Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko
2011-01-01
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.
HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors
DEFF Research Database (Denmark)
Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran
2017-01-01
BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...
TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats
Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin
2011-01-01
In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472
Li, Runqin; Zhang, Yinglin
2016-01-01
Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632
Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel
1972-01-01
Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137
Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles
International Nuclear Information System (INIS)
Bavand, M.R.; Laub, O.
1988-01-01
Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein
Immune pressure analysis of protease and reverse transcriptase ...
African Journals Online (AJOL)
/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina
2013-01-01
The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity
House, M.L.; Kim, C.H.; Reno, P.W.
1998-01-01
Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.
Directory of Open Access Journals (Sweden)
Oluwafeyisetan O. Adebiyi
2015-12-01
Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.
Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer
International Nuclear Information System (INIS)
Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen
2001-01-01
Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts
International Nuclear Information System (INIS)
Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.
1986-01-01
The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)
DEFF Research Database (Denmark)
Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin
2013-01-01
Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...
Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?
Nolan, David
2005-01-01
Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Ana Luiza Chaves Valadão
2015-06-01
Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.
Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X
2014-07-01
Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.
Reverse transcriptase inhibitors as microbicides.
Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido
2012-01-01
The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory
Directory of Open Access Journals (Sweden)
Edward J. Steele
2017-11-01
Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.
Fang, Evandro Fei; Ng, Tzi Bun
2015-04-01
Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.
Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.
Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao
2015-10-01
Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.
The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.
Zhao, Chen; Pyle, Anna Marie
2017-12-01
The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Collins, Kathleen; Nilsen, Timothy W
2013-08-01
Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.
Directory of Open Access Journals (Sweden)
Ajay Kumar
2010-01-01
Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.
Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.
Directory of Open Access Journals (Sweden)
Anna Figueiredo
2006-11-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.
Energy Technology Data Exchange (ETDEWEB)
Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)
2010-03-26
The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-07-01
HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.
International Nuclear Information System (INIS)
Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.
2004-01-01
Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies
International Nuclear Information System (INIS)
Spadafora, C.; Sciamanna, I.; Misteli, T.
2009-01-01
Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma
Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A
2013-11-01
Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.
International Nuclear Information System (INIS)
Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong
2007-01-01
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation
Energy Technology Data Exchange (ETDEWEB)
Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn
2007-04-06
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.
DEFF Research Database (Denmark)
Lundgren, Jens
2008-01-01
BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...
Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase
DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami
2012-01-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma
Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...
Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification
Energy Technology Data Exchange (ETDEWEB)
Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P
2011-12-08
RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.
R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)
2013-01-01
textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the
DEFF Research Database (Denmark)
Borges, Álvaro H; Lundh, Andreas; Tendal, Britta
2016-01-01
BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...
Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells
Directory of Open Access Journals (Sweden)
Yong Teng
2014-02-01
Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.
Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .
Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M
2018-01-01
Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.
Reverse transcriptase inhibitors as potential colorectal microbicides.
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J
2009-05-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.
Sivan, Sree Kanth; Manga, Vijjulatha
2010-06-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.
International Nuclear Information System (INIS)
Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong
2005-01-01
The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)
Oude Essink, B. B.; Das, A. T.; Berkhout, B.
1995-01-01
Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA
DEFF Research Database (Denmark)
Kirk, Ole; Lundgren, Jens D; Pedersen, Court
2003-01-01
BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....
Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.
Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V
2011-12-20
Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.
Directory of Open Access Journals (Sweden)
Elisabeth Humphris-Narayanan
Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.
Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F
2008-10-01
Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Energy Technology Data Exchange (ETDEWEB)
Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)
2016-12-15
The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.
Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.
2004-01-01
Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add
Nicolas Sluis-Cremer
2014-01-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis
2017-02-01
Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano
2017-01-17
Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.
Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.
2009-01-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271
Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda
2016-01-01
Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2013-11-01
Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.
2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase
International Nuclear Information System (INIS)
Starnes, M.C.
1988-01-01
2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells
Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark
2013-11-01
BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.
Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X
2002-12-01
Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.
Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.
Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari
2018-05-03
Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.
Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.
Sharma, Mamta; Saravolatz, Louis D
2013-02-01
Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.
Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2010-03-01
Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.
2010-01-01
Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved
Directory of Open Access Journals (Sweden)
Lucianna Helene Santos
2015-11-01
Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.
Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon
2015-08-01
The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription
Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.
Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E
2013-06-18
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.
2011-01-01
The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.
Directory of Open Access Journals (Sweden)
Dolores Bautista-España
Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2008-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...
Wang, Shuwen; Zhu, Jiyue
2003-05-23
The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.
Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
Directory of Open Access Journals (Sweden)
Ma Bi
2017-10-01
Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.
Czech Academy of Sciences Publication Activity Database
Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko
2016-01-01
Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016
Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis
2010-01-01
Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948
Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M
2016-04-01
Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.
Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.
Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A
2011-01-01
We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.
A second chance for telomerase reverse transcriptase in anticancer immunotherapy.
Zanetti, Maurizio
2017-02-01
Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.
Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J
2009-06-01
Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.
International Nuclear Information System (INIS)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki
2015-01-01
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)
2015-10-23
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.
Directory of Open Access Journals (Sweden)
Weizi Liang
Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
Directory of Open Access Journals (Sweden)
Lapadula Giuseppe
2007-05-01
Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C
2000-05-18
To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.
Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind
2014-04-01
A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.
International Nuclear Information System (INIS)
Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado
2011-01-01
LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy
International Nuclear Information System (INIS)
Ferkous, F.; Saihi, Y.
2018-01-01
Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)
Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue
2013-05-01
To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis
I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)
2015-01-01
textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have
Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul
2004-01-01
The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562
A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...
Lescot, Magali
2015-11-27
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki
2015-01-01
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Li, An; Ziehr, Jessica L; Johnson, Kenneth A
2017-04-21
Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Gronenborn Angela M
2010-05-01
Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.
[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].
Tarasova, O A; Filimonov, D A; Poroikov, V V
2017-10-01
Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-11-01
Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.
Directory of Open Access Journals (Sweden)
Ammad Ahmad Farooqi
2018-04-01
Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.
International Nuclear Information System (INIS)
Zhu Hanneng; Chen Wenying; Xiong Sidong
2000-01-01
Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)
International Nuclear Information System (INIS)
Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun
2007-01-01
Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers
Berman, Andrea J; Gooding, Anne R; Cech, Thomas R
2010-10-01
The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.
Directory of Open Access Journals (Sweden)
Mok Helen OL
2006-09-01
Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome
Directory of Open Access Journals (Sweden)
Marcin Kierczak
2009-10-01
Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-01-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...
DEFF Research Database (Denmark)
Fox, Zoe; Phillips, Andrew; Cohen, Cal
2008-01-01
the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...
Directory of Open Access Journals (Sweden)
Niu Meijuan
2004-10-01
Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.
Amendola, R
1994-11-01
The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.
Reverse transcriptase directs viral evolution in a deep ocean methane seep
Paul, B. G.; Bagby, S. C.
2013-12-01
Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.
Sluis-Cremer, Nicolas
2014-07-31
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni
2005-01-01
Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Directory of Open Access Journals (Sweden)
Liu Tiantian
2010-05-01
Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.
Directory of Open Access Journals (Sweden)
Warrilow David
2008-12-01
Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2014-07-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael
2012-01-01
Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...
Directory of Open Access Journals (Sweden)
Stefanou Nikolaos
2010-08-01
Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.
Directory of Open Access Journals (Sweden)
Ilaria eSciamanna
2016-02-01
Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado
2016-02-01
In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors
Directory of Open Access Journals (Sweden)
S. Ganguly
2008-01-01
Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.
Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania
2018-02-01
Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Francesca Carlini
Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.
Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.
Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M
2017-12-01
Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these
Directory of Open Access Journals (Sweden)
Isabel Hostettler
2014-12-01
Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...
Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z
2017-07-11
Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From
Ngai, Patrick H K; Ng, T B
2003-11-14
From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.
DEFF Research Database (Denmark)
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy
2011-01-01
Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...
Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong
2012-01-01
1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.
Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio
2016-09-30
We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.
Markowitz, Martin; Sarafianos, Stefan G
2018-07-01
4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.
Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni
2008-09-01
We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.
Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami
2017-06-01
We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.
Directory of Open Access Journals (Sweden)
Ru-Yin Tsai
2016-06-01
Conclusion: Resveratrol restores the antinociceptive effect of morphine by reversing morphine infusion-induced spinal cord neuroinflammation and increase in TNFR1 expression. The reversal of the morphine-induced increase in TNFR1 expression by resveratrol is partially due to reversal of the morphine infusion-induced increase in HDAC1 expression. Resveratrol pretreatment can be used as an adjuvant in clinical pain management for patients who need long-term morphine treatment or with neuropathic pain.
Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan
2012-01-01
The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.
Directory of Open Access Journals (Sweden)
Cha YJ
2014-09-01
Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600
Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin
2010-01-01
The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.
International Nuclear Information System (INIS)
Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin
2008-01-01
Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems
Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad
2016-05-01
Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.
Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong
2013-01-01
In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.
Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S
2014-06-01
The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.
Giacobbi, Nicholas S; Sluis-Cremer, Nicolas
2017-07-01
Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Mocroft, A; Horban, A; Clumeck, N
2006-01-01
increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Zhu, Tao; Niu, Deng-Ke
2013-03-05
Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.
Gnanasekaran, Ramachandran
2017-11-08
We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447
APOBEC3G inhibits elongation of HIV-1 reverse transcripts.
Directory of Open Access Journals (Sweden)
Kate N Bishop
2008-12-01
Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.
Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan
2016-05-01
Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.
Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat
2011-01-01
We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.
Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita
2018-01-01
Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673
Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R
2009-02-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2009-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331
Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.
Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D
2006-11-15
TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients
Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H
2015-12-15
Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M
2007-01-01
Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.
Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang
2017-06-16
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi
2017-12-01
We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M
2007-01-01
Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691
Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido
2013-09-01
Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.
Directory of Open Access Journals (Sweden)
Alessandra M. T. de Souza
2013-10-01
Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.
Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan
2010-12-12
Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.
DEFF Research Database (Denmark)
Sabin, Caroline A; Worm, Signe W; Weber, Rainer
2008-01-01
cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...
Directory of Open Access Journals (Sweden)
Madeleine Zerbato
Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.
Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis
2013-12-23
At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.
Directory of Open Access Journals (Sweden)
Meytal Galilee
2018-01-01
Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study
Risperidone-induced reversible neutropenia.
Kattalai Kailasam, Vasanth; Chima, Victoria; Nnamdi, Uchechukwu; Sharma, Kavita; Shah, Kairav
2017-01-01
This case report presents a 44-year-old man with a history of schizophrenia who developed neutropenia on risperidone therapy. The patient's laboratory reports showed a gradual decline of leukocytes and neutrophils after resolution and rechallenging. This was reversed with the discontinuation of risperidone and by switching to olanzapine. In this case report, we also discuss the updated evidence base for management of risperidone-induced neutropenia.
Aminocaproic Acid and Tranexamic Acid Fail to Reverse Dabigatran-Induced Coagulopathy.
Levine, Michael; Huang, Margaret; Henderson, Sean O; Carmelli, Guy; Thomas, Stephen H
In recent years, dabigatran has emerged as a popular alternative to warfarin for treatment of atrial fibrillation. If rapid reversal is required, however, no reversal agent has clearly been established. The primary purpose of this manuscript was to evaluate the efficacy of tranexamic acid and aminocaproic acid as agents to reverse dabigatran-induced coagulopathy. Rats were randomly assigned to 6 groups. Each rat received either dabigatran or oral placebo, followed by saline, tranexamic acid, or aminocaproic acid. An activated clotting test was used to measure the coagulopathy. Neither tranexamic acid nor aminocaproic acid successfully reversed dabigatran-induced coagulopathy. In this rodent model of dabigatran-induced coagulopathy, neither tranexamic acid nor aminocaproic acid were able to reverse the coagulopathy.
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang
2017-12-01
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50 = 0.04 μM) with decent antiviral potency (EC 50 = 7.4 μM) and no cytotoxicity (CC 50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Spackman, Erica; Suarez, David L
2005-01-01
Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.
International Nuclear Information System (INIS)
Freeman-Wittig, M.J.B.
1986-01-01
The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan
Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi
2014-01-01
Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.
Directory of Open Access Journals (Sweden)
Rami Kantor
2005-04-01
Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.
Energy Technology Data Exchange (ETDEWEB)
Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.
2017-02-06
The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Sukrit Silas
2017-07-01
Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.
Energy Technology Data Exchange (ETDEWEB)
Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)
2017-12-15
Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)
Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun
2017-09-01
The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.
Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato
2012-06-06
Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic
Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen
2016-03-01
Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.
Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W
2012-05-01
Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.
Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L
2017-11-08
The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
Light-induced reversible expansion of individual gold nanoplates
Directory of Open Access Journals (Sweden)
Jinsheng Lu
2017-10-01
Full Text Available Light-induced mechanical response of materials has been extensively investigated and widely utilized to convert light energy into mechanical energy directly. The metallic nanomaterials have excellent photothermal properties and show enormous potential in micromechanical actuators, etc. However, the photo-thermo-mechanical properties of individual metallic nanostructures have yet to be well investigated. Here, we experimentally demonstrate a way to realize light-induced reversible expansion of individual gold nanoplates on optical microfibers. The light-induced thermal expansion coefficient is obtained as 21.4 ± 4.6 ∼ 31.5 ± 4.2 μ·K-1 when the light-induced heating temperature of the gold nanoplates is 240 ∼ 490 °C. The photo-thermo-mechanical response time of the gold nanoplates is about 0.3 ± 0.1 s. This insight into the photo-thermo-mechanical properties of the gold nanoplates could deepen the understanding of the light-induced reversible expansion behavior in nanoscale and pave the way for applications based on this piezoelectric-like response, such as light-driven metallic micromotors.
Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang
2010-01-01
A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408
Directory of Open Access Journals (Sweden)
Yanrui Li
2010-01-01
Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
Directory of Open Access Journals (Sweden)
Su X
2016-11-01
Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation
Directory of Open Access Journals (Sweden)
Marius Lazea
2011-12-01
Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.
Telomerase reverse transcriptase promoter mutations in bladder cancer
DEFF Research Database (Denmark)
Allory, Yves; Beukers, Willemien; Sagrera, Ana
2014-01-01
for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...
Directory of Open Access Journals (Sweden)
Parvathi Chary
Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.
Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L
1999-12-17
Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.
de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão
2008-08-01
A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.
Directory of Open Access Journals (Sweden)
Johannes Van Staden
2010-10-01
Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.
Reversible Posterior Leukoencephalopathy Syndrome Induced by Pazopanib
International Nuclear Information System (INIS)
Chelis, Leonidas; Kakolyris, Stylianos; Souftas, Vasilios; Amarantidis, Kiriakos; Xenidis, Nikolaos; Chamalidou, Eleni; Dimopoulos, Prokopios; Michailidis, Prodromos; Christakidis, Evagelos; Prassopoulos, Panagiotis
2012-01-01
The reversible posterior leukoencephalopathy syndrome is a clinical/radiological syndrome characterized by headache, seizures, impaired vision, acute hypertension, and typical magnetic resonance imaging findings. There are several reports in the literature that depict its occurrence in cancer patients. The list of common anticancer and supportive care drugs that predispose to reversible posterior leukoencephalopathy syndrome is expanding and includes not only a large number of chemotherapeutic agents but also an increased number of new targeted drugs, particularly angiogenesis inhibitors such as bevacizumab,sorefenib and sunitinib. Pazopanib is an oral tyrosine kinase inhibitor targeting vascular endothelial growth factor receptor, platelet-derived growth factor receptor, and c-Kit which after a positive phase III randomized clinical trial in patients with advanced renal cell cancer received FDA approval for the treatment of advanced renal cell carcinoma. Until now no cases of reversible posterior leukoencephalopathy syndrome induced by pazopanib have been reported. We present the case of a 40 years old female patient with heavily pre-treated metastatic renal cell carcinoma who received pazopanib as salvage treatment. After 21 days of pazopanib therapy the patient referred to the emergency department with epileptic seizure, impaired vision at both eyes and headache. MRI of the brain revealed subcortical oedema at the occipital and parietal lobes bilaterally. She was treated with anticonvulsants, i.v. administration of mannitol and antihypertensives and she recovered completely from her symptoms and was discharged on the tenth hospital day. A brain MRI performed 3 weeks after showed that the subcortical oedema had been subsided. In conclusion this is the first case of pazopanib induced reversible posterior leukoencephalopathy syndrome. Although usually reversible, this syndrome is a serious and potentially life threatening adverse effect, if untreated, that should
Reversible Posterior Leukoencephalopathy Syndrome Induced by Pazopanib
Directory of Open Access Journals (Sweden)
Chelis Leonidas
2012-10-01
Full Text Available Abstract Background The reversible posterior leukoencephalopathy syndrome is a clinical/radiological syndrome characterized by headache, seizures, impaired vision, acute hypertension, and typical magnetic resonance imaging findings. There are several reports in the literature that depict its occurrence in cancer patients. The list of common anticancer and supportive care drugs that predispose to reversible posterior leukoencephalopathy syndrome is expanding and includes not only a large number of chemotherapeutic agents but also an increased number of new targeted drugs, particularly angiogenesis inhibitors such as bevacizumab,sorefenib and sunitinib. Pazopanib is an oral tyrosine kinase inhibitor targeting vascular endothelial growth factor receptor, platelet-derived growth factor receptor, and c-Kit which after a positive phase III randomized clinical trial in patients with advanced renal cell cancer received FDA approval for the treatment of advanced renal cell carcinoma. Until now no cases of reversible posterior leukoencephalopathy syndrome induced by pazopanib have been reported. Case report We present the case of a 40 years old female patient with heavily pre-treated metastatic renal cell carcinoma who received pazopanib as salvage treatment. After 21 days of pazopanib therapy the patient referred to the emergency department with epileptic seizure, impaired vision at both eyes and headache. MRI of the brain revealed subcortical oedema at the occipital and parietal lobes bilaterally. She was treated with anticonvulsants, i.v. administration of mannitol and antihypertensives and she recovered completely from her symptoms and was discharged on the tenth hospital day. A brain MRI performed 3 weeks after showed that the subcortical oedema had been subsided. Conclusion In conclusion this is the first case of pazopanib induced reversible posterior leukoencephalopathy syndrome. Although usually reversible, this syndrome is a serious and
LENUS (Irish Health Repository)
Bansode, Vijay B
2011-10-13
Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge
Directory of Open Access Journals (Sweden)
Mengjuan Zhu
2016-03-01
Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.
International Nuclear Information System (INIS)
Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha
2005-01-01
Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols
Inactivation of Ca2+-induced ciliary reversal by high-salt extraction in the cilia of Paramecium.
Kutomi, Osamu; Seki, Makoto; Nakamura, Shogo; Kamachi, Hiroyuki; Noguchi, Munenori
2013-10-01
Intracellular Ca(2+) induces ciliary reversal and backward swimming in Paramecium. However, it is not known how the Ca(2+) signal controls the motor machinery to induce ciliary reversal. We found that demembranated cilia on the ciliated cortical sheets from Paramecium caudatum lost the ability to undergo ciliary reversal after brief extraction with a solution containing 0.5 M KCl. KNO(3), which is similar to KCl with respect to chaotropic effect; it had the same effect as that of KCl on ciliary response. Cyclic AMP antagonizes Ca(2+)-induced ciliary reversal. Limited trypsin digestion prevents endogenous A-kinase and cAMP-dependent phosphorylation of an outer arm dynein light chain and induces ciliary reversal. However, the trypsin digestion prior to the high-salt extraction did not affect the inhibition of Ca(2+)-induced ciliary reversal caused by the high-salt extraction. Furthermore, during the course of the high-salt extraction, some axonemal proteins were extracted from ciliary axonemes, suggesting that they may be responsible for Ca(2+)-induced ciliary reversal.
Boer, H.D. de; Egmond, J. van; Booij, L.H.D.J.; Driessen, J.J.
2009-01-01
A case is reported in which a child with Duchenne muscular dystrophy received a dose of sugammadex to reverse a rocuronium-induced profound neuromuscular block. Sugammadex is the first selective relaxant binding agent and reverses rocuronium- and vecuronium-induced neuromuscular block. A fast and
Directory of Open Access Journals (Sweden)
Johnson Barry C
2012-12-01
Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.
International Nuclear Information System (INIS)
Lund, Kaleb C.; Wallace, Kendall B.
2008-01-01
Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug
Directory of Open Access Journals (Sweden)
Mark A Winters
Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.
Idarucizumab for Reversing Dabigatran-Induced Anticoagulation: A Systematic Review.
Thibault, Nathan; Morrill, Amanda M; Willett, Kristine C
The approval of the oral direct thrombin inhibitor, dabigatran etexilate, gave patients an alternative to oral anticoagulation with warfarin. Like all anticoagulants, the primary adverse event (AE) associated with dabigatran is bleeding. Until the FDA approval of idarucizumab, there had been no reversal agent for dabigatran-induced anticoagulation in patients with life-threatening or uncontrollable bleeding, or those requiring emergent procedures. The primary purpose of this review is to summarize the safety and efficacy of idarucizumab, a monoclonal antibody fragment, and its use as a reversal agent for dabigatran. A literature search was conducted through MEDLINE (1946 to November week 1 2015) and Embase (1980-2015 week 46) using the search term idarucizumab. Clinicaltrials.gov was consulted for a comprehensive list of ongoing and completed studies. Additional studies were identified through bibliographical citations. Clinical trials in animals and humans published in English evaluating the safety and efficacy of idarucizumab for reversal of anticoagulant treatment with dabigatran were included for review. Idarucizumab has been shown to significantly reverse the anticoagulant effects of dabigatran in both healthy volunteers and patients requiring a reversal agent because of either overt bleeding or an emergency surgery or invasive procedure. The most common AEs were headache, nasopharyngitis, back pain, skin irritation, hypokalemia, delirium, constipation, pyrexia, and pneumonia. Deaths reported in idarucizumab studies were attributed to either the index event or a preexisting comorbidity. Most adverse effects were minor, but 21 serious AEs have been reported in the published data including thrombotic events. Given the increased use of direct oral anticoagulants, such as dabigatran, a need for specific reversal agents exists. Idarucizumab has been shown to be safe and effective in the reversal of dabigatran-induced anticoagulation in patients requiring emergent
Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R
2015-01-01
Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once
Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B
2018-02-06
Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.
DEFF Research Database (Denmark)
Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L
2012-01-01
We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....
Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P
2000-05-04
Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.
Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni
2016-01-01
Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647
Directory of Open Access Journals (Sweden)
Jessica H Brehm
Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.
Directory of Open Access Journals (Sweden)
Jie Xu
Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.
The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers
Oude Essink, B. B.; Berkhout, B.
1999-01-01
Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by
N-Acetylcysteine Reverses Cocaine Induced Metaplasticity
Moussawi, Khaled; Pacchioni, Alejandra; Moran, Megan; Olive, M. Foster; Gass, Justin T.; Lavin, Antonieta; Kalivas, Peter W
2009-01-01
Cocaine addiction is characterized by an impaired ability to develop adaptive behaviors that can compete with cocaine seeking, implying a deficit in the ability to induce plasticity in cortico-accumbens circuitry critical for regulating motivated behavior. RWe found that rats withdrawn from cocaine self-administration had a marked in vivo deficit in the ability to develop long-term potentation (LTP) and depression (LTD) in the nucleus accumbens core subregion following stimulation of prefrontal cortex. N-acetylcysteine treatment prevents relapse in animal models and craving in humans by activating cystine-glutamate exchange and thereby stimulating extrasynaptic metabotropic glutamate receptors (mGluR). N-acetylcysteine treatment restored the ability to induce LTP and LTD by indirectly stimulating mGluR2/3 and mGluR5, respectively. Cocaine self-administration induces metaplasticity that inhibits the further induction of synaptic plasticity, and this impairment can be reversed by N-acetylcysteine, a drug that also prevents relapse. PMID:19136971
N-Acetylcysteine reverses cocaine-induced metaplasticity.
Moussawi, Khaled; Pacchioni, Alejandra; Moran, Megan; Olive, M Foster; Gass, Justin T; Lavin, Antonieta; Kalivas, Peter W
2009-02-01
Cocaine addiction is characterized by an impaired ability to develop adaptive behaviors that can compete with cocaine seeking, implying a deficit in the ability to induce plasticity in cortico-accumbens circuitry crucial for regulating motivated behavior. We found that rats withdrawn from cocaine self-administration had a marked in vivo deficit in the ability to develop long-term potentiation (LTP) and long-term depression (LTD) in the nucleus accumbens core subregion after stimulation of the prefrontal cortex. N-acetylcysteine (NAC) treatment prevents relapse in animal models and craving in humans by activating cystine-glutamate exchange and thereby stimulating extrasynaptic metabotropic glutamate receptors (mGluR). NAC treatment of rats restored the ability to induce LTP and LTD by indirectly stimulating mGluR2/3 and mGluR5, respectively. Our findings show that cocaine self-administration induces metaplasticity that inhibits further induction of synaptic plasticity, and this impairment can be reversed by NAC, a drug that also prevents relapse.
Song, Yue; Shen, Keng; He, Chun-Xia
2007-09-01
To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells
Directory of Open Access Journals (Sweden)
Markus Hecht
Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic
Seizure-induced brain lesions: A wide spectrum of variably reversible MRI abnormalities
International Nuclear Information System (INIS)
Cianfoni, A.; Caulo, M.; Cerase, A.; Della Marca, G.; Falcone, C.; Di Lella, G.M.; Gaudino, S.; Edwards, J.; Colosimo, C.
2013-01-01
Introduction MRI abnormalities in the postictal period might represent the effect of the seizure activity, rather than its structural cause. Material and Methods Retrospective review of clinical and neuroimaging charts of 26 patients diagnosed with seizure-related MR-signal changes. All patients underwent brain-MRI (1.5-Tesla, standard pre- and post-contrast brain imaging, including DWI-ADC in 19/26) within 7 days from a seizure and at least one follow-up MRI, showing partial or complete reversibility of the MR-signal changes. Extensive clinical work-up and follow-up, ranging from 3 months to 5 years, ruled out infection or other possible causes of brain damage. Seizure-induced brain-MRI abnormalities remained a diagnosis of exclusion. Site, characteristics and reversibility of MRI changes, and association with characteristics of seizures were determined. Results MRI showed unilateral (13/26) and bilateral abnormalities, with high (24/26) and low (2/26) T2-signal, leptomeningeal contrast-enhancement (2/26), restricted diffusion (9/19). Location of abnormality was cortical/subcortical, basal ganglia, white matter, corpus callosum, cerebellum. Hippocampus was involved in 10/26 patients. Reversibility of MRI changes was complete in 15, and with residual gliosis or focal atrophy in 11 patients. Reversibility was noted between 15 and 150 days (average, 62 days). Partial simple and complex seizures were associated with hippocampal involvement (p = 0.015), status epilepticus with incomplete reversibility of MRI abnormalities (p = 0.041). Conclusions Seizure or epileptic status can induce transient, variably reversible MRI brain abnormalities. Partial seizures are frequently associated with hippocampal involvement and status epilepticus with incompletely reversible lesions. These seizure-induced MRI abnormalities pose a broad differential diagnosis; increased awareness may reduce the risk of misdiagnosis and unnecessary intervention
Seizure-induced brain lesions: A wide spectrum of variably reversible MRI abnormalities
Energy Technology Data Exchange (ETDEWEB)
Cianfoni, A., E-mail: acianfoni@hotmail.com [Neuroradiology, Neurocenter of Italian Switzerland–Ospedale regionale Lugano, Via Tesserete 46, Lugano, 6900, CH (Switzerland); Caulo, M., E-mail: caulo@unich.it [Department of Neuroscience and Imaging, University of Chieti, Via dei Vestini 33, 6610 Chieti. Italy (Italy); Cerase, A., E-mail: alfonsocerase@gmail.com [Unit of Neuroimaging and Neurointervention NINT, Department of Neurological and Sensorineural Sciences, Azienda Ospedaliera Universitaria Senese, Policlinico “Santa Maria alle Scotte”, V.le Bracci 16, Siena (Italy); Della Marca, G., E-mail: dellamarca@rm.unicatt.it [Neurology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy); Falcone, C., E-mail: carlo_falc@libero.it [Radiology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy); Di Lella, G.M., E-mail: gdilella@rm.unicatt.it [Radiology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy); Gaudino, S., E-mail: sgaudino@sirm.org [Radiology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy); Edwards, J., E-mail: edwardjc@musc.edu [Neuroscience Dept., Medical University of South Carolina, 96J Lucas st, 29425, Charleston, SC (United States); Colosimo, C., E-mail: colosimo@rm.unicatt.it [Radiology Dept., Catholic University of Rome, L.go F Vito 1, 00100, Rome (Italy)
2013-11-01
Introduction MRI abnormalities in the postictal period might represent the effect of the seizure activity, rather than its structural cause. Material and Methods Retrospective review of clinical and neuroimaging charts of 26 patients diagnosed with seizure-related MR-signal changes. All patients underwent brain-MRI (1.5-Tesla, standard pre- and post-contrast brain imaging, including DWI-ADC in 19/26) within 7 days from a seizure and at least one follow-up MRI, showing partial or complete reversibility of the MR-signal changes. Extensive clinical work-up and follow-up, ranging from 3 months to 5 years, ruled out infection or other possible causes of brain damage. Seizure-induced brain-MRI abnormalities remained a diagnosis of exclusion. Site, characteristics and reversibility of MRI changes, and association with characteristics of seizures were determined. Results MRI showed unilateral (13/26) and bilateral abnormalities, with high (24/26) and low (2/26) T2-signal, leptomeningeal contrast-enhancement (2/26), restricted diffusion (9/19). Location of abnormality was cortical/subcortical, basal ganglia, white matter, corpus callosum, cerebellum. Hippocampus was involved in 10/26 patients. Reversibility of MRI changes was complete in 15, and with residual gliosis or focal atrophy in 11 patients. Reversibility was noted between 15 and 150 days (average, 62 days). Partial simple and complex seizures were associated with hippocampal involvement (p = 0.015), status epilepticus with incomplete reversibility of MRI abnormalities (p = 0.041). Conclusions Seizure or epileptic status can induce transient, variably reversible MRI brain abnormalities. Partial seizures are frequently associated with hippocampal involvement and status epilepticus with incompletely reversible lesions. These seizure-induced MRI abnormalities pose a broad differential diagnosis; increased awareness may reduce the risk of misdiagnosis and unnecessary intervention.
Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun
2016-11-01
A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.
Directory of Open Access Journals (Sweden)
Winny Xie
2013-12-01
Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.
International Nuclear Information System (INIS)
Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.
1999-01-01
We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia
2011-06-01
Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.
Reversible Age-Related Phenotypes Induced during Larval Quiescence in C. elegans
Roux, Antoine E.; Langhans, Kelley; Huynh, Walter; Kenyon, Cynthia
2017-01-01
Summary Cells can enter quiescent states in which cell cycling and growth are suspended. We find that during a long developmental arrest (quiescence) induced by starvation, newly-hatched C. elegans acquire features associated with impaired proteostasis and aging: mitochondrial fission, ROS production, protein aggregation, decreased proteotoxic-stress resistance, and at the organismal level, decline of mobility and high mortality. All signs of aging but one, the presence of protein aggregates, were reversed upon return to development induced by feeding. The endoplasmic reticulum receptor IRE-1 is completely required for recovery, and the downstream transcription factor XBP-1, as well as a protein kinase, KGB-1, are partially required. Interestingly, kgb-1(−) mutants that do recover fail to reverse aging-like mitochondrial phenotypes and have a short adult lifespan. Our study describes the first pathway that reverses phenotypes of aging at the exit of prolonged quiescence. PMID:27304510
Yokoyama, Ken'ichi; Hashimoto, Tatsuki; Sakai, Jun'ichi
2017-11-01
The first dynamic interactions between hydrogen and the stress-induced reverse transformation have been investigated by performing an unloading test on a Ni-Ti superelastic alloy subjected to hydrogen charging under a constant applied strain in the elastic deformation region of the martensite phase. Upon unloading the specimen, charged with a small amount of hydrogen, no change in the behaviour of the stress-induced reverse transformation is observed in the stress-strain curve, although the behaviour of the stress-induced martensite transformation changes. With increasing amount of hydrogen charging, the critical stress for the reverse transformation markedly decreases. Eventually, for a larger amount of hydrogen charging, the reverse transformation does not occur, i.e. there is no recovery of the superelastic strain. The residual martensite phase on the side surface of the unloaded specimen is confirmed by X-ray diffraction. Upon training before the unloading test, the properties of the reverse transformation slightly recover after ageing in air at room temperature. The present study indicates that to change the behaviour of the reverse transformation a larger amount of hydrogen than that for the martensite transformation is necessary. In addition, it is likely that a substantial amount of hydrogen in solid solution more strongly suppresses the reverse transformation than hydrogen trapped at defects, thereby stabilising the martensite phase.
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.
Cios, G.; Tokarski, T.; Żywczak, A.; Dziurka, R.; Stępień, M.; Gondek, Ł.; Marciszko, M.; Pawłowski, B.; Wieczerzak, K.; Bała, P.
2017-10-01
This paper presents a comprehensive study on the strain-induced martensitic transformation and reversion transformation of the strain-induced martensite in AISI 304 stainless steel using a number of complementary techniques such as dilatometry, calorimetry, magnetometry, and in-situ X-ray diffraction, coupled with high-resolution microstructural transmission Kikuchi diffraction analysis. Tensile deformation was applied at temperatures between room temperature and 213 K (-60 °C) in order to obtain a different volume fraction of strain-induced martensite (up to 70 pct). The volume fraction of the strain-induced martensite, measured by the magnetometric method, was correlated with the total elongation, hardness, and linear thermal expansion coefficient. The thermal expansion coefficient, as well as the hardness of the strain-induced martensitic phase was evaluated. The in-situ thermal treatment experiments showed unusual changes in the kinetics of the reverse transformation (α' → γ). The X-ray diffraction analysis revealed that the reverse transformation may be stress assisted—strains inherited from the martensitic transformation may increase its kinetics at the lower annealing temperature range. More importantly, the transmission Kikuchi diffraction measurements showed that the reverse transformation of the strain-induced martensite proceeds through a displacive, diffusionless mechanism, maintaining the Kurdjumov-Sachs crystallographic relationship between the martensite and the reverted austenite. This finding is in contradiction to the results reported by other researchers for a similar alloy composition.
Exercise reverses metabolic syndrome in high-fat diet-induced obese rats.
Touati, Sabeur; Meziri, Fayçal; Devaux, Sylvie; Berthelot, Alain; Touyz, Rhian M; Laurant, Pascal
2011-03-01
Chronic consumption of a high-fat diet induces obesity. We investigated whether exercise would reverse the cardiometabolic disorders associated with obesity without it being necessary to change from a high- to normal-fat diet. Sprague-Dawley rats were placed on a high-fat (HFD) or control diet (CD) for 12 wk. HFD rats were then divided into four groups: sedentary HFD (HFD-S), exercise trained (motor treadmill for 12 wk) HFD (HFD-Ex), modified diet (HFD to CD; HF/CD-S), and exercise trained with modified diet (HF/CD-Ex). Cardiovascular risk parameters associated with metabolic syndrome were measured, and contents of aortic Akt, phospho-Akt at Ser (473), total endothelial nitric oxide synthase (eNOS), and phospho-eNOS at Ser (1177) were determined by Western blotting. Chronic consumption of HFD induced a metabolic syndrome. Exercise and dietary modifications reduced adiposity, improved glucose and insulin levels and plasma lipid profile, and exerted an antihypertensive effect. Exercise was more effective than dietary modification in improving plasma levels of thiobarbituric acid-reacting substance and in correcting the endothelium-dependent relaxation to acetylcholine and insulin. Furthermore, independent of the diet used, exercise increased Akt and eNOS phosphorylation. Metabolic syndrome induced by HFD is reversed by exercise and diet modification. It is demonstrated that exercise training induces these beneficial effects without the requirement for dietary modification, and these beneficial effects may be mediated by shear stress-induced Akt/eNOS pathway activation. Thus, exercise may be an effective strategy to reverse almost all the atherosclerotic risk factors linked to obesity, particularly in the vasculature.
