Bruno; Clausen, Malte [University Medical Center Hamburg-Eppendorf, Department of Nuclear Medicine, Hamburg (Germany); Thomasius, Rainer; Petersen, Kay; Obrocki, Jost; Wartberg, Lutz; Zapletalova, Pavlina [University Medical Center Hamburg-Eppendorf, Departments of Psychiatry and Psychotherapy, Hamburg (Germany)

    2006-02-01

    Animal data suggest that the synthetic drug ecstasy may damage brain serotonin neurons. Previously we reported protracted reductions in the availability of the serotonin transporter (SERT), an index of integrity of the axon terminals of brain serotonergic neurons, in SERT-rich brain regions in current human ecstasy users. Comparison of current ecstasy users and former ecstasy users yielded some evidence that this reduction might be reversible. However, participant selection effects could not be ruled out. Therefore, follow-up examinations were performed in these subjects to test the following a priori hypothesis in a prospective longitudinal design that eliminates participant selection effects to a large extent: availability of the SERT increases towards normal levels when ecstasy use is stopped, and remains unchanged or is further decreased if use is continued. Two follow-up positron emission tomography measurements using the SERT ligand [{sup 11}C](+)McN5652 were completed by 15 current and nine former ecstasy users. All subjects used illicit drugs other than ecstasy, too. The time interval between repeated measurements was about 1 year. The time course of the availability of the SERT was analysed in the following SERT-rich regions: mesencephalon, putamen, caudate and thalamus. Current ecstasy users showed a consistent increase in the availability of the SERT in the mesencephalon during the study (Friedman test: p=0.010), which most likely was caused by a decrease in the intensity of ecstasy consumption (Spearman correlation coefficient -0.725, p=0.002). Former ecstasy users showed a consistent increase in SERT availability in the thalamus (Friedman test: p=0.006). Ecstasy-induced protracted alterations in the availability of the SERT might be reversible. (orig.)

  13. Comparison of neostigmine induced reversal of vecuronium in normal weight, overweight and obese female patients

    Directory of Open Access Journals (Sweden)

    Shilpa Bhimasen Joshi

    2015-01-01

    Full Text Available Background and Aims: Obese patients are more vulnerable to residual neuromuscular block (NMB and its associated complications in the post-operative period. This study was carried out to compare neostigmine induced reversal of vecuronium in normal weight, overweight and obese female patients, objectively using neuromuscular (NM monitoring. Methods: Twenty female patients each belonging to normal weight, overweight and obese, based on body mass index, requiring general anaesthesia were recruited for this prospective cross sectional study. NMB was induced with vecuronium (0.1 mg/kg dose based on patient′s real body weight (RBW and monitored using acceleromyographic train of four (TOF. All patients received neostigmine 40 μg/kg and glycopyrrolate 10 μg/kg at 25% of spontaneous recovery of first twitch height (T1 of TOF (DUR 25% and were allowed to recover to TOF ratio of 0.9. Statistical analysis was done using analysis of variance test. Results: Recovery of TOF ratio to 0.5 was comparable in all three groups. Recovery of TOF ratio to 0.7 was delayed in obese (9.82 ± 3.21 min compared with normal weight group (7.50 ± 2.52 min. Recovery of TOF to 0.9 was significantly delayed in both overweight (12.18 ± 4.29 min and obese patients (13.78 ± 4.30 min. DUR 25% was significantly longer in overweight (mean, standard deviation [range]; 30.10 [19-40 min] and obese (28.8 [12-45 min] compared with normal weight patients (22.75 [16-30 min]. Conclusion: In overweight and obese patients, when vecuronium induction dose is based on RBW, neostigmine induced recovery of NMB is delayed in late phases (TOF 0.7-0.9, which may result in vulnerability for associated complications of incomplete recovery. Ensuring safe recovery thus requires objective NM monitoring.

  14. Reverse electron flow-induced ROS production is attenuated by activation of mitochondrial Ca2+-sensitive K+ channels

    NARCIS (Netherlands)

    Heinen, André; Aldakkak, Mohammed; Stowe, David F.; Rhodes, Samhita S.; Riess, Matthias L.; Varadarajan, Srinivasan G.; Camara, Amadou K. S.

    2007-01-01

    Mitochondria generate reactive oxygen species (ROS) dependent on substrate conditions, O(2) concentration, redox state, and activity of the mitochondrial complexes. It is well known that the FADH(2)-linked substrate succinate induces reverse electron flow to complex I of the electron transport chain

  15. AMPK Activation Prevents and Reverses Drug-Induced Mitochondrial and Hepatocyte Injury by Promoting Mitochondrial Fusion and Function.

    Directory of Open Access Journals (Sweden)

    Sun Woo Sophie Kang

    Full Text Available Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK. When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury.

  16. AMPK Activation Prevents and Reverses Drug-Induced Mitochondrial and Hepatocyte Injury by Promoting Mitochondrial Fusion and Function

    Science.gov (United States)

    Taniane, Caitlin; Farrell, Geoffrey; Arias, Irwin M.; Lippincott-Schwartz, Jennifer; Fu, Dong

    2016-01-01

    Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK). When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury. PMID:27792760

  17. Pressure-induced reversal between thermal contraction and expansion in ferroelectric PbTiO3.

    Science.gov (United States)

    Zhu, Jinlong; Zhang, Jianzhong; Xu, Hongwu; Vogel, Sven C; Jin, Changqing; Frantti, Johannes; Zhao, Yusheng

    2014-01-15

    Materials with zero/near zero thermal expansion coefficients are technologically important for applications in thermal management and engineering. To date, this class of materials can only be produced by chemical routes, either by changing chemical compositions or by composting materials with positive and negative thermal expansion. Here, we report for the first time a physical route to achieve near zero thermal expansion through application of pressure. In the stability field of tetragonal PbTiO3 we observed pressure-induced reversals between thermal contraction and expansion between ambient pressure and 0.9 GPa. This hybrid behavior leads to a mathematically infinite number of crossover points in the pressure-volume-temperature space and near-zero thermal expansion coefficients comparable to or even smaller than those attained by chemical routes. The observed pressures for this unusual phenomenon are within a small range of 0.1-0.9 GPa, potentially feasible for designing stress-engineered materials, such as thin films and nano-crystals, for thermal management applications.

  18. Sugammadex reversal of rocuronium-induced neuromuscular block in a patient with ataxia-telangiectasia

    International Nuclear Information System (INIS)

    Kang, E.; Jung, J.W.

    2015-01-01

    A 17-year-old adolescent with ataxia-telangiectasia was scheduled to have laparoscopic colectomy for a resection of colon cancer. He had symptoms and signs of dyspnea, generalized dystonia, dysmetria, ataxia, and telangiectasia on the orbit. General anesthesia was performed, and rocuronium 30 mg was administered for muscle relaxation. Deep neuromuscular block (post-tetanic count: 0-8) was maintained for 95 minutes without additional rocuronium. On completion of surgery, sugammadex 80 mg was injected and train-of-four ratio was 0.93 at 210 seconds after administration. The tracheal tube was removed 5 min after the end of surgery. He recovered full spontaneous respiration and voluntary movements within 1 minute after extubation. After the surgery, he transferred to the intensive care unit and discharged 14 days after the surgery without any concrete problem. The reversal of rocuronium induced neuromuscular block by sugammadex was fast, complete, and recovered to the initial preoperative level of neuromuscular function in this patient. (author)

  19. Teucrium polium reversed the MCD diet-induced liver injury in rats.

    Science.gov (United States)

    Amini, Rahim; Yazdanparast, Razieh; Aghazadeh, Safiyeh; Ghaffari, Seyed H

    2011-09-01

    In the present study, we evaluated the ability of Teucrium polium ethyl acetate fraction, with high antioxidant activity, in the treatment of nonalcoholic steatohepatitis (NASH) in rats and its possible effect on factors involved in pathogenesis of the disease. To induce NASH, a methionine and choline deficient (MCD) diet was given to N-Mary rats for 8 weeks. After NASH development, MCD-fed rats were divided into 2 groups: NASH group that received MCD diet and NASH + T group which was fed MCD diet plus ethyl acetate fraction of T. polium orally for 3 weeks. Histopathological evaluations revealed that treatment with the extract has abated the severity of NASH among the MCD-fed rats. In addition, the fraction reduced the elevated levels of hepatic tumor necrosis factor-alpha (TNF-α) and transforming growth factor-beta (TGF-β) gene expression and also the elevated level of malondialdehyde (MDA). In addition, the extract increased the activities of superoxide dismutase (SOD), glutathione peroxidase (GPx) and enhanced the level of hepatic glutathione (GSH). Moreover, the fraction treatments lowered caspase-3 level and the phosphorylated form of C-Jun N-terminal kinase (JNK) and augmented the phosphorylated level of extracellular regulated kinase1/2 (ERK1/2). These results indicate that the ethyl acetate fraction of T. poium effectively reversed NASH, mainly due to its strong antioxidant and anti-inflammatory properties.

  20. Localization of Reversion-Induced LIM Protein (RIL) in the Rat Central Nervous System

    International Nuclear Information System (INIS)

    Iida, Yuko; Matsuzaki, Toshiyuki; Morishima, Tetsuro; Sasano, Hiroshi; Asai, Kiyofumi; Sobue, Kazuya; Takata, Kuniaki

    2009-01-01

    Reversion-induced LIM protein (RIL) is a member of the ALP (actinin-associated LIM protein) subfamily of the PDZ/LIM protein family. RIL serves as an adaptor protein and seems to regulate cytoskeletons. Immunoblotting suggested that RIL is concentrated in the astrocytes in the central nervous system. We then examined the expression and localization of RIL in the rat central nervous system and compared it with that of water channel aquaporin 4 (AQP4). RIL was concentrated in the cells of ependyma lining the ventricles in the brain and the central canal in the spinal cord. In most parts of the central nervous system, RIL was expressed in the astrocytes that expressed AQP4. Double-labeling studies showed that RIL was concentrated in the cytoplasm of astrocytes where glial fibrillary acidic protein was enriched as well as in the AQP4-enriched regions such as the endfeet or glia limitans. RIL was also present in some neurons such as Purkinje cells in the cerebellum and some neurons in the brain stem. Differential expression of RIL suggests that it may be involved in the regulation of the central nervous system

  1. Inositol induces mesenchymal-epithelial reversion in breast cancer cells through cytoskeleton rearrangement.

    Science.gov (United States)