Directory of Open Access Journals (Sweden)
Meng Shuang
2010-06-01
Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.
International Nuclear Information System (INIS)
Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.
2006-01-01
Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)
DEFF Research Database (Denmark)
Christoffersen, Mette; Woodward, Elizabeth; Bojesen, Anders Miki
2012-01-01
endometritis based on their endometrial histopathology and ability to clear an induced uterine inflammation. To investigate the effect of immunomodulatory therapy, the mares were inoculated with 10(5) colony forming units (CFU) Escherichia coli in three consecutive estrus cycles in a modified cross-over study...... inoculation. Endometrial biopsies were recovered 3, 24 and 72 h post inoculation. Relative gene-expression analyses were performed by quantitative reverse transcriptase PCR (qRT-PCR). Endometrial gene expression of inflammatory cytokines was modulated by administration of GC. Expression of proinflammatory...
Reversible cold-induced abnormalities in myocardial perfusion and function in systemic sclerosis
International Nuclear Information System (INIS)
Alexander, E.L.; Firestein, G.S.; Weiss, J.L.; Heuser, R.R.; Leitl, G.; Wagner, H.N. Jr.; Brinker, J.A.; Ciuffo, A.A.; Becker, L.C.
1986-01-01
The effects of peripheral cold exposure on myocardial perfusion and function were studied in 13 patients with scleroderma without clinically evident myocardial disease. Ten patients had at least one transient, cold-induced, myocardial perfusion defect visualized by thallium-201 scintigraphy, and 12 had reversible, cold-induced, segmental left ventricular hypokinesis by two-dimensional echocardiography. The 10 patients with transient perfusion defects all had anatomically corresponding ventricular wall motion abnormalities. No one in either of two control groups (9 normal volunteers and 7 patients with chest pain and normal coronary arteriograms) had cold-induced abnormalities. This study is the first to show the simultaneous occurrence of cold-induced abnormalities in myocardial perfusion and function in patients with scleroderma. The results suggest that cold exposure in such patients may elicit transient reflex coronary vasoconstriction resulting in reversible myocardial ischemia and dysfunction. Chronic recurrent episodes of coronary spasm may lead to focal myocardial fibrosis
Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake
2017-11-22
Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.
Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki
2014-01-01
Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.
Directory of Open Access Journals (Sweden)
Atsuko Hachiya
2011-01-01
Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.
Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N
2005-05-01
To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.
Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo
2017-08-31
In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi
2018-05-11
Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Kleijn, Huub J; Zollinger, Daniel P; van den Heuvel, Michiel W; Kerbusch, Thomas
2011-01-01
AIMS An integrated population pharmacokinetic–pharmacodynamic model was developed with the following aims: to simultaneously describe pharmacokinetic behaviour of sugammadex and rocuronium; to establish the pharmacokinetic–pharmacodynamic model for rocuronium-induced neuromuscular blockade and reversal by sugammadex; to evaluate covariate effects; and to explore, by simulation, typical covariate effects on reversal time. METHODS Data (n = 446) from eight sugammadex clinical studies covering men, women, non-Asians, Asians, paediatrics, adults and the elderly, with various degrees of renal impairment, were used. Modelling and simulation techniques based on physiological principles were applied to capture rocuronium and sugammadex pharmacokinetics and pharmacodynamics and to identify and quantify covariate effects. RESULTS Sugammadex pharmacokinetics were affected by renal function, bodyweight and race, and rocuronium pharmacokinetics were affected by age, renal function and race. Sevoflurane potentiated rocuronium-induced neuromuscular blockade. Posterior predictive checks and bootstrapping illustrated the accuracy and robustness of the model. External validation showed concordance between observed and predicted reversal times, but interindividual variability in reversal time was pronounced. Simulated reversal times in typical adults were 0.8, 1.5 and 1.4 min upon reversal with sugammadex 16 mg kg−1 3 min after rocuronium, sugammadex 4 mg kg−1 during deep neuromuscular blockade and sugammadex 2 mg kg−1 during moderate blockade, respectively. Simulations indicated that reversal times were faster in paediatric patients and slightly slower in elderly patients compared with adults. Renal function did not affect reversal time. CONCLUSIONS Simulations of the therapeutic dosing regimens demonstrated limited impact of age, renal function and sevoflurane use, as predicted reversal time in typical subjects was always <2 min. PMID:21535448
Kiyatkin, Eugene A; Ren, Suelynn; Wakabayashi, Ken T; Baumann, Michael H; Shaham, Yavin
2016-01-01
MDMA-induced hyperthermia is highly variable, unpredictable, and greatly potentiated by the social and environmental conditions of recreational drug use. Current strategies to treat pathological MDMA-induced hyperthermia in humans are palliative and marginally effective, and there are no specific pharmacological treatments to counteract this potentially life-threatening condition. Here, we tested the efficacy of mixed adrenoceptor blockers carvedilol and labetalol, and the atypical antipsychotic clozapine, in reversing MDMA-induced brain and body hyperthermia. We injected rats with a moderate non-toxic dose of MDMA (9 mg/kg) during social interaction, and we administered potential treatment drugs after the development of robust hyperthermia (>2.5 °C), thus mimicking the clinical situation of acute MDMA intoxication. Brain temperature was our primary focus, but we also simultaneously recorded temperatures from the deep temporal muscle and skin, allowing us to determine the basic physiological mechanisms of the treatment drug action. Carvedilol was modestly effective in attenuating MDMA-induced hyperthermia by moderately inhibiting skin vasoconstriction, and labetalol was ineffective. In contrast, clozapine induced a marked and immediate reversal of MDMA-induced hyperthermia via inhibition of brain metabolic activation and blockade of skin vasoconstriction. Our findings suggest that clozapine, and related centrally acting drugs, might be highly effective for reversing MDMA-induced brain and body hyperthermia in emergency clinical situations, with possible life-saving results.
Free radical scavenging reverses fructose-induced salt-sensitive hypertension
Directory of Open Access Journals (Sweden)
Zenner ZP
2017-12-01
Full Text Available Zachary P Zenner, Kevin L Gordish, William H Beierwaltes Department of Internal Medicine, Hypertension and Vascular Research Division, Henry Ford Hospital, Detroit, MI, USA Abstract: We have previously reported that a moderate dietary supplementation of 20% fructose but not glucose leads to a salt-sensitive hypertension related to increased proximal sodium–hydrogen exchanger activity and increased renal sodium retention. We also found that while high salt increased renal nitric oxide formation, this was retarded in the presence of fructose intake. We hypothesized that at least part of the pathway leading to fructose-induced salt-sensitive hypertension could be due to fructose-induced formation of reactive oxygen species and inappropriate stimulation of renin secretion, all of which would contribute to an increase in blood pressure. We found that both 20% fructose intake and a high-salt diet stimulated 8-isoprostane excretion. The superoxide dismutase (SOD mimetic tempol significantly reduced this elevated excretion. Next, we placed rats on a high-salt diet (4% for 1 week in combination with normal rat chow or 20% fructose with or without chronic tempol administration. A fructose plus high-salt diet induced a rapid increase (15 mmHg in systolic blood pressure and reversed high salt suppression of plasma renin activity. Tempol treatment reversed the pressor response and restored high salt suppression of renin. We conclude that fructose-induced salt-sensitive hypertension is driven by increased renal reactive oxygen species formation associated with salt retention and an enhanced renin–angiotensin system. Keywords: reactive oxygen species, tempol, sodium, renin, oxidative stress
DEFF Research Database (Denmark)
Sorgenfrei, Iben F; Norrild, Kathrine; Larsen, Per Bo
2006-01-01
Sugammadex (Org 25969) forms a complex with steroidal neuromuscular blocking agents, thereby reversing neuromuscular block. This study investigated the dose-response relation, safety, and pharmacokinetics of sugammadex to reverse rocuronium-induced block.......Sugammadex (Org 25969) forms a complex with steroidal neuromuscular blocking agents, thereby reversing neuromuscular block. This study investigated the dose-response relation, safety, and pharmacokinetics of sugammadex to reverse rocuronium-induced block....
Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi
2016-12-10
The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure
Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng
2014-07-01
The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Ma, Xiongchao; Sun, Baozhen; Zhu, Fei
2018-02-01
This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.
Inhibition of protein kinase A and GIRK channel reverses fentanyl-induced respiratory depression.
Liang, Xiaonan; Yong, Zheng; Su, Ruibin
2018-06-11
Opioid-induced respiratory depression is a major obstacle to improving the clinical management of moderate to severe chronic pain. Opioids inhibit neuronal activity via various pathways, including calcium channels, adenylyl cyclase, and potassium channels. Currently, the underlying molecular pathway of opioid-induced respiratory depression is only partially understood. This study aimed to investigate the mechanisms of opioid-induced respiratory depression in vivo by examining the effects of different pharmacological agents on fentanyl-induced respiratory depression. Respiratory parameters were detected using whole body plethysmography in conscious rats. We show that pre-treatment with the protein kinase A (PKA) inhibitor H89 reversed the fentanyl-related effects on respiratory rate, inspiratory time, and expiratory time. Pre-treatment with the G protein-gated inwardly rectifying potassium (GIRK) channel blocker Tertiapin-Q dose-dependently reversed the fentanyl-related effects on respiratory rate and inspiratory time. A phosphodiesterase 4 (PDE4) inhibitor and cyclic adenosine monophosphate (cAMP) analogs did not affect fentanyl-induced respiratory depression. These findings suggest that PKA and GIRK may be involved in fentanyl-induced respiratory depression and could represent useful therapeutic targets for the treatment of fentanyl-induced ventilatory depression. Copyright © 2018 Elsevier B.V. All rights reserved.
Mouth reversal extinguishes mismatch negativity induced by the McGurk illusion
DEFF Research Database (Denmark)
Eskelund, Kasper; Andersen, Tobias
2013-01-01
The sight of articulatory mouth movements (visual speech) influences auditory speech perception. This is demonstrated by the McGurk illusion in which incongruent visual speech alters the auditory phonetic percept. In behavioral studies, reversal of the vertical mouth direction has been reported...... by visual speech with either upright (unaltered) or vertically reversed mouth area. In a preliminary analysis, we found a Mismatch Negativity component induced by the McGurk illusion for 6 of 17 participants at electrode Cz when the mouth area was upright. In comparison, these participants produced...
Directory of Open Access Journals (Sweden)
Tandale Babasaheb V
2008-12-01
Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy
Quaternary naltrexone reverses radiogenic and morphine-induced locomotor hyperactivity
Energy Technology Data Exchange (ETDEWEB)
Mickley, G.A.; Stevens, K.E.; Galbraith, J.A.; White, G.A.; Gibbs, G.L.
1984-04-01
The present study attempted to determine the relative role of the peripheral and central nervous system in the production of morphine-induced or radiation-induced locomotor hyperactivity of the mouse. Toward this end, we used a quaternary derivative of an opiate antagonist (naltrexone methobromide), which presumably does not cross the blood-brain barrier. Quaternary naltrexone was used to challenge the stereotypic locomotor response observed in these mice after either an i.p. injection of morphine or exposure to 1500 rads /sup 60/Co. The quaternary derivative of naltrexone reversed the locomotor hyperactivity normally observed in the C57BL/6J mouse after an injection of morphine. It also significantly attenuated radiation-induced locomotion. The data reported here support the hypothesis of endorphin involvement in radiation-induced and radiogenic behaviors. However, these conclusions are contingent upon further research which more fully evaluates naltrexone methobromide's capacity to cross the blood-brain barrier.
International Nuclear Information System (INIS)
Samad, N.; Haleem, D.J.
2013-01-01
The study was designed to test the hypothesis that a decrease in the responsiveness of somatodendritic 5-HT-1A receptors by co- administration of imipramine could reverse the induction of VCMs and supersensitivity at 5-HT-IA receptors by haloperidol. Rats treated with haloperidol 0.2mg/rat/day for 2 weeks induced VCMs with twitching of facial musculature that increased in a time dependent manner as the treatment continued to 5 weeks. Co administration of imipramine (5mg/kg/m1) attenuated haloperidol-induced VCMs after 2 weeks and completely reversed it after 5 weeks. The intensity of 8-hydroxy -2-di(n-propyleamino)tetraline (8-OH-DPAT)-induced locomotion and forepaw treading were greater in saline+haloperidol injected but not in imipramine+haloperidol injected animals. 8-OH-DPAT induced decreases of 5-HT metabolism were greater in saline+haloperidol injected animals but not in imipramine+haloperidol injected animals. The mechanism involved in reversal/attenuation of haloperidol-induced tardive dyskinesia by imipramine is discussed. (author)
X-ray irradiation induced reversible resistance change in Pt/TiO2/Pt cells.
Chang, Seo Hyoung; Kim, Jungho; Phatak, Charudatta; D'Aquila, Kenneth; Kim, Seong Keun; Kim, Jiyoon; Song, Seul Ji; Hwang, Cheol Seong; Eastman, Jeffrey A; Freeland, John W; Hong, Seungbum
2014-02-25
The interaction between X-rays and matter is an intriguing topic for both fundamental science and possible applications. In particular, synchrotron-based brilliant X-ray beams have been used as a powerful diagnostic tool to unveil nanoscale phenomena in functional materials. However, it has not been widely investigated how functional materials respond to the brilliant X-rays. Here, we report the X-ray-induced reversible resistance change in 40-nm-thick TiO2 films sandwiched by Pt top and bottom electrodes, and propose the physical mechanism behind the emergent phenomenon. Our findings indicate that there exists a photovoltaic-like effect, which modulates the resistance reversibly by a few orders of magnitude, depending on the intensity of impinging X-rays. We found that this effect, combined with the X-ray irradiation induced phase transition confirmed by transmission electron microscopy, triggers a nonvolatile reversible resistance change. Understanding X-ray-controlled reversible resistance changes can provide possibilities to control initial resistance states of functional materials, which could be useful for future information and energy storage devices.
Directory of Open Access Journals (Sweden)
Wiwit Ananda Wahyu Setyaningsih
2018-03-01
Full Text Available Background: Hyperuricemia contributes to kidney injury, characterized by tubular injury with epithelial–mesenchymal transition (EMT. Wnt5a/Ror2 signaling drives EMT in many kidney pathologies. This study sought to evaluate the involvement of Wnt5a/Ror2 in hyperuricemia-induced EMT in kidney tubular injury. Methods: A hyperuricemia model was performed in male Swiss background mice (3 months old, 30–40 g with daily intraperitoneal injections of 125 mg/kg body weight (BW of uric acid. The mice were terminated on day 7 (UA7, n=5 and on day 14 (UA14, n=5. Allopurinol groups (UAl7 and UAl14, each n=5 were added with oral 50 mg/kg BW of allopurinol treatment. The serum uric acid level was quantified, and tubular injury was assessed based on PAS staining. Reverse transcriptase-PCR was done to quantify Wnt5a, Ror2, E-cadherin, and vimentin expressions. IHC staining was done for E-cadherin and collagen I. We used the Shapiro–Wilk for normality testing and one-way ANOVA for variance analysis with a P<0.05 as significance level using SPSS 22 software. Results: The hyperuricemia groups had a higher uric acid level, which was associated with a higher tubular injury score. Meanwhile, the allopurinol groups had a significantly lower uric acid level and tubular injury than the uric acid groups. Reverse transcriptase-PCR revealed downregulation of the E-cadherin expression. While vimentin and collagen I expression are upregulated, which was associated with a higher Wnt5a expression. However, the allopurinol groups had reverse results. Immunostaining revealed a reduction in E-cadherin staining in the epithelial cells and collagen I positive staining in the epithelial cells and the interstitial areas. Conclusion: Hyperuricemia induced tubular injury, which might have been mediated by EMT through the activation of Wnt5a.
Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong
2018-06-18
We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H = 1.77 μM, IC 50 IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-06-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Reversal of CRF- and stress-induced anorexia by an ayurvedic formulation
Directory of Open Access Journals (Sweden)
V. S. Kulkarni
2012-04-01
Full Text Available Trikatu churna is one of the commonly used Ayurvedic formulations in the traditional system of medicine in India for the treatment of agnimandya, i.e. anorexia. Trikatu contains equal amounts of finely powdered rhizomes of Zingiber officinale Roscoe (Zingiberaceae and fruits of Piper longum L. and Piper nigrum L. (Piperaceae. The chief objective of the study was to determine the antianorectic effects of three drugs individually and to compare these effects with the effect of Trikatu. The activity of the drugs was studied after anorexia was induced in rats by (1 physical stress arising from immobilization for 60 min; (2 intraperitoneal injection of Escherichia coli lipopolysaccharide (LPS, 100 μg/kg body weight; and (3 intraperitoneal administration of fluoxetine (8 mg/kg body weight. Similar doses of the extracts were tested on freely feeding rats and on rats that had been deprived of food for 20 h. Corticotrophin-releasing factor (CRF, 0.3 μg/rat can induce anxiogenic-like behavior and reduced food intake. This model was also studied, and the results were compared. The components of Trikatu churna failed to individually reverse the inhibition of feeding. In contrast, Trikatu churna pretreatment reversed stress-, fluoxetine- and CRF-induced anorexia. The study provides strong evidence of the synergistic action of Ayurvedic formulas and also proves the ability of Trikatu churna to reduce stress and CRF-induced anorexia.
Reversal of CRF- and stress-induced anorexia by an ayurvedic formulation
Directory of Open Access Journals (Sweden)
V. S. Kulkarni
2011-09-01
Full Text Available Trikatu churna is one of the commonly used Ayurvedic formulations in the traditional system of medicine in India for the treatment of agnimandya, i.e. anorexia. Trikatu contains equal amounts of finely powdered rhizomes of Zingiber officinale Roscoe (Zingiberaceae and fruits of Piper longum L. and Piper nigrum L. (Piperaceae. The chief objective of the study was to determine the antianorectic effects of three drugs individually and to compare these effects with the effect of Trikatu. The activity of the drugs was studied after anorexia was induced in rats by (1 physical stress arising from immobilization for 60 min; (2 intraperitoneal injection of Escherichia coli lipopolysaccharide (LPS, 100 μg/kg body weight; and (3 intraperitoneal administration of fluoxetine (8 mg/kg body weight. Similar doses of the extracts were tested on freely feeding rats and on rats that had been deprived of food for 20 h. Corticotrophin-releasing factor (CRF, 0.3 μg/rat can induce anxiogenic-like behavior and reduced food intake. This model was also studied, and the results were compared. The components of Trikatu churna failed to individually reverse the inhibition of feeding. In contrast, Trikatu churna pretreatment reversed stress-, fluoxetine- and CRF-induced anorexia. The study provides strong evidence of the synergistic action of Ayurvedic formulas and also proves the ability of Trikatu churna to reduce stress and CRF-induced anorexia.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
Energy Technology Data Exchange (ETDEWEB)
Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy
2017-04-10
HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.
International Nuclear Information System (INIS)
Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key
2016-01-01
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)
2016-08-26
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
ORIGINAL ARTICLES Symptomatic hyperlactataemia in adults on ...
African Journals Online (AJOL)
2008-09-29
Sep 29, 2008 ... in combination with other antiretroviral drugs in a schedule .... males developed gynaecomastia without other symptoms of ..... nucleoside reverse transcriptase inhibitor (NRTI)-induced lactic acidosis in HIV-infected patients in ...
Reversal of aflatoxin induced liver damage by turmeric and curcumin.
Soni, K B; Rajan, A; Kuttan, R
1992-09-30
The effect of certain food additives on aflatoxin production by Aspergillus parasiticus has been studied in vitro. Extracts of turmeric (Curcuma longa), garlic (Allium sativum) and asafoetida (Ferula asafoetida) inhibited the aflatoxin production considerably (more than 90%) at concentrations of 5-10 mg/ml. Similar results were also seen using butylated hydroxytoluene, butylated hydroxyanisole and ellagic acid at concentration 0.1 mM. Curcumin, the antioxidant principle from Curcuma longa did not have any effect on aflatoxin production. Turmeric and curcumin were also found to reverse the aflatoxin induced liver damage produced by feeding aflatoxin B1 (AFB1) (5 micrograms/day per 14 days) to ducklings. Fatty changes, necrosis and biliary hyperplasia produced by AFB1 were considerably reversed by these food additives.
Boer, H.D. de; Driessen, J.J.; Marcus, M.A.; Kerkkamp, H.E.M.; Heeringa, M.; Klimek, M.
2007-01-01
BACKGROUND: Reversal of rocuronium-induced neuromuscular blockade can be accomplished by chemical encapsulation of rocuronium by sugammadex, a modified gamma-cyclodextrin derivative. This study investigated the efficacy and safety of sugammadex in reversing rocuronium-induced profound neuromuscular
Nicotine Prevents and Reverses Paclitaxel-Induced Mechanical Allodynia in a Mouse Model of CIPN.
Kyte, S Lauren; Toma, Wisam; Bagdas, Deniz; Meade, Julie A; Schurman, Lesley D; Lichtman, Aron H; Chen, Zhi-Jian; Del Fabbro, Egidio; Fang, Xianjun; Bigbee, John W; Damaj, M Imad; Gewirtz, David A
2018-01-01
Chemotherapy-induced peripheral neuropathy (CIPN), a consequence of peripheral nerve fiber dysfunction or degeneration, continues to be a dose-limiting and debilitating side effect during and/or after cancer chemotherapy. Paclitaxel, a taxane commonly used to treat breast, lung, and ovarian cancers, causes CIPN in 59-78% of cancer patients. Novel interventions are needed due to the current lack of effective CIPN treatments. Our studies were designed to investigate whether nicotine can prevent and/or reverse paclitaxel-induced peripheral neuropathy in a mouse model of CIPN, while ensuring that nicotine will not stimulate lung tumor cell proliferation or interfere with the antitumor properties of paclitaxel. Male C57BL/6J mice received paclitaxel every other day for a total of four injections (8 mg/kg, i.p.). Acute (0.3-0.9 mg/kg, i.p.) and chronic (24 mg/kg per day, s.c.) administration of nicotine respectively reversed and prevented paclitaxel-induced mechanical allodynia. Blockade of the antinociceptive effect of nicotine with mecamylamine and methyllycaconitine suggests that the reversal of paclitaxel-induced mechanical allodynia is primarily mediated by the α 7 nicotinic acetylcholine receptor subtype. Chronic nicotine treatment also prevented paclitaxel-induced intraepidermal nerve fiber loss. Notably, nicotine neither promoted proliferation of A549 and H460 non-small cell lung cancer cells nor interfered with paclitaxel-induced antitumor effects, including apoptosis. Most importantly, chronic nicotine administration did not enhance Lewis lung carcinoma tumor growth in C57BL/6J mice. These data suggest that the nicotinic acetylcholine receptor-mediated pathways may be promising drug targets for the prevention and treatment of CIPN. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Boer, H.D. de; Egmond, J. van; Pol, F. van de; Bom, A.; Booij, L.H.D.J.
2006-01-01
BACKGROUND: Binding of the steroidal molecule of rocuronium by a cyclodextrin is a new concept for reversal of neuromuscular block. The present study evaluated the ability of Sugammadex Org 25969, a synthetic gamma-cyclodextrin derivative, to reverse constant neuromuscular block of about 90% induced
Effects of spin-polarized current on pulse field-induced precessional magnetization reversal
Directory of Open Access Journals (Sweden)
Guang-fu Zhang
2012-12-01
Full Text Available We investigate effects of a small DC spin-polarized current on the pulse field-induced precessional magnetization reversal in a thin elliptic magnetic element by micromagnetic simulations. We find that the spin-polarized current not only broadens the time window of the pulse duration, in which a successful precessional reversal is achievable, but also significantly suppresses the magnetization ringing after the reversal. The pulse time window as well as the decay rate of the ringing increase with increasing the current density. When a spin-polarized current with 5 MA/cm2 is applied, the time window increases from 80 ps to 112 ps, and the relaxation time of the ringing decreases from 1.1 ns to 0.32 ns. Our results provide useful information to achieve magnetic nanodevices based on precessional switching.
Reversal of haloperidol induced motor deficits in rats exposed to repeated immobilization stress.
Shireen, Erum; Pervez, Sidra; Masroor, Maria; Ali, Wafa Binte; Rais, Qudsia; Khalil, Samira; Tariq, Anum; Haleem, Darakshan Jabeen
2014-09-01
Stress is defined as a non specific response of body to any physiological and psychological demand. Preclinical studies have shown that an uncontrollable stress condition produces neurochemical and behavioral deficits. The present study was conducted to test the hypothesis that a decrease in the responsiveness of somatodendritic 5-hydroxytryptamine (5-HT)-1A receptors following adaptation to stress could attenuate haloperidol induced acute parkinsonian like effect. Results showed that single exposure (2h) to immobilization stress markedly decreased food intake, growth rate and locomotor activity but these stress-induced behavioral deficits were not observed following repeated (2h/day for 5 days) exposure of immobilization stress suggesting behavioral tolerance occurs to similar stress. An important finding of present study is a reversal of haloperidol-induced motor deficits in animals exposed to repeated immobilization stress than respective control animals. It is suggested that stress induced possible desensitization of somatodendritic 5-HT-1A as well as 5-HT-2C receptors could release dopamine system from the inhibitory influence of serotonin. On the other hand, an increase in the effectiveness of postsynaptic 5-HT-1A receptors elicits a direct stimulatory influence on the activity of dopaminergic neuron and is possibly involved in the reversal of haloperidol-induced parkinsonian like symptoms in repeatedly immobilized rats.
Treatment with pioglitazone induced significant, reversible mitral regurgitation.
Dorkhan, Mozhgan; Dencker, Magnus; Frid, Anders
2008-04-30
There has in recent years been great concern about possible cardiac side effects of thiazolidinediones (TZDs). We present a case-report of a 60 year-old male who developed significant mitral regurgitation during six months treatment with pioglitazone in parallel with laboratory indications of fluid retention. Echocardiography six months after discontinuation of medication showed regression of mitral regurgitation and the laboratory parameters were also normalized. It is noteworthy that six months treatment with pioglitazone could induce significant valve dysfunction, which was reversible, and this underlines the importance of carefully monitoring patients when placing them on treatment with TZDs.
Treatment with pioglitazone induced significant, reversible mitral regurgitation
Directory of Open Access Journals (Sweden)
Frid Anders
2008-04-01
Full Text Available Abstract There has in recent years been great concern about possible cardiac side effects of thiazolidinediones (TZDs. We present a case-report of a 60 year-old male who developed significant mitral regurgitation during six months treatment with pioglitazone in parallel with laboratory indications of fluid retention. Echocardiography six months after discontinuation of medication showed regression of mitral regurgitation and the laboratory parameters were also normalized. It is noteworthy that six months treatment with pioglitazone could induce significant valve dysfunction, which was reversible, and this underlines the importance of carefully monitoring patients when placing them on treatment with TZDs.
Directory of Open Access Journals (Sweden)
Sun Woo Sophie Kang
Full Text Available Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK. When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury.
Taniane, Caitlin; Farrell, Geoffrey; Arias, Irwin M.; Lippincott-Schwartz, Jennifer; Fu, Dong
2016-01-01
Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK). When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury. PMID:27792760
Restoration of hippocampal growth hormone reverses stress-induced hippocampal impairment
Directory of Open Access Journals (Sweden)
Caitlin M. Vander Weele
2013-06-01
Full Text Available Though growth hormone (GH is synthesized by hippocampal neurons, where its expression is influenced by stress exposure, its function is poorly characterized. Here, we show that a regimen of chronic stress that impairs hippocampal function in rats also leads to a profound decrease in hippocampal GH levels. Restoration of hippocampal GH in the dorsal hippocampus via viral-mediated gene transfer completely reversed stress-related impairment of two hippocampus-dependent behavioral tasks, auditory trace fear conditioning and contextual fear conditioning, without affecting hippocampal function in unstressed control rats. GH overexpression reversed stress-induced decrements in both fear acquisition and long-term fear memory. These results suggest that loss of hippocampal GH contributes to hippocampal dysfunction following prolonged stress and demonstrate that restoring hippocampal GH levels following stress can promote stress resilience.
Lipopolysaccharide induces the migration of human dental pulp cells by up-regulating miR-146a.
Wang, Min-Ching; Hung, Pei-Shih; Tu, Hsi-Feng; Shih, Wen-Yu; Li, Wan-Chun; Chang, Kuo-Wei
2012-12-01
MicroRNAs are small noncoding RNAs that play crucial roles in regulating normal and pathologic functions. Bacterial lipopolysaccharide (LPS) is one of the key regulators of pulpal pathogenesis. This study investigated how LPS regulates microRNA expression and affects the phenotype of human dental pulp cells (DPCs). Primary DPCs were established and immortalized to achieve immortalized DPCs (I-DPCs). DPCs and I-DPCs were treated with LPS and examined to identify changes in microRNA expression, cell proliferation, and cell migration. Quantitative reverse-transcriptase polymerase chain reaction was used to detect changes in gene expression. Exogenous miR-146a expression was performed transfection with pre-mir-146a mimic. Knockdown of interleukin receptor-associated kinase (IRAK1) and tumor necrosis factor receptor-associated factor 6 (TRAF6) expression was performed by small interference oligonucleotide transfection. Western blot analysis was used to detect changes in the expression of the IRAK1 and TRAF6 proteins. The differentiation of DPCs was induced by osteogenic medium. I-DPCs had a higher level of human telomerase reverse transcriptase gene than the parental DPCs. Up-regulation of miR-146a expression and an increase in migration was induced by LPS treatment of DPCs and I-DPCs. Exogenous miR-146a expression increased the migration of DPCs and I-DPCs and down-regulated the expression of IRAK1 and TRAF6. Knockdown of IRAK1 and/or TRAF6 increased the migration of DPCs. The results suggested that LPS is able to increase the migration of DPCs by modulating the miR-146a-TRAF6/IRAK1 regulatory cascade. Copyright © 2012 American Association of Endodontists. All rights reserved.
Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.
2017-10-01
The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.
Energy Technology Data Exchange (ETDEWEB)
Lu, Z. X.; Tynan, G. [Center for Energy Research and Department of Mechanical and Aerospace Engineering, University of California at San Diego, San Diego, California 92093 (United States); Center for Momentum Transport and Flow Organization and Center for Astrophysics and Space Science, University of California, San Diego, California 92093 (United States); Wang, W. X.; Ethier, S. [Princeton Plasma Physics Laboratory, Princeton, New Jersey 08540 (United States); Diamond, P. H. [Center for Momentum Transport and Flow Organization and Center for Astrophysics and Space Science, University of California, San Diego, California 92093 (United States); Gao, C.; Rice, J. [Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)
2015-05-15
Intrinsic torque, which can be generated by turbulent stresses, can induce toroidal rotation in a tokamak plasma at rest without direct momentum injection. Reversals in intrinsic torque have been inferred from the observation of toroidal velocity changes in recent lower hybrid current drive (LHCD) experiments. This work focuses on understanding the cause of LHCD-induced intrinsic torque reversal using gyrokinetic simulations and theoretical analyses. A new mechanism for the intrinsic torque reversal linked to magnetic shear (s{sup ^}) effects on the turbulence spectrum is identified. This reversal is a consequence of the ballooning structure at weak s{sup ^}. Based on realistic profiles from the Alcator C-Mod LHCD experiments, simulations demonstrate that the intrinsic torque reverses for weak s{sup ^} discharges and that the value of s{sup ^}{sub crit} is consistent with the experimental results s{sup ^}{sub crit}{sup exp}≈0.2∼0.3 [Rice et al., Phys. Rev. Lett. 111, 125003 (2013)]. The consideration of this intrinsic torque feature in our work is important for the understanding of rotation profile generation at weak s{sup ^} and its consequent impact on macro-instability stabilization and micro-turbulence reduction, which is crucial for ITER. It is also relevant to internal transport barrier formation at negative or weakly positive s{sup ^}.
Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang
2006-05-01
To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.
Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram
2003-01-01
Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we
Directory of Open Access Journals (Sweden)
Lemmens Hendrikus JM
2010-09-01
Full Text Available Abstract Background Acetylcholinesterase inhibitors cannot rapidly reverse profound neuromuscular block. Sugammadex, a selective relaxant binding agent, reverses the effects of rocuronium and vecuronium by encapsulation. This study assessed the efficacy of sugammadex compared with neostigmine in reversal of profound vecuronium-induced neuromuscular block under sevoflurane anesthesia. Methods Patients aged ≥18 years, American Society of Anesthesiologists class 1-4, scheduled to undergo surgery under general anesthesia were enrolled in this phase III, multicenter, randomized, safety-assessor blinded study. Sevoflurane anesthetized patients received vecuronium 0.1 mg/kg for intubation, with maintenance doses of 0.015 mg/kg as required. Patients were randomized to receive sugammadex 4 mg/kg or neostigmine 70 μg/kg with glycopyrrolate 14 μg/kg at 1-2 post-tetanic counts. The primary efficacy variable was time from start of study drug administration to recovery of the train-of-four ratio to 0.9. Safety assessments included physical examination, laboratory data, vital signs, and adverse events. Results Eighty three patients were included in the intent-to-treat population (sugammadex, n = 47; neostigmine, n = 36. Geometric mean time to recovery of the train-of-four ratio to 0.9 was 15-fold faster with sugammadex (4.5 minutes compared with neostigmine (66.2 minutes; p Conclusions Recovery from profound vecuronium-induced block is significantly faster with sugammadex, compared with neostigmine. Neostigmine did not rapidly reverse profound neuromuscular block (Trial registration number: NCT00473694.
Magnetic field induced flow pattern reversal in a ferrofluidic Taylor-Couette system.
Altmeyer, Sebastian; Do, Younghae; Lai, Ying-Cheng
2015-12-21
We investigate the dynamics of ferrofluidic wavy vortex flows in the counter-rotating Taylor-Couette system, with a focus on wavy flows with a mixture of the dominant azimuthal modes. Without external magnetic field flows are stable and pro-grade with respect to the rotation of the inner cylinder. More complex behaviors can arise when an axial or a transverse magnetic field is applied. Depending on the direction and strength of the field, multi-stable wavy states and bifurcations can occur. We uncover the phenomenon of flow pattern reversal as the strength of the magnetic field is increased through a critical value. In between the regimes of pro-grade and retrograde flow rotations, standing waves with zero angular velocities can emerge. A striking finding is that, under a transverse magnetic field, a second reversal in the flow pattern direction can occur, where the flow pattern evolves into pro-grade rotation again from a retrograde state. Flow reversal is relevant to intriguing phenomena in nature such as geomagnetic reversal. Our results suggest that, in ferrofluids, flow pattern reversal can be induced by varying a magnetic field in a controlled manner, which can be realized in laboratory experiments with potential applications in the development of modern fluid devices.
Reversible catecholamine-induced cardiomyopathy due to pheochromocytoma: case report.
Satendra, Milan; de Jesus, Cláudia; Bordalo e Sá, Armando L; Rosário, Luís; Rocha, José; Bicha Castelo, Henrique; Correia, Maria José; Nunes Diogo, António
2014-03-01
Pheochromocytoma is a tumor originating from chromaffin tissue. It commonly presents with symptoms and signs of catecholamine excess, such as hypertension, tachycardia, headache and sweating. Cardiovascular manifestations include catecholamine-induced cardiomyopathy, which may present as severe left ventricular dysfunction and congestive heart failure. We report a case of pheochromocytoma which was diagnosed following investigation of dilated cardiomyopathy. We highlight the dramatic symptomatic improvement and reversal of cardiomyopathy, with recovery of left ventricular function after treatment. Copyright © 2013 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.
Detection of hepatitis C virus RNA using reverse transcription PCR
International Nuclear Information System (INIS)
Yap, S.F.
1998-01-01
Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory
Liu, Xiao; Li, Jitao; Guo, Chunmei; Wang, Hongli; Sun, Yaxin; Wang, Han; Su, Yun-Ai; Li, Keqing; Si, Tianmei
2018-01-01
Cognitive dysfunction constitutes an essential component in schizophrenia for its early presence in the pathophysiology of the disease and close relatedness to life quality of patients. To develop effective treatment of cognitive deficits, it is important to understand their neurobiological causes and to identify potential therapeutic targets. In this study, adopting repeated MK-801 treatment as an animal model of schizophrenia, we investigated whether antipsychotic drugs, olanzapine and haloperidol, can reverse MK-801-induced cognitive deficits and how the reversal processes recruited proteins involved in glutamate neurotransmission in rat medial prefrontal cortex (mPFC) and hippocampus. We found that low-dose chronic MK-801 treatment impaired object-in-context recognition memory and reversal learning in the Morris water maze, leaving reference memory relatively unaffected, and that these cognitive deficits can be partially reversed by olanzapine, not haloperidol, treatment. At the molecular level, chronic MK-801 treatment resulted in the reduction of multiple N-methyl-D-aspartate (NMDA) receptor subunits in rat mPFC and olanzapine, not haloperidol, treatment restored the levels of GluN1 and phosphorylated GluN2B in this region. Taken together, MK-801-induced cognitive deficits may be associated with region-specific changes in NMDA receptor subunits and the reversal of specific NMDA receptor subunits may underlie the cognition-enhancing effects of olanzapine. PMID:29375333
Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark
2009-01-01
Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161
Dexamethasone Does Not Inhibit Sugammadex Reversal After Rocuronium-Induced Neuromuscular Block.
Buonanno, Pasquale; Laiola, Anna; Palumbo, Chiara; Spinelli, Gianmario; Servillo, Giuseppe; Di Minno, Raffaele Maria; Cafiero, Tullio; Di Iorio, Carlo
2016-06-01
Sugammadex is a relatively new molecule that reverses neuromuscular block induced by rocuronium. The particular structure of sugammadex traps the cyclopentanoperhydrophenanthrene ring of rocuronium in its hydrophobic cavity. Dexamethasone shares the same steroidal structure with rocuronium. Studies in vitro have demonstrated that dexamethasone interacts with sugammadex, reducing its efficacy. In this study, we investigated the clinical relevance of this interaction and its influence on neuromuscular reversal. In this retrospective case-control study, we analyzed data from 45 patients divided into 3 groups: dexamethasone after induction group (15 patients) treated with 8 mg dexamethasone as an antiemetic drug shortly after induction of anesthesia; dexamethasone before reversal group (15 patients) treated with dexamethasone just before sugammadex injection; and control group (15 patients) treated with 8 mg ondansetron. All groups received 0.6 mg/kg rocuronium at induction, 0.15 mg/kg rocuronium at train-of-four ratio (TOF) 2 for neuromuscular relaxation, and 2 mg/kg sugammadex for reversal at the end of the procedure at TOF2. Neuromuscular relaxation was monitored with a TOF-Watch® system. The control group had a recovery time of 154 ± 54 seconds (mean ± SD), the dexamethasone after induction group 134 ± 55 seconds, and the dexamethasone before reversal group 131 ± 68 seconds. The differences among groups were not statistically significant (P = 0.5141). Our results show that the use of dexamethasone as an antiemetic drug for the prevention of postoperative nausea and vomiting does not interfere with reversal of neuromuscular blockade with sugammadex in patients undergoing elective surgery with general anesthesia in contrast to in vitro studies that support this hypothesis.
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-07-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.
Endogenous α-crystallin inhibits expression of caspase-3 induced by hypoxia in retinal neurons.
Ying, Xi; Peng, Yanli; Zhang, Jiaping; Wang, Xingli; Wu, Nan; Zeng, Yuxiao; Wang, Yi
2014-08-28
To investigate the expression of endogenous, hypoxic stress-induced α-crystallin and caspase-3 in rat retinal neurons in vitro. Retinal neurons were cultured from Long-Evans rats. The expression of endogenous α-crystallin was analyzed by immunohistochemistry and reverse transcriptase-polymerase chain reaction (RT-PCR). Furthermore, hypoxic exposure was performed in cultured cells, and the expression of endogenous α-crystallin and caspase-3 was assayed by Western blotting. Positive α-crystallin staining was observed in cultured retinal neurons, and expression of endogenous α-crystallin mRNA peaked 3-5d after inoculation (Pendogenous, hypoxic stress-induced α-crystallin expression increased gradually, peaking 6h after hypoxia. The expression was more abundant compared to the control (Pendogenous α-crystallin in retinal neurons, especially over-expression induced by hypoxic stress, results in the down regulation of caspase-3. The data suggest that endogenous α-crystallin may act as an endogenous neuroprotective factor in retinal neurons. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Fox Jane
2010-12-01
Full Text Available Abstract Background Agonist stimulation of airway smooth muscle (ASM results in IP3 mediated Ca2+ release from the sarcoplasmic reticulum followed by the activation of store operated and receptor operated non-selective cation channels. Activation of these non-selective channels also results in a Na+ influx. This localised increase in Na+ levels can potentially switch the Na+/Ca2+ exchanger into reverse mode and so result in a further influx of Ca2+. The aim of this study was to characterise the expression and physiological function of the Na+/Ca2+ exchanger in cultured human bronchial smooth muscle cells and determine its contribution to agonist induced Ca2+ influx into these cells. Methods The expression profile of NCX (which encodes the Na+/Ca2+ exchanger homologues in cultured human bronchial smooth muscle cells was determined by reverse transcriptase PCR. The functional activity of reverse mode NCX was investigated using a combination of whole cell patch clamp, intracellular Ca2+ measurements and porcine airway contractile analyses. KB-R7943 (an antagonist for reverse mode NCX and target specific siRNA were utilised as tools to inhibit NCX function. Results NCX1 protein was detected in cultured human bronchial smooth muscle cells (HBSMC cells and NCX1.3 was the only mRNA transcript variant detected. A combination of intracellular Na+ loading and addition of extracellular Ca2+ induced an outwardly rectifying current which was augmented following stimulation with histamine. This outwardly rectifying current was inhibited by 10 μM KB-R7943 (an antagonist of reverse mode NCX1 and was reduced in cells incubated with siRNA against NCX1. Interestingly, this outwardly rectifying current was also inhibited following knockdown of STIM1, suggesting for the first time a link between store operated cation entry and NCX1 activation. In addition, 10 μM KB-R7943 inhibited agonist induced changes in cytosolic Ca2+ and induced relaxation of porcine
Sugammadex 4.0 mg kg-1 reversal of deep rocuronium-induced neuromuscular blockade
DEFF Research Database (Denmark)
Yu, Buwei; Wang, Xiangrui; Hansen, Søren Helbo
2014-01-01
Objective: Maintenance of deep Neuro Muscular Blockade (NMB) until the end of surgery may be beneficial in some surgical procedures. The selective relaxant binding agent sugammadex rapidly reverses deep levels of rocuronium-induced NMB. The purpose of this study was to evaluate the efficacy...... and safety of sugammadex 4.0 mg kg-1 for reversal of deep rocuronium-induced NMB in Chinese and Caucasian patients. Methods: This was an open-label, multicenter, prospective Phase III efficacy study in adult American Society of Anesthesiologists Class 1-3 patients scheduled for surgery under general...... anesthesia and requiring deep NMB. All patients received intravenous propofol and opioids for induction and maintenance of anesthesia, and a single intubation dose of rocuronium 0.6 mg/kg, with maintenance doses of 0.1-0.2 mg/kg as required. Sugammadex 4.0 mg/kg was administered after the last dose...
Reversible photo-induced trap formation in mixed-halide hybrid perovskites for photovoltaics.
Hoke, Eric T; Slotcavage, Daniel J; Dohner, Emma R; Bowring, Andrea R; Karunadasa, Hemamala I; McGehee, Michael D
2015-01-01
We report on reversible, light-induced transformations in (CH 3 NH 3 )Pb(Br x I 1- x ) 3 . Photoluminescence (PL) spectra of these perovskites develop a new, red-shifted peak at 1.68 eV that grows in intensity under constant, 1-sun illumination in less than a minute. This is accompanied by an increase in sub-bandgap absorption at ∼1.7 eV, indicating the formation of luminescent trap states. Light soaking causes a splitting of X-ray diffraction (XRD) peaks, suggesting segregation into two crystalline phases. Surprisingly, these photo-induced changes are fully reversible; the XRD patterns and the PL and absorption spectra revert to their initial states after the materials are left for a few minutes in the dark. We speculate that photoexcitation may cause halide segregation into iodide-rich minority and bromide-enriched majority domains, the former acting as a recombination center trap. This instability may limit achievable voltages from some mixed-halide perovskite solar cells and could have implications for the photostability of halide perovskites used in optoelectronics.
Directory of Open Access Journals (Sweden)
Turyadi Turyadi
2018-01-01
Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase. Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis
Foulds, Wallace S; Barathi, Veluchamy A; Luu, Chi D
2013-12-09
To determine whether progressive ametropia can be induced in chicks and reversed by manipulation of the chromaticity of ambient light. One-day-old chicks were raised in red light (90% red, 10% yellow-green) or in blue light (85% blue, 15% green) with a 12 hour on/off cycle for 14 to 42 days. Refraction was determined by streak retinoscopy, and by automated infrared photoretinoscopy and ocular biometry by A-scan ultrasonography. Red light induced progressive myopia (mean refraction ± SD at 28 days, -2.83 ± 0.25 diopters [D]). Progressive hyperopia was induced by blue light (mean refraction at 28 days, +4.55 ± 0.21 D). The difference in refraction between the groups was highly significant at P light (-2.21 ± 0.21 D) was reversed to hyperopia (+2.50 ± 0.29 D) by subsequent 21 days of blue light. Hyperopia induced by 21 days of blue light (+4.21 ± 0.19 D) was reversed to myopia (-1.23 ± 0.12 D) by 21 days of red light. Rearing chicks in red light caused progressive myopia, while rearing in blue light caused progressive hyperopia. Light-induced myopia or hyperopia in chicks can be reversed to hyperopia or myopia, respectively, by an alteration in the chromaticity of ambient light. Manipulation of chromaticity may be applicable to the management of human childhood myopia.
Energy Technology Data Exchange (ETDEWEB)
Shi, Wen-Zhu [Anesthesia and Operation Center, Hainan Branch of Chinese PLA General Hospital, Hainan 572013 (China); Anesthesia and Operation Center, Chinese PLA General Hospital, Beijing 100853 (China); Miao, Yu-Liang [Department of Anesthesiology, PLA No. 306 Hospital, Beijing 100101 (China); Guo, Wen-Zhi [Department of Anesthesiology, Beijing Military General Hospital of Chinese People’s Liberation Army, Beijing 100700 (China); Wu, Wei, E-mail: wwzwgk@163.com [Department of Head and Neck Surgery of Otolaryngology, PLA No. 306 Hospital, Beijing 100101 (China); Li, Bao-Wei [Department of Head and Neck Surgery of Otolaryngology, PLA No. 306 Hospital, Beijing 100101 (China); An, Li-Na [Department of Anesthesiology, Armed Police General Hospital, Beijing 100039 (China); Fang, Wei-Wu [Department of Anesthesiology, PLA No. 306 Hospital, Beijing 100101 (China); Mi, Wei-Dong, E-mail: elite2005gg@163.com [Anesthesia and Operation Center, Chinese PLA General Hospital, Beijing 100853 (China)
2014-04-25
Highlights: • Leptin promotes the proliferation of neural stem cells isolated from embryonic mouse hippocampus. • Leptin reverses corticosterone-induced inhibition of neural stem cell proliferation. • The effects of leptin are partially mediated by upregulating NR2B subunits. - Abstract: Corticosterone inhibits the proliferation of hippocampal neural stem cells (NSCs). The removal of corticosterone-induced inhibition of NSCs proliferation has been reported to contribute to neural regeneration. Leptin has been shown to regulate brain development, improve angiogenesis, and promote neural regeneration; however, its effects on corticosterone-induced inhibition of NSCs proliferation remain unclear. Here we reported that leptin significantly promoted the proliferation of hippocampal NSCs in a concentration-dependent pattern. Also, leptin efficiently reversed the inhibition of NSCs proliferation induced by corticosterone. Interestingly, pre-treatment with non-specific NMDA antagonist MK-801, specific NR2B antagonist Ro 25-6981, or small interfering RNA (siRNA) targeting NR2B, significantly blocked the effect of leptin on corticosterone-induced inhibition of NSCs proliferation. Furthermore, corticosterone significantly reduced the protein expression of NR2B, whereas pre-treatment with leptin greatly reversed the attenuation of NR2B expression caused by corticosterone in cultured hippocampal NSCs. Our findings demonstrate that leptin reverses the corticosterone-induced inhibition of NSCs proliferation. This process is, at least partially mediated by increased expression of NR2B subunits of NMDA receptors.
Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A
2017-01-01
Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N
Kang, Woon Seok; Kim, Kyo Sang; Song, Shin Mi
2017-04-01
Magnesium sulfate (MgSO 4 ) has been used in the treatment of pre-eclampsia, hypertension and arrhythmia. Magnesium enhances the neuromuscular block of rocuronium. This study has been conducted to evaluate the reversal efficacy of sugammadex from deep rocuronium-induced neuromuscular block (NMB) during consistent pretreatment of MgSO 4 in rabbits. Twenty-eight rabbits were randomly assigned to four groups, a control group or study groups (50% MgSO 4 150-200 mg/kg and 25 mg/kg/h IV), and received rocuronium 0.6 mg/kg. When post-tetanic count 1-2 appeared, sugammadex 2, 4, and 8 mg/kg was administered in the 2-mg group, control and 4-mg group, and 8-mg group, respectively. The recovery course after reversal of sugammadex administration was evaluated in each group. The mean serum concentration of magnesium was maintained at more than 2 mmol/L in the study groups, and the total dose of MgSO 4 was more than 590 mg. The reversal effect of sugammadex on rocuronium-induced NMB in pretreated MgSO 4 was not different from that in the group without MgSO 4 . The recovery time to train-of-four ratio 0.9 after sugammadex administration in the 2-mg group was longer than in the other groups (P rocuronium-induced NMB during large pretreatment of MgSO 4 was not affected. However, we should consider that the reversal effect of sugammadex varied depending on the dose.
Sparr, Harald J.; Vermeyen, Karel M.; Beaufort, Anton M.; Rietbergen, Henk; Proost, Johannes H.; Saldien, Vera; Velik-Salchner, Corinna; Wierda, J. Mark K. H.
Background: Sugammadex reverses the neuromuscular blocking effects of rocuronium by chemical encapsulation. The efficacy, safety, and pharmacokinetics of sugammadex for reversal of profound rocuronium-induced neuromuscular blockade were evaluated. Methods: Ninety-eight male adult patients were
Browning, Kirsteen N; Fortna, Samuel R; Hajnal, Andras
2013-05-01
Diet-induced obesity (DIO) has been shown to alter the biophysical properties and pharmacological responsiveness of vagal afferent neurones and fibres, although the effects of DIO on central vagal neurones or vagal efferent functions have never been investigated. The aims of this study were to investigate whether high-fat diet-induced DIO also affects the properties of vagal efferent motoneurones, and to investigate whether these effects were reversed following weight loss induced by Roux-en-Y gastric bypass (RYGB) surgery. Whole-cell patch-clamp recordings were made from rat dorsal motor nucleus of the vagus (DMV) neurones in thin brainstem slices. The DMV neurones from rats exposed to high-fat diet for 12-14 weeks were less excitable, with a decreased membrane input resistance and decreased ability to fire action potentials in response to direct current pulse injection. The DMV neurones were also less responsive to superfusion with the satiety neuropeptides cholecystokinin and glucagon-like peptide 1. Roux-en-Y gastric bypass reversed all of these DIO-induced effects. Diet-induced obesity also affected the morphological properties of DMV neurones, increasing their size and dendritic arborization; RYGB did not reverse these morphological alterations. Remarkably, independent of diet, RYGB also reversed age-related changes of membrane properties and occurrence of charybdotoxin-sensitive (BK) calcium-dependent potassium current. These results demonstrate that DIO also affects the properties of central autonomic neurones by decreasing the membrane excitability and pharmacological responsiveness of central vagal motoneurones and that these changes were reversed following RYGB. In contrast, DIO-induced changes in morphological properties of DMV neurones were not reversed following gastric bypass surgery, suggesting that they may be due to diet, rather than obesity. These findings represent the first direct evidence for the plausible effect of RYGB to improve vagal
International Nuclear Information System (INIS)
Yamamoto, Kazuo
1985-01-01
The effect of photoreactivation of the ultraviolet radiation induced reversion of a trpE9777 frameshift mutation was studied in a uvr A6 derivative of Escherichia coli K12. Two different photoreactivation treatments were used, one providing a single flash of photoreactivating light and another providing 10 min of light from fluorescent lamps. The reversion frequency of the trpE9777 frameshift mutation was strongly reduced when subsueqently exposed to visible light. The dose modification factor (the ratio of equally effective doses), for cells challenged with single-flash photoreactivation, for survival and induction of reversion to Trp + was 3.6 and 3.4, respectively. UV induction of RecA protein synthesis was not reversed by a single flash of photoreactivation. The dose modification factor for 10 min of fluorescent lamp photoreactivation for survival and for induction of reversion to Trp + was 6.5 and 6.3, respectively. The dose modification factor for 10 min of photoreactivation for induction of RecA protein was 1.7-2.5. Photoreactivation decreased the reversion of trpE9777 and increased survival to the same extent. We concluded that cyclobutyl pyrimidine dimers are the premutagenic lesions of UV mutagenesis of the trpE9777 allele in a uvr A6 background. (orig.)
Local Peltier-effect-induced reversible metal–insulator transition in VO2 nanowires
International Nuclear Information System (INIS)
Takami, Hidefumi; Kanki, Teruo; Tanaka, Hidekazu
2016-01-01
We report anomalous resistance leaps and drops in VO 2 nanowires with operating current density and direction, showing reversible and nonvolatile switching. This event is associated with the metal–insulator phase transition (MIT) of local nanodomains with coexistence states of metallic and insulating phases induced by thermoelectric cooling and heating effects. Because the interface of metal and insulator domains has much different Peltier coefficient, it is possible that a significant Peltier effect would be a source of the local MIT. This operation can be realized by one-dimensional domain configuration in VO 2 nanowires because one straight current path through the electronic domain-interface enables theoretical control of thermoelectric effects. This result will open a new method of reversible control of electronic states in correlated electron materials.
DEFF Research Database (Denmark)
Christoffersen, Mette; Woodward, Elizabeth; Bojesen, Anders Miki
2012-01-01
. Endometrial biopsies were obtained 3, 12, 24 and 72 hours (h) after bacterial inoculation and blood samples were obtained during the 7 day period post bacterial inoculation. Expression levels of cytokines and SAA were determined by quantitative real-time reverse transcriptase PCR (qRT-PCR)....
Molina, A.L.; Boer, H.D. de; Klimek, M.; Heeringa, M.; Klein, J.
2007-01-01
Sugammadex is the first selective relaxant binding agent and reverses rocuronium-induced neuromuscular block. A case is reported in which a patient accidentally received a high dose of sugammadex (40 mg kg-1) to reverse a rocuronium-induced (1.2 mg kg-1) profound neuromuscular block. A fast and
Directory of Open Access Journals (Sweden)
Mounira Tlili
2015-01-01
Full Text Available The rate of atmospheric vanadium is constantly increasing due to fossil fuel combustion. This environmental pollution favours vanadium exposure in particular to its vanadate form, causing occupational bronchial asthma and bronchitis. Based on the well admitted bronchodilator properties of the pituitary adenylate cyclase-activating polypeptide (PACAP, we investigated the ability of this neuropeptide to reverse the vanadate-induced airway hyperresponsiveness in rats. Exposure to ammonium metavanadate aerosols (5 mg/m3/h for 15 minutes induced 4 hours later an array of pathophysiological events, including increase of bronchial resistance and histological alterations, activation of proinflammatory alveolar macrophages, and increased oxidative stress status. Powerfully, PACAP inhalation (0.1 mM for 10 minutes alleviated many of these deleterious effects as demonstrated by a decrease of bronchial resistance and histological restoration. PACAP reduced the level of expression of mRNA encoding inflammatory chemokines (MIP-1α, MIP-2, and KC and cytokines (IL-1α and TNF-α in alveolar macrophages and improved the antioxidant status. PACAP reverses the vanadate-induced airway hyperresponsiveness not only through its bronchodilator activity but also by counteracting the proinflammatory and prooxidative effects of the metal. Then, the development of stable analogs of PACAP could represent a promising therapeutic alternative for the treatment of inflammatory respiratory disorders.
Study of cancer-specific chimeric promoters induced by irradiation
International Nuclear Information System (INIS)
Xiong Jie; Zhou Yunfeng; Sun Wenjie; Wang Weifeng; Liao Zhengkai; Zhou Fuxiang; Xie Conghua
2010-01-01
Objective: To combine the radio-inducible CArG element with cancer-specific human telomerase reverse transcriptase (hTERT) gene promoter, and to construct the novel chimeric promoters. Methods: The synthetic hTERT promoters containing different number of radio-inducible CArG elements were constructed, and the activities of the promoters in the cancer cells (HeLa, A549, and MHCC97 cells) and nomal cells (hEL cells) were detected by using luciferase-reporter assays after the treatment of irradiation (a single or fractionated irradiation dose). Results: Synthetic promoter containing 6 repeated CArG units was better in radio-inducibility than any other promoters containing different number of CArG units, and nearly maximum levels obtained at 4-6 Gy. The very low activities of the chimeric promoters could be detected in normal hEL cells. A similar level of reporter gene expression was observed after 3 fractionated doses of 2 Gy compared with a single dose of 6 Gy in cancer cells. Conclusions: The cancer-specific chimeric promoter containing 6 CArG elements showes the best radio-response, and the chimeric promoter system has the potential in cancer gene therapy. (authors)
Patick, A K; Boritzki, T J; Bloom, L A
1997-10-01
Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.
[Comparison of neostigmine induced reversal of rocuronium in different age children].
Liu, Jinzhu; Cheng, Zhaoyu
2016-03-15
To compare the effectiveness of neostigmine induced reversal of rocuronium in neonates, infants, young children and children. One hundred and sixty ASA I or II pediatric patients undergoings elective surgical procedures under total intravenous anesthesia were enrolled during July 2014 to April 2015 in Tianjin Children's Hospital. The patients were divided into four groups according to ages: neonate group, infant group, young children group and children group.Then control subgroup and neostigmine reversal subgroup including twenty patients were randomly selected from every different age groups by the method of random number table. After induction of anesthesia, 0.6 mg/kg rocuronium was administered, and 0.2 mg/kg maintenance doses given as required during period of operation. Neuromuscular block was monitored using acceleromyographic train of four (TOF). When T1/control returned to 15%, 0.03 mg/kg neostigmine and 0.01 mg/kg atropine were given to patients of reversal subgroups, and saline 0.1 ml/kg was given to patients of control subgroups. The recovery time of T25, T75, TR0.7, recovery index, blood pressure, heart rate and adverse reactions were observed and recorded. In control subgroups, the recovery time of T75 for neonates, infants, young children and children were (27.10±8.72), (16.70±6.35), (13.05±1.96), (14.40±3.08) min, respectively (F=25.052, P0.05). But the recovery time of T75, TR0.7 and recovery index in neonate group were longer than other age groups (all Procuronium are comparable in infant, young children and children. There are obviously reversal effects in all of age groups when neostigmine is given to antagonize rocuronium. Either spontaneous recovery time or reversal recovery time of neostigmine to rocuronium is longer for neonates than other age's children.
Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella
2005-01-01
The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-01-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260
Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin
2017-08-02
Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.
Lactobacillus rhamnosus strain JB-1 reverses restraint stress-induced gut dysmotility.
West, C; Wu, R Y; Wong, A; Stanisz, A M; Yan, R; Min, K K; Pasyk, M; McVey Neufeld, K-A; Karamat, M I; Foster, J A; Bienenstock, J; Forsythe, P; Kunze, W A
2017-01-01
Environmental stress affects the gut with dysmotility being a common consequence. Although a variety of microbes or molecules may prevent the dysmotility, none reverse the dysmotility. We have used a 1 hour restraint stress mouse model to test for treatment effects of the neuroactive microbe, L. rhamnosus JB-1 ™ . Motility of fluid-filled ex vivo gut segments in a perfusion organ bath was recorded by video and migrating motor complexes measured using spatiotemporal maps of diameter changes. Stress reduced jejunal and increased colonic propagating contractile cluster velocities and frequencies, while increasing contraction amplitudes for both. Luminal application of 10E8 cfu/mL JB-1 restored motor complex variables to unstressed levels within minutes of application. L. salivarius or Na.acetate had no treatment effects, while Na.butyrate partially reversed stress effects on colonic frequency and amplitude. Na.propionate reversed the stress effects for jejunum and colon except on jejunal amplitude. Our findings demonstrate, for the first time, a potential for certain beneficial microbes as treatment of stress-induced intestinal dysmotility and that the mechanism for restoration of function occurs within the intestine via a rapid drug-like action on the enteric nervous system. © 2016 John Wiley & Sons Ltd.
Giri, Shibashish; Bader, Augustinus
2014-09-01
Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a
Directory of Open Access Journals (Sweden)
Soo-Huey Yap
2007-12-01
Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which
Directory of Open Access Journals (Sweden)
Junie P Warrington
Full Text Available Whole brain radiation therapy (WBRT is commonly used for treatment of primary and metastatic brain tumors; however, cognitive impairment occurs in 40-50% of brain tumor survivors. The etiology of the cognitive impairment following WBRT remains elusive. We recently reported that radiation-induced cerebrovascular rarefaction within hippocampal subregions could be completely reversed by systemic hypoxia. However, the effects of this intervention on learning and memory have not been reported. In this study, we assessed the time-course for WBRT-induced impairments in contextual and spatial learning and the capacity of systemic hypoxia to reverse WBRT-induced deficits in spatial memory. A clinical fractionated series of 4.5Gy WBRT was administered to mice twice weekly for 4 weeks, and after various periods of recovery, behavioral analyses were performed. To study the effects of systemic hypoxia, mice were subjected to 11% (hypoxia or 21% oxygen (normoxia for 28 days, initiated 1 month after the completion of WBRT. Our results indicate that WBRT induces a transient deficit in contextual learning, disruption of working memory, and progressive impairment of spatial learning. Additionally, systemic hypoxia completely reversed WBRT-induced impairments in learning and these behavioral effects as well as increased vessel density persisted for at least 2 months following hypoxia treatment. Our results provide critical support for the hypothesis that cerebrovascular rarefaction is a key component of cognitive impairment post-WBRT and indicate that processes of learning and memory, once thought to be permanently impaired after WBRT, can be restored.
Directory of Open Access Journals (Sweden)
Lin Bai
Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.
Directory of Open Access Journals (Sweden)
Mohd. Azeemuddin Mukram
2013-04-01
Full Text Available Background: This investigation was aimed to evaluate the effect of Speman®, a well known ayurvedic proprietary preparation, in an experimental model of cyclophosphamide-(CP induced oligospermia in rats.Materials and Methods: Thirty male rats were randomized in to five, equally-sized groups. Rats in group 1 served as a normal control; group 2 served as an untreated positive control; groups 3, 4, 5 received Speman® granules at doses of 300, 600, and 900mg/kg body weight p.o. respectively, once daily for 13 days. On day four, one hour after the respective treatment, oligospermia was induced by administering a single dose of CP (100mg/kg body weight p.o. to all the groups except group1. At the end of the study period the rats were euthanised and accessory reproductive organs were weighed and subjected to histopathological examination. The semen samples were subject to enumeration of sperms. Weight of the reproductive organs, histopathological examination of the tissues, and sperm count were the parameters studied to understand the effect of Speman® on rats with CP-induced oligospermia.Results: Changes that occurred due to the administration of CP at a dose of 100 mg/kg body weight were dose dependently reversed with Speman® at a dose of 300, 600, and 900 mg/kg body weight. There was a statistically significant increase in sperm count and the weight of the seminal vesicle, epididymis, and prostate.Conclusion: Findings of this investigation indicate that Speman® dose dependently reversed the CP-induced derangement of various parameters pertaining to the reproductive system. This could explain the total beneficial actions of Speman® reported in several other clinical trials.
Krep, H H; Graves, S W; Price, D A; Lazarus, M; Ensign, A; Soszynski, P A; Hollenberg, N K
1996-01-01
The possibility that a circulating sodium pump inhibitor contributes to the pathogenesis of volume-dependent hypertension via an action on vascular smooth muscle (VSM) is supported by multiple lines of investigation, but remains controversial. We had two goals in this study. The first was to compare the pattern of contractile response of rabbit aorta induced by two candidates, ouabain and a labile sodium pump inhibitor that we have identified in the peritoneal dialysate of volume-expanded hypertensive patients with chronic renal failure. Our second goal was to examine the ability of Digibind, a Fab fragment of antisera directed against digoxin, to reverse VSM contraction induced by both agents. Ouabain induced a concentration-dependent contraction, which was delayed in onset, was gradual, and reached a stable plateau after many hours. The labile sodium pump inhibitor induced a qualitatively similar series of responses. Digibind rapidly reversed the contractile responses to both sodium pump inhibitors, with a rate of relaxation that matched that induced by physical removal of the pump inhibitor from the bath. For ouabain, the Digibind:ouabain stoichiometry was highly predictable. When Digibind was present in a molar concentration equivalent to that of ouabain, or less, it had no effect. When the Digibind concentration was twice that of ouabain, complete relaxation occurred. Although the concentration:VSM response relationship for ouabain was steep, the concentration:effect interaction with Digibind was even more steep. The molar concentration of Digibind required to reverse the effects of the labile endogenous inhibitor from peritoneal dialysate was consistently lower than that for ouabain, which is compatible with either greater potency of the labile factor in VSM or greater affinity for Digibind. These findings are compatible with a role for one or more endogenous sodium pump inhibitors as the determinant of vascular smooth muscle tone in the volume
Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong
2007-06-30
Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.
Directory of Open Access Journals (Sweden)
MK Chaubey
2009-01-01
Full Text Available In the present study, Heterometrus fastigiousus venom (HFV was employed as antigen to produce species-specific scorpion antivenom (SAV in albino mice (NIH strain. To determine SAV efficacy, it was pre-incubated with 10 LD50 of HFV and then injected subcutaneously into mice. Subsequently, mortality was observed after 24 hours. Minimum effective dose (MED was 12.5 LD50 of HFV/mL of SAV. SAV effectiveness to reverse HFV-induced biochemical alterations in mice was analyzed by challenge method. Simultaneously, mice received subcutaneously 40% of 24-hour-LD50 of HFV and intravenously SAV. After four hours, changes in serum glucose, free amino acids, uric acids, pyruvic acid, cholesterol, total protein, alkaline phosphatase, acid phosphatase, lactic dehydrogenase and glutamate-pyruvate transaminase enzyme level were determined. Treatment with species-specific SAV resulted in the reversal of HFV-induced biochemical alterations.
Sugammadex for reversal of rocuronium-induced neuromuscular blockade in pediatric patients
Won, Young Ju; Lim, Byung Gun; Lee, Dong Kyu; Kim, Heezoo; Kong, Myoung Hoon; Lee, Il Ok
2016-01-01
Abstract Background: Previous studies have shown that sugammadex, a modified γ-cyclodextrin, is a well-tolerated agent for the reversal of neuromuscular blockade (NMB) induced by a steroidal neuromuscular blocking drug in adult patients. However, its use has not been reviewed in pediatric patients. The aim of this meta-analysis was to evaluate the efficacy and safety of sugammadex in the reversal of rocuronium-induced NMB during surgery under general anesthesia in pediatric patients. Methods: A literature search was performed using the Pubmed, EMBASE: Drugs and pharmacology, Cochrane Central Register of Controlled Trials, and Cochrane Database of Systematic Reviews. Analysis was conducted using RevMan 5.3. Data collected from different trials were pooled; the weighted mean difference or the pooled risk ratio and the corresponding 95% confidence interval (CI) were used for analysis, and heterogeneity (I2) assessment was performed. Results: Six randomized controlled trials comparing 253 pediatric patients (age range, 2–18 years) were included in the final analysis. The mean time taken to reach a train-of-four ratio of ≥0.9 was significantly shorter in the sugammadex groups (2 and 4 mg/kg) than in the control group (neostigmine or placebo), although the heterogeneity was high. The weighted mean differences of the 2 and 4 mg/kg sugammadex groups were −7.15 (95% CI: −10.77 to −3.54; I2 = 96%; P = 0.0001) and −17.32 (95% CI: −29.31 to −5.32; I2 = 98%; P = 0.005), respectively. The extubation time in the sugammadex group was shorter than that in the control group; the weighted mean difference of the sugammadex group was −6.00 (95% CI: −11.46 to −0.53; I2 = 99%; P = 0.03). There was no significant difference between the groups in terms of the incidence of postanesthetic adverse events; the pooled risk ratio was 0.67 (95% CI: 0.27–1.71; I2 = 59%; P = 0.41). Conclusion: We suggest that sugammadex is fast and
Inducing sex reversal of the urogenital system of marsupials.
Renfree, Marilyn B; Chew, Keng Yih; Shaw, Geoff
2014-01-01
Marsupials differ from eutherian mammals in their reproductive strategy of delivering a highly altricial young after a short gestation. The young, with its undeveloped organ systems completes its development post-natally, usually within a pouch. The young is dependent on milk with a composition that varies through lactation to support its growth and changing needs as it matures over a lengthy period. Gonadal differentiation occurs after birth, providing a unique opportunity to examine the effects of hormonal manipulations on its sexual differentiation of the highly accessible young. In marsupials a difference in the migration of the urinary ducts around the genital ducts from eutherian mammals results in the unique tammar reproductive tract which has three vaginae and two cervices, and two distinctly separate uteri. In the tammar wallaby, a small member of the kangaroo family, we showed that virilisation of the Wolffian duct, prostate and phallus depends on an alternate androgen pathway, which has now been shown to be important for virilisation in humans. Through hormonal manipulations over differing time periods we have achieved sex reversal of both ovaries and testes, germ cells, genital ducts, prostate and phallus. Whilst we understand many of the mechanisms behind sexual differentiation there are still many lessons to be learned from understanding how sex reversal is achieved by using a model such as the tammar wallaby. This will help guide investigations into the major questions of how and why sex determination is achieved in other species. This review discusses the control and development of the marsupial urogenital system, largely drawn from our studies in the tammar wallaby and our ability to manipulate this system to induce sex reversal. Copyright © 2013 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.