    Dinicola, Simona; Fabrizi, Gianmarco; Masiello, Maria Grazia; Proietti, Sara; Palombo, Alessandro; Minini, Mirko; Harrath, Abdel Halim; Alwasel, Saleh H; Ricci, Giulia; Catizone, Angela; Cucina, Alessandra; Bizzarri, Mariano

    2016-07-01

    Inositol displays multi-targeted effects on many biochemical pathways involved in epithelial-mesenchymal transition (EMT). As Akt activation is inhibited by inositol, we investigated if such effect could hamper EMT in MDA-MB-231 breast cancer cells. In cancer cells treated with pharmacological doses of inositol E-cadherin was increased, β-catenin was redistributed behind cell membrane, and metalloproteinase-9 was significantly reduced, while motility and invading capacity were severely inhibited. Those changes were associated with a significant down-regulation of PI3K/Akt activity, leading to a decrease in downstream signaling effectors: NF-kB, COX-2, and SNAI1. Inositol-mediated inhibition of PS1 leads to lowered Notch 1 release, thus contributing in decreasing SNAI1 levels. Overall, these data indicated that inositol inhibits the principal molecular pathway supporting EMT. Similar results were obtained in ZR-75, a highly metastatic breast cancer line. These findings are coupled with significant changes on cytoskeleton. Inositol slowed-down vimentin expression in cells placed behind the wound-healing edge and stabilized cortical F-actin. Moreover, lamellipodia and filopodia, two specific membrane extensions enabling cell migration and invasiveness, were no longer detectable after inositol addiction. Additionally, fascin and cofilin, two mandatory required components for F-actin assembling within cell protrusions, were highly reduced. These data suggest that inositol may induce an EMT reversion in breast cancer cells, suppressing motility and invasiveness through cytoskeleton modifications. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Reversal of haloperidol-induced tardive vacuous chewing movements and supersensitive somatodendritic serotonergic response by imipramine in rats

    International Nuclear Information System (INIS)

    Samad, N.; Haleem, D.J.

    2013-01-01

    The study was designed to test the hypothesis that a decrease in the responsiveness of somatodendritic 5-HT-1A receptors by co- administration of imipramine could reverse the induction of VCMs and supersensitivity at 5-HT-IA receptors by haloperidol. Rats treated with haloperidol 0.2mg/rat/day for 2 weeks induced VCMs with twitching of facial musculature that increased in a time dependent manner as the treatment continued to 5 weeks. Co administration of imipramine (5mg/kg/m1) attenuated haloperidol-induced VCMs after 2 weeks and completely reversed it after 5 weeks. The intensity of 8-hydroxy -2-di(n-propyleamino)tetraline (8-OH-DPAT)-induced locomotion and forepaw treading were greater in saline+haloperidol injected but not in imipramine+haloperidol injected animals. 8-OH-DPAT induced decreases of 5-HT metabolism were greater in saline+haloperidol injected animals but not in imipramine+haloperidol injected animals. The mechanism involved in reversal/attenuation of haloperidol-induced tardive dyskinesia by imipramine is discussed. (author)

  3. Spin-orbit torque induced magnetic vortex polarity reversal utilizing spin-Hall effect

    Science.gov (United States)

    Li, Cheng; Cai, Li; Liu, Baojun; Yang, Xiaokuo; Cui, Huanqing; Wang, Sen; Wei, Bo

    2018-05-01

    We propose an effective magnetic vortex polarity reversal scheme that makes use of spin-orbit torque introduced by spin-Hall effect in heavy-metal/ferromagnet multilayers structure, which can result in subnanosecond polarity reversal without endangering the structural stability. Micromagnetic simulations are performed to investigate the spin-Hall effect driven dynamics evolution of magnetic vortex. The mechanism of magnetic vortex polarity reversal is uncovered by a quantitative analysis of exchange energy density, magnetostatic energy density, and their total energy density. The simulation results indicate that the magnetic vortex polarity is reversed through the nucleation-annihilation process of topological vortex-antivortex pair. This scheme is an attractive option for ultra-fast magnetic vortex polarity reversal, which can be used as the guidelines for the choice of polarity reversal scheme in vortex-based random access memory.

  4. Electric-Field-Induced Magnetization Reversal in a Ferromagnet-Multiferroic Heterostructure

    Science.gov (United States)

    Heron, J. T.; Trassin, M.; Ashraf, K.; Gajek, M.; He, Q.; Yang, S. Y.; Nikonov, D. E.; Chu, Y.-H.; Salahuddin, S.; Ramesh, R.

    2011-11-01

    A reversal of magnetization requiring only the application of an electric field can lead to low-power spintronic devices by eliminating conventional magnetic switching methods. Here we show a nonvolatile, room temperature magnetization reversal determined by an electric field in a ferromagnet-multiferroic system. The effect is reversible and mediated by an interfacial magnetic coupling dictated by the multiferroic. Such electric-field control of a magnetoelectric device demonstrates an avenue for next-generation, low-energy consumption spintronics.

  5. Reversal of rocuronium-induced (1.2 mg kg-1) profound neuromuscular block by accidental high dose of sugammadex (40 mg kg-1).

    NARCIS (Netherlands)

    Molina, A.L.; Boer, H.D. de; Klimek, M.; Heeringa, M.; Klein, J.

    2007-01-01

    Sugammadex is the first selective relaxant binding agent and reverses rocuronium-induced neuromuscular block. A case is reported in which a patient accidentally received a high dose of sugammadex (40 mg kg-1) to reverse a rocuronium-induced (1.2 mg kg-1) profound neuromuscular block. A fast and

  6. Strain-assisted current-induced magnetization reversal in magnetic tunnel junctions: A micromagnetic study with phase-field microelasticity

    International Nuclear Information System (INIS)

    Huang, H. B.; Hu, J. M.; Yang, T. N.; Chen, L. Q.; Ma, X. Q.

    2014-01-01

    Effect of substrate misfit strain on current-induced in-plane magnetization reversal in CoFeB-MgO based magnetic tunnel junctions is investigated by combining micromagnetic simulations with phase-field microelasticity theory. It is found that the critical current density for in-plane magnetization reversal decreases dramatically with an increasing substrate strain, since the effective elastic field can drag the magnetization to one of the four in-plane diagonal directions. A potential strain-assisted multilevel bit spin transfer magnetization switching device using substrate misfit strain is also proposed.

  7. Effect of Si on the reversibility of stress-induced martensite in Fe-Mn-Si shape memory alloys

    Energy Technology Data Exchange (ETDEWEB)

    Stanford, N. [Centre for Material and Fibre Innovation, Deakin University, Geelong, Victoria 3217 (Australia); Dunne, D.P., E-mail: druce_dunne@uow.edu.au [Faculty of Engineering, University of Wollongong, Wollongong, NSW 2522 (Australia)

    2010-12-15

    Fe-Mn-Si is a well-characterized ternary shape memory alloy. Research on this alloy has consistently shown that the addition of 5-6 wt.% Si is desirable to enhance the reversibility of stress-induced martensite vis-a-vis shape memory. This paper examines the effect of Si on the morphology and the crystallography of the martensite in the Fe-Mn-Si system. It is concluded that the addition of Si increases the c/a ratio of the martensite, reduces the transformation volume change and decreases the atomic spacing difference between the parallel close-packed directions in the austenite-martensite interface (habit) plane. It is proposed that, in addition to austenite strengthening, Si enhances reversibility by reducing the volume change and the interfacial atomic mismatch between the martensite and the austenite. Although shape memory is improved, transformation reversibility remains limited by the necessary misfit dislocations that accommodate the atomic spacing differences in the interface.

  8. Effect of Si on the reversibility of stress-induced martensite in Fe-Mn-Si shape memory alloys

    International Nuclear Information System (INIS)

    Stanford, N.; Dunne, D.P.

    2010-01-01

    Fe-Mn-Si is a well-characterized ternary shape memory alloy. Research on this alloy has consistently shown that the addition of 5-6 wt.% Si is desirable to enhance the reversibility of stress-induced martensite vis-a-vis shape memory. This paper examines the effect of Si on the morphology and the crystallography of the martensite in the Fe-Mn-Si system. It is concluded that the addition of Si increases the c/a ratio of the martensite, reduces the transformation volume change and decreases the atomic spacing difference between the parallel close-packed directions in the austenite-martensite interface (habit) plane. It is proposed that, in addition to austenite strengthening, Si enhances reversibility by reducing the volume change and the interfacial atomic mismatch between the martensite and the austenite. Although shape memory is improved, transformation reversibility remains limited by the necessary misfit dislocations that accommodate the atomic spacing differences in the interface.

  9. Energetic-particle-driven instabilities and induced fast-ion transport in a reversed field pinch

    International Nuclear Information System (INIS)

    Lin, L.; Brower, D. L.; Ding, W. X.; Anderson, J. K.; Capecchi, W.; Eilerman, S.; Forest, C. B.; Koliner, J. J.; Nornberg, M. D.; Reusch, J.; Sarff, J. S.; Liu, D.

    2014-01-01

    Multiple bursty energetic-particle (EP) driven modes with fishbone-like structure are observed during 1 MW tangential neutral-beam injection in a reversed field pinch (RFP) device. The distinguishing features of the RFP, including large magnetic shear (tending to add stability) and weak toroidal magnetic field (leading to stronger drive), provide a complementary environment to tokamak and stellarator configurations for exploring basic understanding of EP instabilities. Detailed measurements of the EP mode characteristics and temporal-spatial dynamics reveal their influence on fast ion transport. Density fluctuations exhibit a dynamically evolving, inboard-outboard asymmetric spatial structure that peaks in the core where fast ions reside. The measured mode frequencies are close to the computed shear Alfvén frequency, a feature consistent with continuum modes destabilized by strong drive. The frequency pattern of the dominant mode depends on the fast-ion species. Multiple frequencies occur with deuterium fast ions compared to single frequency for hydrogen fast ions. Furthermore, as the safety factor (q) decreases, the toroidal mode number of the dominant EP mode transits from n=5 to n=6 while retaining the same poloidal mode number m=1. The transition occurs when the m=1, n=5 wave-particle resonance condition cannot be satisfied as the fast-ion safety factor (q fi ) decreases. The fast-ion temporal dynamics, measured by a neutral particle analyzer, resemble a classical predator-prey relaxation oscillation. It contains a slow-growth phase arising from the beam fueling followed by a rapid drop when the EP modes peak, indicating that the fluctuation-induced transport maintains a stiff fast-ion density profile. The inferred transport rate is strongly enhanced with the onset of multiple EP modes

  10. Potent and reversible lentiviral vector restriction in murine induced pluripotent stem cells.

    Science.gov (United States)

    Geis, Franziska K; Galla, Melanie; Hoffmann, Dirk; Kuehle, Johannes; Zychlinski, Daniela; Maetzig, Tobias; Schott, Juliane W; Schwarzer, Adrian; Goffinet, Christine; Goff, Stephen P; Schambach, Axel

    2017-05-31

    Retroviral vectors are derived from wild-type retroviruses, can be used to study retrovirus-host interactions and are effective tools in gene and cell therapy. However, numerous cell types are resistant or less permissive to retrovirus infection due to the presence of active defense mechanisms, or the absence of important cellular host co-factors. In contrast to multipotent stem cells, pluripotent stem cells (PSC) have potential to differentiate into all three germ layers. Much remains to be elucidated in the field of anti-viral immunity in stem cells, especially in PSC. In this study, we report that transduction with HIV-1-based, lentiviral vectors (LV) is impaired in murine PSC. Analyses of early retroviral events in induced pluripotent stem cells (iPSC) revealed that the restriction is independent of envelope choice and does not affect reverse transcription, but perturbs nuclear entry and proviral integration. Proteasomal inhibition by MG132 could not circumvent the restriction. However, prevention of cyclophilin A (CypA) binding to the HIV-1 capsid via use of either a CypA inhibitor (cyclosporine A) or CypA-independent capsid mutants improved transduction. In addition, application of higher vector doses also increased transduction. Our data revealed a CypA mediated restriction in iPSC, which was acquired during reprogramming, associated with pluripotency and relieved upon subsequent differentiation. We showed that murine PSC and iPSC are less susceptible to LV. The block observed in iPSC was CypA-dependent and resulted in reduced nuclear entry of viral DNA and proviral integration. Our study helps to improve transduction of murine pluripotent cells with HIV-1-based vectors and contributes to our understanding of retrovirus-host interactions in PSC.

  11. Studies of Current Induced Magnetization reversal and generation of GHz radiation in magnetic nanopillars

    Science.gov (United States)

    Alhajdarwish, Mustafa Yousef

    This thesis describes studies of two phenomena: Current-Induced Magnetization Switching (CIMS), and Current-Induced Generation of GHz Radiation. The CIMS part contains results of measurements of current-perpendicular-to-plane (CPP) magnetoresistance (MR) and CIMS behavior on Ferromagnetic/Nonmetal/Ferromagnetic (F1/N/F2) nanopillars. Judicious combinations of F1 and F2 metals with different bulk scattering asymmetries, and with F1/N and N/F2 interfaces having different interfacial scattering asymmetries, are shown to be able to controllably, and independently, 'invert' both the CPP-MR and the CIMS. In 'normal' CPP-MR, R(AP) > R(P), where R(AP) and R(P) are the nanopillar resistances for the anti-parallel (AP) and parallel (P) orientations of the Fi and F2 magnetic moments. In 'inverse' CPP-MR, R(P) > R(AP). In 'normal' CIMS, positive current switches the nanopillar from the P to the AP state. In 'inverse' CIMS, positive current switches the nanopillar from AP to P. All four possible combinations of CPP-MR and CIMS---(a) 'normal'-'normal', (b) 'normal'- 'inverse', 'inverse'-'normal', and (d) 'inverse'-'inverse' are shown and explained. These results rule out the self-Oersted field as the switching source, since the direction of that field is independent of the bulk or interfacial scattering asymmetries. Successful use of impurities to reverse the bulk scattering asymmetry shows the importance of scattering off of impurities within the bulk F1 and F2 metals---i.e. that the transport must be treated as 'diffusive' rather than 'ballistic'. The GHz studies consist of five parts: (1) designing a sample geometry that allows reliable measurements; (2) making nanopillar samples with this geometry; (3) constructing a system for measuring frequencies up to 12 GHz and measuring current-driven GHz radiation data with it; (4) showing 'scaling' behavior of GHz data with the critical fields and currents for nominally identical (but actually slightly different) samples, and

  12. Ultraviolet-induced reversion of cyc1 alleles in radiation-sensitive strains of yeast. III. rev 3 mutant strains

    International Nuclear Information System (INIS)

    Lawrence, C.W.; Crhistensen, R.B.

    1979-01-01

    The role of rev3 gene function in uv-induced mutagenesis in the yeast Saccharomyces cerevisiae has been examined by determining the reversion of 12 well-defined cyc1 mutations in diploid strains homozygous for the rev3-1 or rev3-3 allale. The 12 cyc1 alleles include one ochre, one amber, four initiation, two proline missense, and four frameshift mutations. We find that the rev3 mutations reduce the frequency of UV-induced reversion of all of the cyc1 alleles, though different classes of alleles respond to a different extent. These results imply that the rev3 gene function is required for the production of a wide variety of mutational events, though probably not all, and show that each of the three rev loci have different mutational phenotypes. Such diverse phenotypes are not predicted by the unitary model for bacterial mutagenes, suggesting that this is at best an incomplete description of eukaryotic mutagenesis

  13. UV-induced reversion of his4 frameshift mutations in rad6, rev1, and rev3 mutants of yeast.

    Science.gov (United States)

    Lawrence, C W; O'Brien, T; Bond, J

    1984-01-01

    The UV-induced reversion of two his4 frameshift alleles was much reduced in rad6 mutants of Saccharomyces cerevisiae, an observation that is consistent with the hypothesis that RAD6 function is required for the induction of all types of genetic alteration in misrepair mutagenesis. The reversion of these his4 alleles, together with two others of the same type, was also reduced in rev1 and rev3 mutant strains; in these, however, the extent of the reduction varied considerably with test allele used, in a manner analogous to the results in these strains for base repair substitution test alleles. The general features of UV-induced frameshift and substitution mutagenesis therefore appear quite similar, indicating that they may depend on related processes. If this conclusion is correct, greater attention must be given to integrating models which account for the production of nucleotide additions and deletions into those concerning misrepair mutagenesis.

  14. INCREASES IN ANXIETY-LIKE BEHAVIOR INDUCED BY ACUTE STRESS ARE REVERSED BY ETHANOL IN ADOLESCENT BUT NOT ADULT RATS

    OpenAIRE

    Varlinskaya, Elena I.; Spear, Linda P.

    2011-01-01

    Repeated exposure to stressors has been found to increase anxiety-like behavior in laboratory rodents, with the social anxiety induced by repeated restraint being extremely sensitive to anxiolytic effects of ethanol in both adolescent and adult rats. No studies, however, have compared social anxiogenic effects of acute stress or the capacity of ethanol to reverse this anxiety in adolescent and adult animals. Therefore, the present study was designed to investigate whether adolescent [postnata...

  15. Reversal of Transjugular Intrahepatic Portosystemic Shunt (TIPS)-Induced Hepatic Encephalopathy Using a Strictured Self-Expanding Covered Stent

    International Nuclear Information System (INIS)

    Cox, Mitchell W.; Soltes, George D.; Lin, Peter H.; Bush, Ruth L.; Lumsden, Alan B.

    2003-01-01

    Hepatic encephalopathy is a known complication following percutaneous transjugular intrahepatic portosystemic shunt (TIPS) placement. We describe herein a simple and effective strategy of TIPS revision by creating an intraluminal stricture within a self-expanding covered stent, which is deployed in the portosystemic shunt to reduce the TIPS blood flow. This technique was successful in reversing a TIPS-induced hepatic encephalopathy in our patient

  16. Temperature induced reversible polymorphic phase transformations in a bis-hydrazone compound

    Science.gov (United States)

    Jayant, Vikrant; Das, Dinabandhu

    2018-03-01

    Two reversible polymorphic phase transformation of 2,3-butanedione, 2,3- bis[4,4‧-bis(diethylamino)benzophenone hydrazone] (DEBH) have been identified in DSC experiment. Topotactic phase transformation of three polymorphs has been observed in variable temperature Single Crystal X-ray Diffraction experiment. The reversible phase transformation of bulk material has been confirmed by Powder X-ray diffraction study.

  17. Estimation of neutral-beam-induced field reversal in MFTF by an approximate scaling law

    International Nuclear Information System (INIS)

    Shearer, J.W.

    1980-01-01

    Scaling rules are derived for field-reversed plasmas whose dimensions are common multiples of the ion gyroradius in the vacuum field. These rules are then applied to the tandem MFTF configuration, and it is shown that field reversal appears to be possible for neutral beam currents of the order of 150 amperes, provided that the electron temperature is at least 500 eV

  18. Can mesenchymal stem cells reverse chronic stress-induced impairment of lung healing following traumatic injury?

    Science.gov (United States)

    Gore, Amy V; Bible, Letitia E; Livingston, David H; Mohr, Alicia M; Sifri, Ziad C

    2015-04-01

    One week following unilateral lung contusion (LC), rat lungs demonstrate full histologic recovery. When animals undergo LC plus the addition of chronic restraint stress (CS), wound healing is significantly delayed. Mesenchymal stem cells (MSCs) are pluripotent cells capable of immunomodulation, which have been the focus of much research in wound healing and tissue regeneration. We hypothesize that the addition of MSCs will improve wound healing in the setting of CS. Male Sprague-Dawley rats (n = 6-7 per group) were subjected to LC/CS with or without the injection of MSCs. MSCs were given as a single intravenous dose of 5 × 10 cells in 1 mL Iscove's Modified Dulbecco's Medium at the time of LC. Rats were subjected to 2 hours of restraint stress on Days 1 to 6 following LC. Seven days following injury, rats were sacrificed, and the lungs were examined for histologic evidence of wound healing using a well-established histologic lung injury score (LIS) to grade injury. LIS examines inflammatory cells/high-power field (HPF) averaged over 30 fields, interstitial edema, pulmonary edema, and alveolar integrity, with scores ranging from 0 (normal) to 11 (highly damaged). Peripheral blood was analyzed by flow cytometry for the presence of T-regulatory (C4CD25FoxP3) cells. Data were analyzed by analysis of variance followed by Tukey's multiple comparison test, expressed as mean (SD). As previously shown, 7 days following isolated LC, LIS has returned to 0.83 (0.41), with a subscore of zero for inflammatory cells/HPF. The addition of CS results in an LIS of 4.4 (2.2), with a subscore of 1.9 (0.7) for inflammatory cells/HPF. Addition of MSC to LC/CS decreased LIS to 1.7 (0.8), with a subscore of zero for inflammatory cells/HPF. Furthermore, treatment of animals undergoing LC/CS with MSCs increased the %T-regulatory cells by 70% in animals undergoing LC/CS alone (12.9% [2.4]% vs. 6.2% [1.3%]). Stress-induced impairment of wound healing is reversed by the addition of MSCs given

  19. Whole brain radiation-induced impairments in learning and memory are time-sensitive and reversible by systemic hypoxia.