Hosokawa, Yoichiroh; Ohta, Mika; Ito, Akihiko; Takaoka, Yutaka
2013-03-01
Photomechanical laser ablation due to focused femtosecond laser irradiation was induced on the hind legs of living mice, and its clinical influence on muscle cell proliferation was investigated via histological examination and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis to examine the expression of the gene encoding myostatin, which is a growth repressor in muscle satellite cells. The histological examination suggested that damage of the tissue due to the femtosecond laser irradiation was localized on epidermis and dermis and hardly induced in the muscle tissue below. On the other hand, gene expression of the myostatin of muscle tissue after laser irradiation was suppressed. The suppression of myostatin expression facilitates the proliferation of muscle cells, because myostatin is a growth repressor in muscle satellite cells. On the basis of these results, we recognize the potential of the femtosecond laser as a tool for noncontact, high-throughput acupuncture in the treatment of muscle disease.
Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao
2016-01-01
Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were
Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max
2014-01-01
During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.
Perales, Sonia; Alejandre, M. José; Palomino-Morales, Rogelio; Torres, Carolina; Iglesias, Jose; Linares, Ana
2009-01-01
Smooth muscle cells (SMCs) undergo changes related to proliferation and apoptosis in the physiological remodeling of vessels and in diseases such as atherosclerosis and restenosis. Recent studies also have demonstrated the vascular cell proliferation and programmed cell death contribute to changes in vascular architecture in normal development and in disease. The present study was designed to investigate the apoptotic pathways induced by 25-hydroxycholesterol in SMCs cultures, using an in vivo/in vitro cell model in which SMCs were isolated and culture from chicken exposed to an atherogenic cholesterol-rich diet (SMC-Ch) and/or an antiatherogenic fish oil-rich diet (SMC-Ch-FO). Cells were exposed in vitro to 25-hydroxycholesterol to study levels of apoptosis and apoptotic proteins Bcl-2, Bcl-XL and Bax and the expression of bcl-2 and bcl-xL, genes. The quantitative real-time reverse transcriptase-polymerase chain reaction and the Immunoblotting western blot analysis showed that 25-hydroxycholesterol produces apoptosis in SMCs, mediated by a high increase in Bax protein and Bax gene expression. These changes were more marked in SMC-Ch than in SMC-Ch-FO, indicating that dietary cholesterol produces changes in SMCs that make them more susceptible to 25-hydroxycholesterol-mediated apoptosis. Our results suggest that the replacement of a cholesterol-rich diet with a fish oil-rich diet produces some reversal of cholesterol-induced changes in the apoptotic pathways induced by 25-hydroxycholesterol in SMCs cultures, making SMCs more resistant to apoptosis. PMID:19727411
Directory of Open Access Journals (Sweden)
Sonia Perales
2009-01-01
Full Text Available Smooth muscle cells (SMCs undergo changes related to proliferation and apoptosis in the physiological remodeling of vessels and in diseases such as atherosclerosis and restenosis. Recent studies also have demonstrated the vascular cell proliferation and programmed cell death contribute to changes in vascular architecture in normal development and in disease. The present study was designed to investigate the apoptotic pathways induced by 25-hydroxycholesterol in SMCs cultures, using an in vivo/in vitro cell model in which SMCs were isolated and culture from chicken exposed to an atherogenic cholesterol-rich diet (SMC-Ch and/or an antiatherogenic fish oil-rich diet (SMC-Ch-FO. Cells were exposed in vitro to 25-hydroxycholesterol to study levels of apoptosis and apoptotic proteins Bcl-2, Bcl-XL and Bax and the expression of bcl-2 and bcl-xL, genes. The quantitative real-time reverse transcriptase-polymerase chain reaction and the Immunoblotting western blot analysis showed that 25-hydroxycholesterol produces apoptosis in SMCs, mediated by a high increase in Bax protein and Bax gene expression. These changes were more marked in SMC-Ch than in SMC-Ch-FO, indicating that dietary cholesterol produces changes in SMCs that make them more susceptible to 25-hydroxycholesterol-mediated apoptosis. Our results suggest that the replacement of a cholesterol-rich diet with a fish oil-rich diet produces some reversal of cholesterol-induced changes in the apoptotic pathways induced by 25-hydroxycholesterol in SMCs cultures, making SMCs more resistant to apoptosis.
Goswami, Dinesh G; Kant, Rama; Tewari-Singh, Neera; Agarwal, Rajesh
2018-09-01
Vesicating agent, Sulfur mustard (SM), causes devastating eye injury; however, there are no effective antidotes available. Using nitrogen mustard (NM), a bi-functional analog of SM, we have earlier reported that NM-induced corneal injury in ex vivo rabbit cornea organ culture model parallels corneal injury reported with SM. Using this model, we have demonstrated the therapeutic efficacy of dexamethasone (DEX), doxycycline (DOX) and silibinin (SB) in reversing NM (2h exposure)-induced corneal injuries when added immediately after washing NM. In the present study, we further examined the efficacy of similar/higher doses of these agents when added immediately, 2, or 4h after washing NM following its 2h exposure. All three treatment agents caused a reversal in established NM-induced injury biomarkers when added immediately or 2h after washing NM following its 2h exposure; however, when treatments were carried out 4h after washing NM, there was no significant effect. Together, our results further show the beneficial effect of these agents in reversing NM-induced corneal injury and indicate the time window for effective treatment. This could be useful towards future development of targeted therapeutics against vesicant-induced ocular injury. Copyright © 2017 Elsevier B.V. All rights reserved.
Neuroprotection of Grape Seed Extract and Pyridoxine against Triton-Induced Neurotoxicity
Directory of Open Access Journals (Sweden)
Heba M. Abdou
2016-01-01
Full Text Available Triton WR-1339 administration causes neurotoxicity. Natural products and herbal extracts can attenuate cerebral injury. In the present study, we investigated the neuroprotective role of grape seed extract and/or vitamin B6 against triton-induced neurotoxicity. Thirty-five adult male albino rats of the Sprague-Dawley strain, weighing 140–145 g, were divided into five groups: control, triton, grape seed extract + triton, grape seed extract + triton + vitamin B6, and vitamin B6 + triton. The hematological and biochemical analyses were carried out. Alteration in iNOS mRNA gene expression was determined using reverse-transcriptase PCR analysis. In addition, qualitative DNA fragmentation was examined using agarose gel electrophoresis. Triton-treatment caused significant disturbances in the hematological parameters, the neurological functions, and the antioxidant profile. Also, triton significantly increased the iNOS mRNA expression and DNA damage. Our results showed that grape seed extract and/or vitamin B6 could attenuate all the examined parameters. These natural substances could exhibit protective effects against triton-induced neurological damage because of their antioxidative and antiapoptotic capacities.
Tenorio, Bruno Mendes; Ferreira Filho, Moisés Bonifacio Alves; Jimenez, George Chaves; de Morais, Rosana Nogueira; Peixoto, Christina Alves; Nogueira, Romildo de Albuquerque; da Silva Junior, Valdemiro Amaro
2014-06-01
Male infertility is often related to reproductive age couples experiencing fertility-related issues. Men may have fertility problems associated with reversible testicular damage. Considering that men have been increasingly exposed to extremely low-frequency magnetic fields generated by the production, distribution and use of electricity, this study analyzed whether 60 Hz and 1 mT magnetic field exposure may impair spermatogenesis recovery after reversible testicular damage induced by heat shock using rats as an experimental model. Adult male rats were subjected to a single testicular heat shock (HS, 43 °C for 12 min) and then exposed to the magnetic field for 15, 30 and 60 d after HS. Magnetic field exposure during the spermatogenesis recovery induced changes in testis components volume, cell ultrastructure and histomorphometrical parameters. Control animals had a reestablished and active spermatogenesis at 60 d after heat shock, while animals exposed to magnetic field still showed extensive testicular degeneration. Magnetic field exposure did not change the plasma testosterone. In conclusion, extremely low-frequency magnetic field may be harmful to fertility recovery in males affected by reversible testicular damage.
DEFF Research Database (Denmark)
Bubser, Michael; Bridges, Thomas M; Dencker, Ditte
2014-01-01
PAMs, enabling a more extensive characterization of M4 actions in rodent models. We used VU0467154 to test the hypothesis that selective potentiation of M4 receptor signaling could ameliorate the behavioral, cognitive, and neurochemical impairments induced by the noncompetitive NMDAR antagonist MK-801....... VU0467154 produced a robust dose-dependent reversal of MK-801-induced hyperlocomotion and deficits in preclinical models of associative learning and memory functions, including the touchscreen pairwise visual discrimination task in wild-type mice, but failed to reverse these stimulant...
Directory of Open Access Journals (Sweden)
Manzo Suzuki
2014-01-01
Full Text Available Negative pressure pulmonary edema (NPPE is a rare complication that accompanies general anesthesia, especially after extubation. We experienced a case of negative pressure pulmonary edema after tracheal extubation following reversal of rocuronium-induced neuromuscular blockade by sugammadex. In this case, the contribution of residual muscular block on the upper airway muscle as well as large inspiratory forces created by the respiratory muscle which has a low response to muscle relaxants, is suspected as the cause.
Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture
DEFF Research Database (Denmark)
Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic
2005-01-01
RNA and protein could be detected. The data suggest that iNOS expression may be a molecular mechanism mediating the adaptive response of trigeminal ganglia cells to the serum free stressful stimulus the culture environment provides. It may act as a cellular signalling molecule that is expressed after cell......Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascular......, reverse transcriptase polymerase chain reaction (RT-PCR) and Western blotting. In trigeminal ganglia cells not subjected to culture, endothelial (e) and neuronal (n) but not inducible (i) NOS mRNA and protein were detected. Culture of rat neurones resulted in a rapid axonal outgrowth of NOS positive...
Tabrizian, Kaveh; Azami, Kian; Belaran, Maryam; Soodi, Maliheh; Abdi, Khosrou; Fanoudi, Sahar; Sanati, Mehdi; Mottaghi Dastjerdi, Negar; Soltany Rezaee-Rad, Mohammad; Sharifzadeh, Mohammad
2016-10-01
Zinc, an essential micronutrient and biochemical element of the human body, plays structural, catalytic, and regulatory roles in numerous physiological functions. In the current study, the effects of a pretraining oral administration of zinc chloride (10, 25, and 50 mg/kg) for 14 consecutive days and post-training bilateral intra-hippocampal infusion of 1400W as a selective inducible nitric oxide synthase (iNOS) inhibitor (10, 50, and 100 μM/side), alone and in combination, on the spatial memory retention in Morris water maze (MWM) were investigated. Animals were trained for 4 days and tested 48 h after completion of training. Also, the molecular effects of these compounds on the expression of choline acetyltransferase (ChAT), as a cholinergic marker in the CA1 region of the hippocampus and medial septal area (MSA), were evaluated. Behavioral and molecular findings of this study showed that a 2-week oral administration of zinc chloride (50 mg/kg) impaired spatial memory retention in MWM and decreased ChAT expression. Immunohistochemical analysis of post-training bilateral intra-hippocampal infusion of 1400W revealed a significant increase in ChAT immunoreactivity. Furthermore, post-training bilateral intra-hippocampal infusion of 1400W into the CA1 region of the hippocampus reversed zinc chloride-induced spatial memory impairment in MWM and significantly increased ChAT expression in comparison with zinc chloride-treated animals. Taken together, these results emphasize the role of selective iNOS inhibitors in reversing zinc chloride-induced spatial memory deficits via modulation of cholinergic marker expression.
Parkinson’s disease managing reversible neurodegeneration
Hinz, Marty; Stein, Alvin; Cole, Ted; McDougall, Beth; Westaway, Mark
2016-01-01
Traditionally, the Parkinson’s disease (PD) symptom course has been classified as an irreversible progressive neurodegenerative disease. This paper documents 29 PD and treatment-induced systemic depletion etiologies which cause and/or exacerbate the seven novel primary relative nutritional deficiencies associated with PD. These reversible relative nutritional deficiencies (RNDs) may facilitate and accelerate irreversible progressive neurodegeneration, while other reversible RNDs may induce previously undocumented reversible pseudo-neurodegeneration that is hiding in plain sight since the symptoms are identical to the symptoms being experienced by the PD patient. Documented herein is a novel nutritional approach for reversible processes management which may slow or halt irreversible progressive neurodegenerative disease and correct reversible RNDs whose symptoms are identical to the patient’s PD symptoms. PMID:27103805
Sangeetha, K N; Shilpa, K; Jyothi Kumari, P; Lakshmi, B S
2013-02-15
The present study investigates the efficacy of Mangifera indica ethyl acetate extract (MIEE) and its bioactive compound, 3β-taraxerol in the reversal of dexamethasone (DEX) induced insulin resistance in 3T3L1 adipocytes. MIEE and 3β-taraxerol were evaluated for their ability to restore impaired glucose uptake and, expression of molecular markers in the insulin signaling pathway induced by DEX in 3T3L1 adipocytes using 2-deoxy-D-[1-(3)H] glucose uptake assay and ELISA. An insulin resistant model has been developed using a glucocorticoid, DEX on 3T3L1 adipocytes. Insulin resistant condition was observed at 24h of DEX induction wherein a maximum degree of resistance of about 50% was measured based on inhibition of glucose uptake, which was confirmed using cytotoxicity analysis. The developed model of insulin resistance was studied in comparison to positive control rosiglitazone. DEX induced inhibition of glucose uptake and the expression of insulin signaling markers GLUT4 and PI3K were found to be restored by 3β-taraxerol and MIEE, thus delineating its mechanism of action in the reversal of insulin resistance. 3β-Taraxerol effectively restored DEX induced desensitization via restoration of PI3K and GLUT4 expression. To conclude, since 3β-taraxerol exhibits significant effect in reversing insulin resistance it can be further investigated as an insulin resistance reversal agent. Copyright © 2012 Elsevier GmbH. All rights reserved.
Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng
2018-06-27
The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.
Local Peltier-effect-induced reversible metal–insulator transition in VO{sub 2} nanowires
Energy Technology Data Exchange (ETDEWEB)
Takami, Hidefumi; Kanki, Teruo, E-mail: kanki@sanken.osaka-u.ac.jp, E-mail: h-tanaka@sanken.osaka-u.ac.jp; Tanaka, Hidekazu, E-mail: kanki@sanken.osaka-u.ac.jp, E-mail: h-tanaka@sanken.osaka-u.ac.jp [Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan)
2016-06-15
We report anomalous resistance leaps and drops in VO{sub 2} nanowires with operating current density and direction, showing reversible and nonvolatile switching. This event is associated with the metal–insulator phase transition (MIT) of local nanodomains with coexistence states of metallic and insulating phases induced by thermoelectric cooling and heating effects. Because the interface of metal and insulator domains has much different Peltier coefficient, it is possible that a significant Peltier effect would be a source of the local MIT. This operation can be realized by one-dimensional domain configuration in VO{sub 2} nanowires because one straight current path through the electronic domain-interface enables theoretical control of thermoelectric effects. This result will open a new method of reversible control of electronic states in correlated electron materials.
Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K
2015-04-01
MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.
NCBI nr-aa BLAST: CBRC-DDIS-06-0095 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-DDIS-06-0095 gb|AAX19886.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excel...sa] gb|AAX19887.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excelsa] AAX19886.1 1e-44 25% ...
International Nuclear Information System (INIS)
Sauga, Ako; Laas, Katrin; Mankin, Romi
2015-01-01
Highlights: • Cross-correlation (CC) of coordinates of particles in viscoelastic shear flows is discussed. • Expressions for CC functions subjected to both internal and external noises are presented. • Impact of internal and external noises on CC functions are compared. • Memory-induced reentrant sign reversals of the spatial cross-moment are established. - Abstract: The behavior of shear-induced cross-correlation functions between particle fluctuations along orthogonal directions in the shear plane for harmonically trapped Brownian particles in a viscoelastic shear flow is studied. A generalized Langevin equation with a power-law-type memory kernel is used to model the complex structure of the viscoelastic media. Interaction with fluctuations of environmental parameters is modeled by a multiplicative white Gaussian noise, by an internal fractional Gaussian noise, and by an additive external white noise. It is shown that the presence of a memory has a profound effect on the behavior of the cross-correlation functions. Particularly, memory-induced reentrant sign reversals of the spatial cross-moment between orthogonal random displacements of a particle are established, i.e., an increase of the memory exponent can cause the sign reversal from positive to negative, but by a further increase of the memory exponent a reentrant transition from negative to positive values appears. Similarities and differences between the behavior of the models with additive internal and external noises are considered. It is shown that additive external and internal noises cause qualitatively different dependencies of the cross-correlation functions on the time lag. The occurrence of energetic instability due to the influence of multiplicative noise is also discussed.
Saadati, Hakimeh; Sheibani, Vahid; Esmaeili-Mahani, Saeed; Darvishzadeh-Mahani, Fatemeh; Mazhari, Shahrzad
2014-11-01
Previous studies indicated that brain-derived neurotrophic factor (BDNF) is the main candidate to mediate the beneficial effects of exercise on cognitive function in sleep deprived male rats. In addition, our previous findings demonstrate that female rats are more vulnerable to the deleterious effects of sleep deprivation on cognitive performance and synaptic plasticity. Therefore, the current study was designed to investigate the effects of treadmill exercise and/or sleep deprivation (SD) on the levels of BDNF mRNA and protein in the hippocampus of female rats. Intact and ovariectomized (OVX) female Wistar rats were used in the present experiment. The exercise protocol was four weeks treadmill running and sleep deprivation was accomplished using the multiple platform method. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and immunoblot analysis were used to evaluate the level of BDNF mRNA and protein in the rat hippocampus respectively. Our results showed that protein and mRNA expression of BDNF was significantly (psleep deprived OVX rats under exercise conditions had a significant (peffect against hippocampus-related functions and impairments induced by sleep deprivation probably by inducing BDNF expression. Copyright © 2014 Elsevier B.V. All rights reserved.
Scully, William F; White, Klane K; Song, Kit M; Mosca, Vincent S
2015-03-01
Adoption rates are increasing in the United States and other developed countries. A large proportion of adopted children have been found to have unsuspected medical diagnoses, including orthopedic problems. One condition, termed injection-induced gluteus maximus contracture, has been previously described in several case series and can be difficult to diagnose if unfamiliar with this condition. By reviewing the etiology and pathoanatomy of this problem, as well as the typical examination findings, including the near-pathognomonic-positive "reverse Ober test," treating providers will be better prepared to recognize and properly treat this condition. This is a retrospective review of 4 patients treated at our institution for injection-induced gluteus maximus contracture. Patient history, physical examination findings, and treatment outcomes were recorded. All had undergone surgical treatment through a longitudinal incision along the posterior margin of the iliotibial band, with division of thickened, contracted gluteus tissue down to the ischial tuberosity. All 4 of the patients were adopted from orphanages in developing countries. Chief complaints of the patients varied, but physical examination findings were very consistent. Three of the 4 patients had undergone rotational osteotomies for presumed femoral retroversion before their diagnosis and treatment for injection-induced gluteus maximus contracture. All patients had concave, atrophic buttock contours and numerous punctate buttock scars. All walked with an out-toed gait and had marked apparent femoral retroversion. Each patient was found to have full hip adduction when the hip was extended but a hip abduction contracture when the hip was flexed. This finding of increasing abduction as an extended/adducted hip is flexed to 90 degrees is described as a positive "reverse Ober test." After surgical treatment, all hips could adduct to neutral from full extension to full flexion. Although common in some countries
Major, Andrew T; Smith, Craig A
2016-01-01
Sexual differentiation in birds is controlled genetically as in mammals, although the sex chromosomes are different. Males have a ZZ sex chromosome constitution, while females are ZW. Gene(s) on the sex chromosomes must initiate gonadal sex differentiation during embryonic life, inducing paired testes in ZZ individuals and unilateral ovaries in ZW individuals. The traditional view of avian sexual differentiation aligns with that expounded for other vertebrates; upon sexual differentiation, the gonads secrete sex steroid hormones that masculinise or feminise the rest of the body. However, recent studies on naturally occurring or experimentally induced avian sex reversal suggest a significant role for direct genetic factors, in addition to sex hormones, in regulating sexual differentiation of the soma in birds. This review will provide an overview of sex determination in birds and both naturally and experimentally induced sex reversal, with emphasis on the key role of oestrogen. We then consider how recent studies on sex reversal and gynandromorphic birds (half male:half female) are shaping our understanding of sexual differentiation in avians and in vertebrates more broadly. Current evidence shows that sexual differentiation in birds is a mix of direct genetic and hormonal mechanisms. Perturbation of either of these components may lead to sex reversal. © 2016 S. Karger AG, Basel.
Cyclic GMP-AMP Synthase is an Innate Immune Sensor of HIV and Other Retroviruses
Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J.
2013-01-01
Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic-GMP-AMP (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type-I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse transcribed HIV DNA triggers the...
Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre
2012-04-01
The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Reversal or protection by light of the ethidium bromide induced petite mutation in yeast
International Nuclear Information System (INIS)
Hixon, S.C.; Burnham, A.D.; Irons, R.L.
1979-01-01
An intermediate in the ethidium bromide (EB) induced petite mutation pathway may be destabilized by daylight light to cause a reversion to the normal grande phenotype. Starved cells preincubated in the dark for up to 6 h with 100μg/ml EB could be reverted to grandes after one hour of light exposure, whereas similarly treated cells maintained in the dark expresse the petite mutation in more than 80 percent of the population. In addition, the production of petite mutants by EB in buffer could be prevented if cell suspensions were exposed to light immediately upon the addition of EB. Photoreversal of the EB-derived petite mutation in growing cells as less efficient presumably because the availability of an energy source caused a continuation of mutation events beyond the light revertible step to a non-reversible fixation of the mutation. Cells treated with EB in growth and reversal of the mutation. This may be due to the cold inhibition of an enzyme which comes into play beyond the light sensitive step in the mutation pathway. (orig.) [de
Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano
2005-01-13
Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.
NEW DRUGS NEW TARGETS AND NOVEL ANTIRETROVIRALS
African Journals Online (AJOL)
2005-11-02
Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).
Chung, Pei-Hsuan; Wu, Ying-Ying; Chen, Pei-Hsuan; Fung, Chang-Phone; Hsu, Ching-Mei; Chen, Lee-Wei
2016-09-01
Altered intestinal microbiota and subsequent endotoxemia play pathogenic roles in diabetes. We aimed to study the mechanisms of intestinal defense impairment in type 1 diabetes and the effects of Lactobacillus salivarius as well as fructooligosaccharides (FOS) supplementation on diabetes-induced bacterial translocation. Alterations in the enteric microbiome, expression of mucosal antibacterial proteins and bacteria-killing activity of the intestinal mucosa in streptozotocin (STZ)-induced diabetic mice and Ins2(Akita) mice were investigated. The effects of dead L. salivarius (2×10(8)CFU/ml) and FOS (250 mg per day) supplementation for 1 week on endotoxin levels and Klebsiella pneumoniae translocation were also examined. Finally, germ-free mice were cohoused with wild-type or Ins2(Akita) mice for 2 weeks to examine the contribution of microbiota on the antibacterial protein expression. STZ-induced diabetic mice developed intestinal defense impairment as demonstrated by decreased mucosal bacteria-killing activity; reduction of non-defensin family proteins, such as Reg3β, Reg3γ, CRP-ductin and RELMβ, but not the defensin family proteins; and increased bacterial translocation. Intestinal bacteria overgrowth, enteric dysbiosis and increased intestinal bacterial translocation, particularly pathogenic K. pneumoniae in STZ-induced diabetic mice and Ins2(Akita) mice, were noted. Treating diabetic mice with dead L. salivarius or FOS reversed enteric dysbiosis, restored mucosal antibacterial protein and lessened endotoxin levels as well as K. pneumoniae translocation. Moreover, germ-free mice cohoused with wild-type mice demonstrated more intestinal Reg3β and RELMβ expression than those cohoused with Ins2(Akita) mice. These results indicate that hyperglycemia induces enteric dysbiosis, reduction of non-defensin proteins as well as bacteria-killing activity of the intestinal mucosa and intestinal defense impairment. Reversal of enteric dysbiosis with dead L. salivarius or
DEFF Research Database (Denmark)
Duvaldestin, Philippe; Kuizenga, Karel; Saldien, Vera
2010-01-01
Sugammadex is the first of a new class of selective muscle relaxant binding drugs developed for the rapid and complete reversal of neuromuscular blockade induced by rocuronium and vecuronium. Many studies have demonstrated a dose-response relationship with sugammadex for reversal of neuromuscular...
Duvaldestin, Philippe; Kuizenga, Karel; Saldien, Vera; Claudius, Casper; Servin, Frederique; Klein, Jan; Debaene, Bertrand; Heeringa, Marten
BACKGROUND: Sugammadex is the first of a new class of selective muscle relaxant binding drugs developed for the rapid and complete reversal of neuromuscular blockade induced by rocuronium and vecuronium. Many studies have demonstrated a close-response relationship with sugammadex for reversal of
Quetiapine reverse paclitaxel-induced neuropathic pain in mice: Role of Alpha2- adrenergic receptors
Directory of Open Access Journals (Sweden)
Alireza Abed
2017-11-01
Full Text Available Objective(s: Paclitaxel-induced peripheral neuropathy is a common adverse effect of cancer chemo -therapy. This neuropathy has a profound impact on quality of life and patient’s survival. Preventing and treating paclitaxel-induced peripheral neuropathy is a major concern. First- and second-generation antipsychotics have shown analgesic effects both in humans and animals. Quetiapine is a novel atypical antipsychotic with low propensity to induce extrapyramidal or hyperprolactinemia side effects. The present study was designed to investigate the effects of quetiapine on the development and expression of neuropathic pain induced by paclitaxel in mice and the role of α2-adrenoceptors on its antinociception. Materials and Methods: Paclitaxel (2 mg/kg IP was injected for five consecutive days which resulted in thermal hyperalgesia and mechanical and cold allodynia. Results: Early administration of quetiapine from the 1st day until the 5th day (5, 10, and 15 mg/kg PO did not affect thermal, mechanical, and cold stimuli and could not prevent the development of neuropathic pain. In contrast, when quetiapine (10 and 15 mg/kg PO administration was started on the 6th day after the first paclitaxel injections, once the model had been established, and given daily until the 10th day, heat hyperalgesia and mechanical and cold allodynia were significantly attenuated. Also, the effect of quetiapine on heat hyperalgesia was reversed by pretreatment with yohimbine, as an alpha-2 adrenergic receptor antagonist. Conclusion: These results indicate that quetiapine, when administered after nerve injury can reverse the expression of neuropathic pain. Also, we conclude that α2-adrenoceptors participate in the antinociceptive effects of quetiapine.
Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong
2018-01-01
As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens
2012-01-01
Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...
A transient ischemic environment induces reversible compaction of chromatin.
Kirmes, Ina; Szczurek, Aleksander; Prakash, Kirti; Charapitsa, Iryna; Heiser, Christina; Musheev, Michael; Schock, Florian; Fornalczyk, Karolina; Ma, Dongyu; Birk, Udo; Cremer, Christoph; Reid, George
2015-11-05
Cells detect and adapt to hypoxic and nutritional stress through immediate transcriptional, translational and metabolic responses. The environmental effects of ischemia on chromatin nanostructure were investigated using single molecule localization microscopy of DNA binding dyes and of acetylated histones, by the sensitivity of chromatin to digestion with DNAseI, and by fluorescence recovery after photobleaching (FRAP) of core and linker histones. Short-term oxygen and nutrient deprivation of the cardiomyocyte cell line HL-1 induces a previously undescribed chromatin architecture, consisting of large, chromatin-sparse voids interspersed between DNA-dense hollow helicoid structures 40-700 nm in dimension. The chromatin compaction is reversible, and upon restitution of normoxia and nutrients, chromatin transiently adopts a more open structure than in untreated cells. The compacted state of chromatin reduces transcription, while the open chromatin structure induced upon recovery provokes a transitory increase in transcription. Digestion of chromatin with DNAseI confirms that oxygen and nutrient deprivation induces compaction of chromatin. Chromatin compaction is associated with depletion of ATP and redistribution of the polyamine pool into the nucleus. FRAP demonstrates that core histones are not displaced from compacted chromatin; however, the mobility of linker histone H1 is considerably reduced, to an extent that far exceeds the difference in histone H1 mobility between heterochromatin and euchromatin. These studies exemplify the dynamic capacity of chromatin architecture to physically respond to environmental conditions, directly link cellular energy status to chromatin compaction and provide insight into the effect ischemia has on the nuclear architecture of cells.
Wisitpitthaya, Somsinee; Zhao, Yi; Long, Marcus J C; Li, Minxing; Fletcher, Elaine A; Blessing, William A; Weiss, Robert S; Aye, Yimon
2016-07-15
The enzyme ribonucleotide reductase (RNR) is a major target of anticancer drugs. Until recently, suicide inactivation in which synthetic substrate analogs (nucleoside diphosphates) irreversibly inactivate the RNR-α2β2 heterodimeric complex was the only clinically proven inhibition pathway. For instance, this mechanism is deployed by the multifactorial anticancer agent gemcitabine diphosphate. Recently reversible targeting of RNR-α-alone coupled with ligand-induced RNR-α-persistent hexamerization has emerged to be of clinical significance. To date, clofarabine nucleotides are the only known example of this mechanism. Herein, chemoenzymatic syntheses of the active forms of two other drugs, phosphorylated cladribine (ClA) and fludarabine (FlU), allow us to establish that reversible inhibition is common to numerous drugs in clinical use. Enzyme inhibition and fluorescence anisotropy assays show that the di- and triphosphates of the two nucleosides function as reversible (i.e., nonmechanism-based) inhibitors of RNR and interact with the catalytic (C site) and the allosteric activity (A site) sites of RNR-α, respectively. Gel filtration, protease digestion, and FRET assays demonstrate that inhibition is coupled with formation of conformationally diverse hexamers. Studies in 293T cells capable of selectively inducing either wild-type or oligomerization-defective mutant RNR-α overexpression delineate the central role of RNR-α oligomerization in drug activity, and highlight a potential resistance mechanism to these drugs. These data set the stage for new interventions targeting RNR oligomeric regulation.
International Nuclear Information System (INIS)
Huang, H. B.; Hu, J. M.; Yang, T. N.; Chen, L. Q.; Ma, X. Q.
2014-01-01
Effect of substrate misfit strain on current-induced in-plane magnetization reversal in CoFeB-MgO based magnetic tunnel junctions is investigated by combining micromagnetic simulations with phase-field microelasticity theory. It is found that the critical current density for in-plane magnetization reversal decreases dramatically with an increasing substrate strain, since the effective elastic field can drag the magnetization to one of the four in-plane diagonal directions. A potential strain-assisted multilevel bit spin transfer magnetization switching device using substrate misfit strain is also proposed.
(3,4-dihydroisoquinolin-2(1H)-yl)
Indian Academy of Sciences (India)
Administrator
HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.
New targets and novel antiretrovirals | Wood | Southern African ...
African Journals Online (AJOL)
Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). These ARV classes ...
Efficacy of the chelating agent CaEDTA in reversing lead-induced changes in behavior.
Cory-Slechta, D A; Weiss, B
1989-01-01
The chelating agent CaEDTA has been reported to reverse the deficits in intellectual function and performance associated with Pb (lead) exposure in children. However, such studies have not included rigorous controls for the intervention procedures per se. The experiments reported here examined reversibility of performance changes in a rat model based on behavior sensitive to low-level Pb exposure. Rats were exposed to 50 ppm sodium or Pb acetate in drinking water from weaning. Performance maintained under a Fixed-Interval schedule of food reinforcement began at 55 days of age. Following the onset of the characteristic increase in short interresponse times (IRTs) associated with low-level Pb exposure after 35 experimental sessions, Pb treatment was terminated. Animals within both the control and Pb groups were then matched on the basis of performance indices and injected daily for 5 days with either saline, 75 mg/kg or 150 mg/kg CaEDTA. Subsequent changes in F1 performance were monitored for 35-60 sessions. No consistent effects of CaEDTA were detected in control animals. CaEDTA treatment failed to reverse the behavioral effects in Pb-exposed animals. If anything, it tended to further increase the proportion of short IRTs. These data suggest that better controlled clinical studies are warranted to evaluate the efficacy of CaEDTA in reversing Pb-induced behavioral effects before its application for these purposes becomes widespread.
Luo, Lan; Yan, Chen; Urata, Yoshishige; Hasan, Al Shaimaa; Goto, Shinji; Guo, Chang-Ying; Zhang, Shouhua; Li, Tao-Sheng
2017-01-01
We evaluated the dose-dependency and reversibility of radiation-induced injury in cardiac explant-derived cells (CDCs), a mixed cell population grown from heart tissues. Adult C57BL/6 mice were exposed to 0, 10, 50 and 250 mGy γ-rays for 7 days and atrial tissues were collected for experiments 24 hours after last exposure. The number of CDCs was significantly decreased by daily exposure to over 250 mGy. Interestingly, daily exposure to over 50 mGy significantly decreased the c-kit expression and telomerase activity, increased 53BP1 foci in the nuclei of CDCs. However, CD90 expression and growth factors production in CDCs were not significantly changed even after daily exposure to 250 mGy. We further evaluated the reversibility of radiation-induced injury in CDCs at 1 week and 3 weeks after a single exposure to 3 Gy γ-rays. The number and growth factors production of CDCs were soon recovered at 1 week. However, the increased expression of CD90 were retained at 1 week, but recovered at 3 weeks. Moreover, the decreased expression of c-kit, impaired telomerase activity, and increased 53BP1 foci were poorly recovered even at 3 weeks. These data may help us to find the most sensitive and reliable bio-parameter(s) for evaluating radiation-induced injury in CDCs. PMID:28098222
Neis, Vivian B; Bettio, Luis E B; Moretti, Morgana; Rosa, Priscila B; Ribeiro, Camille M; Freitas, Andiara E; Gonçalves, Filipe M; Leal, Rodrigo B; Rodrigues, Ana Lúcia S
Agmatine is an endogenous neuromodulator that has been shown to have antidepressant-like properties. We have previously demonstrated that it can induce a rapid increase in BDNF levels after acute administration, suggesting that agmatine may be a fast-acting antidepressant. To investigate this hypothesis, the present study evaluated the effects of a single administration of agmatine in mice subjected to chronic unpredictable stress (CUS), a model of depression responsive only to chronic treatment with conventional antidepressants. The ability of agmatine to reverse CUS-induced behavioral and biochemical alterations was evaluated and compared with those elicited by the fast-acting antidepressant (ketamine) and the conventional antidepressant (fluoxetine). After exposed to CUS for 14days, mice received a single oral dose of agmatine (0.1mg/kg), ketamine (1mg/kg) or fluoxetine (10mg/kg), and were submitted to behavioral evaluation after 24h. The exposure to CUS caused an increased immobility time in the tail suspension test (TST) but did not change anhedonic-related parameters in the splash test. Our findings provided evidence that, similarly to ketamine, agmatine is able to reverse CUS-induced depressive-like behavior in the TST. Western blot analyses of prefrontal cortex (PFC) demonstrated that mice exposed to CUS and/or treated with agmatine, fluoxetine or ketamine did not present alterations in the immunocontent of synaptic proteins [i.e. GluA1, postsynaptic density protein 95 (PSD-95) and synapsin]. Altogether, our findings indicate that a single administration of agmatine is able to reverse behavioral alterations induced by CUS in the TST, suggesting that this compound may have fast-acting antidepressant-like properties. However, there was no alteration in the levels of synaptic proteins in the PFC, a result that need to be further investigated in other time points. Copyright © 2016 Elsevier Inc. All rights reserved.
Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd
2013-11-05
Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable
Heinen, André; Aldakkak, Mohammed; Stowe, David F.; Rhodes, Samhita S.; Riess, Matthias L.; Varadarajan, Srinivasan G.; Camara, Amadou K. S.
2007-01-01
Mitochondria generate reactive oxygen species (ROS) dependent on substrate conditions, O(2) concentration, redox state, and activity of the mitochondrial complexes. It is well known that the FADH(2)-linked substrate succinate induces reverse electron flow to complex I of the electron transport chain
DEFF Research Database (Denmark)
Dukes, J.P.; King, D.P.; Alexandersen, Søren
2006-01-01
Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...
Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W
2014-09-01
Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We
Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin
2017-04-01
Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.
Bacterial lipoprotein-induced tolerance is reversed by overexpression of IRAK-1.
LENUS (Irish Health Repository)
Li, Chong Hui
2012-03-01
Tolerance to bacterial cell wall components including bacterial lipoprotein (BLP) represents an essential regulatory mechanism during bacterial infection. Reduced Toll-like receptor 2 (TLR2) and IL-1 receptor-associated kinase 1 (IRAK-1) expression is a characteristic of the downregulated TLR signaling pathway observed in BLP-tolerised cells. In this study, we attempted to clarify whether TLR2 and\\/or IRAK-1 are the key molecules responsible for BLP-induced tolerance. Transfection of HEK293 cells and THP-1 cells with the plasmid encoding TLR2 affected neither BLP tolerisation-induced NF-κB deactivation nor BLP tolerisation-attenuated pro-inflammatory cytokine tumor necrosis factor alpha (TNF-α) production, indicating that BLP tolerance develops despite overexpression of TLR2 in these cells. In contrast, overexpression of IRAK-1 reversed BLP-induced tolerance, as transfection of IRAK-1 expressing vector resulted in a dose-dependent NF-κB activation and TNF-α release in BLP-tolerised cells. Furthermore, BLP-tolerised cells exhibited markedly repressed NF-κB p65 phosphorylation and impaired binding of p65 to several pro-inflammatory cytokine gene promoters including TNF-α and interleukin-6 (IL-6). Overexpression of IRAK-1 restored the nuclear transactivation of p65 at both TNF-α and IL-6 promoters. These results indicate a crucial role for IRAK-1 in BLP-induced tolerance, and suggest IRAK-1 as a potential target for manipulation of the TLR-mediated inflammatory response during microbial sepsis.
Effect of dimethyl sulfoxide (DMSO) on radiation-induced heteroallelic reversion in diploid yeast
International Nuclear Information System (INIS)
Singh, D.R.; Mahajan, J.M.; Krishnan, D.
1976-01-01
Dimethyl sulfoxide has cryoprotective and radioprotective properties. It is also an efficient scavenger of radicals produced by radiolysis of water. Gamma-induced reversion of diploid yeast in the presence of this chemical during irradiation have been studied. The dose-modifying factor was in the same range as for survival. When the yeast was irradiated in the frozen state, the observed protection by DMSO disappeared. The results are discussed in terms of direct and indirect actions of radiations and the radical-scavenging ability of this chemical
Reversible metronidazole-induced neurotoxicity after 10 weeks of therapy.
AlDhaleei, Wafa; AlMarzooqi, Ayesha; Gaber, Nouran
2018-04-20
Metronidazole is a commonly used antimicrobial worldwide. The most common side effects that have been reported are nausea, vomiting and hypersensitivity reactions. However, neurotoxicity has been reported with the use of metronidazole but rather rare. The most common neurological manifestation is peripheral neuropathy involvement in the form of sensory loss. It is worth mentioning that central neurotoxicity is a rare side effect of metronidazole use but reversible. The manifestations vary from a headache, altered mental status to focal neurological deficits. The diagnosis is mainly by neuroimaging in the setting of acute neurological change in the patient status. Here, we report a case of metronidazole-induced neurotoxicity in a 38-year-old male patient who was admitted with a brain abscess and was started on metronidazole for more than 10 weeks. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Oliveira, Tatiana de Queiroz; de Sousa, Caren Nádia Soares; Vasconcelos, Germana Silva; de Sousa, Luciene Costa; de Oliveira, Anneheydi Araújo; Patrocínio, Cláudio Felipe Vasconcelos; Medeiros, Ingridy da Silva; Honório Júnior, José Eduardo Ribeiro; Maes, Michael; Macedo, Danielle; Vasconcelos, Silvânia Maria Mendes
2017-09-01
Depression is accompanied by activated neuro-oxidative and neuro-nitrosative pathways, while targeting these pathways has clinical efficacy in depression. This study aimed to investigate the effects of mirtazapine (MIRT) alone and combined with alpha-lipoic acid (ALA) against corticosterone (CORT) induced behavioral and oxidative alterations. Male mice received vehicle or CORT 20mg/kg during 14 days. From the 15th to 21st days they were divided in groups administered: vehicle, MIRT 3mg/kg or the combinations MIRT+ALA100 or MIRT+ALA200. On the 21st day of treatment, the animals were subjected to behavioral tests. Twenty-four hours after the last drug administration hippocampus (HC) and striatum (ST) were dissected for the determination reduced glutathione (GSH), lipid peroxidation (LP) and nitrite levels. CORT induced anxiety- and depressive-like behaviors as observed by increased immobility time in the tail suspension test and decreased sucrose consumption. MIRT or MIRT+ALA are effective in reversing anxiety- and depressive-like behaviors induced by CORT. CORT and MIRT alone prolonged sleeping time and this effect was reversed by MIRT+ALA. CORT significantly increased LP, which was reversed by MIRT or MIRT+ALA. Nitrite levels were increased in CORT-treated animals and reversed by MIRT+ALA200 (HC), MIRT or MIRT+ALA (ST). A relative small sample size and lack of a washout period between drug administration and behavioral testing. MIRT or MIRT+ALA reverse CORT-induced anxiety- and depressive-like behaviors probably via their central antioxidant effects. Augmentation of MIRT with ALA may reverse sedation, an important side effect of MIRT. Randomized controlled studies are needed to examine the clinical efficacy of this combination in human depression. Copyright © 2017 Elsevier B.V. All rights reserved.
Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa
Directory of Open Access Journals (Sweden)
Aline Aki Tanikawa
2013-08-01
Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.
Age-Dependent Cellular and Behavioral Deficits Induced by Molecularly Targeted Drugs Are Reversible.
Scafidi, Joseph; Ritter, Jonathan; Talbot, Brooke M; Edwards, Jorge; Chew, Li-Jin; Gallo, Vittorio
2018-04-15
Newly developed targeted anticancer drugs inhibit signaling pathways commonly altered in adult and pediatric cancers. However, as these pathways are also essential for normal brain development, concerns have emerged of neurologic sequelae resulting specifically from their application in pediatric cancers. The neural substrates and age dependency of these drug-induced effects in vivo are unknown, and their long-term behavioral consequences have not been characterized. This study defines the age-dependent cellular and behavioral effects of these drugs on normally developing brains and determines their reversibility with post-drug intervention. Mice at different postnatal ages received short courses of molecularly targeted drugs in regimens analagous to clinical treatment. Analysis of rapidly developing brain structures important for sensorimotor and cognitive function showed that, while adult administration was without effect, earlier neonatal administration of targeted therapies attenuated white matter oligodendroglia and hippocampal neuronal development more profoundly than later administration, leading to long-lasting behavioral deficits. This functional impairment was reversed by rehabilitation with physical and cognitive enrichment. Our findings demonstrate age-dependent, reversible effects of these drugs on brain development, which are important considerations as treatment options expand for pediatric cancers. Significance: Targeted therapeutics elicit age-dependent long-term consequences on the developing brain that can be ameliorated with environmental enrichment. Cancer Res; 78(8); 2081-95. ©2018 AACR . ©2018 American Association for Cancer Research.
Opii, Wycliffe O; Sultana, Rukhsana; Abdul, Hafiz Mohmmad; Ansari, Mubeen Ahmad; Nath, Avindra; Butterfield, D Allan
2007-03-01
Human immunodeficiency virus dementia (HIVD) is the most common form of dementia occurring among young adults. In HIVD, neuronal cell loss occurs in the absence of neuronal infection. With the advent of highly active anti-retroviral therapy (HAART), the incidence of HIVD has drastically reduced, though prevalence of milder forms of HIVD continues to rise. Though these agents have been used successfully in suppressing viral production, they have also been associated with a number of side effects. Here we examine the possible role of NRTIs, in particular 2',3'-dideoxycytidine (ddC), in the neuropathology of HIVD. Synaptosomes and isolated mitochondria treated and incubated for 6 h with CSF-achievable concentrations of ddC, i.e., 6-11 ng/ml, were found to show a significant increase in oxidative stress with 40 nM ddC as measured by protein carbonyls and 3-nitrotyrosine (3NT), effects that were not observed in the more tolerable NRTI, 3TC. Protection against protein oxidation induced by ddC was observed when brain mitochondria were isolated from gerbils 1 h after injection i.p. with the brain accessible antioxidant and glutathione mimetic, tricyclodecan-9-yl-xanthogenate (D609). In addition, there is a significant reduction in the levels of anti-apoptotic protein Bcl-2 and a significant increase in cytochrome c release and also a significant increase in the expression of pro-apoptotic protein caspase-3 after mitochondria were treated with 40 nM ddC. The results reported here show that ddC at 40 nM can induce oxidative stress, cause the release of cytochrome c, and in addition, reduce the levels of anti-apoptotic proteins, increase the levels of pro-apoptotic proteins, thereby increasing the possibility for induction of apoptosis. These findings are consistent with the notion of a possible role of the NRTIs, and in particular, ddC, in the mechanisms involved in HIVD.
How decision reversibility affects motivation.
Bullens, Lottie; van Harreveld, Frenk; Förster, Jens; Higgins, Tory E
2014-04-01
The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making, strengthening prevention-related motivation relatively more than promotion-related motivation. If so, then decision reversibility should have effects associated with the relative differences between prevention and promotion motivation. In 5 studies, we manipulated the reversibility of a decision and used different indicators of regulatory focus motivation to test these predictions. Specifically, Study 1 tested for differences in participants' preference for approach versus avoidance strategies toward a desired end state. In Study 2, we used speed and accuracy performance as indicators of participants' regulatory motivation, and in Study 3, we measured global versus local reaction time performance. In Study 4, we approached the research question in a different way, making use of the value-from-fit hypothesis (Higgins, 2000, 2002). We tested whether a fit between chronic regulatory focus and focus induced by the reversibility of the decision increased participants' subjective positive feelings about the decision outcome. Finally, in Study 5, we tested whether regulatory motivation, induced by decision reversibility, also influenced participants' preference in specific product features. The results generally support our hypothesis showing that, compared to irreversible decisions, reversible decisions strengthen a prevention focus more than a promotion focus. Implications for research on decision making are discussed.
Saito, Akiko; Ooki, Akio; Nakamura, Takashi; Onodera, Shoko; Hayashi, Kamichika; Hasegawa, Daigo; Okudaira, Takahito; Watanabe, Katsuhito; Kato, Hiroshi; Onda, Takeshi; Watanabe, Akira; Kosaki, Kenjiro; Nishimura, Ken; Ohtaka, Manami; Nakanishi, Mahito; Sakamoto, Teruo; Yamaguchi, Akira; Sueishi, Kenji; Azuma, Toshifumi
2018-01-22
Runt-related transcription factor 2 (RUNX2) haploinsufficiency causes cleidocranial dysplasia (CCD) which is characterized by supernumerary teeth, short stature, clavicular dysplasia, and osteoporosis. At present, as a therapeutic strategy for osteoporosis, mesenchymal stem cell (MSC) transplantation therapy is performed in addition to drug therapy. However, MSC-based therapy for osteoporosis in CCD patients is difficult due to a reduction in the ability of MSCs to differentiate into osteoblasts resulting from impaired RUNX2 function. Here, we investigated whether induced pluripotent stem cells (iPSCs) properly differentiate into osteoblasts after repairing the RUNX2 mutation in iPSCs derived from CCD patients to establish normal iPSCs, and whether engraftment of osteoblasts derived from properly reverted iPSCs results in better regeneration in immunodeficient rat calvarial bone defect models. Two cases of CCD patient-derived induced pluripotent stem cells (CCD-iPSCs) were generated using retroviral vectors (OCT3/4, SOX2, KLF4, and c-MYC) or a Sendai virus SeVdp vector (KOSM302L). Reverted iPSCs were established using programmable nucleases, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas-derived RNA-guided endonucleases, to correct mutations in CCD-iPSCs. The mRNA expressions of osteoblast-specific markers were analyzed using quantitative reverse-transcriptase polymerase chain reaction. iPSCs-derived osteoblasts were transplanted into rat calvarial bone defects, and bone regeneration was evaluated using microcomputed tomography analysis and histological analysis. Mutation analysis showed that both contained nonsense mutations: one at the very beginning of exon 1 and the other at the initial position of the nuclear matrix-targeting signal. The osteoblasts derived from CCD-iPSCs (CCD-OBs) expressed low levels of several osteoblast differentiation markers, and transplantation of these osteoblasts into calvarial bone defects created in rats with
Castro-Grattoni, Anabel L; Alvarez-Buvé, Roger; Torres, Marta; Farré, Ramon; Montserrat, Josep M; Dalmases, Mireia; Almendros, Isaac; Barbé, Ferran; Sánchez-de-la-Torre, Manuel
2016-06-01
Intermittent hypoxia (IH) is the principal injurious factor involved in the cardiovascular morbidity and mortality associated with OSA. The gold standard for treatment is CPAP, which eliminates IH and appears to reduce cardiovascular risk. There is no experimental evidence on the reversibility of cardiovascular remodeling after IH withdrawal. The objective of the present study is to assess the reversibility of early cardiovascular structural remodeling induced by IH after resumption of normoxic breathing in a novel recovery animal model mimicking OSA treatment. We investigated cardiovascular remodeling in C57BL/6 mice exposed to IH for 6 weeks vs the normoxia group and its spontaneous recovery after 6 subsequent weeks under normoxia. Aortic expansive remodeling was induced by IH, with intima-media thickening and without lumen perimeter changes. Elastic fiber network disorganization, fragmentation, and estrangement between the end points of disrupted fibers were increased by IH. Extracellular matrix turnover was altered, as visualized by collagen and mucoid interlaminar accumulation. Furthermore, left ventricular perivascular fibrosis was increased by IH, whereas cardiomyocytes size was unaffected. These cardiovascular remodeling events induced by IH were normalized after recovery in normoxia, mimicking CPAP treatment. The early structural cardiovascular remodeling induced by IH was normalized after IH removal, revealing a novel recovery model for studying the effects of OSA treatment. Our findings suggest the clinical relevance of early detection and effective treatment of OSA in patients to prevent the natural course of cardiovascular diseases. Copyright © 2016 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Nagi F Idris
2009-06-01
Full Text Available Recent studies in our laboratory have shown that PCP (phencyclidine and d-amphetamine induce a cognitive deficit in rats, in a paradigm of potential relevance for the pathology of schizophrenia. Atypical, but not classical antipsychotics and the anticonvulsant, lamotrigine have been shown to prevent a selective reversal learning deficit induced by PCP. In contrast, only haloperidol reversed the d-amphetamine-induced deficit. The present study aimed to explore the ability of two anticonvulsants with differing mechanism of action, valproate and phenytoin to attenuate the cognitive deficits induced by PCP and d-amphetamine in the reversal learning paradigm. PCP at 1.5mg/kg and d-amphetamine at 0.5mg/kg both produced a selective and significant reduction in performance of the reversal phase with no effect on the initial phase of the task in female-hooded Lister rats. Valproate (25-200mg/kg and phenytoin (25-50mg/kg had no effect on performance when administered alone. Valproate (100-200mg/kg, whose principle action is thought to be the enhancement of GABA transmission, was unable to prevent the cognitive deficit induced by either PCP or d-amphetamine. Conversely, phenytoin (50mg/kg, a use-dependent sodium channel inhibitor, significantly prevented the deficit induced by PCP, but not d-amphetamine. These results add to our earlier work with lamotrigine, and suggest that sodium channel blockade may be a mechanism by which some anticonvulsant drugs can prevent the PCP-induced deficit. These data have implications for the use of anticonvulsant drugs in the treatment of cognitive or psychotic disorders.
PPARγ ligand ciglitazone inhibits TNFα-induced ICAM-1 in human airway smooth muscle cells
Directory of Open Access Journals (Sweden)
Chien-Da Huang
2014-08-01
Full Text Available Background: Modification of human airway smooth muscle (ASM function by proinflammatory cytokines has been regarded as a potential mechanism underlying bronchial hyperresponsiveness in asthma. Human ASM cells express intercellular adhesion molecule (ICAM-1 in response to cytokines. Synthetic ligands for peroxisome proliferator-activated receptor (PPARγ reportedly possess anti-inflammatory and immunomodulatory properties. In this study, we examined whether ciglitazone, a synthetic PPARγ ligand, can modulate the basal and tumor necrosis factor (TNFα-induced ICAM1 gene expression in human ASM cells. Methods: Human ASM cells were treated with TNFα. ICAM-1 expression was assessed by flow cytometry and reverse transcriptase-polymerase chain reaction (RT-PCR analysis. PPARγ activity was inhibited by target-specific small interfering (si RNA targeting PPARγ and GW9662, a PPARγ antagonist. Activity of nuclear factor (NF-κB was assessed by using immunoblot analysis, immune-confocal images, and electrophoretic mobility shift assay (EMSA. Results: By flow cytometry, ciglitazone alone had no effect on ICAM-1 expression in ASM cells, but inhibited ICAM-1 expression in response to TNFα (10 ng/ml in a dose-dependent manner (1-10 μM. It also inhibited TNFα-induced ICAM1 gene expression by RT-PCR analysis. Knockdown of PPARγ gene by target-specific siRNA targeting PPARγ enhanced ICAM-1 expression and the inhibitory effect of ciglitazone on TNFα-induced ICAM-1 expression was reversed by PPARγ siRNA and GW9662. SN-50 (10 μg/ml, an inhibitor for nuclear translocation of NF-κB, inhibited TNFα-induced ICAM-1 expression. Ciglitazone did not prevent TNFα-induced degradation of the cytosolic inhibitor of NF-κB (IκB, but inhibited the nuclear translocation of p65 induced by TNFα and suppressed the NF-κB/DNA binding activity. Conclusion: These findings suggest that ciglitazone inhibits TNFα-induced ICAM1 gene expression in human ASM cells through
Directory of Open Access Journals (Sweden)
Chong Kong T
2006-09-01
Full Text Available Abstract Background Epithelial defensins including human β-defensins (hBDs and α-defensins (HDs are antimicrobial peptides that play important roles in the mucosal defense system. However, the role of defensins in papillomavirus induced epithelial lesions is unknown. Results Papilloma tissues were prospectively collected from 15 patients with recurrent respiratory papillomatosis (RRP and analyzed for defensins and chemokine IL-8 expression by quantitative, reverse-transcriptase polymerase chain reaction (RT-PCR assays. HBD-1, -2 and -3 mRNAs were detectable in papilloma samples from all RRP patients and the levels were higher than in normal oral mucosal tissues from healthy individuals. Immunohistochemical analysis showed that both hBD-1 and 2 were localized in the upper epithelial layers of papilloma tissues. Expression of hBD-2 and hBD-3 appeared to be correlated as indicated by scatter plot analysis (r = 0.837, p Conclusion Human β-defensins are upregulated in respiratory papillomas. This novel finding suggests that hBDs might contribute to innate and adaptive immune responses targeted against papillomavirus-induced epithelial lesions.
International Nuclear Information System (INIS)
Lawrence, C.W.; Crhistensen, R.B.
1979-01-01
The role of rev3 gene function in uv-induced mutagenesis in the yeast Saccharomyces cerevisiae has been examined by determining the reversion of 12 well-defined cyc1 mutations in diploid strains homozygous for the rev3-1 or rev3-3 allale. The 12 cyc1 alleles include one ochre, one amber, four initiation, two proline missense, and four frameshift mutations. We find that the rev3 mutations reduce the frequency of UV-induced reversion of all of the cyc1 alleles, though different classes of alleles respond to a different extent. These results imply that the rev3 gene function is required for the production of a wide variety of mutational events, though probably not all, and show that each of the three rev loci have different mutational phenotypes. Such diverse phenotypes are not predicted by the unitary model for bacterial mutagenes, suggesting that this is at best an incomplete description of eukaryotic mutagenesis
Detection of human telomerase reverse transcriptase messenger ...
African Journals Online (AJOL)
Introduction and Objectives: Bladder cancer is an important national health problem as it is the leading cancer in men in Egypt. Cystoscopy and biopsy, currently remains the gold standard procedure for diagnosis, yet, it is invasive and costly. Urinary cytopathology remains to be the only non-invasive alternative method for ...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Effect of Si on the reversibility of stress-induced martensite in Fe-Mn-Si shape memory alloys
Energy Technology Data Exchange (ETDEWEB)
Stanford, N. [Centre for Material and Fibre Innovation, Deakin University, Geelong, Victoria 3217 (Australia); Dunne, D.P., E-mail: druce_dunne@uow.edu.au [Faculty of Engineering, University of Wollongong, Wollongong, NSW 2522 (Australia)
2010-12-15
Fe-Mn-Si is a well-characterized ternary shape memory alloy. Research on this alloy has consistently shown that the addition of 5-6 wt.% Si is desirable to enhance the reversibility of stress-induced martensite vis-a-vis shape memory. This paper examines the effect of Si on the morphology and the crystallography of the martensite in the Fe-Mn-Si system. It is concluded that the addition of Si increases the c/a ratio of the martensite, reduces the transformation volume change and decreases the atomic spacing difference between the parallel close-packed directions in the austenite-martensite interface (habit) plane. It is proposed that, in addition to austenite strengthening, Si enhances reversibility by reducing the volume change and the interfacial atomic mismatch between the martensite and the austenite. Although shape memory is improved, transformation reversibility remains limited by the necessary misfit dislocations that accommodate the atomic spacing differences in the interface.
Effect of Si on the reversibility of stress-induced martensite in Fe-Mn-Si shape memory alloys
International Nuclear Information System (INIS)
Stanford, N.; Dunne, D.P.
2010-01-01
Fe-Mn-Si is a well-characterized ternary shape memory alloy. Research on this alloy has consistently shown that the addition of 5-6 wt.% Si is desirable to enhance the reversibility of stress-induced martensite vis-a-vis shape memory. This paper examines the effect of Si on the morphology and the crystallography of the martensite in the Fe-Mn-Si system. It is concluded that the addition of Si increases the c/a ratio of the martensite, reduces the transformation volume change and decreases the atomic spacing difference between the parallel close-packed directions in the austenite-martensite interface (habit) plane. It is proposed that, in addition to austenite strengthening, Si enhances reversibility by reducing the volume change and the interfacial atomic mismatch between the martensite and the austenite. Although shape memory is improved, transformation reversibility remains limited by the necessary misfit dislocations that accommodate the atomic spacing differences in the interface.
Directory of Open Access Journals (Sweden)
Ana Cecília P. Oliveira
2016-01-01
Full Text Available ABSTRACT Objective To determine if the original protocol of Constraint-Induced Movement Therapy (CIMT, is adequate to reverse the nonuse of the affected upper limb (AUL in patients with Cerebral Palsy (CP in adulthood. Method The study included 10 patients diagnosed with CP hemiparesis had attended the adult protocol CIMT, from January/August 2009/2014. Results Average age 24.6 (SD 9.44; MAL average pretreatment How Often (HO = 0.72 and How Well (HW = 0.68 and post-treatment HO = 3.77 and HW = 3.60 (p ≤ 0.001 and pretreatment WMFT average = 21.03 and post-treatment average = 18.91 (p = 0.350. Conclusion The constraint-induced movement therapy is effective to reverse the nonuse learn of the AUL in adult patients with CP.
Cowin, Prue A; Gold, Elspeth; Aleksova, Jasna; O'Bryan, Moira K; Foster, Paul M D; Scott, Hamish S; Risbridger, Gail P
2010-02-01
Vinclozolin is an endocrine-disrupting chemical (EDC) that binds with high affinity to the androgen receptor (AR) and blocks the action of gonadal hormones on male reproductive organs. An alternative mechanism of action of Vinclozolin involves transgenerational effects on the male reproductive tract. We previously reported in utero Vinclozolin exposure-induced prostatitis (prostate inflammation) in postpubertal rats concurrent with down-regulation of AR and increased nuclear factor-kappaB activation. We postulated the male reproductive abnormalities induced by in utero Vinclozolin exposure could be reversed by testosterone supplementation, in contrast to the permanent modifications involving DNA methyltransferases (Dnmts) described by others. To test this hypothesis, we administered high-dose testosterone at puberty to Vinclozolin-treated rats and determined the effect on anogenital distance (AGD); testicular germ cell apoptosis, concentration of elongated spermatids, and the onset of prostatitis. Concurrently we examined Dnmt1, -3A, -3B, and -3L mRNA expression. Consistent with previous reports, in utero exposure to Vinclozolin significantly reduced AGD, increased testicular germ cell apoptosis 3-fold, reduced elongated spermatid number by 40%, and induced postpubertal prostatitis in 100% of exposed males. Administration of high-dose testosterone (25 mg/kg) at puberty normalized AGD, reduced germ cell apoptosis, and restored elongated spermatid number. Testosterone restored AR and nuclear factor-kappaB expression in the prostate and abolished Vinclozolin-induced prostatitis. Altered Dnmt expression was evident with in utero Vinclozolin exposure and was not normalized after testosterone treatment. These data demonstrate in utero Vinclozolin-induced male reproductive tract abnormalities are AR mediated and reversible and involve a mechanism independent of Dnmt expression.
International Nuclear Information System (INIS)
Chan, Nelson L.S.; Wang Huan; Wang Yun; Leung, H.Y.; Leung, Lai K.
2006-01-01
Perillyl alcohol (POH) is a dietary monoterpene with potential applications in chemoprevention and chemotherapy. Although clinical trials are under way, POH's physiological and pharmacological properties are still unclear. In the present study, the effect of POH on polycyclic aromatic hydrocarbon (PAH)-induced genotoxicity, and the related expression were examined in MCF-7 cells. Exposure to environmental toxicant increases the risk of cancer. Many of these compounds are pro-carcinogens and are biotransformed into their ultimate genotoxic structures by xenobiotic metabolizing enzymes. CYP1A1 and 1B1 are enzymes that catalyze the biotransformation of dimethylbenz[a]anthracene (DMBA). Our data revealed that 0.5 μM of POH was effective in blocking DMBA-DNA binding. Ethoxyresorufin-O-deethylase (EROD) assay indicated that the administration of POH inhibited the DMBA-induced enzyme activity in MCF-7 cells. Enzyme kinetic analysis revealed that POH inhibited CYP1B1 but not CYP1A1 activity. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay also demonstrated that the monoterpene reduced CYP1B1 mRNA abundance induced by DMBA. The present study illustrated that POH might inhibit and downregulate CYP1B1, which could protect against PAH-induced carcinogenesis
Parkinson’s disease managing reversible neurodegeneration
Directory of Open Access Journals (Sweden)
Hinz M
2016-04-01
Full Text Available Marty Hinz,1 Alvin Stein,2 Ted Cole,3 Beth McDougall,4 Mark Westaway5 1Clinical Research, NeuroResearch Clinics, Inc., Cape Coral, FL, 2Stein Orthopedic Associates, Plantation, FL, 3Cole Center for Healing, Cincinnati, OH, 4CLEARCenter of Health, Mill Valley, CA, USA; 5Four Pillars Health, Brendale, QLD, Australia Abstract: Traditionally, the Parkinson’s disease (PD symptom course has been classified as an irreversible progressive neurodegenerative disease. This paper documents 29 PD and treatment-induced systemic depletion etiologies which cause and/or exacerbate the seven novel primary relative nutritional deficiencies associated with PD. These reversible relative nutritional deficiencies (RNDs may facilitate and accelerate irreversible progressive neurodegeneration, while other reversible RNDs may induce previously undocumented reversible pseudo-neurodegeneration that is hiding in plain sight since the symptoms are identical to the symptoms being experienced by the PD patient. Documented herein is a novel nutritional approach for reversible processes management which may slow or halt irreversible progressive neurodegenerative disease and correct reversible RNDs whose symptoms are identical to the patient’s PD symptoms. Keywords: Parkinson’s disease, L-dopa, carbidopa, B6, neurodegeneration
Energy Technology Data Exchange (ETDEWEB)
Misra, R.D.K., E-mail: dmisra@louisiana.edu [Center for Structural and Functional Materials, University of Louisiana at Lafayette, Madison Hall Room 217, P.O. Box 44130, Lafayette, LA 70504-1430 (United States); Zhang, Z.; Venkatasurya, P.K.C. [Center for Structural and Functional Materials, University of Louisiana at Lafayette, Madison Hall Room 217, P.O. Box 44130, Lafayette, LA 70504-1430 (United States); Somani, M.C.; Karjalainen, L.P. [Department of Mechanical Engineering, University of Oulu, P.O. Box 4200, Oulu 90014 (Finland)
2010-11-15
Research highlights: {yields} Development of a novel process involving phase-reversion annealing process. {yields} Austensite stability strongly influences development of nanograined structure. {yields} Interstitial elements influence microstructural evolution during annealing. - Abstract: We describe here an electron microscopy study of microstructural evolution associated with martensitic shear phase reversion-induced nanograined/ultrafine-grained (NG/UFG) structure in an experimental Fe-16Cr-10Ni alloy with very low interstitial content. The primary objective is to understand and obtain fundamental insights on the influence of degree of austenite stability (Fe-16Cr-10Ni, 301LN, and 301 have different austenite stability index) and interstitial elements (carbon and nitrogen) in terms of phase reversion process, microstructural evolution during reversion annealing, and temperature-time annealing sequence. A relative comparison of Fe-16Cr-10Ni alloy with 301LN and 301 austenitic stainless steels indicated that phase reversion in Fe-16Cr-10Ni occurred by shear mechanism, which is similar to that observed for 301, but is different from the diffusional mechanism in 301LN steel. While the phase reversion in the experimental Fe-16Cr-10Ni alloy and 301 austenitic stainless steel occurred by shear mechanism, there were fundamental differences between these two alloys. The reversed strain-free austenite grains in Fe-16Cr-10Ni alloy were characterized by nearly same crystallographic orientation, where as in 301 steel there was evidence of break-up of martensite laths during reversion annealing resulting in several regions of misoriented austenite grains in 301 steel. Furthermore, a higher phase reversion annealing temperature range (800-900 deg. C) was required to obtain a fully NG/UFG structure of grain size 200-600 nm. The difference in the phase reversion and the temperature-time sequence in the three stages is explained in terms of Gibbs free energy change that
Role of hTERT in apoptosis of cervical cancer induced by histone deacetylase inhibitor
International Nuclear Information System (INIS)
Wu, Peng; Meng, Li; Wang, Hui; Zhou, Jianfeng; Xu, Gang; Wang, Shixuan; Xi, Ling; Chen, Gang; Wang, Beibei; Zhu, Tao; Lu, Yunping; Ma, Ding
2005-01-01
Human telomerase reverse transcriptase (hTERT) is the catalytic subunit of telomerase holoenzyme as well as the rate-limiting component of the telomerase enzyme complex. However, the role of the hTERT in apoptosis induced by histone deacetylase inhibitor has only been marginally addressed. For the first time, our study demonstrated that trichostatin A (TSA) briefly activated the proliferation of cervical cancer cell lines, HeLa and SiHa, within 12 h, but then inhibited cell growth after that time point. In response to TSA, hTERT expression, telomerase activity, and telomere length also underwent similar changes during the same time frame. Furthermore, the data in our study showed that cells transfected with dominant negative hTERT were more likely to undergo apoptosis induced by TSA than cells transfected with wild-type hTERT. The cyclin/cdk inhibitor p21 waf1 was down-regulated by hTERT without changing the expression of p53. Results from this study suggest that the hTERT might be a primary target of TSA and the anti-apoptosis effect of hTERT might be carried out through a p21 waf1 -dependent and p53-independent pathway
Desipramine rescues age-related phenotypes in depression-like rats induced by chronic mild stress.
Xie, Xiaoxian; Chen, Yangyang; Wang, Qi; Shen, Qichen; Ma, Lingyan; Huang, Liangfeng; Wu, Tao; Fu, Zhengwei
2017-11-01
Our previous finding demonstrates that major depressive disorder can mediate accelerated aging in rats. Desipramine is a typical tricyclic antidepressant, and can provide neuroprotection and counteract depression-like behaviors. However, whether desipramine can rescue age-related phenotypes in depressed individuals is not understood. In the present study, we investigated the physiological function of desipramine on rescuing the age-related phenotypes in these animals. The rats were induced by chronic mild stress paradigm, and the depression-like behaviors of rats were detected by sucrose intake test, open field test (OFT) and forced swimming test (FST). Then the depressed rats were treated by desipramine. Desipramine administration was effective in counteracting depression-like behaviors by increasing the sucrose solution intake, reducing the immobility time in the FST, and increasing total distance travelled and numbers of grid line crossed in the OFT. Moreover, desipramine treatment was able to reduce the oxidative damage to rat liver, and to increase the expression of telomerase reverse transcriptase (TERT), leading to correspondingly restored telomerase activity. Our findings identify that one function of desipramine may partly be to rescue age-related phenotypes in depressed individuals induced by chronic stress. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Shirdel, M., E-mail: mshirdel1989@ut.ac.ir [School of Metallurgy and Materials Engineering, College of Engineering, University of Tehran, P.O. Box 11155-4563, Tehran (Iran, Islamic Republic of); Mirzadeh, H., E-mail: hmirzadeh@ut.ac.ir [School of Metallurgy and Materials Engineering, College of Engineering, University of Tehran, P.O. Box 11155-4563, Tehran (Iran, Islamic Republic of); Advanced Metalforming and Thermomechanical Processing Laboratory, School of Metallurgy and Materials Engineering, University of Tehran, Tehran (Iran, Islamic Republic of); Parsa, M.H., E-mail: mhparsa@ut.ac.ir [School of Metallurgy and Materials Engineering, College of Engineering, University of Tehran, P.O. Box 11155-4563, Tehran (Iran, Islamic Republic of); Center of Excellence for High Performance Materials, School of Metallurgy and Materials Engineering, University of Tehran, Tehran (Iran, Islamic Republic of); Advanced Metalforming and Thermomechanical Processing Laboratory, School of Metallurgy and Materials Engineering, University of Tehran, Tehran (Iran, Islamic Republic of)
2015-05-15
A comprehensive study was carried out on the strain-induced martensitic transformation, its reversion to austenite, the resultant grain refinement, and the enhancement of strength and strain-hardening ability through the transformation-induced plasticity (TRIP) effect in a commercial austenitic 304L stainless steel with emphasis on the mechanisms and the microstructural evolution. A straightforward magnetic measurement device, which is based on the measurement of the saturation magnetization, for evaluating the amount of strain-induced martensite after cold rolling and reversion annealing in metastable austenitic stainless steels was used, which its results were in good consistency with those of the X-ray diffraction (XRD) method. A new parameter called the effective reduction in thickness was introduced, which corresponds to the reasonable upper bound on the obtainable martensite fraction based on the saturation in the martensitic transformation. By means of thermodynamics calculations, the reversion mechanisms were estimated and subsequently validated by experimental results. The signs of thermal martensitic transformation at cooling stage after reversion at 850 °C were found, which was attributed to the rise in the martensite start temperature due to the carbide precipitation. After the reversion treatment, the average grain sizes were around 500 nm and the nanometric grains of the size of ~ 65 nm were also detected. The intense grain refinement led to the enhanced mechanical properties and observation of the change in the work-hardening capacity and TRIP effect behavior. A practical map as a guidance for grain refining and characterizing the stability against grain growth was proposed, which shows the limitation of the reversion mechanism for refinement of grain size. - Graphical abstract: Display Omitted - Highlights: • Nano/ultrafine grained austenitic stainless steel through martensite treatment • A parameter descriptive of a reasonable upper bound on
International Nuclear Information System (INIS)
Shirdel, M.; Mirzadeh, H.; Parsa, M.H.
2015-01-01
A comprehensive study was carried out on the strain-induced martensitic transformation, its reversion to austenite, the resultant grain refinement, and the enhancement of strength and strain-hardening ability through the transformation-induced plasticity (TRIP) effect in a commercial austenitic 304L stainless steel with emphasis on the mechanisms and the microstructural evolution. A straightforward magnetic measurement device, which is based on the measurement of the saturation magnetization, for evaluating the amount of strain-induced martensite after cold rolling and reversion annealing in metastable austenitic stainless steels was used, which its results were in good consistency with those of the X-ray diffraction (XRD) method. A new parameter called the effective reduction in thickness was introduced, which corresponds to the reasonable upper bound on the obtainable martensite fraction based on the saturation in the martensitic transformation. By means of thermodynamics calculations, the reversion mechanisms were estimated and subsequently validated by experimental results. The signs of thermal martensitic transformation at cooling stage after reversion at 850 °C were found, which was attributed to the rise in the martensite start temperature due to the carbide precipitation. After the reversion treatment, the average grain sizes were around 500 nm and the nanometric grains of the size of ~ 65 nm were also detected. The intense grain refinement led to the enhanced mechanical properties and observation of the change in the work-hardening capacity and TRIP effect behavior. A practical map as a guidance for grain refining and characterizing the stability against grain growth was proposed, which shows the limitation of the reversion mechanism for refinement of grain size. - Graphical abstract: Display Omitted - Highlights: • Nano/ultrafine grained austenitic stainless steel through martensite treatment • A parameter descriptive of a reasonable upper bound on
Reversible Heat-Induced Inactivation of Chimeric β-Glucuronidase in Transgenic Plants1
Almoguera, Concepción; Rojas, Anabel; Jordano, Juan
2002-01-01
We compared the expression patterns in transgenic tobacco (Nicotiana tabacum) of two chimeric genes: a translational fusion to β-glucuronidase (GUS) and a transcriptional fusion, both with the same promoter and 5′-flanking sequences of Ha hsp17.7 G4, a small heat shock protein (sHSP) gene from sunflower (Helianthus annuus). We found that immediately after heat shock, the induced expression from the two fusions in seedlings was similar, considering chimeric mRNA or GUS protein accumulation. Surprisingly, we discovered that the chimeric GUS protein encoded by the translational fusion was mostly inactive in such conditions. We also found that this inactivation was fully reversible. Thus, after returning to control temperature, the GUS activity was fully recovered without substantial changes in GUS protein accumulation. In contrast, we did not find differences in the in vitro heat inactivation of the respective GUS proteins. Insolubilization of the chimeric GUS protein correlated with its inactivation, as indicated by immunoprecipitation analyses. The inclusion in another chimeric gene of the 21 amino-terminal amino acids from a different sHSP lead to a comparable reversible inactivation. That effect not only illustrates unexpected post-translational problems, but may also point to sequences involved in interactions specific to sHSPs and in vivo heat stress conditions. PMID:12011363
International Nuclear Information System (INIS)
Krueger, P.; Stucky, T.; Boewe, M.; Neuhaeuser, H.
1993-01-01
Quasi-static stress relaxation and dynamic internal friction measurements of stress induced reversible structural relaxation were performed on the amorphous alloy Fe 40 Ni 40 B 20 . The kinetics can be well described by a stretched exponential Kohlrausch-Williams-Watts quasi-static relaxation. The thermally activated part of the internal friction shows an Arrhenius temperature behaviour for a fixed vibration frequency and an inverse power frequency behaviour for a fixed temperature. The activation energies calculated from the Arrhenius equation and from the frequency shift method are significantly different. In order to explain this discrepancy the relation between the quasi-static and the dynamic descriptions of the reversible relaxation is reexamined. In particular it is shown that these two activation energies are connected by the Kohlrausch exponent of the quasi-static relaxation. (orig.)
Human cytomegalovirus (HCMV) induces human endogenous retrovirus (HERV) transcription.
Assinger, Alice; Yaiw, Koon-Chu; Göttesdorfer, Ingmar; Leib-Mösch, Christine; Söderberg-Nauclér, Cecilia
2013-11-12
Emerging evidence suggests that human cytomegalovirus (HCMV) is highly prevalent in tumours of different origin. This virus is implied to have oncogenic and oncomodulatory functions, through its ability to control host gene expression. Human endogenous retroviruses (HERV) are also frequently active in tumours of different origin, and are supposed to contribute as cofactors to cancer development. Due to the high prevalence of HCMV in several different tumours, and its ability to control host cell gene expression, we sought to define whether HCMV may affect HERV transcription. Infection of 3 established cancer cell lines, 2 primary glioblastoma cells, endothelial cells from 3 donors and monocytes from 4 donors with HCMV (strains VR 1814 or TB40/F) induced reverse transcriptase (RT) activity in all cells tested, but the response varied between donors. Both, gammaretrovirus-related class I elements HERV-T, HERV-W, HERV-F and ERV-9, and betaretrovirus-related class II elements HML-2 - 4 and HML-7 - 8, as well as spuma-virus related class III elements of the HERV-L group were up-regulated in response to HCMV infection in GliNS1 cells. Up-regulation of HERV activity was more pronounced in cells harbouring active HCMV infection, but was also induced by UV-inactivated virus. The effect was only slightly affected by ganciclovir treatment and was not controlled by the IE72 or IE86 HCMV genes. Within this brief report we show that HCMV infection induces HERV transcriptional activity in different cell types.
Song, Yue; Shen, Keng; Yu, Jing-rong
2007-11-06
To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase
Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa
2012-11-01
Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.
Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William
2007-01-01
Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK...
International Nuclear Information System (INIS)
Poliandri, Ariel H.B.; Cabilla, Jimena P.; Velardez, Miguel O.; Bodo, Cristian C.A.; Duvilanski, Beatriz H.
2003-01-01
Cadmium (Cd 2+ ) is an ubiquitous toxic metal that is involved in a variety of pathological conditions. Several reports indicate that Cd 2+ alters normal pituitary hormone secretion; however, little is known about the mechanisms that induce this misregulation. This paper reports the effect of Cd 2+ on anterior pituitary cell viability and its relation to prolactin secretion. Cd 2+ concentrations above 10 μM were found to be cytotoxic for pituitary cells. Morphological studies as well as DNA ladder fragmentation and caspase activation showed that Cd 2+ -treated cells undergo apoptosis. Even though several hours were needed to detect Cd 2+ -induced cytotoxicity, the effect of the metal became irreversible very quickly, requiring only 3 h of treatment. Prolactin release (measured at 48 h) was inhibited when the cells were exposed to Cd 2+ for 1 h, before any change in cell viability was observed. The antioxidants N-acetyl-cysteine and Trolox (a hydrosoluble derivative of vitamin E), but not ascorbic acid, reversed both Cd 2+ -mediated cytotoxicity and the inhibition of prolactin release, supporting the involvement of oxidative stress in the mechanism of Cd 2+ action. In summary, the present work demonstrates that Cd 2+ is cytotoxic for anterior pituitary cells, that this effect is due to an induction of apoptosis, and that it can be reversed by antioxidants
International Nuclear Information System (INIS)
Cox, Mitchell W.; Soltes, George D.; Lin, Peter H.; Bush, Ruth L.; Lumsden, Alan B.
2003-01-01
Hepatic encephalopathy is a known complication following percutaneous transjugular intrahepatic portosystemic shunt (TIPS) placement. We describe herein a simple and effective strategy of TIPS revision by creating an intraluminal stricture within a self-expanding covered stent, which is deployed in the portosystemic shunt to reduce the TIPS blood flow. This technique was successful in reversing a TIPS-induced hepatic encephalopathy in our patient
Electric-Field-Induced Magnetization Reversal in a Ferromagnet-Multiferroic Heterostructure
Heron, J. T.; Trassin, M.; Ashraf, K.; Gajek, M.; He, Q.; Yang, S. Y.; Nikonov, D. E.; Chu, Y.-H.; Salahuddin, S.; Ramesh, R.
2011-11-01
A reversal of magnetization requiring only the application of an electric field can lead to low-power spintronic devices by eliminating conventional magnetic switching methods. Here we show a nonvolatile, room temperature magnetization reversal determined by an electric field in a ferromagnet-multiferroic system. The effect is reversible and mediated by an interfacial magnetic coupling dictated by the multiferroic. Such electric-field control of a magnetoelectric device demonstrates an avenue for next-generation, low-energy consumption spintronics.
From reverse transcription to human brain tumors
Directory of Open Access Journals (Sweden)
Dmitrenko V. V.
2013-05-01
Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line
Kammouni, W; Figarella, C; Baeza, N; Marchand, S; Merten, M D
1997-12-18
Human tracheal gland (HTG) serous cells are now believed to play a major role in the physiopathology of cystic fibrosis. Because of the persistent inflammation and the specific infection by Pseudomonas aeruginosa in the lung, we looked for the action of the lipopolysaccharide (LPS) of this bacteria on human tracheal gland cells in culture by studying the secretion of the secretory leukocyte proteinase inhibitor (SLPI) which is a specific serous secretory marker of these cells. Treatment with Pseudomonas aeruginosa LPS resulted in a significant dose-dependent increase in the basal production of SLPI (+ 250 +/- 25%) whilst the SLPI transcript mRNA levels remained unchanged. This LPS-induced increase in secretion was inhibited by glucocorticoides. Furthermore, LPS treatment of HTG cells induces a loss of responsiveness to carbachol and isoproterenol but not to adenosine triphosphate. These findings indicate that HTG cells treated by Pseudomonas aeruginosa LPS have the same behavior as those previously observed with CF-HTG cells. Exploration by using reverse transcriptase polymerase chain reaction amplification showed that LPS downregulated cystic fibrosis transmembrane conductance regulator (CFTR) mRNA expression in HTG cells indicative of a link between CFTR function and consequent CF-like alteration in protein secretory process.
Asztalos, László; Szabó-Maák, Zoltán; Gajdos, András; Nemes, Réka; Pongrácz, Adrienn; Lengyel, Szabolcs; Fülesdi, Béla; Tassonyi, Edömér
2017-09-01
Rocuronium-induced neuromuscular block that spontaneously recovered to a train-of-four count of four can be reversed with sugammadex 0.5 or 1.0 mg/kg. We investigated whether these doses of sugammadex can also reverse vecuronium at a similar level of block. Sixty-five patients were randomly assigned, and 64 were analyzed in this controlled, superiority study. Participants received general anesthesia with propofol, sevoflurane, fentanyl, and vecuronium. Measurement of neuromuscular function was performed with acceleromyography (TOF-Watch-SX, Organon Teknika B.V., The Netherlands ). Once the block recovered spontaneously to four twitches in response to train-of-four stimulation, patients were randomly assigned to receive sugammadex 0.5, 1.0, or 2.0 mg/kg; neostigmine 0.05 mg/kg; or placebo. Time from study drug injection to normalized train-of-four ratio 0.9 and the incidence of incomplete reversal within 30 min were the primary outcome variables. Secondary outcome was the incidence of reparalysis (normalized train-of-four ratio less than 0.9). Sugammadex, in doses of 1.0 and 2.0 mg/kg, reversed a threshold train-of-four count of four to normalized train-of-four ratio of 0.9 or higher in all patients in 4.4 ± 2.3 min (mean ± SD) and 2.6 ± 1.6 min, respectively. Sugammadex 0.5 mg/kg reversed the block in 6.8 ± 4.1 min in 70% of patients (P 0.05 vs. sugammadex 0.5 mg/kg). The overall frequency of reparalysis was 18.7%, but this incidence varied from group to group. Sugammadex 1.0 mg/kg, unlike 0.5 mg/kg, properly reversed a threshold train-of-four count of four vecuronium-induced block but did not prevent reparalysis.
UV-induced reversion of his4 frameshift mutations in rad6, rev1, and rev3 mutants of yeast.
Lawrence, C W; O'Brien, T; Bond, J
1984-01-01
The UV-induced reversion of two his4 frameshift alleles was much reduced in rad6 mutants of Saccharomyces cerevisiae, an observation that is consistent with the hypothesis that RAD6 function is required for the induction of all types of genetic alteration in misrepair mutagenesis. The reversion of these his4 alleles, together with two others of the same type, was also reduced in rev1 and rev3 mutant strains; in these, however, the extent of the reduction varied considerably with test allele used, in a manner analogous to the results in these strains for base repair substitution test alleles. The general features of UV-induced frameshift and substitution mutagenesis therefore appear quite similar, indicating that they may depend on related processes. If this conclusion is correct, greater attention must be given to integrating models which account for the production of nucleotide additions and deletions into those concerning misrepair mutagenesis.
Apigenin reduce lipoteichoic acid-induced inflammatory response in rat cardiomyoblast cells.
Gutiérrez-Venegas, Gloria; González-Rosas, Zeltzin
2017-02-01
Infective endocarditis is caused by Streptococcus sanguinis present in dental plaque, which can induce inflammatory responses in the endocardium. The present study depicts research on the properties of apigenin in embryonic mouse heart cells (H9c2) treated with lipoteichoic acid (LTA) obtained from S. sanguinis. Interleukin-1β and cyclooxygenase (COX)-2 expression were detected by reverse transcriptase polymerase chain reaction. In addition, western blot assays and immuno-fluorescence staining were used to assess translocation of nuclear factor kappa beta (NF-κB), degradation of IκB, as well as activity of the mitogen activated protein kinases: extracellular signal-regulated kinase (ERK)1/2, p38, and c-Jun N-terminal kinase (JNK). Effect of apigenin on cell viability was equally assessed in other experimental series. Our results showed that apigenin blocked activation of ERK, JNK, and p38 in cardiomyocytes treated with LTA in a dose-dependent fashion. Moreover, apigenin showed no cytotoxic effects; it blocked NF-κB translocation and IκB degradation. Our findings suggested that apigenin possessed potential value in the treatment of infectious endocarditis.
Stanton, Thaddeus B.; Humphrey, Samuel B.; Sharma, Vijay K.; Zuerner, Richard L.
2008-01-01
Brachyspira hyodysenteriae is an anaerobic spirochete and the etiologic agent of swine dysentery. The genome of this spirochete contains a mitomycin C-inducible, prophage-like gene transfer agent designated VSH-1. VSH-1 particles package random 7.5-kb fragments of the B. hyodysenteriae genome and transfer genes between B. hyodysenteriae cells. The chemicals and conditions inducing VSH-1 production are largely unknown. Antibiotics used in swine management and stressors inducing traditional prophages might induce VSH-1 and thereby stimulate lateral gene transfer between B. hyodysenteriae cells. In these studies, VSH-1 induction was initially detected by a quantitative real-time reverse transcriptase PCR assay evaluating increased transcription of hvp38 (VSH-1 head protein gene). VSH-1 induction was confirmed by detecting VSH-1-associated 7.5-kb DNA and VSH-1 particles in B. hyodysenteriae cultures. Nine antibiotics (chlortetracycline, lincomycin, tylosin, tiamulin, virginiamycin, ampicillin, ceftriaxone, vancomycin, and florfenicol) at concentrations affecting B. hyodysenteriae growth did not induce VSH-1 production. By contrast, VSH-1 was detected in B. hyodysenteriae cultures treated with mitomycin C (10 μg/ml), carbadox (0.5 μg/ml), metronidazole (0.5 μg/ml), and H2O2 (300 μM). Carbadox- and metronidazole-induced VSH-1 particles transmitted tylosin and chloramphenicol resistance determinants between B. hyodysenteriae strains. The results of these studies suggest that certain antibiotics may induce the production of prophage or prophage-like elements by intestinal bacteria and thereby impact intestinal microbial ecology. PMID:18359835
Be'er, Avraham; Florin, E-L; Fisher, Carolyn R; Swinney, Harry L; Payne, Shelley M
2011-01-01
Natural habitats vary in available nutrients and room for bacteria to grow, but successful colonization can lead to overcrowding and stress. Here we show that competing sibling colonies of Paenibacillus dendritiformis bacteria survive overcrowding by switching between two distinct vegetative phenotypes, motile rods and immotile cocci. Growing colonies of the rod-shaped bacteria produce a toxic protein, Slf, which kills cells of encroaching sibling colonies. However, sublethal concentrations of Slf induce some of the rods to switch to Slf-resistant cocci, which have distinct metabolic and resistance profiles, including resistance to cell wall antibiotics. Unlike dormant spores of P. dendritiformis, the cocci replicate. If cocci encounter conditions that favor rods, they secrete a signaling molecule that induces a switch to rods. Thus, in contrast to persister cells, P. dendritiformis bacteria adapt to changing environmental conditions by inducible and reversible phenotypic switching. In favorable environments, species may face space and nutrient limits due to overcrowding. Bacteria provide an excellent model for analyzing principles underlying overcrowding and regulation of density in nature, since their population dynamics can be easily and accurately assessed under controlled conditions. We describe a newly discovered mechanism for survival of a bacterial population during overcrowding. When competing with sibling colonies, Paenibacillus dendritiformis produces a lethal protein (Slf) that kills cells at the interface of encroaching colonies. Slf also induces a small proportion of the cells to switch from motile, rod-shaped cells to nonmotile, Slf-resistant, vegetative cocci. When crowding is reduced and nutrients are no longer limiting, the bacteria produce a signal that induces cocci to switch back to motile rods, allowing the population to spread. Genes encoding components of this phenotypic switching pathway are widespread among bacterial species, suggesting
Directory of Open Access Journals (Sweden)
Chen Hao-tai
2011-10-01
Full Text Available Abstract A reverse transcriptase loop-mediated isothermal amplification (RT-LAMP assay was rapidly used to detect serotype Asia 1 of foot-and-mouth disease virus (FMDV within 45 min at 61°C. All FMDV serotype Asia 1 reference strains were positive by RT-LAMP, while other viruses such as FMDV serotypes O, C, A and classical swine fever virus, swine vesicular disease virus, porcine reproductive and respiratory syndrome virus and Japanese encephalitis virus remained negative. Furthermore, FMDV sreotype Asia 1 positive samples were able to detect by RT-LAMP assay. This RT-LAMP assay may be suitable particularly for diagnosis of FMDV serotype Asia 1 infection in field stations.
2014-01-01
Background The reversal efficacy of 2% lipid emulsion in cardiac asystole induced by different concentrations of bupivacaine is poorly defined and needs to be determined. Methods Forty-two male Sprague–Dawley rats were randomly divided into seven groups: B40, B60, B80, B100, B120, B140 and B160, n = 6. The Langendorff isolated heart perfusion model was used, which consisted of a balanced perfusion with Krebs-Henseleit solution for 25 minutes and a continuous infusion of 100 μmol/L bupivacaine until asystole had been induced for 3 minutes. The hearts in the seven groups were perfused with Krebs-Henseleit solution containing a 2% lipid emulsion, and 40, 60, 80, 100, 120, 140 or 160 μmol/L bupivacaine, respectively. Cardiac recovery was defined as a spontaneous and regular rhythm with a rate-pressure product > 10% of the baseline value for more than 1 minute. Our primary outcome was the rate-pressure product 25 minutes after cardiac recovery. Other cardiac function parameters were also recorded. Results All groups demonstrated cardiac recovery. During the recovery phase, heart rate, rate-pressure product, the maximum left ventricular pressure rise and decline in heart rate in the B120-B160 groups was significantly lower than those in the B40-B80 groups (P bupivacaine and the reversal effects of a 2% lipid emulsion showed a typical transoid S-shaped curve, R2 = 0.9983, IC50 value was 102.5 μmol/L (95% CI: 92.44 - 113.6). Conclusions There is a concentration-response relationship between the concentrations of bupivacaine and the reversal effects of 2% lipid emulsion. PMID:25089118
International Nuclear Information System (INIS)
Cassin, Guillaume
1994-01-01
This research thesis reports the study of the influence of intra-micellar attractions on the thermodynamic behaviour of reverse micellar systems, as well as of the effects induced by the solubilisation of natives or modified proteins. The author proposes a model to explain the decrease of attractions between droplets when the volume fraction occupied by reverse micelles increases. This model which highlights the importance of depletion forces between reverse micelles, allows the building up of a theoretical relationship between the bonding parameter and the volume fraction of reverse micelles. In order to understand the appearance of an attractive term related to the solubilisation of native cytochrome-c in these systems, this protein has been chemically modified. The author highlights the role of the charge born by a micellar probe on the thermodynamic behaviour of micro-emulsions. Then, the author applies the model of dimerizing adhesive spheres to reverse micellar systems containing native cytochrome-c. He shows that theoretical predictions of this model are in agreement with obtained experimental results [fr
Balakrishnan, Mini; Roques, Bernard P.; Fay, Philip J.; Bambara, Robert A.
2003-01-01
The biochemical mechanism of template switching by human immunodeficiency virus type 1 (HIV-1) reverse transcriptase and the role of template dimerization were examined. Homologous donor-acceptor template pairs derived from the HIV-1 untranslated leader region and containing the wild-type and mutant dimerization initiation sequences (DIS) were used to examine the efficiency and distribution of transfers. Inhibiting donor-acceptor interaction was sufficient to reduce transfers in DIS-containin...
Spin-orbit torque induced magnetic vortex polarity reversal utilizing spin-Hall effect
Li, Cheng; Cai, Li; Liu, Baojun; Yang, Xiaokuo; Cui, Huanqing; Wang, Sen; Wei, Bo
2018-05-01
We propose an effective magnetic vortex polarity reversal scheme that makes use of spin-orbit torque introduced by spin-Hall effect in heavy-metal/ferromagnet multilayers structure, which can result in subnanosecond polarity reversal without endangering the structural stability. Micromagnetic simulations are performed to investigate the spin-Hall effect driven dynamics evolution of magnetic vortex. The mechanism of magnetic vortex polarity reversal is uncovered by a quantitative analysis of exchange energy density, magnetostatic energy density, and their total energy density. The simulation results indicate that the magnetic vortex polarity is reversed through the nucleation-annihilation process of topological vortex-antivortex pair. This scheme is an attractive option for ultra-fast magnetic vortex polarity reversal, which can be used as the guidelines for the choice of polarity reversal scheme in vortex-based random access memory.
Directory of Open Access Journals (Sweden)
Maryam Mosadegh
2017-02-01
Full Text Available Objective(s: Present study was performed in order to uncover new aspects for nicotine-induced damages on spermatogenesis cell lineage. Materials and Methods: For this purpose, 36 mature male Wistar rats were divided into three groups as; control-sham (0.2 ml, saline normal, IP, low dose (0.2 mg/kg BW-1, IP nicotine-received and high dose (0.4 mg/kg BW-1, IP nicotine-received groups. Following 7 weeks, the expression of bcl-2, p53 and caspase-3 at mRNA and protein levels were investigated by using reverse-transcriptase PCR (RT-PCR and immunohistochemical (IHC analyses, respectively. Moreover, the serum level of FSH, LH and testosterone were evaluated. Finally, the mRNA damage was analyzed by using special fluorescent staining. Results: Nicotine, at both dose levels, decreased tubular differentiation, spermiogenesis and repopulation indices and enhanced cellular depletion. Animals in nicotine-received groups exhibited a significant (P
Hua, Hui; Wang, Jingmin; Jiang, Chengbao; Xu, Huibin
2018-05-01
Ni42-xCoxCu8Mn37Ga13 (0 ≤ x ≤ 14) alloys are reported to exhibit a magnetostructural transition from weakly-magnetic martensite to ferromagnetic austenite over a rather wide temperature window ranging from 200 K to 380 K. Simultaneously a large magnetization change Δσ of up to 105 Am2 kg-1 is obtained at the martensitic transformation. A reversible magnetic-field-induced martensitic transformation is realized, resulting in a large magnetocaloric effect related to the high magnetic entropy change with a broad working temperature span. This work shows how it is possible to effectively tailor the magnetostructural transition in Ni-Mn-Ga alloys so as to achieve a reversible magnetic-field-induced martensitic transformation and associated functionalities.
Kinetic Line Voronoi Operations and Their Reversibility
DEFF Research Database (Denmark)
Mioc, Darka; Anton, François; Gold, Christopher
2010-01-01
In Geographic Information Systems the reversibility of map update operations has not been explored yet. In this paper we are using the Voronoi based Quad-edge data structure to define reversible map update operations. The reversibility of the map operations has been formalised at the lowest level...... mechanisms and dynamic map visualisations. In order to use the reversibility within the kinetic Voronoi diagram of points and open oriented line segments, we need to assure that reversing the map commands will produce exactly the changes in the map equivalent to the previous map states. To prove...... that reversing the map update operations produces the exact reverse changes, we show an isomorphism between the set of complex operations on the kinetic Voronoi diagram of points and open oriented line segments and the sets of numbers of new / deleted Voronoi regions induced by these operations, and its...
Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.
Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad
2015-02-01
In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.
Steidl, Stephan; Lee, Esther; Wasserman, David; Yeomans, John S
2013-09-01
Lesions of the pedunculopontine tegmental nucleus (PPT), one of two sources of cholinergic input to the ventral tegmental area (VTA), block conditioned place preference (CPP) for morphine in drug-naïve rats. M5 muscarinic cholinergic receptors, expressed by midbrain dopamine neurons, are critical for the ability of morphine to increase nucleus accumbens dopamine levels and locomotion, and for morphine CPP. This suggests that M5-mediated PPT cholinergic inputs to VTA dopamine neurons critically contribute to morphine-induced dopamine activation, reward and locomotion. In the current study we tested whether food deprivation, which reduces PPT contribution to morphine CPP in rats, could also reduce M5 contributions to morphine-induced locomotion in mice. Acute 18-h food deprivation reversed the phenotypic differences usually seen between non-deprived wild-type and M5 knockout mice. That is, food deprivation increased morphine-induced locomotion in M5 knockout mice but reduced morphine-induced locomotion in wild-type mice. Food deprivation increased saline-induced locomotion equally in wild-type and M5 knockout mice. Based on these findings, we suggest that food deprivation reduces the contribution of M5-mediated PPT cholinergic inputs to the VTA in morphine-induced locomotion and increases the contribution of a PPT-independent pathway. The contributions of cholinergic, dopaminergic and GABAergic neurons to the effects of acute food deprivation are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Pedersen Niels C
2007-04-01
Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be
Directory of Open Access Journals (Sweden)
Ying Huang
2013-11-01
Ischemia-reperfusion injury and tissue hypoxia are of high clinical relevance because they are associated with various pathophysiological conditions such as myocardial infarction and stroke. Nevertheless, the underlying mechanisms causing cell damage are still not fully understood, which is at least partially due to the lack of cell culture systems for the induction of rapid and transient hypoxic conditions. The aim of the study was to establish a model that is suitable for the investigation of cellular and molecular effects associated with transient and long-term hypoxia and to gain insights into hypoxia-mediated mechanisms employing a neuronal culture system. A semipermeable membrane insert system in combination with the hypoxia-inducing enzymes glucose oxidase and catalase was employed to rapidly and reversibly generate hypoxic conditions in the culture medium. Hydrogen peroxide assays, glucose measurements and western blotting were performed to validate the system and to evaluate the effects of the generated hypoxia on neuronal IMR-32 cells. Using the insert-based two-enzyme model, hypoxic conditions were rapidly induced in the culture medium. Glucose concentrations gradually decreased, whereas levels of hydrogen peroxide were not altered. Moreover, a rapid and reversible (onoff generation of hypoxia could be performed by the addition and subsequent removal of the enzyme-containing inserts. Employing neuronal IMR-32 cells, we showed that 3 hours of hypoxia led to morphological signs of cellular damage and significantly increased levels of lactate dehydrogenase (a biochemical marker of cell damage. Hypoxic conditions also increased the amounts of cellular procaspase-3 and catalase as well as phosphorylation of the pro-survival kinase Akt, but not Erk1/2 or STAT5. In summary, we present a novel framework for investigating hypoxia-mediated mechanisms at the cellular level. We claim that the model, the first of its kind, enables researchers to rapidly and
Findeisen, Hannes M; Gizard, Florence; Zhao, Yue; Cohn, Dianne; Heywood, Elizabeth B; Jones, Karrie L; Lovett, David H; Howatt, Deborah A; Daugherty, Alan; Bruemmer, Dennis
2011-02-01
Abdominal aortic aneurysms (AAA) are an age-related vascular disease and an important cause of morbidity and mortality. In this study, we sought to determine whether the catalytic component of telomerase, telomerase reverse transcriptase (TERT), modulates angiotensin (Ang) II-induced AAA formation. Low-density lipoprotein receptor-deficient (LDLr-/-) mice were lethally irradiated and reconstituted with bone marrow-derived cells from TERT-deficient (TERT-/-) mice or littermate wild-type mice. Mice were placed on a diet enriched in cholesterol, and AAA formation was quantified after 4 weeks of Ang II infusion. Repopulation of LDLr-/- mice with TERT-/- bone marrow-derived cells attenuated Ang II-induced AAA formation. TERT-deficient recipient mice revealed modest telomere attrition in circulating leukocytes at the study end point without any overt effect of the donor genotype on white blood cell counts. In mice repopulated with TERT-/- bone marrow, aortic matrix metalloproteinase-2 (MMP-2) activity was reduced, and TERT-/- macrophages exhibited decreased expression and activity of MMP-2 in response to stimulation with Ang II. Finally, we demonstrated in transient transfection studies that TERT overexpression activates the MMP-2 promoter in macrophages. TERT deficiency in bone marrow-derived macrophages attenuates Ang II-induced AAA formation in LDLr-/- mice and decreases MMP-2 expression. These results point to a previously unrecognized role of TERT in the pathogenesis of AAA.
Thyrotropin-releasing hormone (TRH) reverses hyperglycemia in rat
International Nuclear Information System (INIS)
Luo Luguang; Luo, John Z.Q.; Jackson, Ivor M.D.
2008-01-01
Hyperglycemia in thyrotropin-releasing hormone (TRH) null mice indicates that TRH is involved in the regulation of glucose homeostasis. Further, TRH levels in the pancreas peak during the stages of late embryonic and early neonatal β cell development. These observations are consistent in linking TRH to islet cell proliferation and differentiation. In this study, we examined the effect of TRH administration in damaged pancreatic rat (streptozotocin, STZ) to determine whether TRH could improve damaged pancreatic β cells function. We hypothesize that TRH is able to reverse STZ-induced hyperglycemia by increasing pancreatic islet insulin content, preventing apoptosis, and potentially induce islet regeneration. It was found that following intra-peritoneal (ip) injection, TRH (10 μg/kg body weight (bwt)) reverses STZ (65 mg/kg bwt)-induced hyperglycemia (TRH given 3 days after STZ injection). Increased circulating insulin levels and insulin content in extracted pancreas suggests that TRH reversed STZ-induced hyperglycemia through improving pancreatic islet β cell function. Further studies show a significantly lower level of apoptosis in islets treated with TRH as well as the presence of proliferation marker nestin and Brdu, suggesting that the TRH has the potential to prevent apoptosis and stimulate islet proliferation
Yang, You-Lan; Chen, Chi-Li; Chen, Chi-Ming; Ko, Wun-Chang
2017-05-30
We recently reported that hesperetin-5,7,3'-O-triacetate (HTA) dually inhibited phosphodiesterase (PDE)3/4 with a therapeutic ratio of 20.8. The application and development of PDE4 inhibitors for treating asthma or COPD are limited by their side effects, such as nausea, vomiting and gastric hypersecretion. PDE4 inhibitors were reported to reverse xylazine/ketamine-induced anesthesia in rats and triggered vomiting in ferrets. Thus the reversing effect of HTA on xylazine/ketamine-induced anesthesia in mice was studied to assess emetic effect of HTA. The aim of this study was to prove the therapeutic effect of HTA without vomiting effect at an effective dose for treating COPD. Ten female BALB/c mice in each group were sensitized by ovalbumin (OVA) on days 0 and 14. On day 21, these mice were emphasized the sensitization by Freund's complete adjuvant. Mice were challenged by 1% OVA nebulization on days 28, 29, and 30. Airway hyperresponsiveness (AHR) was assessed on day 32 in each group, using the FlexiVent system to determine airway resistance (R L ) and lung dynamic compliance (C dyn ) in anesthetized ovalbumin (OVA)-sensitized and challenged mice. Each group was orally administered HTA (10 ~ 100 μmol/kg), roflumilast (1 and 5 mg/kg) or vehicles (controls) 2 h before and 6 and 24 h after OVA provocation. For comparison, sham-treated mice were challenged with saline instead of 1% OVA. The ability to reverse xylazine/ketamine-induced anesthesia by HTA or roflumilast for 3 h was determined in normal mice. We used roflumilast, a selective PDE4 inhibitor and bronchodilator for severe COPD approved by the US Food and Drug Administration, as a reference drug. In the results, HTA (100 μmol/kg, p.o.) or roflumilast (5 mg/kg, p.o.) significantly suppressed all R L values of MCh at 0.78 ~ 25 mg/mL and enhanced C dyn values of MCh at 3.125 ~ 25 mg/mL compared to OVA-sensitized and -challenged control mice. Orally administered 1, 3 or 10 mg/kg roflumilast
International Nuclear Information System (INIS)
Macnab, A. I. D.; Milroy, R. D.; Kim, C. C.; Sovinec, C. R.