    Directory of Open Access Journals (Sweden)

    Junie P Warrington

    Full Text Available Whole brain radiation therapy (WBRT is commonly used for treatment of primary and metastatic brain tumors; however, cognitive impairment occurs in 40-50% of brain tumor survivors. The etiology of the cognitive impairment following WBRT remains elusive. We recently reported that radiation-induced cerebrovascular rarefaction within hippocampal subregions could be completely reversed by systemic hypoxia. However, the effects of this intervention on learning and memory have not been reported. In this study, we assessed the time-course for WBRT-induced impairments in contextual and spatial learning and the capacity of systemic hypoxia to reverse WBRT-induced deficits in spatial memory. A clinical fractionated series of 4.5Gy WBRT was administered to mice twice weekly for 4 weeks, and after various periods of recovery, behavioral analyses were performed. To study the effects of systemic hypoxia, mice were subjected to 11% (hypoxia or 21% oxygen (normoxia for 28 days, initiated 1 month after the completion of WBRT. Our results indicate that WBRT induces a transient deficit in contextual learning, disruption of working memory, and progressive impairment of spatial learning. Additionally, systemic hypoxia completely reversed WBRT-induced impairments in learning and these behavioral effects as well as increased vessel density persisted for at least 2 months following hypoxia treatment. Our results provide critical support for the hypothesis that cerebrovascular rarefaction is a key component of cognitive impairment post-WBRT and indicate that processes of learning and memory, once thought to be permanently impaired after WBRT, can be restored.

  20. Reversal with sugammadex for rocuronium-induced deep neuromuscular block after pretreatment of magnesium sulfate in rabbits.

    Science.gov (United States)

    Kang, Woon Seok; Kim, Kyo Sang; Song, Shin Mi

    2017-04-01

    Magnesium sulfate (MgSO 4 ) has been used in the treatment of pre-eclampsia, hypertension and arrhythmia. Magnesium enhances the neuromuscular block of rocuronium. This study has been conducted to evaluate the reversal efficacy of sugammadex from deep rocuronium-induced neuromuscular block (NMB) during consistent pretreatment of MgSO 4 in rabbits. Twenty-eight rabbits were randomly assigned to four groups, a control group or study groups (50% MgSO 4 150-200 mg/kg and 25 mg/kg/h IV), and received rocuronium 0.6 mg/kg. When post-tetanic count 1-2 appeared, sugammadex 2, 4, and 8 mg/kg was administered in the 2-mg group, control and 4-mg group, and 8-mg group, respectively. The recovery course after reversal of sugammadex administration was evaluated in each group. The mean serum concentration of magnesium was maintained at more than 2 mmol/L in the study groups, and the total dose of MgSO 4 was more than 590 mg. The reversal effect of sugammadex on rocuronium-induced NMB in pretreated MgSO 4 was not different from that in the group without MgSO 4 . The recovery time to train-of-four ratio 0.9 after sugammadex administration in the 2-mg group was longer than in the other groups (P rocuronium-induced NMB during large pretreatment of MgSO 4 was not affected. However, we should consider that the reversal effect of sugammadex varied depending on the dose.

  1. Extremely low-frequency magnetic fields can impair spermatogenesis recovery after reversible testicular damage induced by heat.

    Science.gov (United States)

    Tenorio, Bruno Mendes; Ferreira Filho, Moisés Bonifacio Alves; Jimenez, George Chaves; de Morais, Rosana Nogueira; Peixoto, Christina Alves; Nogueira, Romildo de Albuquerque; da Silva Junior, Valdemiro Amaro

    2014-06-01

    Male infertility is often related to reproductive age couples experiencing fertility-related issues. Men may have fertility problems associated with reversible testicular damage. Considering that men have been increasingly exposed to extremely low-frequency magnetic fields generated by the production, distribution and use of electricity, this study analyzed whether 60 Hz and 1 mT magnetic field exposure may impair spermatogenesis recovery after reversible testicular damage induced by heat shock using rats as an experimental model. Adult male rats were subjected to a single testicular heat shock (HS, 43 °C for 12 min) and then exposed to the magnetic field for 15, 30 and 60 d after HS. Magnetic field exposure during the spermatogenesis recovery induced changes in testis components volume, cell ultrastructure and histomorphometrical parameters. Control animals had a reestablished and active spermatogenesis at 60 d after heat shock, while animals exposed to magnetic field still showed extensive testicular degeneration. Magnetic field exposure did not change the plasma testosterone. In conclusion, extremely low-frequency magnetic field may be harmful to fertility recovery in males affected by reversible testicular damage.

  2. A randomized, dose-response study of sugammadex given for the reversal of deep rocuronium- or vecuronium-induced neuromuscular blockade under sevoflurane anesthesia

    DEFF Research Database (Denmark)

    Duvaldestin, Philippe; Kuizenga, Karel; Saldien, Vera

    2010-01-01

    Sugammadex is the first of a new class of selective muscle relaxant binding drugs developed for the rapid and complete reversal of neuromuscular blockade induced by rocuronium and vecuronium. Many studies have demonstrated a dose-response relationship with sugammadex for reversal of neuromuscular...

  3. A Randomized, Dose-Response Study of Sugammadex Given for the Reversal of Deep Rocuronium- or Vecuronium-Induced Neuromuscular Blockade Under Sevoflurane Anesthesia

    NARCIS (Netherlands)

    Duvaldestin, Philippe; Kuizenga, Karel; Saldien, Vera; Claudius, Casper; Servin, Frederique; Klein, Jan; Debaene, Bertrand; Heeringa, Marten

    BACKGROUND: Sugammadex is the first of a new class of selective muscle relaxant binding drugs developed for the rapid and complete reversal of neuromuscular blockade induced by rocuronium and vecuronium. Many studies have demonstrated a close-response relationship with sugammadex for reversal of

  4. Acute agmatine administration, similar to ketamine, reverses depressive-like behavior induced by chronic unpredictable stress in mice.

    Science.gov (United States)

    Neis, Vivian B; Bettio, Luis E B; Moretti, Morgana; Rosa, Priscila B; Ribeiro, Camille M; Freitas, Andiara E; Gonçalves, Filipe M; Leal, Rodrigo B; Rodrigues, Ana Lúcia S

    Agmatine is an endogenous neuromodulator that has been shown to have antidepressant-like properties. We have previously demonstrated that it can induce a rapid increase in BDNF levels after acute administration, suggesting that agmatine may be a fast-acting antidepressant. To investigate this hypothesis, the present study evaluated the effects of a single administration of agmatine in mice subjected to chronic unpredictable stress (CUS), a model of depression responsive only to chronic treatment with conventional antidepressants. The ability of agmatine to reverse CUS-induced behavioral and biochemical alterations was evaluated and compared with those elicited by the fast-acting antidepressant (ketamine) and the conventional antidepressant (fluoxetine). After exposed to CUS for 14days, mice received a single oral dose of agmatine (0.1mg/kg), ketamine (1mg/kg) or fluoxetine (10mg/kg), and were submitted to behavioral evaluation after 24h. The exposure to CUS caused an increased immobility time in the tail suspension test (TST) but did not change anhedonic-related parameters in the splash test. Our findings provided evidence that, similarly to ketamine, agmatine is able to reverse CUS-induced depressive-like behavior in the TST. Western blot analyses of prefrontal cortex (PFC) demonstrated that mice exposed to CUS and/or treated with agmatine, fluoxetine or ketamine did not present alterations in the immunocontent of synaptic proteins [i.e. GluA1, postsynaptic density protein 95 (PSD-95) and synapsin]. Altogether, our findings indicate that a single administration of agmatine is able to reverse behavioral alterations induced by CUS in the TST, suggesting that this compound may have fast-acting antidepressant-like properties. However, there was no alteration in the levels of synaptic proteins in the PFC, a result that need to be further investigated in other time points. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Influence of domain structure induced coupling on magnetization reversal of Co/Pt/Co film with perpendicular anisotropy

    Energy Technology Data Exchange (ETDEWEB)

    Matczak, Michał [Institute of Molecular Physics, Polish Academy of Sciences, M. Smoluchowskiego 17, 60-179 Poznań (Poland); NanoBioMedical Centre, Adam Mickiewicz University, Umultowska 85, 61-614 Poznań (Poland); Schäfer, Rudolf [Leibniz Institute for Solid State and Materials Research (IFW) Dresden, Institute for Metallic Materials, PO 270116, D-01171 Dresden (Germany); Dresden University of Technology, Institute for Materials Science, D-01062 Dresden (Germany); Urbaniak, Maciej; Kuświk, Piotr; Szymański, Bogdan; Schmidt, Marek; Aleksiejew, Jacek [Institute of Molecular Physics, Polish Academy of Sciences, M. Smoluchowskiego 17, 60-179 Poznań (Poland); Stobiecki, Feliks, E-mail: Feliks.Stobiecki@ifmpan.poznan.pl [Institute of Molecular Physics, Polish Academy of Sciences, M. Smoluchowskiego 17, 60-179 Poznań (Poland); NanoBioMedical Centre, Adam Mickiewicz University, Umultowska 85, 61-614 Poznań (Poland)

    2017-01-15

    A magnetic multilayer of substrate/Pt-15 nm/Co-0.8 nm/Pt-wedge 0–7 nm/Co-0.6 nm/Pt-2 nm structure is characterized by a perpendicular anisotropy of the Co layers and by graded interlayer coupling between them. Using magnetooptical Kerr microscopy we observed a distinct influence of magnetic domains in one Co layer on the nucleation field and positions of nucleation sites of reversed domains in the second Co layer. For sufficiently strong interlayer coupling a replication of magnetic domains from the magnetically harder layer to the magnetically softer layer is observed. - Highlights: • Co/Pt-wedge/Co layered film is characterized by a gradient of interlayer coupling. • Magnetic field controls propagation of straight domain wall. • Replication of magnetic domains in multilayers with strong ferromagnetic coupling. • Coupling induced by domains influences magnetization reversal of spin valves.

  6. On the relation between quasi-static and dynamic stress induced reversible structural relaxation of amorphous alloys

    International Nuclear Information System (INIS)

    Krueger, P.; Stucky, T.; Boewe, M.; Neuhaeuser, H.

    1993-01-01

    Quasi-static stress relaxation and dynamic internal friction measurements of stress induced reversible structural relaxation were performed on the amorphous alloy Fe 40 Ni 40 B 20 . The kinetics can be well described by a stretched exponential Kohlrausch-Williams-Watts quasi-static relaxation. The thermally activated part of the internal friction shows an Arrhenius temperature behaviour for a fixed vibration frequency and an inverse power frequency behaviour for a fixed temperature. The activation energies calculated from the Arrhenius equation and from the frequency shift method are significantly different. In order to explain this discrepancy the relation between the quasi-static and the dynamic descriptions of the reversible relaxation is reexamined. In particular it is shown that these two activation energies are connected by the Kohlrausch exponent of the quasi-static relaxation. (orig.)

  7. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  8. Nanostructured graphite-induced destabilization of LiBH4 for reversible hydrogen storage

    CSIR Research Space (South Africa)

    Wang, K

    2016-11-01

    Full Text Available been conducted to gain insight into the promoting effect of nano-G on the reversible dehydrogenation of the LiBH(sub4). Our study found that nano-G exerts its promoting effect via interaction with LiBH(sub4) and as grinding aid....

  9. Hydrazine-induced thermo-reversible optical shifts in silver-gelatin bionanocomposites

    Science.gov (United States)

    Aimé, Carole; Rietveld, Ivo B.; Coradin, Thibaud

    2011-03-01

    Bionanocomposites formed by in situ growth of silver nanoparticles within gelatin gels exhibit large (up to 100 nm) thermo-reversible optical shifts resulting from the enhancement of gel matrix scattering by the interaction of the biopolymer with the hydrazine reducing agent.

  10. Crack Cocaine-Induced Cardiac Conduction Abnormalities Are Reversed by Sodium Bicarbonate Infusion

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Miranda

    2013-01-01

    Full Text Available We report a dramatic case of a 19-year-old man with crack cocaine overdose with important clinical complications as cardiac arrest due to ventricular fibrillation and epileptics status. During this intoxication, electrocardiographic abnormalities similar to those found in tricyclic antidepressant poisoning were observed, and they were reversed by intravenous sodium bicarbonate infusion.

  11. Dose-dependency and reversibility of radiation-induced injury in cardiac explant-derived cells of mice

    Science.gov (United States)

    Luo, Lan; Yan, Chen; Urata, Yoshishige; Hasan, Al Shaimaa; Goto, Shinji; Guo, Chang-Ying; Zhang, Shouhua; Li, Tao-Sheng

    2017-01-01

    We evaluated the dose-dependency and reversibility of radiation-induced injury in cardiac explant-derived cells (CDCs), a mixed cell population grown from heart tissues. Adult C57BL/6 mice were exposed to 0, 10, 50 and 250 mGy γ-rays for 7 days and atrial tissues were collected for experiments 24 hours after last exposure. The number of CDCs was significantly decreased by daily exposure to over 250 mGy. Interestingly, daily exposure to over 50 mGy significantly decreased the c-kit expression and telomerase activity, increased 53BP1 foci in the nuclei of CDCs. However, CD90 expression and growth factors production in CDCs were not significantly changed even after daily exposure to 250 mGy. We further evaluated the reversibility of radiation-induced injury in CDCs at 1 week and 3 weeks after a single exposure to 3 Gy γ-rays. The number and growth factors production of CDCs were soon recovered at 1 week. However, the increased expression of CD90 were retained at 1 week, but recovered at 3 weeks. Moreover, the decreased expression of c-kit, impaired telomerase activity, and increased 53BP1 foci were poorly recovered even at 3 weeks. These data may help us to find the most sensitive and reliable bio-parameter(s) for evaluating radiation-induced injury in CDCs. PMID:28098222

  12. Selective Activation of M4 Muscarinic Acetylcholine Receptors Reverses MK-801-Induced Behavioral Impairments and Enhances Associative Learning in Rodents

    Science.gov (United States)

    2015-01-01

    Positive allosteric modulators (PAMs) of the M4 muscarinic acetylcholine receptor (mAChR) represent a novel approach for the treatment of psychotic symptoms associated with schizophrenia and other neuropsychiatric disorders. We recently reported that the selective M4 PAM VU0152100 produced an antipsychotic drug-like profile in rodents after amphetamine challenge. Previous studies suggest that enhanced cholinergic activity may also improve cognitive function and reverse deficits observed with reduced signaling through the N-methyl-d-aspartate subtype of the glutamate receptor (NMDAR) in the central nervous system. Prior to this study, the M1 mAChR subtype was viewed as the primary candidate for these actions relative to the other mAChR subtypes. Here we describe the discovery of a novel M4 PAM, VU0467154, with enhanced in vitro potency and improved pharmacokinetic properties relative to other M4 PAMs, enabling a more extensive characterization of M4 actions in rodent models. We used VU0467154 to test the hypothesis that selective potentiation of M4 receptor signaling could ameliorate the behavioral, cognitive, and neurochemical impairments induced by the noncompetitive NMDAR antagonist MK-801. VU0467154 produced a robust dose-dependent reversal of MK-801-induced hyperlocomotion and deficits in preclinical models of associative learning and memory functions, including the touchscreen pairwise visual discrimination task in wild-type mice, but failed to reverse these stimulant-induced deficits in M4 KO mice. VU0467154 also enhanced the acquisition of both contextual and cue-mediated fear conditioning when administered alone in wild-type mice. These novel findings suggest that M4 PAMs may provide a strategy for addressing the more complex affective and cognitive disruptions associated with schizophrenia and other neuropsychiatric disorders. PMID:25137629

  13. Memory-induced sign reversals of the spatial cross-correlation for particles in viscoelastic shear flows

    International Nuclear Information System (INIS)

    Sauga, Ako; Laas, Katrin; Mankin, Romi

    2015-01-01

    Highlights: • Cross-correlation (CC) of coordinates of particles in viscoelastic shear flows is discussed. • Expressions for CC functions subjected to both internal and external noises are presented. • Impact of internal and external noises on CC functions are compared. • Memory-induced reentrant sign reversals of the spatial cross-moment are established. - Abstract: The behavior of shear-induced cross-correlation functions between particle fluctuations along orthogonal directions in the shear plane for harmonically trapped Brownian particles in a viscoelastic shear flow is studied. A generalized Langevin equation with a power-law-type memory kernel is used to model the complex structure of the viscoelastic media. Interaction with fluctuations of environmental parameters is modeled by a multiplicative white Gaussian noise, by an internal fractional Gaussian noise, and by an additive external white noise. It is shown that the presence of a memory has a profound effect on the behavior of the cross-correlation functions. Particularly, memory-induced reentrant sign reversals of the spatial cross-moment between orthogonal random displacements of a particle are established, i.e., an increase of the memory exponent can cause the sign reversal from positive to negative, but by a further increase of the memory exponent a reentrant transition from negative to positive values appears. Similarities and differences between the behavior of the models with additive internal and external noises are considered. It is shown that additive external and internal noises cause qualitatively different dependencies of the cross-correlation functions on the time lag. The occurrence of energetic instability due to the influence of multiplicative noise is also discussed.

  14. Vinclozolin exposure in utero induces postpubertal prostatitis and reduces sperm production via a reversible hormone-regulated mechanism.

    Science.gov (United States)

    Cowin, Prue A; Gold, Elspeth; Aleksova, Jasna; O'Bryan, Moira K; Foster, Paul M D; Scott, Hamish S; Risbridger, Gail P

    2010-02-01

    Vinclozolin is an endocrine-disrupting chemical (EDC) that binds with high affinity to the androgen receptor (AR) and blocks the action of gonadal hormones on male reproductive organs. An alternative mechanism of action of Vinclozolin involves transgenerational effects on the male reproductive tract. We previously reported in utero Vinclozolin exposure-induced prostatitis (prostate inflammation) in postpubertal rats concurrent with down-regulation of AR and increased nuclear factor-kappaB activation. We postulated the male reproductive abnormalities induced by in utero Vinclozolin exposure could be reversed by testosterone supplementation, in contrast to the permanent modifications involving DNA methyltransferases (Dnmts) described by others. To test this hypothesis, we administered high-dose testosterone at puberty to Vinclozolin-treated rats and determined the effect on anogenital distance (AGD); testicular germ cell apoptosis, concentration of elongated spermatids, and the onset of prostatitis. Concurrently we examined Dnmt1, -3A, -3B, and -3L mRNA expression. Consistent with previous reports, in utero exposure to Vinclozolin significantly reduced AGD, increased testicular germ cell apoptosis 3-fold, reduced elongated spermatid number by 40%, and induced postpubertal prostatitis in 100% of exposed males. Administration of high-dose testosterone (25 mg/kg) at puberty normalized AGD, reduced germ cell apoptosis, and restored elongated spermatid number. Testosterone restored AR and nuclear factor-kappaB expression in the prostate and abolished Vinclozolin-induced prostatitis. Altered Dnmt expression was evident with in utero Vinclozolin exposure and was not normalized after testosterone treatment. These data demonstrate in utero Vinclozolin-induced male reproductive tract abnormalities are AR mediated and reversible and involve a mechanism independent of Dnmt expression.

  15. Redox-induced reversible luminescence switching of cerium-doped upconversion nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Yanan [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Xiao, Qingbo, E-mail: qbxiao2011@sinano.ac.cn [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Wang, Jian [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Xi, Yonglan [Laboratory for Agricultural Wastes Treatment and Recycling Institute of Agricultural Resources and Environment, Jiangsu Academy of Agricultural Science, Nanjing 210014 (China); Li, Fujin [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Feng, Yamin [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Shi, Liyi [College of Sciences, Shanghai University, Shanghai 200444 (China); Lin, Hongzhen, E-mail: hzlin2010@sinano.ac.cn [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China)

    2016-05-15

    Smart upconversion nanophosphors (UCNPs) that can be reversibly switched between two or more luminescent states by certain external stimuli have attracted considerable attention due to their great potential in biological applications. Here we report for the first time a type of redox-switchable UCNPs by codoping NaGdF{sub 4}:Yb/Er nanorods with the redox-active Ce{sup 3+}/Ce{sup 4+} ion pairs. A reversible switching of their UC luminescence intensity was observed upon the variation of the surrounding redox environments. We show solid proof that the luminescence switching is caused by the tailoring of the NaGdF{sub 4} host crystal structure in response to changing redox state of the codoped cerium ions. A proof-of-concept example is further demonstrated by using these UCNPs for probing the dynamical variation of redox environments in biological tissues. - Highlights: • Synthesis of upconversion nanoparticles doped with Ce{sup 3+}/Ce{sup 4+} ions. • The precise and reversible modification of crystal structure by redox reactions. • Tuning the upconversion luminescence by tailoring the crystal structure.