2007-01-01
End-shorting of the open field lines that surround a field-reversed configuration (FRC) is believed to contribute to its observed rotation. In this study, nonlinear extended magnetohydrodynamics (MHD) simulations were performed that detail the end-shorting process and the resulting spin-up of the FRC. The tangential component of the electric field E T is set to zero at the axial boundaries in an extended MHD model that includes the Hall and ∇P e terms. This shorting of the electric field leads to the generation of toroidal fields on the open field lines, which apply a torque leading to a rotation of the ions on the open field lines. The FRC then gains angular momentum through a viscous transfer from the open field line region. In addition, it is shown that spin-up is still induced when insulating boundaries are assumed
The protective effect of Transhinone II A in radiation-induced pulmonary fibrosis
International Nuclear Information System (INIS)
Li Guanghu; Li Zhiping; Xu Yong; Xu Feng; Wang Jin
2006-01-01
Objective: To investigate the protective effect and it's possible mechanism of Tanshinone II A in radiation-induced pulmonary fibrosis. Methods: Having the right hemithorax of female Wistar rats irradiated 30 Gy in 10 fractions within 14 days by 6 MV photons, the radiation-induced pulmonary fibrosis animal model was established. In the treatment group, sodium Tanshinone II A sulfonate (15 mg/kg) was given by intraperitoneal injection 1 hour before each fraction of irradiation. Five months after irradiation, the difference of the histopathological changes, the hyckoxyproline content and expression of TGF-β1 between the radiation alone group, tanshinone plus radiation and control group were analyzed by HE stain, Massion stain, immunohistochemical methor and reverse transcriptase polymerase chain reaction(RT-PCR) method. Results: The histopathological comparison revealed the protective effect of Tanshinone II A. The content of hydroxyproline was (21.99±3.96), (38.25± 7.18), (28.94±4.29) μg/g in the control group, radiation alone group and radiation plus Tanshinone II A. The expression of TGF-β1 (mRNA and protein) was reduced by Tanshinone II A. Pathological changes of the pulmonary fibrosis was reduced by Tanshinone II A yet. Conclusions: Our study shows that Tanshinone II A can inhibit radiation-induced pulmonary fibrosis, and the possible mechanism of its may be made possible through down-regulating the expression of TGF-β1 in the irritated lung tissue. (authors)
Management of HIV During Pregnancy
Chamma JP; Monteleone VF; V dos Reis L; Bonafe SM; Panão M
2016-01-01
According to UNAIDS, in 2015, one hundred and fifty thousand children were infected by HIV worldwide, therefore the use of antiretroviral therapy (ARV) during pregnancy is an important development for the reduction of maternal-fetal transmission. The treatment of a pregnant woman is done by combining two different ARV classes. The combination of two nucleoside reverse transcriptase inhibitors (NRTIs) with one non-nucleoside reverse transcriptase inhibitor (NNRTI) or protease inhibitor (PI) is...
Won, Young Ju; Lim, Byung Gun; Lee, Dong Kyu; Kim, Heezoo; Kong, Myoung Hoon; Lee, Il Ok
2016-08-01
Previous studies have shown that sugammadex, a modified γ-cyclodextrin, is a well-tolerated agent for the reversal of neuromuscular blockade (NMB) induced by a steroidal neuromuscular blocking drug in adult patients. However, its use has not been reviewed in pediatric patients. The aim of this meta-analysis was to evaluate the efficacy and safety of sugammadex in the reversal of rocuronium-induced NMB during surgery under general anesthesia in pediatric patients. A literature search was performed using the Pubmed, EMBASE: Drugs and pharmacology, Cochrane Central Register of Controlled Trials, and Cochrane Database of Systematic Reviews. Analysis was conducted using RevMan 5.3. Data collected from different trials were pooled; the weighted mean difference or the pooled risk ratio and the corresponding 95% confidence interval (CI) were used for analysis, and heterogeneity (I) assessment was performed. Six randomized controlled trials comparing 253 pediatric patients (age range, 2-18 years) were included in the final analysis. The mean time taken to reach a train-of-four ratio of ≥0.9 was significantly shorter in the sugammadex groups (2 and 4 mg/kg) than in the control group (neostigmine or placebo), although the heterogeneity was high. The weighted mean differences of the 2 and 4 mg/kg sugammadex groups were -7.15 (95% CI: -10.77 to -3.54; I = 96%; P = 0.0001) and -17.32 (95% CI: -29.31 to -5.32; I = 98%; P = 0.005), respectively. The extubation time in the sugammadex group was shorter than that in the control group; the weighted mean difference of the sugammadex group was -6.00 (95% CI: -11.46 to -0.53; I = 99%; P = 0.03). There was no significant difference between the groups in terms of the incidence of postanesthetic adverse events; the pooled risk ratio was 0.67 (95% CI: 0.27-1.71; I = 59%; P = 0.41). We suggest that sugammadex is fast and effective in reversing rocuronium-induced NMB in pediatric patients. Although there
Colour break in reverse bicolour daffodils is associated with the presence of Narcissus mosaic virus
Directory of Open Access Journals (Sweden)
Davies Kevin M
2011-08-01
Full Text Available Abstract Background Daffodils (Narcissus pseudonarcissus are one of the world's most popular ornamentals. They also provide a scientific model for studying the carotenoid pigments responsible for their yellow and orange flower colours. In reverse bicolour daffodils, the yellow flower trumpet fades to white with age. The flowers of this type of daffodil are particularly prone to colour break whereby, upon opening, the yellow colour of the perianth is observed to be 'broken' into patches of white. This colour break symptom is characteristic of potyviral infections in other ornamentals such as tulips whose colour break is due to alterations in the presence of anthocyanins. However, reverse bicolour flowers displaying colour break show no other virus-like symptoms such as leaf mottling or plant stunting, leading some to argue that the carotenoid-based colour breaking in reverse bicolour flowers may not be caused by virus infection. Results Although potyviruses have been reported to cause colour break in other flower species, enzyme-linked-immunoassays with an antibody specific to the potyviral family showed that potyviruses were not responsible for the occurrence of colour break in reverse bicolour daffodils. Colour break in this type of daffodil was clearly associated with the presence of large quantities of rod-shaped viral particles of lengths 502-580 nm in tepals. Sap from flowers displaying colour break caused red necrotic lesions on Gomphrena globosa, suggesting the presence of potexvirus. Red necrotic lesions were not observed in this indicator plant when sap from reverse bicolour flowers not showing colour break was used. The reverse transcriptase polymerase reactions using degenerate primers to carla-, potex- and poty-viruses linked viral RNA with colour break and sequencing of the amplified products indicated that the potexvirus Narcissisus mosaic virus was the predominant virus associated with the occurrence of the colour break
Darlix, J L; Vincent, A; Gabus, C; de Rocquigny, H; Roques, B
1993-08-01
Two DNA strand transfer reactions take place during reverse transcription of the retroviral genome. The first transfer, that of the minus-strand strong stop DNA from the 5' end of the viral RNA to the 3' end, has been studied in vitro with two RNAs mimicking the 5' and 3' regions of the HIV1 genome and with nucleocapsid protein, NCp7, and reverse transcriptase. The results show that NCp7 strongly activates the 5' to 3' DNA strand transfer during reverse transcription while a basic peptide resembling NCp7 is inactive. Activation of the first transfer by several NCp7 derived peptides and the influence of the terminal redundancies (R) present at the 5' and 3' ends of HIV1 RNA were also examined. The first transfer is optimal in the presence of intact NCp7 and necessitates R on both the 5' and 3' RNAs. Sequencing of full length viral DNA products reveals approximately 40% misincorporations at the first nucleotide beyond the transfer point. If such base misincorporations occur during proviral DNA synthesis with possible homologous recombinations it may well contribute to the high level of genetic variability of HIV.
Tian, Xiao-Jun; Zhang, Hang; Xing, Jianhua
2013-01-01
Epithelial to mesenchymal transition (EMT) plays an important role in embryonic development, tissue regeneration, and cancer metastasis. Whereas several feedback loops have been shown to regulate EMT, it remains elusive how they coordinately modulate EMT response to TGF-β treatment. We construct a mathematical model for the core regulatory network controlling TGF-β-induced EMT. Through deterministic analyses and stochastic simulations, we show that EMT is a sequential two-step program in which an epithelial cell first is converted to partial EMT then to the mesenchymal state, depending on the strength and duration of TGF-β stimulation. Mechanistically the system is governed by coupled reversible and irreversible bistable switches. The SNAIL1/miR-34 double-negative feedback loop is responsible for the reversible switch and regulates the initiation of EMT, whereas the ZEB/miR-200 feedback loop is accountable for the irreversible switch and controls the establishment of the mesenchymal state. Furthermore, an autocrine TGF-β/miR-200 feedback loop makes the second switch irreversible, modulating the maintenance of EMT. Such coupled bistable switches are robust to parameter variation and molecular noise. We provide a mechanistic explanation on multiple experimental observations. The model makes several explicit predictions on hysteretic dynamic behaviors, system response to pulsed stimulation, and various perturbations, which can be straightforwardly tested. PMID:23972859
Xie, Zhongcong; Culley, Deborah J; Dong, Yuanlin; Zhang, Guohua; Zhang, Bin; Moir, Robert D; Frosch, Matthew P; Crosby, Gregory; Tanzi, Rudolph E
2008-12-01
An estimated 200 million patients worldwide have surgery each year. Anesthesia and surgery have been reported to facilitate emergence of Alzheimer's disease. The commonly used inhalation anesthetic isoflurane has previously been reported to induce apoptosis, and to increase levels and aggregation of Alzheimer's disease-associated amyloid beta-protein (Abeta) in cultured cells. However, the in vivo relevance has not been addressed. We therefore set out to determine effects of isoflurane on caspase activation and levels of beta-site amyloid precursor protein-cleaving enzyme (BACE) and Abeta in naive mice, using Western blot, immunohistochemistry, and reverse transcriptase polymerase chain reaction. Here we show for the first time that a clinically relevant isoflurane anesthesia (1.4% isoflurane for 2 hours) leads to caspase activation and modest increases in levels of BACE 6 hours after anesthesia in mouse brain. Isoflurane anesthesia induces caspase activation, and increases levels of BACE and Abeta up to 24 hours after anesthesia. Isoflurane may increase BACE levels by reducing BACE degradation. Moreover, the Abeta aggregation inhibitor, clioquinol, was able to attenuate isoflurane-induced caspase-3 activation in vivo. Given that transient insults to brain may lead to long-term brain damage, these findings suggest that isoflurane may promote Alzheimer's disease neuropathogenesis and, as such, have implications for use of isoflurane in humans, pending human study confirmation.
Energy Technology Data Exchange (ETDEWEB)
Matczak, Michał [Institute of Molecular Physics, Polish Academy of Sciences, M. Smoluchowskiego 17, 60-179 Poznań (Poland); NanoBioMedical Centre, Adam Mickiewicz University, Umultowska 85, 61-614 Poznań (Poland); Schäfer, Rudolf [Leibniz Institute for Solid State and Materials Research (IFW) Dresden, Institute for Metallic Materials, PO 270116, D-01171 Dresden (Germany); Dresden University of Technology, Institute for Materials Science, D-01062 Dresden (Germany); Urbaniak, Maciej; Kuświk, Piotr; Szymański, Bogdan; Schmidt, Marek; Aleksiejew, Jacek [Institute of Molecular Physics, Polish Academy of Sciences, M. Smoluchowskiego 17, 60-179 Poznań (Poland); Stobiecki, Feliks, E-mail: Feliks.Stobiecki@ifmpan.poznan.pl [Institute of Molecular Physics, Polish Academy of Sciences, M. Smoluchowskiego 17, 60-179 Poznań (Poland); NanoBioMedical Centre, Adam Mickiewicz University, Umultowska 85, 61-614 Poznań (Poland)
2017-01-15
A magnetic multilayer of substrate/Pt-15 nm/Co-0.8 nm/Pt-wedge 0–7 nm/Co-0.6 nm/Pt-2 nm structure is characterized by a perpendicular anisotropy of the Co layers and by graded interlayer coupling between them. Using magnetooptical Kerr microscopy we observed a distinct influence of magnetic domains in one Co layer on the nucleation field and positions of nucleation sites of reversed domains in the second Co layer. For sufficiently strong interlayer coupling a replication of magnetic domains from the magnetically harder layer to the magnetically softer layer is observed. - Highlights: • Co/Pt-wedge/Co layered film is characterized by a gradient of interlayer coupling. • Magnetic field controls propagation of straight domain wall. • Replication of magnetic domains in multilayers with strong ferromagnetic coupling. • Coupling induced by domains influences magnetization reversal of spin valves.
D-cycloserine in prelimbic cortex reverses scopolamine-induced deficits in olfactory memory in rats.
Directory of Open Access Journals (Sweden)
Marta Portero-Tresserra
Full Text Available A significant interaction between N-methyl-D-aspartate (NMDA and muscarinic receptors has been suggested in the modulation of learning and memory processes. The present study further investigates this issue and explores whether d-cycloserine (DCS, a partial agonist at the glycine binding site of the NMDA receptors that has been regarded as a cognitive enhancer, would reverse scopolamine (SCOP-induced amnesia in two olfactory learning tasks when administered into the prelimbic cortex (PLC. Thus, in experiment 1, DCS (10 µg/site was infused prior to acquisition of odor discrimination (ODT and social transmission of food preference (STFP, which have been previously characterized as paradigms sensitive to PLC muscarinic blockade. Immediately after learning such tasks, SCOP was injected (20 µg/site and the effects of both drugs (alone and combined were tested in 24-h retention tests. To assess whether DCS effects may depend on the difficulty of the task, in the STFP the rats expressed their food preference either in a standard two-choice test (experiment 1 or a more challenging three-choice test (experiment 2. The results showed that bilateral intra-PLC infusions of SCOP markedly disrupted the ODT and STFP memory tests. Additionally, infusions of DCS alone into the PLC enhanced ODT but not STFP retention. However, the DCS treatment reversed SCOP-induced memory deficits in both tasks, and this effect seemed more apparent in ODT and 3-choice STFP. Such results support the interaction between the glutamatergic and the cholinergic systems in the PLC in such a way that positive modulation of the NMDA receptor/channel, through activation of the glycine binding site, may compensate dysfunction of muscarinic neurotransmission involved in stimulus-reward and relational learning tasks.
D-cycloserine in prelimbic cortex reverses scopolamine-induced deficits in olfactory memory in rats.
Portero-Tresserra, Marta; Cristóbal-Narváez, Paula; Martí-Nicolovius, Margarita; Guillazo-Blanch, Gemma; Vale-Martínez, Anna
2013-01-01
A significant interaction between N-methyl-D-aspartate (NMDA) and muscarinic receptors has been suggested in the modulation of learning and memory processes. The present study further investigates this issue and explores whether d-cycloserine (DCS), a partial agonist at the glycine binding site of the NMDA receptors that has been regarded as a cognitive enhancer, would reverse scopolamine (SCOP)-induced amnesia in two olfactory learning tasks when administered into the prelimbic cortex (PLC). Thus, in experiment 1, DCS (10 µg/site) was infused prior to acquisition of odor discrimination (ODT) and social transmission of food preference (STFP), which have been previously characterized as paradigms sensitive to PLC muscarinic blockade. Immediately after learning such tasks, SCOP was injected (20 µg/site) and the effects of both drugs (alone and combined) were tested in 24-h retention tests. To assess whether DCS effects may depend on the difficulty of the task, in the STFP the rats expressed their food preference either in a standard two-choice test (experiment 1) or a more challenging three-choice test (experiment 2). The results showed that bilateral intra-PLC infusions of SCOP markedly disrupted the ODT and STFP memory tests. Additionally, infusions of DCS alone into the PLC enhanced ODT but not STFP retention. However, the DCS treatment reversed SCOP-induced memory deficits in both tasks, and this effect seemed more apparent in ODT and 3-choice STFP. Such results support the interaction between the glutamatergic and the cholinergic systems in the PLC in such a way that positive modulation of the NMDA receptor/channel, through activation of the glycine binding site, may compensate dysfunction of muscarinic neurotransmission involved in stimulus-reward and relational learning tasks.
Reversal of reflex pulmonary vasoconstriction induced by main pulmonary arterial distension.
Juratsch, C E; Grover, R F; Rose, C E; Reeves, J T; Walby, W F; Laks, M M
1985-04-01
Distension of the main pulmonary artery (MPA) induces pulmonary hypertension, most probably by neurogenic reflex pulmonary vasoconstriction, although constriction of the pulmonary vessels has not actually been demonstrated. In previous studies in dogs with increased pulmonary vascular resistance produced by airway hypoxia, exogenous arachidonic acid has led to the production of pulmonary vasodilator prostaglandins. Hence, in the present study, we investigated the effect of arachidonic acid in seven intact anesthetized dogs after pulmonary vascular resistance was increased by MPA distention. After steady-state pulmonary hypertension was established, arachidonic acid (1.0 mg/min) was infused into the right ventricle for 16 min; 15-20 min later a 16-mg bolus of arachidonic acid was injected. MPA distension was maintained throughout the study. Although the infusion of arachidonic acid significantly lowered the elevated pulmonary vascular resistance induced by MPA distension, the pulmonary vascular resistance returned to control levels only after the bolus injection of arachidonic acid. Notably, the bolus injection caused a biphasic response which first increased the pulmonary vascular resistance transiently before lowering it to control levels. In dogs with resting levels of pulmonary vascular resistance, administration of arachidonic acid in the same manner did not alter the pulmonary vascular resistance. It is concluded that MPA distension does indeed cause reflex pulmonary vasoconstriction which can be reversed by vasodilator metabolites of arachidonic acid. Even though this reflex may help maintain high pulmonary vascular resistance in the fetus, its function in the adult is obscure.
2015-01-01
Positive allosteric modulators (PAMs) of the M4 muscarinic acetylcholine receptor (mAChR) represent a novel approach for the treatment of psychotic symptoms associated with schizophrenia and other neuropsychiatric disorders. We recently reported that the selective M4 PAM VU0152100 produced an antipsychotic drug-like profile in rodents after amphetamine challenge. Previous studies suggest that enhanced cholinergic activity may also improve cognitive function and reverse deficits observed with reduced signaling through the N-methyl-d-aspartate subtype of the glutamate receptor (NMDAR) in the central nervous system. Prior to this study, the M1 mAChR subtype was viewed as the primary candidate for these actions relative to the other mAChR subtypes. Here we describe the discovery of a novel M4 PAM, VU0467154, with enhanced in vitro potency and improved pharmacokinetic properties relative to other M4 PAMs, enabling a more extensive characterization of M4 actions in rodent models. We used VU0467154 to test the hypothesis that selective potentiation of M4 receptor signaling could ameliorate the behavioral, cognitive, and neurochemical impairments induced by the noncompetitive NMDAR antagonist MK-801. VU0467154 produced a robust dose-dependent reversal of MK-801-induced hyperlocomotion and deficits in preclinical models of associative learning and memory functions, including the touchscreen pairwise visual discrimination task in wild-type mice, but failed to reverse these stimulant-induced deficits in M4 KO mice. VU0467154 also enhanced the acquisition of both contextual and cue-mediated fear conditioning when administered alone in wild-type mice. These novel findings suggest that M4 PAMs may provide a strategy for addressing the more complex affective and cognitive disruptions associated with schizophrenia and other neuropsychiatric disorders. PMID:25137629
Local renin-angiotensin system contributes to hyperthyroidism-induced cardiac hypertrophy.
Kobori, H; Ichihara, A; Miyashita, Y; Hayashi, M; Saruta, T
1999-01-01
We have reported previously that thyroid hormone activates the circulating and tissue renin-angiotensin systems without involving the sympathetic nervous system, which contributes to cardiac hypertrophy in hyperthyroidism. This study examined whether the circulating or tissue renin-angiotensin system plays the principal role in hyperthyroidism-induced cardiac hypertrophy. The circulating renin-angiotensin system in Sprague-Dawley rats was fixed by chronic angiotensin II infusion (40 ng/min, 28 days) via mini-osmotic pumps. Daily i.p. injection of thyroxine (0.1 mg/kg per day, 28 days) was used to mimic hyperthyroidism. Serum free tri-iodothyronine, plasma renin activity, plasma angiotensin II, cardiac renin and cardiac angiotensin II were measured with RIAs. The cardiac expression of renin mRNA was evaluated by semiquantitative reverse transcriptase-polymerase chain reaction. Plasma renin activity and plasma angiotensin II were kept constant in the angiotensin II and angiotensin II+thyroxine groups (0.12+/-0.03 and 0.15+/-0.03 microgram/h per liter, 126+/-5 and 130+/-5 ng/l respectively) (means+/-s.e.m.). Despite stabilization of the circulating renin-angiotensin system, thyroid hormone induced cardiac hypertrophy (5.0+/-0.5 vs 3.5+/-0.1 mg/g) in conjunction with the increases in cardiac expression of renin mRNA, cardiac renin and cardiac angiotensin II (74+/-2 vs 48+/-2%, 6.5+/-0.8 vs 3.8+/-0.4 ng/h per g, 231+/-30 vs 149+/-2 pg/g respectively). These results indicate that the local renin-angiotensin system plays the primary role in the development of hyperthyroidism-induced cardiac hypertrophy.
Monoamines stimulate sex reversal in the saddleback wrasse.
Larson, Earl T; Norris, David O; Gordon Grau, E; Summers, Cliff H
2003-02-15
Monoamine neurotransmitters (norepinephrine, dopamine, and serotonin) play an important role in reproduction and sexual behavior throughout the vertebrates. They are the first endogenous chemical signals in the regulation of the hypothalamo-pituitary-gonadal (HPG) axis. In teleosts with behavioral sex determination, much is known about behavioral cues that induce sex reversal. The cues are social, processed via the visual system and depend on the ratio of females to males in the population. The mechanisms by which these external behavioral cues are converted to an internal chemical regulatory process are largely unknown. The protogynous Hawaiian saddleback wrasse, Thalassoma duperrey, was used to investigate the biological pathway mediating the conversion of a social cue into neuroendocrine events regulating sex reversal. Because monoamines play an important role in the regulation of the HPG axis, they were selected as likely candidates for such a conversion. To determine if monoamines could affect sex reversal, drugs affecting monoamines were used in an attempt to either induce sex reversal under non-permissive conditions, or prevent sex reversal under permissive conditions. Increasing norepinephrine or blocking dopamine or serotonin lead to sex reversal in experimental animals under non-permissive conditions. Increasing serotonin blocked sex reversal under permissive conditions, while blocking dopamine or norepinephrine retarded the process. The results presented here demonstrate that monoamines contribute significantly to the control sex reversal. Norepinephrine stimulates initiation and completion of gonadal sex of reversal as well as color change perhaps directly via its effects on the HPG axis. Dopamine exercises inhibitory action on the initiation of sex reversal while 5-HT inhibits both initiation and completion of sex reversal. The serotonergic system appears to be an integral part of the pathway mediating the conversion of a social cue into a
Directory of Open Access Journals (Sweden)
Sandra Almeida
2012-10-01
Full Text Available The pathogenic mechanisms of frontotemporal dementia (FTD remain poorly understood. Here we generated multiple induced pluripotent stem cell lines from a control subject, a patient with sporadic FTD, and an FTD patient with a novel heterozygous GRN mutation (progranulin [PGRN] S116X. In neurons and microglia differentiated from PGRN S116X induced pluripotent stem cells, the levels of intracellular and secreted PGRN were reduced, establishing patient-specific cellular models of PGRN haploinsufficiency. Through a systematic screen of inducers of cellular stress, we found that PGRN S116X neurons, but not sporadic FTD neurons, exhibited increased sensitivity to staurosporine and other kinase inhibitors. Moreover, the serine/threonine kinase S6K2, a component of the phosphatidylinositol 3-kinase and mitogen-activated protein kinase pathways, was specifically downregulated in PGRN S116X neurons. Both increased sensitivity to kinase inhibitors and reduced S6K2 were rescued by PGRN expression. Our findings identify cell-autonomous, reversible defects in patient neurons with PGRN deficiency, and provide a compelling model for studying PGRN-dependent pathogenic mechanisms and testing potential therapies.
Energy Technology Data Exchange (ETDEWEB)
Nakanishi, Masako, E-mail: n-masako@wakayama-med.ac.jp [Department of Pathology, Wakayama Medical University, 811-1 Kimiidera, Wakayama 641-8509 (Japan); Morita, Yoshihiro [Department of Molecular and Cellular Biochemistry, Osaka University Graduate School of Dentistry, Suita, Osaka 565-0871 (Japan); Department of Oral and Maxillofacial Surgery, Seichokai Hannan Municipal Hospital, Hannan, Osaka 599-0202 (Japan); Hata, Kenji [Department of Molecular and Cellular Biochemistry, Osaka University Graduate School of Dentistry, Suita, Osaka 565-0871 (Japan); Muragaki, Yasuteru, E-mail: ymuragak@wakayama-med.ac.jp [Department of Pathology, Wakayama Medical University, 811-1 Kimiidera, Wakayama 641-8509 (Japan)
2016-07-15
Local acidosis is one of the characteristic features of the cancer microenvironment. Many reports indicate that acidosis accelerates the proliferation and invasiveness of cancer cells. However, whether acidic conditions affect lymphatic metastasis is currently unknown. In the present study, we focused on the effects of acidosis on lymphatic endothelial cells (LECs) to assess the relationship between acidic microenvironments and lymph node metastasis. We demonstrated that normal human LECs express various acid receptors by immunohistochemistry and reverse transcriptase-polymerase chain reaction (PCR). Acidic stimulation with low pH medium induced morphological changes in LECs to a spindle shape, and significantly promoted cellular growth and tube formation. Moreover, real-time PCR revealed that acidic conditions increased the mRNA expression of interleukin (IL)-8. Acidic stimulation increased IL-8 production in LECs, whereas a selective transient receptor potential vanilloid subtype 1 (TRPV1) antagonist, 5′-iodoresiniferatoxin, decreased IL-8 production. IL-8 accelerated the proliferation of LECs, and inhibition of IL-8 diminished tube formation and cell migration. In addition, phosphorylation of nuclear factor (NF)-κB was induced by acidic conditions, and inhibition of NF-κB activation reduced acid-induced IL-8 expression. These results suggest that acidic microenvironments in tumors induce lymphangiogenesis via TRPV1 activation in LECs, which in turn may promote lymphatic metastasis. - Highlights: • Acidity accelerates the growth, migration, and tube formation of LECs. • Acidic condition induces IL-8 expression in LECs. • IL-8 is critical for the changes of LECs. • IL-8 expression is induced via TRPV1 activation.
Varlinskaya, Elena I; Spear, Linda P
2012-01-01
Repeated exposure to stressors has been found to increase anxiety-like behavior in laboratory rodents, with the social anxiety induced by repeated restraint being extremely sensitive to anxiolytic effects of ethanol in both adolescent and adult rats. No studies, however, have compared social anxiogenic effects of acute stress or the capacity of ethanol to reverse this anxiety in adolescent and adult animals. Therefore, the present study was designed to investigate whether adolescent [postnatal day (P35)] Sprague-Dawley rats differ from their adult counterparts (P70) in the impact of acute restraint stress on social anxiety and in their sensitivity to the social anxiolytic effects of ethanol. Animals were restrained for 90 min, followed by examination of stress- and ethanol-induced (0, 0.25, 0.5, 0.75, and 1 g/kg) alterations in social behavior using a modified social interaction test in a familiar environment. Acute restraint stress increased anxiety, as indexed by reduced levels of social investigation at both ages, and decreased social preference among adolescents. These increases in anxiety were dramatically reversed among adolescents by acute ethanol. No anxiolytic-like effects of ethanol emerged following restraint stress in adults. The social suppression seen in response to higher doses of ethanol was reversed by restraint stress in animals of both ages. To the extent that these data are applicable to humans, the results of the present study provide some experimental evidence that stressful life events may increase the attractiveness of alcohol as an anxiolytic agent for adolescents. Copyright © 2011 Elsevier Inc. All rights reserved.
The history of antiretrovirals: key discoveries over the past 25 years.
De Clercq, Erik
2009-09-01
Within 25 years after zidovudine (3'-azido-2',3'-dideoxythymidine, AZT) was first described as an inhibitor of HIV replication, 25 anti-HIV drugs have been formally approved for clinical use in the treatment of HIV infections: seven nucleoside reverse transcriptase inhibitors (NRTIs): zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir and emtricitabine; one nucleotide reverse transcriptase inhibitor (NtRTI): tenofovir [in its oral prodrug form: tenofovir disoproxil fumarate (TDF)]; four non-nucleoside reverse transcriptase inhibitors (NNRTIs): nevirapine, delavirdine, efavirenz and etravirine; ten protease inhibitors (PIs): saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, tipranavir and darunavir; one fusion inhibitor (FI): enfuvirtide; one co-receptor inhibitor (CRI): maraviroc and one integrase inhibitor (INI): raltegravir. These compounds are used in various drug combination (some at fixed dose) regimens so as to achieve the highest possible benefit and tolerability, and to diminish the risk of virus-drug resistance development. (c) 2009 John Wiley & Sons, Ltd.
Effects of a Tumor Necrosis Factor-α Antagonist on Experimentally Induced Rhinosinusitis
Directory of Open Access Journals (Sweden)
Dong-Hyun Kim
2011-01-01
Full Text Available This prospective, randomized, and controlled study examined the effects of tumor necrosis factor soluble receptor type I (sTNFRI, a TNF-α antagonist on experimentally induced rhinosinusitis in rats. The experimental groups received an instillation of lipopolysaccharide (LPS plus an intramuscular injection of amoxicillin/clavulanate (antibiotic group, an instillation of sTNFRI (sTNFRI group, an instillation of sTNFRI and an injection of amoxicillin/clavulanate (sTNFRI/antibiotic group, or no additional treatment (LPS group. Histopathological changes were determined using hematoxylin-eosin and periodic acid-Schiff (PAS staining. Leakage of exudate was determined using fluorescence microscopy. Vascular permeability was measured using the Evans blue dye technique. Expression of MUC5AC was measured using reverse transcriptase PCR. The sTNFRI, antibiotic, and sTNFRI/antibiotic groups had significantly less capillary permeability, mucosal edema, PAS staining, and expression of MUC5AC than the LPS group. There were no differences in capillary permeability, mucosal edema, PAS staining, and MUC5AC expression between the sTNFRI and sTNFRI/antibiotic groups. The antibiotic group had PAS staining similar to that of the sTNFRI and sTNFRI/antibiotic groups but had a greater increase in capillary permeability, mucosal edema, and MUC5AC expression. This study shows that sTNFRI reduces inflammatory activity and mucus hypersecretion in LPS-induced rhinosinusitis in rats.
International Nuclear Information System (INIS)
Jin Wensen; Kong Zhaolu; Shen Zhifen; Tong Shungao; Ji Huajun; Jin Yizun
2008-01-01
Objective: To study the regulation of hypoxia inducible factor-1α (HIF-1α) expression in hepatoma cells after irradiation and the expression of HIF-1α effect on the radiosensitivity of heptoma cells. Methods: HepG2 cells were pretreated by Cobalt chloride (COCl 2 ), a chemical hypoxia agent, to induce and stabilize the expression of HIF-1α, and then exposed to different γ-irradiation doses. Clonogenic assay was used to evaluate HepG2 cell survival fraction (SF) after irradiation under normoxia and chemical hypoxia. Reverse transcriptase polymerase chain reaction (RT-PCR) and immunoblot assay (Western blot) were utilized to detect the changes of intracellular HIF-1α on the level of transcripation and translation. Results: Cell survival level was elevated by chemical hypoxia and there was a statistical difference between chemical hypoxic group and normoxic group. The ratios of SF(SF co /SF o 2 )on two different conditions were increased with irradiation doses. Meanwhile, the irradiation induced up-regulation of HIF-1α in dose-dependent manner. The expression of HIF-1α was correlated with HepG2 cell survival level to some extent. Conclusions: Irradiation could up-regulate the level of HIF-1α expression in HepG2 cells under chemical hypoxic condition. The cells survival level might be influenced by the changes in HIF-1α expression. (authors)
International Nuclear Information System (INIS)
Mueller, M.; Gonzalez-Garcia, Y.; Pakula, C.; Zaporojtchenko, V.; Strunskus, T.; Faupel, F.; Herges, R.; Zargarani, D.; Magnussen, O.M.
2011-01-01
Thin films in the range 40-80 nm of a blend of PMMA with an azobenzene derivative have been studied directly during UV and blue light irradiation by atomic force microscopy (AFM), revealing highly reversible changes in the surface roughness and the film adhesion. UV light induces an ∼80% increase in surface roughness, whereas illumination by blue light completely reverses these changes. Based on the observed surface topography and transition kinetics a reversible mass flow mechanisms is suggested, where the polarity changes upon switching trigger a wetting-dewetting transition in a surface segregation layer of the chromophore. Similar AFM measurements of the pull-off force indicate a decrease upon UV and an increase after blue light illumination with a complex kinetic behavior: a rapid initial change, attributed to the change in the cis isomer fraction of the azobenzene derivative, and a more gradual change, indicative of slow structural reorganization.
Energy Technology Data Exchange (ETDEWEB)
Brown, R; Stretch, A; Thacker, J
1986-04-01
A large series of independent mutants deficient in HPRT enzyme activity, isolated from V79-4 hamster cells, were assessed for properties which reflect the nature of the genetic changes induced. A total of 88 mutants were screened, 43 isolated from ..gamma..-ray-treated cultures and 45 induced by ethyl methanesulphonate (EMS). Firstly, each mutant was assayed for the presence of protein with the antigenic response of HPRT. In a competitive inhibition assay, 31% of EMS-induced mutants were CRM-positive compared to 7% of the ..gamma..-ray series. Secondly, each mutant was tested for ability to revert to HPRT proficiency. All except 2 of the EMS-induced mutants reverted with ethyl nitrosourea ENU, and many reverted spontaneously, under the given conditions. However reversion was not detected in about 80% of ..gamma..-ray-induced mutants, suggesting that the types of forward mutation caused by ionizing radiation differ qualitatively from those caused by EMS. (Auth.). 30 refs.; 6 figs.; 2 tabs.
Beyond the polymerase-γ theory: Production of ROS as a mode of NRTI-induced mitochondrial toxicity.
Directory of Open Access Journals (Sweden)
Reuben L Smith
Full Text Available Use of some HIV-1 nucleoside reverse transcriptase inhibitors (NRTI is associated with severe adverse events. However, the exact mechanisms behind their toxicity has not been fully understood. Mitochondrial dysfunction after chronic exposure to specific NRTIs has predominantly been assigned to mitochondrial polymerase-γ inhibition by NRTIs. However, an increasing amount of data suggests that this is not the sole mechanism. Many NRTI induced adverse events have been linked to the incurrence of oxidative stress, although the causality of events leading to reactive oxygen species (ROS production and their role in toxicity is unclear. In this study we show that short-term effects of first generation NRTIs, which are rarely discussed in the literature, include inhibition of oxygen consumption, decreased ATP levels and increased ROS production. Collectively these events affect fitness and longevity of C. elegans through mitohormetic signalling events. Furthermore, we demonstrate that these effects can be normalized by addition of the anti-oxidant N-acetylcysteine (NAC, which suggests that ROS likely influence the onset and severity of adverse events upon drug exposure.
Matricon, Julien; Seillier, Alexandre; Giuffrida, Andrea
2016-09-01
The fatty acid amide hydrolase inhibitor, URB597, an endocannabinoid enhancing drug, reverses social withdrawal in the sub-chronic PCP rat model of schizophrenia, but reduces social interaction (SI) in controls. To identify the anatomical substrates associated with PCP-induced social withdrawal and the contrasting effects of URB597 on SI in PCP- versus saline-treated rats, we analyzed SI-induced c-Fos expression in 28 brain areas relevant to schizophrenia and/or social behavior following vehicle or URB597 administration. In saline-treated rats, SI was accompanied by changes in c-Fos expression in the infralimbic and orbitofrontal cortices, dorsomedial caudate putamen, ventrolateral nucleus of the septum, dorsolateral periaqueductal gray (dlPAG) and central amygdala. Except for the dlPAG, these changes were not observed in PCP-treated rats or in saline-treated rats receiving URB597. In the dorsomedial part of the bed nucleus of the stria terminalis (dmBNST), SI-induced c-Fos expression was observed only in PCP-treated rats. Interestingly, URB597 in PCP-treated rats restored a similar c-Fos expression pattern as observed in saline-treated rats: activation of the orbitofrontal cortex, inhibition of the central amygdala and suppression of activation of the dmBNST. These data suggest that orbitofrontal cortex, central amygdala and dmBNST play a critical role in the reversal of PCP-induced social withdrawal by URB597. Copyright © 2016 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.