  16. Superhydrophobic TiO2-polymer nanocomposite surface with UV-induced reversible wettability and self-cleaning properties.

    Science.gov (United States)

    Xu, Qian Feng; Liu, Yang; Lin, Fang-Ju; Mondal, Bikash; Lyons, Alan M

    2013-09-25

    Multifunctional superhydrophobic nanocomposite surfaces based on photocatalytic materials, such as fluorosilane modified TiO2, have generated significant research interest. However, there are two challenges to forming such multifunctional surfaces with stable superhydrophobic properties: the photocatalytic oxidation of the hydrophobic functional groups, which leads to the permanent loss of superhydrophobicity, as well as the photoinduced reversible hydrolysis of the catalytic particle surface. Herein, we report a simple and inexpensive template lamination method to fabricate multifunctional TiO2-high-density polyethylene (HDPE) nanocomposite surfaces exhibiting superhydrophobicity, UV-induced reversible wettability, and self-cleaning properties. The laminated surface possesses a hierarchical roughness spanning the micro- to nanoscale range. This was achieved by using a wire mesh template to emboss the HDPE surface creating an array of polymeric posts while partially embedding untreated TiO2 nanoparticles selectively into the top surface of these features. The surface exhibits excellent superhydrophobic properties immediately after lamination without any chemical surface modification to the TiO2 nanoparticles. Exposure to UV light causes the surface to become hydrophilic. This change in wettability can be reversed by heating the surface to restore superhydrophobicity. The effect of TiO2 nanoparticle surface coverage and chemical composition on the mechanism and magnitude of wettability changes was studied by EDX and XPS. In addition, the ability of the surface to shed impacting water droplets as well as the ability of such droplets to clean away particulate contaminants was demonstrated.

  17. RECOMBINANT HUMAN INTERLEUKIN-6 INDUCES A RAPID AND REVERSIBLE ANEMIA IN CANCER-PATIENTS

    NARCIS (Netherlands)

    NIEKEN, J; MULDER, NH; VELLENGA, E; LIMBURG, PC; PIERS, DA; DEVRIES, EGE

    1995-01-01

    Initial studies have shown that recombinant human interleukin-6 (rhIL-6) induces anemia. Until now, the pathophysiologic mechanism of this induced anemia has been unknown. To unravel the underlying mechanism, we examined 15 cancer patients receiving rhIL-6 as an antitumor immunotherapy in a phase II

  18. Intermittent Hypoxia-Induced Cardiovascular Remodeling Is Reversed by Normoxia in a Mouse Model of Sleep Apnea.

    Science.gov (United States)

    Castro-Grattoni, Anabel L; Alvarez-Buvé, Roger; Torres, Marta; Farré, Ramon; Montserrat, Josep M; Dalmases, Mireia; Almendros, Isaac; Barbé, Ferran; Sánchez-de-la-Torre, Manuel

    2016-06-01

    Intermittent hypoxia (IH) is the principal injurious factor involved in the cardiovascular morbidity and mortality associated with OSA. The gold standard for treatment is CPAP, which eliminates IH and appears to reduce cardiovascular risk. There is no experimental evidence on the reversibility of cardiovascular remodeling after IH withdrawal. The objective of the present study is to assess the reversibility of early cardiovascular structural remodeling induced by IH after resumption of normoxic breathing in a novel recovery animal model mimicking OSA treatment. We investigated cardiovascular remodeling in C57BL/6 mice exposed to IH for 6 weeks vs the normoxia group and its spontaneous recovery after 6 subsequent weeks under normoxia. Aortic expansive remodeling was induced by IH, with intima-media thickening and without lumen perimeter changes. Elastic fiber network disorganization, fragmentation, and estrangement between the end points of disrupted fibers were increased by IH. Extracellular matrix turnover was altered, as visualized by collagen and mucoid interlaminar accumulation. Furthermore, left ventricular perivascular fibrosis was increased by IH, whereas cardiomyocytes size was unaffected. These cardiovascular remodeling events induced by IH were normalized after recovery in normoxia, mimicking CPAP treatment. The early structural cardiovascular remodeling induced by IH was normalized after IH removal, revealing a novel recovery model for studying the effects of OSA treatment. Our findings suggest the clinical relevance of early detection and effective treatment of OSA in patients to prevent the natural course of cardiovascular diseases. Copyright © 2016 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  19. Increases in anxiety-like behavior induced by acute stress are reversed by ethanol in adolescent but not adult rats.

    Science.gov (United States)

    Varlinskaya, Elena I; Spear, Linda P

    2012-01-01

    Repeated exposure to stressors has been found to increase anxiety-like behavior in laboratory rodents, with the social anxiety induced by repeated restraint being extremely sensitive to anxiolytic effects of ethanol in both adolescent and adult rats. No studies, however, have compared social anxiogenic effects of acute stress or the capacity of ethanol to reverse this anxiety in adolescent and adult animals. Therefore, the present study was designed to investigate whether adolescent [postnatal day (P35)] Sprague-Dawley rats differ from their adult counterparts (P70) in the impact of acute restraint stress on social anxiety and in their sensitivity to the social anxiolytic effects of ethanol. Animals were restrained for 90 min, followed by examination of stress- and ethanol-induced (0, 0.25, 0.5, 0.75, and 1 g/kg) alterations in social behavior using a modified social interaction test in a familiar environment. Acute restraint stress increased anxiety, as indexed by reduced levels of social investigation at both ages, and decreased social preference among adolescents. These increases in anxiety were dramatically reversed among adolescents by acute ethanol. No anxiolytic-like effects of ethanol emerged following restraint stress in adults. The social suppression seen in response to higher doses of ethanol was reversed by restraint stress in animals of both ages. To the extent that these data are applicable to humans, the results of the present study provide some experimental evidence that stressful life events may increase the attractiveness of alcohol as an anxiolytic agent for adolescents. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Reprogramming human A375 amelanotic melanoma cells by catalase overexpression: Reversion or promotion of malignancy by inducing melanogenesis or metastasis

    Science.gov (United States)

    Bracalente, Candelaria; Salguero, Noelia; Notcovich, Cintia; Müller, Carolina B.; da Motta, Leonardo L.; Klamt, Fabio; Ibañez, Irene L.; Durán, Hebe

    2016-01-01

    Advanced melanoma is the most aggressive form of skin cancer. It is highly metastatic and dysfunctional in melanogenesis; two processes that are induced by H2O2. This work presents a melanoma cell model with low levels of H2O2 induced by catalase overexpression to study differentiation/dedifferentiation processes. Three clones (A7, C10 and G10) of human A375 amelanotic melanoma cells with quite distinct phenotypes were obtained. These clones faced H2O2 scavenging by two main strategies. One developed by clone G10 where ROS increased. This resulted in G10 migration and metastasis associated with the increased of cofilin-1 and CAP1. The other strategy was observed in clone A7 and C10, where ROS levels were maintained reversing malignant features. Particularly, C10 was not tumorigenic, while A7 reversed the amelanotic phenotype by increasing melanin content and melanocytic differentiation markers. These clones allowed the study of potential differentiation and migration markers and its association with ROS levels in vitro and in vivo, providing a new melanoma model with different degree of malignancy. PMID:27206672

  1. Reversible pressure-induced crystal-amorphous structural transformation in ice Ih

    Science.gov (United States)

    English, Niall J.; Tse, John S.

    2014-08-01

    Molecular dynamics (MD) simulation of depressurised high-density amorphous ice (HDA) at 80 K and at negative pressures has been performed. Over several attempts, HDA recrystallised to a form close to hexagonal ice Ih, albeit with some defects. The results support the hypothesis that compression of ice-Ih to HDA is a reversible first-order phase transition, with a large hysteresis. Therefore, it would appear that LDA is not truly amorphous. The elastic energy estimated from the area of the hysteresis loop is ca. 4.5 kJ/mol, in some way consistent with experimentally-determined accumulated successive heats of transformations from recovered HDA → ice Ih.

  2. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  3. APOBEC3G inhibits elongation of HIV-1 reverse transcripts.

    Directory of Open Access Journals (Sweden)

    Kate N Bishop

    2008-12-01

    Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.

  4. Verapamil reverses PTH- or CRF-induced abnormal fatty acid oxidation in muscle

    International Nuclear Information System (INIS)

    Perna, A.F.; Smogorzewski, M.; Massry, S.G.

    1988-01-01

    Chronic renal failure (CRF) is associated with impaired long chain fatty acids (LCFA) oxidation by skeletal muscle mitochondria. This is due to reduced activity of carnitine palmitoyl transferase (CPT). These derangements were attributed to the secondary hyperparathyroidism of CRF, since prior parathyroidectomy in CRF rats reversed these abnormalities and PTH administration to normal rats reproduced them. It was proposed that these effects of PTH are mediated by its ionophoric property leading to increased entry of calcium into skeletal muscle. A calcium channel blocker may, therefore, correct these derangements. The present study examined the effects of verapamil on LCFA oxidation, CPT activity by skeletal muscle mitochondria, and 45 Ca uptake by skeletal muscle obtained from CRF rats and normal animals treated with PTH with and without verapamil. Both four days of PTH administration and 21 days of CRF produced significant (P less than 0.01) reduction in LCFA oxidation and CPT activity of skeletal muscle mitochondria, and significant (P less than 0.01) increment in 45 Ca uptake by skeletal muscle. Simultaneous treatment with verapamil corrected all these derangements. Administration of verapamil alone to normal rats did not cause a significant change in any of these parameters. The data are consistent with the proposition that the alterations in LCFA in CRF or after PTH treatment are related to the ionophoric action of the hormone and could be reversed by a calcium channel blocker

  5. Steam-cooking rapidly destroys and reverses onion-induced antiplatelet activity

    Directory of Open Access Journals (Sweden)

    Hansen Emilie A

    2012-09-01

    Full Text Available Abstract Background Foods in the diet that can aid in the prevention of diseases are of major interest. Onions are key ingredients in many cuisines around the world and moreover, onion demand has trended higher over the past three decades. An important pharmacological aspect of onion is the ability to inhibit platelet aggregation. Raw onions inhibit platelet aggregation; however, when onions are boiled or heated, antiplatelet activity may be abolished. Methods Onion quarters were steamed for 0, 1, 3, 6, 10, and 15 min. The in vitro antiplatelet activity of a yellow hybrid storage onion was examined at these times on the blood of 12 human subjects using in vitro whole blood aggregometry. Results Contrary to findings reported for boiling, antiplatelet activity was destroyed between 3 and 6 min of steaming, and at 10 min of steaming, cooked onions stimulated platelet activity. Extracts from cooked onion had the potential to reverse the inhibitory effect on blood platelets by 25%. Responses were consistent across all donors. Total polyphenolic concentration and soluble solids were not affected by steaming time. Conclusions The potential value of cooked onion preparations may result in destruction or reversal of antiplatelet activity, without affecting the polyphenolic concentration.

  6. Elucidation of mechanism of Si-jun-zi decoction-induced reversal of ...

    African Journals Online (AJOL)

    Methods: Spleen deficiency syndrome was induced in a rat model with reserpine. Liquid ... high-throughput quantification ability for ... HPLC grade acetonitrile was purchased from ..... study on the antitumor effect of flavonoid derivative 3d in.

  7. Subacute ethanol consumption reverses p-xylene-induced decreases in axonal transport

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, S.; Lyerly, D.L.; Pope, C.N.

    1992-01-01

    Organic solvants, as a class, have been implicated as neurotoxic agents in humans and laboratory animals. The study was designed to assess the interaction between subacute ingestion of moderate levels of ethanol and the p-xylene-induced decreases in protein and glycoprotein synthesis and axonal transport in the rat optic system. The results indicated that animals maintained on 10% ethanol as a drinking liquid show less p-xylene-induced neurotoxicity than animals receiving no ethanol supplement.

  8. The reverse transcription inhibitor abacavir shows anticancer activity in prostate cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Francesca Carlini

    Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.

  9. Reversible-Deactivation Radical Polymerization of Methyl Methacrylate Induced by Photochemical Reduction of Various Copper Catalysts

    Directory of Open Access Journals (Sweden)

    Jaroslav Mosnáček

    2014-11-01

    Full Text Available Photochemically mediated reversible-deactivation radical polymerization of methyl methacrylate was successfully performed using 50–400 ppm of various copper compounds such as CuSO4·5H2O, copper acetate, copper triflate and copper acetylacetonate as catalysts. The copper catalysts were reduced in situ by irradiation at wavelengths of 366–546 nm, without using any additional reducing agent. Bromopropionitrile was used as an initiator. The effects of various solvents and the concentration and structure of ligands were investigated. Well-defined polymers were obtained when at least 100 or 200 ppm of any catalyst complexed with excess tris(2-pyridylmethylamine as a ligand was used in dimethyl sulfoxide as a solvent.

  10. A Case of Posterior Reversible Encephalopathy Syndrome Induced by Cisplatin/Pemetrexed Chemotherapy for Lung Cancer

    Directory of Open Access Journals (Sweden)

    Masashi Ishihara

    2017-03-01

    Full Text Available This report presents the case of a 60-year-old woman who was diagnosed with stage IV lung adenocarcinoma with asymptomatic brain metastases and commenced chemotherapy with cisplatin/pemetrexed (CDDP/Pem. She experienced tonic-clonic convulsions on day 9 of the first cycle, which were accompanied by increased blood pressure (173/69 mm Hg and headache. Therefore, brain MRI was performed to check for stroke or progression of brain metastatic foci. T2-weighted, FLAIR, and ADC map images showed high-intensity areas in the subcortical region of the bilateral parieto-occipital lobes, leading to a diagnosis of posterior reversible encephalopathy syndrome (PRES. The symptoms improved after treatment with antihypertensive and antiepileptic drugs. Clinicians should keep it in mind that central nervous system symptoms during anticancer therapy containing Pem may indicate possible PRES.

  11. Organic honey supplementation reverses pesticide-induced genotoxicity by modulating DNA damage response.

    Science.gov (United States)

    Alleva, Renata; Manzella, Nicola; Gaetani, Simona; Ciarapica, Veronica; Bracci, Massimo; Caboni, Maria Fiorenza; Pasini, Federica; Monaco, Federica; Amati, Monica; Borghi, Battista; Tomasetti, Marco

    2016-10-01

    Glyphosate (GLY) and organophosphorus insecticides such as chlorpyrifos (CPF) may cause DNA damage and cancer in exposed individuals through mitochondrial dysfunction. Polyphenols ubiquitously present in fruits and vegetables, have been viewed as antioxidant molecules, but also influence mitochondrial homeostasis. Here, honey containing polyphenol compounds was evaluated for its potential protective effect on pesticide-induced genotoxicity. Honey extracts from four floral organic sources were evaluated for their polyphenol content, antioxidant activity, and potential protective effects on pesticide-related mitochondrial destabilization, reactive oxygen and nitrogen species formation, and DNA damage response in human bronchial epithelial and neuronal cells. The protective effect of honey was, then evaluated in a residential population chronically exposed to pesticides. The four honey types showed a different polyphenol profile associated with a different antioxidant power. The pesticide-induced mitochondrial dysfunction parallels ROS formation from mitochondria (mtROS) and consequent DNA damage. Honey extracts efficiently inhibited pesticide-induced mtROS formation, and reduced DNA damage by upregulation of DNA repair through NFR2. Honey supplementation enhanced DNA repair activity in a residential population chronically exposed to pesticides, which resulted in a marked reduction of pesticide-induced DNA lesions. These results provide new insight regarding the effect of honey containing polyphenols on pesticide-induced DNA damage response. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Sugammadex for reversal of rocuronium-induced neuromuscular blockade in pediatric patients: A systematic review and meta-analysis.

    Science.gov (United States)

    Won, Young Ju; Lim, Byung Gun; Lee, Dong Kyu; Kim, Heezoo; Kong, Myoung Hoon; Lee, Il Ok

    2016-08-01

    Previous studies have shown that sugammadex, a modified γ-cyclodextrin, is a well-tolerated agent for the reversal of neuromuscular blockade (NMB) induced by a steroidal neuromuscular blocking drug in adult patients. However, its use has not been reviewed in pediatric patients. The aim of this meta-analysis was to evaluate the efficacy and safety of sugammadex in the reversal of rocuronium-induced NMB during surgery under general anesthesia in pediatric patients. A literature search was performed using the Pubmed, EMBASE: Drugs and pharmacology, Cochrane Central Register of Controlled Trials, and Cochrane Database of Systematic Reviews. Analysis was conducted using RevMan 5.3. Data collected from different trials were pooled; the weighted mean difference or the pooled risk ratio and the corresponding 95% confidence interval (CI) were used for analysis, and heterogeneity (I) assessment was performed. Six randomized controlled trials comparing 253 pediatric patients (age range, 2-18 years) were included in the final analysis. The mean time taken to reach a train-of-four ratio of ≥0.9 was significantly shorter in the sugammadex groups (2 and 4 mg/kg) than in the control group (neostigmine or placebo), although the heterogeneity was high. The weighted mean differences of the 2 and 4 mg/kg sugammadex groups were -7.15 (95% CI: -10.77 to -3.54; I = 96%; P = 0.0001) and -17.32 (95% CI: -29.31 to -5.32; I = 98%; P = 0.005), respectively. The extubation time in the sugammadex group was shorter than that in the control group; the weighted mean difference of the sugammadex group was -6.00 (95% CI: -11.46 to -0.53; I = 99%; P = 0.03). There was no significant difference between the groups in terms of the incidence of postanesthetic adverse events; the pooled risk ratio was 0.67 (95% CI: 0.27-1.71; I = 59%; P = 0.41). We suggest that sugammadex is fast and effective in reversing rocuronium-induced NMB in pediatric patients. Although there

  13. Carnosine reverses the aging-induced down regulation of brain regional serotonergic system.

    Science.gov (United States)

    Banerjee, Soumyabrata; Ghosh, Tushar K; Poddar, Mrinal K

    2015-12-01

    The purpose of the present investigation was to study the role of carnosine, an endogenous dipeptide biomolecule, on brain regional (cerebral cortex, hippocampus, hypothalamus and pons-medulla) serotonergic system during aging. Results showed an aging-induced brain region specific significant (a) increase in Trp (except cerebral cortex) and their 5-HIAA steady state level with an increase in their 5-HIAA accumulation and declination, (b) decrease in their both 5-HT steady state level and 5-HT accumulation (except cerebral cortex). A significant decrease in brain regional 5-HT/Trp ratio (except cerebral cortex) and increase in 5-HIAA/5-HT ratio were also observed during aging. Carnosine at lower dosages (0.5-1.0μg/Kg/day, i.t. for 21 consecutive days) didn't produce any significant response in any of the brain regions, but higher dosages (2.0-2.5μg/Kg/day, i.t. for 21 consecutive days) showed a significant response on those aging-induced brain regional serotonergic parameters. The treatment with carnosine (2.0μg/Kg/day, i.t. for 21 consecutive days), attenuated these brain regional aging-induced serotonergic parameters and restored towards their basal levels that observed in 4 months young control rats. These results suggest that carnosine attenuates and restores the aging-induced brain regional down regulation of serotonergic system towards that observed in young rats' brain regions. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Reversible acid-induced inactivation of the membrane fusion protein of Semliki Forest virus

    NARCIS (Netherlands)

    Waarts, BL; Smit, JM; Aneke, OJC; McInerney, GM; Liljestrom, P; Bittman, R; Wilschut, J

    Previously, it has been shown that the exposure of Semliki Forest virus (SFV) to a mildly acidic environment induces a rapid and complete loss of the ability of the virus to bind and fuse to target membranes added subsequently. In the present study, incubation of SFV at low pH followed by a specific

  15. Reversal by methylene blue of tetanic fade induced in cats by nitric oxide

    Directory of Open Access Journals (Sweden)

    C.R. Ambiel

    1998-03-01

    Full Text Available Previous data from our laboratory have indicated that nitric oxide (NO acting at the presynaptic level increases the amplitude of muscular contraction (AMC of the phrenic-diaphragm preparations isolated from indirectly stimulated rats, but, by acting at the postsynaptic level, it reduces the AMC when the preparations are directly stimulated. In the present study we investigated the effects induced by NO when tetanic frequencies of stimulation were applied to in vivo preparations (sciatic nerve-anterior tibial muscle of the cat. Intra-arterial injection of NO (0.75-1.5 mg/kg induced a dose-dependent increase in the Wedensky inhibition produced by high frequencies of stimulation applied to the motor nerve. Intra-arterial administration of 7.2 µg/kg methylene blue did not produce any change in AMC at low frequencies of nerve stimulation (0.2 Hz, but antagonized the NO-induced Wedensky inhibition. The experimental data suggest that NO-induced Wedensky inhibition may be mediated by the guanylate cyclase-cGMP pathway

  16. Go-6976 Reverses Hyperglycemia-Induced Insulin Resistance Independently of cPKC Inhibition in Adipocytes

    Science.gov (United States)

    Robinson, Katherine A.; Hegyi, Krisztina; Hannun, Yusuf A.; Buse, Maria G.; Sethi, Jaswinder K.

    2014-01-01

    Chronic hyperglycemia induces insulin resistance by mechanisms that are incompletely understood. One model of hyperglycemia-induced insulin resistance involves chronic preincubation of adipocytes in the presence of high glucose and low insulin concentrations. We have previously shown that the mTOR complex 1 (mTORC1) plays a partial role in the development of insulin resistance in this model. Here, we demonstrate that treatment with Go-6976, a widely used “specific” inhibitor of cPKCs, alleviates hyperglycemia-induced insulin resistance. However, the effects of mTOR inhibitor, rapamycin and Go-6976 were not additive and only rapamycin restored impaired insulin-stimulated AKT activation. Although, PKCα, (but not –β) was abundantly expressed in these adipocytes, our studies indicate cPKCs do not play a major role in causing insulin-resistance in this model. There was no evidence of changes in the expression or phosphorylation of PKCα, and PKCα knock-down did not prevent the reduction of insulin-stimulated glucose transport. This was also consistent with lack of IRS-1 phosphorylation on Ser-24 in hyperglycemia-induced insulin-resistant adipocytes. Treatment with Go-6976 did inhibit a component of the mTORC1 pathway, as evidenced by decreased phosphorylation of S6 ribosomal protein. Raptor knock-down enhanced the effect of insulin on glucose transport in insulin resistant adipocytes. Go-6976 had the same effect in control cells, but was ineffective in cells with Raptor knock-down. Taken together these findings suggest that Go-6976 exerts its effect in alleviating hyperglycemia-induced insulin-resistance independently of cPKC inhibition and may target components of the mTORC1 signaling pathway. PMID:25330241

  17. Fast light-induced reversible wettability of a zinc oxide nanorod array coated with a thin gold layer

    Science.gov (United States)

    Wei, Yuefan; Du, Hejun; Kong, Junhua; Tran, Van-Thai; Koh, Jia Kai; Zhao, Chenyang; He, Chaobin

    2017-11-01

    Zinc oxide (ZnO) has gained much attention recently due to its excellent physical and chemical properties, and has been extensively studied in energy harvesting applications such as photovoltaic and piezoelectric devices. In recent years, its reversible wettability has also attracted increasing interest. The wettability of ZnO nanostructures with various morphologies has been studied. However, to the best of our knowledge, there is still a lack of investigations on further modifications on ZnO to provide more benefits than pristine ZnO. Comprehensive studies on the reversible wettability are still needed. In this study, a ZnO nanorod array was prepared via a hydrothermal process and subsequently coated with thin gold layers with varied thickness. The morphologies and structures, optical properties and wettability were investigated. It is revealed that the ZnO-Au system possesses recoverable wettability upon switching between visible-ultraviolet light and a dark environment, which is verified by the contact angle change. The introduction of the thin gold layer to the ZnO nanorod array effectively increases the recovery rate of the wettability. The improvements are attributed to the hierarchical structures, which are formed by depositing thin gold layers onto the ZnO nanorod array, the visible light sensitivity due to the plasmonic effect of the deposited gold, as well as the fast charge-induced surface status change upon light illumination or dark storage. The improvement is beneficial to applications in environmental purification, energy harvesting, micro-lenses, and smart devices.

  18. Martensite phase reversion-induced nano/ ultrafine grained AISI 304L stainless steel with magnificent mechanical properties

    Directory of Open Access Journals (Sweden)

    Mohammad Shirdel

    2015-06-01

    Full Text Available Austenitic stainless steels are extensively used in various applications requiring good corrosion resistance and formability. In the current study, the formation of nano/ ultrafine grained austenitic microstructure in a microalloyed AISI 304L stainless steel was investigated by the advanced thermomechanical process of reversion of strain-induced martensite. For this purpose, samples were subjected to heavy cold rolling to produce a nearly complete martensitic structure. Subsequently, a wide range of annealing temperatures (600 to 800°C and times (1 to 240 min were employed to assess the reversion behavior and to find the best annealing condition for the production of the nano/ultrafine grained austenitic microstructure. Microstructural characterizations have been performed using X-ray diffraction (XRD, scanning electron microscopy (SEM, and magnetic measurement, whereas the mechanical properties were assessed by tensile and hardness tests. After thermomechanical treatment, a very fine austenitic structure was obtained, which was composed of nano sized grains of ~ 85 nm in an ultrafine grained matrix with an average grain size of 480 nm. This microstructure exhibited superior mechanical properties: high tensile strength of about 1280 MPa with a desirable elongation of about 41%, which can pave the way for the application of these sheets in the automotive industry.

  19. L-cysteine reversibly inhibits glucose-induced biphasic insulin secretion and ATP production by inactivating PKM2.

    Science.gov (United States)

    Nakatsu, Daiki; Horiuchi, Yuta; Kano, Fumi; Noguchi, Yoshiyuki; Sugawara, Taichi; Takamoto, Iseki; Kubota, Naoto; Kadowaki, Takashi; Murata, Masayuki

    2015-03-10

    Increase in the concentration of plasma L-cysteine is closely associated with defective insulin secretion from pancreatic β-cells, which results in type 2 diabetes (T2D). In this study, we investigated the effects of prolonged L-cysteine treatment on glucose-stimulated insulin secretion (GSIS) from mouse insulinoma 6 (MIN6) cells and from mouse pancreatic islets, and found that the treatment reversibly inhibited glucose-induced ATP production and resulting GSIS without affecting proinsulin and insulin synthesis. Comprehensive metabolic analyses using capillary electrophoresis time-of-flight mass spectrometry showed that prolonged L-cysteine treatment decreased the levels of pyruvate and its downstream metabolites. In addition, methyl pyruvate, a membrane-permeable form of pyruvate, rescued L-cysteine-induced inhibition of GSIS. Based on these results, we found that both in vitro and in MIN6 cells, L-cysteine specifically inhibited the activity of pyruvate kinase muscle isoform 2 (PKM2), an isoform of pyruvate kinases that catalyze the conversion of phosphoenolpyruvate to pyruvate. L-cysteine also induced PKM2 subunit dissociation (tetramers to dimers/monomers) in cells, which resulted in impaired glucose-induced ATP production for GSIS. DASA-10 (NCGC00181061, a substituted N,N'-diarylsulfonamide), a specific activator for PKM2, restored the tetramer formation and the activity of PKM2, glucose-induced ATP production, and biphasic insulin secretion in L-cysteine-treated cells. Collectively, our results demonstrate that impaired insulin secretion due to exposure to L-cysteine resulted from its direct binding and inactivation of PKM2 and suggest that PKM2 is a potential therapeutic target for T2D.

  20. Endoplasmic reticulum stress-induced resistance to doxorubicin is reversed by paeonol treatment in human hepatocellular carcinoma cells.

    Directory of Open Access Journals (Sweden)

    Lulu Fan

    Full Text Available BACKGROUND: Endoplasmic reticulum stress (ER stress is generally activated in solid tumors and results in tumor cell anti-apoptosis and drug resistance. Paeonol (Pae, 2-hydroxy-4-methoxyacetophenone, is a natural product extracted from the root of Paeonia Suffruticosa Andrew. Although Pae displays anti-neoplastic activity and increases the efficacy of chemotherapeutic drugs in various cell lines and in animal models, studies related to the effect of Pae on ER stress-induced resistance to chemotherapeutic agents in hepatocellular carcinoma (HCC are poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we investigated the effect of the endoplasmic reticulum (ER stress response during resistance of human hepatocellular carcinoma cells to doxorubicin. Treatment with the ER stress-inducer tunicamycin (TM before the addition of doxorubicin reduced the rate of apoptosis induced by doxorubicin. Interestingly, co-pretreatment with tunicamycin and Pae significantly increased apoptosis induced by doxorubicin. Furthermore, induction of ER stress resulted in increasing expression of COX-2 concomitant with inactivation of Akt and up-regulation of the pro-apoptotic transcription factor CHOP (GADD153 in HepG2 cells. These cellular changes in gene expression and Akt activation may be an important resistance mechanism against doxorubicin in hepatocellular carcinoma cells undergoing ER stress. However, co-pretreatment with tunicamycin and Pae decreased the expression of COX-2 and levels of activation of Akt as well as increasing the levels of CHOP in HCC cells. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that Pae reverses ER stress-induced resistance to doxorubicin in human hepatocellular carcinoma cells by targeting COX-2 mediated inactivation of PI3K/AKT/CHOP.

  1. Ciguatoxin-induced catecholamine secretion in bovine chromaffin cells: mechanism of action and reversible inhibition by brevenal.

    Science.gov (United States)

    Nguyen-Huu, Truong D; Mattei, César; Wen, Peter J; Bourdelais, Andrea J; Lewis, Richard J; Benoit, Evelyne; Baden, Daniel G; Molgó, Jordi; Meunier, Frédéric A

    2010-10-01

    Ciguatoxin (P-CTX-1B) from the dinoflagellate Gambierdiscus toxicus, belongs to the family of polyether neurotoxins responsible for the neurological poisoning disorder ciguatera. Although it is the most widespread marine-borne disease affecting humans, there is no current FDA-approved treatment available except for symptomatic therapies. In this paper, we report that P-CTX-1B promotes catecholamine secretion from bovine chromaffin cells, an effect that is insensitive to concomitant activation of capacitative Ca(2+) entry. Moreover, we confirm that brevenal, a polyether from the dinoflagellate Karenia brevis, blocks P-CTX-1B-induced catecholamine secretion. This effect is partially reversible. Our results therefore raise the prospect of finding functional antagonists for P-CTX-1B that could be useful for the treatment of ciguatera. Copyright 2009 Elsevier Ltd. All rights reserved.

  2. Energetic rationale for an unexpected and abrupt reversal of guanidinium chloride-induced unfolding of peptide deformylase.

    Science.gov (United States)

    Berg, Alexander K; Manokaran, Sumathra; Eiler, Daniel; Kooren, Joel; Mallik, Sanku; Srivastava, D K

    2008-01-01

    Peptide deformylase (PDF) catalyzes the removal of formyl group from the N-terminal methionine residues of nascent proteins in prokaryotes, and this enzyme is a high priority target for antibiotic design. In pursuit of delineating the structural-functional features of Escherichia coli PDF (EcPDF), we investigated the mechanistic pathway for the guanidinium chloride (GdmCl)-induced unfolding of the enzyme by monitoring the secondary structural changes via CD spectroscopy. The experimental data revealed that EcPDF is a highly stable enzyme, and it undergoes slow denaturation in the presence of varying concentrations of G