5-HT(1A) receptor antagonism reverses and prevents fluoxetine-induced sexual dysfunction in rats.
Sukoff Rizzo, Stacey J; Pulicicchio, Claudine; Malberg, Jessica E; Andree, Terrance H; Stack, Gary P; Hughes, Zoë A; Schechter, Lee E; Rosenzweig-Lipson, Sharon
2009-09-01
Sexual dysfunction associated with antidepressant treatment continues to be a major compliance issue for antidepressant therapies. 5-HT(1A) antagonists have been suggested as beneficial adjunctive treatment in respect of antidepressant efficacy; however, the effects of 5-HT(1A) antagonism on antidepressant-induced side-effects has not been fully examined. The present study was conducted to evaluate the ability of acute or chronic treatment with 5-HT(1A) antagonists to alter chronic fluoxetine-induced impairments in sexual function. Chronic 14-d treatment with fluoxetine resulted in a marked reduction in the number of non-contact penile erections in sexually experienced male rats, relative to vehicle-treated controls. Acute administration of the 5-HT(1A) antagonist WAY-101405 resulted in a complete reversal of chronic fluoxetine-induced deficits on non-contact penile erections at doses that did not significantly alter baselines. Chronic co-administration of the 5-HT(1A) antagonists WAY-100635 or WAY-101405 with fluoxetine prevented fluoxetine-induced deficits in non-contact penile erections in sexually experienced male rats. Moreover, withdrawal of WAY-100635 from co-treatment with chonic fluoxetine, resulted in a time-dependent reinstatement of chronic fluoxetine-induced deficits in non-contact penile erections. Additionally, chronic administration of SSA-426, a molecule with dual activity as both a SSRI and 5-HT(1A) antagonist, did not produce deficits in non-contact penile erections at doses demonstrated to have antidepressant-like activity in the olfactory bulbectomy model. Taken together, these data suggest that 5-HT(1A) antagonist treatment may have utility for the management of SSRI-induced sexual dysfunction.
Thakkar, Vidhi D; Cox, Robert M; Sawatsky, Bevan; da Fontoura Budaszewski, Renata; Sourimant, Julien; Wabbel, Katrin; Makhsous, Negar; Greninger, Alexander L; von Messling, Veronika; Plemper, Richard K
2018-04-15
pathogenesis. We show that internal deletions in this Ntail region of up to 55 amino acids in length are compatible with efficient replication of recombinant viruses in cell culture but result in gradual viral attenuation in a lethal canine distemper virus (CDV)/ferret model. Mechanistically, we demonstrate a role of the intact Ntail region in the regulation of viral transcriptase activity. Recombinant viruses with Ntail truncations induce protective immunity against lethal challenge of ferrets with pathogenic CDV. This identification of the unstructured central Ntail domain as a nonessential paramyxovirus pathogenesis factor establishes a foundation for harnessing Ntail truncations for vaccine engineering against emerging and reemerging members of the paramyxovirus family. Copyright © 2018 American Society for Microbiology.
Xu, Qian Feng; Liu, Yang; Lin, Fang-Ju; Mondal, Bikash; Lyons, Alan M
2013-09-25
Multifunctional superhydrophobic nanocomposite surfaces based on photocatalytic materials, such as fluorosilane modified TiO2, have generated significant research interest. However, there are two challenges to forming such multifunctional surfaces with stable superhydrophobic properties: the photocatalytic oxidation of the hydrophobic functional groups, which leads to the permanent loss of superhydrophobicity, as well as the photoinduced reversible hydrolysis of the catalytic particle surface. Herein, we report a simple and inexpensive template lamination method to fabricate multifunctional TiO2-high-density polyethylene (HDPE) nanocomposite surfaces exhibiting superhydrophobicity, UV-induced reversible wettability, and self-cleaning properties. The laminated surface possesses a hierarchical roughness spanning the micro- to nanoscale range. This was achieved by using a wire mesh template to emboss the HDPE surface creating an array of polymeric posts while partially embedding untreated TiO2 nanoparticles selectively into the top surface of these features. The surface exhibits excellent superhydrophobic properties immediately after lamination without any chemical surface modification to the TiO2 nanoparticles. Exposure to UV light causes the surface to become hydrophilic. This change in wettability can be reversed by heating the surface to restore superhydrophobicity. The effect of TiO2 nanoparticle surface coverage and chemical composition on the mechanism and magnitude of wettability changes was studied by EDX and XPS. In addition, the ability of the surface to shed impacting water droplets as well as the ability of such droplets to clean away particulate contaminants was demonstrated.
Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben
2004-01-01
Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation
Huang, Rong-Shuang; Zhou, Jiao-Jiao; Feng, Yu-Ying; Shi, Min; Guo, Fan; Gou, Shen-Ju; Salerno, Stephen; Ma, Liang; Fu, Ping
2017-09-20
Acute kidney injury (AKI) is the most common and life-threatening systemic complication of rhabdomyolysis. Inflammation plays an important role in the development of rhabdomyolysis-induced AKI. This study aimed to investigate the kidney model of AKI caused by rhabdomyolysis to verify the role of macrophage Toll-like receptor 4/nuclear factor-kappa B (TLR4/NF-κB) signaling pathway. C57BL/6 mice were injected with a 50% glycerin solution at bilateral back limbs to induce rhabdomyolysis, and CLI-095 or pyrrolidine dithiocarbamate (PDTC) was intraperitoneally injected at 0.5 h before molding. Serum creatinine levels, creatine kinase, the expression of tumor necrosis factor (TNF)-α, interleukin (IL)-1β and IL-6, and hematoxylin and eosin stainings of kidney tissues were tested. The infiltration of macrophage, mRNA levels, and protein expression of TLR4 and NF-κB were investigated by immunofluorescence double-staining techniques, reverse transcriptase-quantitative polymerase chain reaction, and Western blotting, respectively. In vitro, macrophage RAW264.7 was stimulated by ferrous myoglobin; the cytokines, TLR4 and NF-κB expressions were also detected. In an in vivo study, using CLI-095 or PDTC to block TLR4/NF-κB, functional and histologic results showed that the inhibition of TLR4 or NF-κB alleviated glycerol-induced renal damages (P rhabdomyolysis-induced AKI by the regulation of proinflammatory cytokine production and macrophage infiltration.
Directory of Open Access Journals (Sweden)
Wonkyoung Cho
Full Text Available Atherosclerosis, the major pathology of cardiovascular disease, is caused by multiple factors involving psychological stress. Corticotropin-releasing hormone (CRH, which is released by neurosecretory cells in the hypothalamus, peripheral nerve terminals and epithelial cells, regulates various stress-related responses. Our current study aimed to verify the role of CRH in macrophage foam cell formation, the initial critical stage of atherosclerosis. Our quantitative real-time reverse transcriptase PCR (qRT-PCR, semi-quantitative reverse transcriptase PCR, and Western blot results indicate that CRH down-regulates ATP-binding cassette transporter-1 (ABCA1 and liver X receptor (LXR-α, a transcription factor for ABCA1, in murine peritoneal macrophages and human monocyte-derived macrophages. Oil-red O (ORO staining and intracellular cholesterol measurement of macrophages treated with or without oxidized LDL (oxLDL and with or without CRH (10 nM in the presence of apolipoprotein A1 (apoA1 revealed that CRH treatment promotes macrophage foam cell formation. The boron-dipyrromethene (BODIPY-conjugated cholesterol efflux assay showed that CRH treatment reduces macrophage cholesterol efflux. Western blot analysis showed that CRH-induced down-regulation of ABCA1 is dependent on phosphorylation of Akt (Ser473 induced by interaction between CRH and CRH receptor 1(CRHR1. We conclude that activation of this pathway by CRH accelerates macrophage foam cell formation and may promote stress-related atherosclerosis.
International Nuclear Information System (INIS)
Van Dijk, A.A.; Huismans, H.
1982-01-01
Virions of bluetongue virus (BTV), epizootic haemorrhagic disease virus (EHDV) and African horsesickness virus (AHSV) can be converted to core particles by treatment with chymotrypsin and magnesium. The conversion is characterized by the removal of the 2 outer capsid polypeptides of the virion. The loss of these 2 proteins results in an increase in density from 1,36 g/ml to 1,40 g/ml on CsCl gradients. The BTV, EHDV and AHSV core particles have an associated double-stranded RNA dependent RNA transcriptase that appears to transcribe mRNA optimally at 28 degrees Celsius. It was found, at least in the case of BTV, that this low temperature preference is not an intrinsic characteristic of the transcriptase, but is due to a temperature-dependent inhibition of transcription at high core concentrations
Bracalente, Candelaria; Salguero, Noelia; Notcovich, Cintia; Müller, Carolina B.; da Motta, Leonardo L.; Klamt, Fabio; Ibañez, Irene L.; Durán, Hebe
2016-01-01
Advanced melanoma is the most aggressive form of skin cancer. It is highly metastatic and dysfunctional in melanogenesis; two processes that are induced by H2O2. This work presents a melanoma cell model with low levels of H2O2 induced by catalase overexpression to study differentiation/dedifferentiation processes. Three clones (A7, C10 and G10) of human A375 amelanotic melanoma cells with quite distinct phenotypes were obtained. These clones faced H2O2 scavenging by two main strategies. One developed by clone G10 where ROS increased. This resulted in G10 migration and metastasis associated with the increased of cofilin-1 and CAP1. The other strategy was observed in clone A7 and C10, where ROS levels were maintained reversing malignant features. Particularly, C10 was not tumorigenic, while A7 reversed the amelanotic phenotype by increasing melanin content and melanocytic differentiation markers. These clones allowed the study of potential differentiation and migration markers and its association with ROS levels in vitro and in vivo, providing a new melanoma model with different degree of malignancy. PMID:27206672
Wieczorek, K; Elashry, A; Quentin, M; Grundler, F M W; Favery, B; Seifert, G J; Bohlmann, H
2014-09-01
Pectin in the primary plant cell wall is thought to be responsible for its porosity, charge density, and microfibril spacing and is the main component of the middle lamella. Plant-parasitic nematodes secrete cell wall-degrading enzymes that macerate the plant tissue, facilitating the penetration and migration within the roots. In sedentary endoparasitic nematodes, these enzymes are released only during the migration of infective juveniles through the root. Later, nematodes manipulate the expression of host plant genes, including various cell wall enzymes, in order to induce specific feeding sites. In this study, we investigated expression of two Arabidopsis pectate lyase-like genes (PLL), PLL18 (At3g27400) and PLL19 (At4g24780), together with pectic epitopes with different degrees of methylesterification in both syncytia induced by the cyst nematode Heterodera schachtii and giant cells induced by the root-knot nematode Meloidogyne incognita. We confirmed upregulation of PLL18 and PLL19 in both types of feeding sites with quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) and in situ RT-PCR. Furthermore, the functional analysis of mutants demonstrated the important role of both PLL genes in the development and maintenance of syncytia but not giant cells. Our results show that both enzymes play distinct roles in different infected root tissues as well as during parasitism of different nematodes.
Temperature induced reversible polymorphic phase transformations in a bis-hydrazone compound
Jayant, Vikrant; Das, Dinabandhu
2018-03-01
Two reversible polymorphic phase transformation of 2,3-butanedione, 2,3- bis[4,4‧-bis(diethylamino)benzophenone hydrazone] (DEBH) have been identified in DSC experiment. Topotactic phase transformation of three polymorphs has been observed in variable temperature Single Crystal X-ray Diffraction experiment. The reversible phase transformation of bulk material has been confirmed by Powder X-ray diffraction study.
Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc
2011-07-01
Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.
das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda
2010-06-05
The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Varlinskaya, Elena I.; Spear, Linda P.
2011-01-01
Repeated exposure to stressors has been found to increase anxiety-like behavior in laboratory rodents, with the social anxiety induced by repeated restraint being extremely sensitive to anxiolytic effects of ethanol in both adolescent and adult rats. No studies, however, have compared social anxiogenic effects of acute stress or the capacity of ethanol to reverse this anxiety in adolescent and adult animals. Therefore, the present study was designed to investigate whether adolescent [postnata...
Redox-induced reversible luminescence switching of cerium-doped upconversion nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Huang, Yanan [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Xiao, Qingbo, E-mail: qbxiao2011@sinano.ac.cn [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Wang, Jian [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Xi, Yonglan [Laboratory for Agricultural Wastes Treatment and Recycling Institute of Agricultural Resources and Environment, Jiangsu Academy of Agricultural Science, Nanjing 210014 (China); Li, Fujin [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Feng, Yamin [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Shi, Liyi [College of Sciences, Shanghai University, Shanghai 200444 (China); Lin, Hongzhen, E-mail: hzlin2010@sinano.ac.cn [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China)
2016-05-15
Smart upconversion nanophosphors (UCNPs) that can be reversibly switched between two or more luminescent states by certain external stimuli have attracted considerable attention due to their great potential in biological applications. Here we report for the first time a type of redox-switchable UCNPs by codoping NaGdF{sub 4}:Yb/Er nanorods with the redox-active Ce{sup 3+}/Ce{sup 4+} ion pairs. A reversible switching of their UC luminescence intensity was observed upon the variation of the surrounding redox environments. We show solid proof that the luminescence switching is caused by the tailoring of the NaGdF{sub 4} host crystal structure in response to changing redox state of the codoped cerium ions. A proof-of-concept example is further demonstrated by using these UCNPs for probing the dynamical variation of redox environments in biological tissues. - Highlights: • Synthesis of upconversion nanoparticles doped with Ce{sup 3+}/Ce{sup 4+} ions. • The precise and reversible modification of crystal structure by redox reactions. • Tuning the upconversion luminescence by tailoring the crystal structure.
Almeida, Sandra; Zhang, Zhijun; Coppola, Giovanni; Mao, Wenjie; Futai, Kensuke; Karydas, Anna; Geschwind, Michael D.; Tartaglia, M. Carmela; Gao, Fuying; Gianni, Davide; Sena-Esteves, Miguel; Geschwind, Daniel H.; Miller, Bruce L.; Farese, Robert V.; Gao, Fen-Biao
2012-01-01
SUMMARY The pathogenic mechanisms of frontotemporal dementia (FTD) remain poorly understood. Here we generated multiple induced pluripotent stem cell (iPSC) lines from a control subject, a patient with sporadic FTD, and an FTD patient with a novel GRN mutation (PGRN S116X). In neurons and microglia differentiated from PGRN S116X iPSCs, the levels of intracellular and secreted progranulin were reduced, establishing patient-specific cellular models of progranulin haploinsufficiency. Through a systematic screen of inducers of cellular stress, we found that PGRN S116X neurons, but not sporadic FTD neurons, exhibited increased sensitivity to staurosporine and other kinase inhibitors. Moreover, the serine/threonine kinase S6K2, a component of the PI3K and MAPK pathways, was specifically downregulated in PGRN S116X neurons. Both increased sensitivity to kinase inhibitors and reduced S6K2 were rescued by progranulin expression. Our findings identify cell-autonomous, reversible defects in patient neurons with progranulin deficiency and provide a new model for studying progranulin-dependent pathogenic mechanisms and testing potential therapies. PMID:23063362
High Frequency Electromagnetic Field Induces Lipocalin 2 Expression in
Directory of Open Access Journals (Sweden)
Amaneh Mohammadi Roushandeh
2010-06-01
Full Text Available Objective(sNeutrophil gelatinase-associated lipocalin (NGAL/Lcn2, comprise a group of small extracellular proteins with a common β-sheet-dominated 3-dimensional structure. In the past, it was assumed that the predominant role of lipocalin was acting as transport proteins. Recently it has been found that oxidative stress induces Lcn2 expression. It has been also proved that electromagnetic field (EMF produces reactive oxygen species (ROS in different tissues. Expression of Lcn2 following exposure to electromagnetic field has been investigated in this study. Materials and MethodsBalb/c mice (8 weeks old were exposed to 3 mT, 50 HZ EMF for 2 months, 4 hr/day. Afterwards, the mice were sacrificed by cervical dislocation and livers were removed. The liver specimens were stained with Haematoxylin- Eosin (H&E and analyzed under an optical microscope. Total RNA was extracted from liver and reverse transcription was performed by SuperScript III reverse transcriptase with 1 µg of total RNA. Assessment of Lcn2 expression was performed by semiquantitative and real time- PCR.ResultsThe light microscopic studies revealed that the number of lymphocyte cells was increased compared to control and dilation of sinosoids was observed in the liver. Lcn2 was up-regulated in the mice exposed to EMF both in mRNA and protein levels.ConclusionTo the extent of our knowledge, this is the first report dealing with up-regulation of Lcn2 in liver after exposure to EMF. The up-regulation might be a compensatory response that involves cell defense pathways and protective effects against ROS. However, further and complementary studies are required in this regards.
HDAC inhibition induces HIV-1 protein and enables immune-based clearance following latency reversal
DEFF Research Database (Denmark)
Wu, Guoxin; Swanson, Michael; Talla, Aarthi
2017-01-01
Promising therapeutic approaches for eradicating HIV include transcriptional activation of provirus from latently infected cells using latency-reversing agents (LRAs) and immune-mediated clearance to purge reservoirs. Accurate detection of cells capable of producing viral antigens and virions......, and the measurement of clearance of infected cells, is essential to assessing therapeutic efficacy. Here, we apply enhanced methodology extending the sensitivity limits for the rapid detection of subfemtomolar HIV gag p24 capsid protein in CD4+ T cells from ART-suppressed HIV+ individuals, and we show viral protein...... induction following treatment with LRAs. Importantly, we demonstrate that clinical administration of histone deacetylase inhibitors (HDACis; vorinostat and panobinostat) induced HIV gag p24, and ex vivo stimulation produced sufficient viral antigen to elicit immune-mediated cell killing using anti-gp120/CD3...
Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors
CSIR Research Space (South Africa)
Bode, ML
2011-06-01
Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...
Directory of Open Access Journals (Sweden)
Carlton Susan M
2010-03-01
Full Text Available Abstract Background Cisplatin is primarily used for treatment of ovarian and testicular cancer. Oxaliplatin is the only effective treatment for metastatic colorectal cancer. Both are known to cause dose related, cumulative toxic effects on the peripheral nervous system and thirty to forty percent of cancer patients receiving these agents experience painful peripheral neuropathy. The mechanisms underlying painful platinum-induced neuropathy remain poorly understood. Previous studies have demonstrated important roles for TRPV1, TRPM8, and TRPA1 in inflammation and nerve injury induced pain. Results In this study, using real-time, reverse transcriptase, polymerase chain reaction (RT-PCR, we analyzed the expression of TRPV1, TRPM8, and TRPA1 induced by cisplatin or oxaliplatin in vitro and in vivo. For in vitro studies, cultured E15 rat dorsal root ganglion (DRG neurons were treated for up to 48 hours with cisplatin or oxaliplatin. For in vivo studies, trigeminal ganglia (TG were isolated from mice treated with platinum drugs for three weeks. We show that cisplatin and oxaliplatin-treated DRG neurons had significantly increased in TRPV1, TRPA1, and TRPM8 mRNA expression. TG neurons from cisplatin treated mice had significant increases in TRPV1 and TRPA1 mRNA expression while oxaliplatin strongly induced only TRPA1. Furthermore, compared to the cisplatin-treated wild-type mice, cisplatin-treated TRPV1-null mice developed mechanical allodynia but did not exhibit enhancement of noxious heat- evoked pain responses. Immunohistochemistry studies showed that cisplatin-treated mice had no change in the proportion of the TRPV1 immunopositive TG neurons. Conclusion These results indicate that TRPV1 and TRPA1 could contribute to the development of thermal hyperalgesia and mechanical allodynia following cisplatin-induced painful neuropathy but that TRPV1 has a crucial role in cisplatin-induced thermal hyperalgesia in vivo.
Energy Technology Data Exchange (ETDEWEB)
Dey, Sumit K.; Saha, Shekhar; Das, Provas; Das, Mahua R.; Jana, Siddhartha S., E-mail: bcssj@iacs.res.in
2014-08-01
3-Methylcholanthrene (3MC) induces tumor formation at the site of injection in the hind leg of mice within 110 days. Recent reports reveal that the transformation of normal muscle cells to atypical cells is one of the causes for tumor formation, however the molecular mechanism behind this process is not well understood. Here, we show in an in vitro study that 3MC induces fragmentation of multinucleate myotubes into viable mononucleates. These mononucleates form colonies when they are seeded into soft agar, indicative of cellular transformation. Immunoblot analysis reveals that phosphorylation of myosin regulatory light chain (RLC{sub 20}) is 5.6±0.5 fold reduced in 3MC treated myotubes in comparison to vehicle treated myotubes during the fragmentation of myotubes. In contrast, levels of myogenic factors such as MyoD, Myogenin and cell cycle regulators such as Cyclin D, Cyclin E1 remain unchanged as assessed by real-time PCR array and reverse transcriptase PCR analysis, respectively. Interestingly, addition of the myosin light chain kinase inhibitor, ML-7, enhances the fragmentation, whereas phosphatase inhibitor perturbs the 3MC induced fragmentation of myotubes. These results suggest that decrease in RLC{sub 20} phosphorylation may be associated with the fragmentation step of dedifferentiation. - Highlights: • 3-Methylcholanthrene induces fragmentation of C2C12-myotubes. • Dedifferentiation can be divided into two steps – fragmentation and proliferation. • Fragmentation is associated with rearrangement of nonmuscle myosin II. • Genes associated with differentiation and proliferation are not altered during fragmentation. • Phosphorylation of myosin regulatory light chain is reduced during fragmentation.
Suryavanshi, P S; Ugale, R R; Yilmazer-Hanke, D; Stairs, D J; Dravid, S M
2014-01-01
Background and Purpose Despite ample evidence supporting the N-methyl-d-aspartate receptor (NMDAR) hypofunction hypothesis of schizophrenia, progress in the development of effective therapeutics based on this hypothesis has been limited. Facilitation of NMDA receptor function by co-agonists (d-serine or glycine) only partially alleviates the symptoms in schizophrenia; other means to facilitate NMDA receptors are required. NMDA receptor sub-types differ in their subunit composition, with varied GluN2 subunits (GluN2A-GluN2D) imparting different physiological, biochemical and pharmacological properties. CIQ is a positive allosteric modulator that is selective for GluN2C/GluN2D-containing NMDA receptors (Mullasseril et al.). Experimental Approach The effect of systemic administration of CIQ was tested on impairment in prepulse inhibition (PPI), hyperlocomotion and stereotypy induced by i.p. administration of MK-801 and methamphetamine. The effect of CIQ was also tested on MK-801-induced impairment in working memory in Y-maze spontaneous alternation test. Key Results We found that systemic administration of CIQ (20 mg·kg−1, i.p.) in mice reversed MK-801 (0.15 mg·kg−1, i.p.)-induced, but not methamphetamine (3 mg·kg−1, i.p.)-induced, deficit in PPI. MK-801 increased the startle amplitude to pulse alone, which was not reversed by CIQ. In contrast, methamphetamine reduced the startle amplitude to pulse alone, which was reversed by CIQ. CIQ also partially attenuated MK-801- and methamphetamine-induced hyperlocomotion and stereotyped behaviours. Additionally, CIQ reversed the MK-801-induced working memory deficit in spontaneous alternation in a Y-maze. Conclusion and Implications Together, these results suggest that facilitation of GluN2C/GluN2D-containing receptors may serve as an important therapeutic strategy for treating positive and cognitive symptoms in schizophrenia. PMID:24236947
Medulla Oblongata Hemorrhage and Reverse Takotsubo Cardiomyopathy.
Gobeske, Kevin T; Sarano, Maurice E; Fugate, Jennifer E; Wijdicks, Eelco F
2017-12-19
Acute brain injury with strong surges of adrenergic outflow has resulted in takotsubo cardiomyopathy, but there are surprisingly few reports of takotsubo cardiomyopathy after intracranial hemorrhage, and none have been described from hemorrhage within the brainstem. We describe a patient with reverse and reversible cardiomyopathy following a hemorrhage in the lateral medulla oblongata. While it is limited in size, the location of the hemorrhage caused acute systolic failure with left ventricular ejection fraction of 27% and vasopressor requirement for cardiogenic shock and pulmonary edema. There was full recovery after 7 days. Detailed case report. Hemorrhage into medulla oblongata pressor centers may result in acute, reversible, stress-induced cardiomyopathy, affirming the adrenergic origin of this condition.
Zhang, Zhong; Li, Qiang; Liu, Fengchen; Sun, Yuqian; Zhang, Jinchao
2010-03-15
The aim of this study was to investigate the prevention of diet-induced obesity by a high safflower oil diet and adipocytic gene expression in mice. Forty 3-week-old C57BL/6 mice were randomly divided into three groups: control group (CON, 5% lard + 5% safflower oil), high lard group (LAR, 45% lard + 5% safflower oil), and high safflower oil group (SAF, 45% safflower oil + 5% lard). After 10 weeks, 10 mice of the LAR group were switched to high safflower oil diet (LAR-SAF). Ten weeks later, glucose tolerance tests were performed by intraperitoneal injection of glucose. Circulating levels of lipid and insulin were measured and white adipose tissues were taken for gene chip and reverse transcriptase-polymerase chain reaction analysis. The LAR group showed higher body weight, adiposity index, insulin, and lipids than the CON group (P<0.05). The body weight in the LAR-SAF group decreased after dietary reversal. The plasma biochemical profiles decreased in the LAR-SAF and SAF groups (P<0.05) compared with those of the LAR group. The blood glucose level of the LAR-SAF group was reduced during intraperitoneal glucose tolerance test compared with that of the LAR group. The LAR-SAF group had lower levels of Orexin and Ghrelin gene expression, whereas the level of PPARalpha gene expression was significantly enhanced compared with that of the LAR group. So, the SAF diet can alter adipocytic adiposity-related gene expression and result in effective amelioration of diet-induced obesity.
Müllers, Erik; Uhlig, Tobias; Stirnnagel, Kristin; Fiebig, Uwe; Zentgraf, Hanswalter; Lindemann, Dirk
2011-02-01
Prototype foamy virus (PFV) Gag lacks the characteristic orthoretroviral Cys-His motifs that are essential for various steps of the orthoretroviral replication cycle, such as RNA packaging, reverse transcription, infectivity, integration, and viral assembly. Instead, it contains three glycine-arginine-rich boxes (GR boxes) in its C terminus that putatively represent a functional equivalent. We used a four-plasmid replication-deficient PFV vector system, with uncoupled RNA genome packaging and structural protein translation, to analyze the effects of deletion and various substitution mutations within each GR box on particle release, particle-associated protein composition, RNA packaging, DNA content, infectivity, particle morphology, and intracellular localization. The degree of viral particle release by all mutants was similar to that of the wild type. Only minimal effects on Pol encapsidation, exogenous reverse transcriptase (RT) activity, and genomic viral RNA packaging were observed. In contrast, particle-associated DNA content and infectivity were drastically reduced for all deletion mutants and were undetectable for all alanine substitution mutants. Furthermore, GR box I mutants had significant changes in particle morphology, and GR box II mutants lacked the typical nuclear localization pattern of PFV Gag. Finally, it could be shown that GR boxes I and III, but not GR box II, can functionally complement each other. It therefore appears that, similar to the orthoretroviral Cys-His motifs, the PFV Gag GR boxes are important for RNA encapsidation, genome reverse transcription, and virion infectivity as well as for particle morphogenesis.
2013-01-01
Background Prepubertal gynecomastia is a rare condition and most frequently classified as idiopathic. In HIV-infected adults gynecomastia is a recognised but infrequent side-effect of antiretroviral treatment (ART) and mostly attributed to efavirenz use. Gynecomastia should be distinguished from pseudogynecomastia as part of the lipodystrophy syndrome caused by Nucleoside Reverse Transcriptase Inhibitors (NRTIs) to avoid incorrect substitution of drugs. In the medical literature only five cases of prepubertal gynecomastia in children taking ART are described and underlying pathogenesis was unknown. The occurrence of adverse effects of ART may interfere with therapy adherence and long-term prognosis and for that reason requires attention. We report the first case of prepubertal gynecomastia in a young girl attributed to efavirenz use. Case presentation A seven-year-old African girl presented with true gynecomastia four months after initiation on ART (abacavir, lamivudine, efavirenz). History, physical examination and laboratory tests excluded known causes of gynecomastia and efavirenz was considered as the most likely cause. Six weeks after withdrawal of efavirenz the breast enlargement had completely resolved. Conclusions Efavirenz-induced gynecomastia may occur in children as well as in adults. With the increasing access to ART, the possibility of efavirenz-exposure and the potential occurrence of its associated side-effects may be high. In resource-poor settings, empirical change from efavirenz to nevirapine may be considered, providing no other known or alarming cause is identified, as efavirenz-induced gynecomastia can resolve quickly after withdrawal of the drug. Timely recognition of gynecomastia as a side-effect of efavirenz is important in order to intervene while the condition may still be reversible, to sustain adherence to ART and to maintain the sociopsychological health of the child. PMID:23941256
Liver fibrosis in mice induced by carbon tetrachloride and its reversion by luteolin
International Nuclear Information System (INIS)
Domitrovic, Robert; Jakovac, Hrvoje; Tomac, Jelena; Sain, Ivana
2009-01-01
Hepatic fibrosis is effusive wound healing process in which excessive connective tissue builds up in the liver. Because specific treatments to stop progressive fibrosis of the liver are not available, we have investigated the effects of luteolin on carbon tetrachloride (CCl 4 )-induced hepatic fibrosis. Male Balb/C mice were treated with CCl 4 (0.4 ml/kg) intraperitoneally (i.p.), twice a week for 6 weeks. Luteolin was administered i.p. once daily for next 2 weeks, in doses of 10, 25, and 50 mg/kg of body weight. The CCl 4 control group has been observed for spontaneous reversion of fibrosis. CCl 4 -intoxication increased serum aminotransferase and alkaline phosphatase levels and disturbed hepatic antioxidative status. Most of these parameters were spontaneously normalized in the CCl 4 control group, although the progression of liver fibrosis was observed histologically. Luteolin treatment has increased hepatic matrix metalloproteinase-9 levels and metallothionein (MT) I/II expression, eliminated fibrinous deposits and restored architecture of the liver in a dose-dependent manner. Concomitantly, the expression of glial fibrillary acidic protein and α-smooth muscle actin indicated deactivation of hepatic stellate cells. Our results suggest the therapeutic effects of luteolin on CCl 4 -induced liver fibrosis by promoting extracellular matrix degradation in the fibrotic liver tissue and the strong enhancement of hepatic regenerative capability, with MTs as a critical mediator of liver regeneration.
The macrophage scavenger receptor CD163
DEFF Research Database (Denmark)
Nielsen, Marianne Jensby; Madsen, Mette; Møller, Holger J
2006-01-01
CD163 is the monocyte/macrophage-specific receptor for haptoglobin-hemoglobin (Hp-Hb) complexes. The cytoplasmic tail of human CD163 exists as a short tail variant and two long tail variants. Reverse transcriptase-polymerase chain reaction analysis indicated that all three CD163 variants are subs......CD163 is the monocyte/macrophage-specific receptor for haptoglobin-hemoglobin (Hp-Hb) complexes. The cytoplasmic tail of human CD163 exists as a short tail variant and two long tail variants. Reverse transcriptase-polymerase chain reaction analysis indicated that all three CD163 variants...
DEFF Research Database (Denmark)
Uhrbrand, Katrine; Myrmel, Mette; Maunula, Leena
2010-01-01
Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently to evalu......Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently...
Nakatsu, Daiki; Horiuchi, Yuta; Kano, Fumi; Noguchi, Yoshiyuki; Sugawara, Taichi; Takamoto, Iseki; Kubota, Naoto; Kadowaki, Takashi; Murata, Masayuki
2015-03-10
Increase in the concentration of plasma L-cysteine is closely associated with defective insulin secretion from pancreatic β-cells, which results in type 2 diabetes (T2D). In this study, we investigated the effects of prolonged L-cysteine treatment on glucose-stimulated insulin secretion (GSIS) from mouse insulinoma 6 (MIN6) cells and from mouse pancreatic islets, and found that the treatment reversibly inhibited glucose-induced ATP production and resulting GSIS without affecting proinsulin and insulin synthesis. Comprehensive metabolic analyses using capillary electrophoresis time-of-flight mass spectrometry showed that prolonged L-cysteine treatment decreased the levels of pyruvate and its downstream metabolites. In addition, methyl pyruvate, a membrane-permeable form of pyruvate, rescued L-cysteine-induced inhibition of GSIS. Based on these results, we found that both in vitro and in MIN6 cells, L-cysteine specifically inhibited the activity of pyruvate kinase muscle isoform 2 (PKM2), an isoform of pyruvate kinases that catalyze the conversion of phosphoenolpyruvate to pyruvate. L-cysteine also induced PKM2 subunit dissociation (tetramers to dimers/monomers) in cells, which resulted in impaired glucose-induced ATP production for GSIS. DASA-10 (NCGC00181061, a substituted N,N'-diarylsulfonamide), a specific activator for PKM2, restored the tetramer formation and the activity of PKM2, glucose-induced ATP production, and biphasic insulin secretion in L-cysteine-treated cells. Collectively, our results demonstrate that impaired insulin secretion due to exposure to L-cysteine resulted from its direct binding and inactivation of PKM2 and suggest that PKM2 is a potential therapeutic target for T2D.
Shen, Ji-Duo; Wei, Yu; Li, Yu-Jie; Qiao, Jing-Yi; Li, Yu-Cheng
2017-08-01
Increasing evidence has demonstrated that patients with depression have a higher risk of developing type 2 diabetes. Insulin resistance has been identified as the key mechanism linking depression and diabetes. The present study established a rat model of depression complicated by insulin resistance using a 12-week exposure to chronic mild stress (CMS) and investigated the therapeutic effects of curcumin. Sucrose intake tests were used to evaluate depressive-like behaviors, and oral glucose tolerance tests (OGTT) and intraperitoneal insulin tolerance tests (IPITT) were performed to evaluate insulin sensitivity. Serum parameters were detected using commercial kits. Real-time quantitative PCR was used to examine mRNA expression. CMS rats exhibited reduced sucrose consumption, increased serum glucose, insulin, triglyceride (TG), low density lipoprotein-cholesterol (LDL-C), non-esterified fatty acid (NEFA), glucagon, leptin, and corticosterone levels, as well as impaired insulin sensitivity. Curcumin upregulated the phosphorylation of insulin receptor substrate (IRS)-1 and protein kinase B (Akt) in the liver, enhanced insulin sensitivity, and reversed the metabolic abnormalities and depressive-like behaviors mentioned above. Moreover, curcumin increased the hepatic glycogen content by inhibiting glycogen synthase kinase (GSK)-3β and prevented gluconeogenesis by inhibiting phosphoenolpyruvate carboxykinase (PEPCK) and glucose 6-phosphatase (G6Pase). These results suggest that curcumin not only exerted antidepressant-like effects, but also reversed the insulin resistance and metabolic abnormalities induced by CMS. These data may provide evidence to support the potential use of curcumin against depression and/or metabolic disorders.
Directory of Open Access Journals (Sweden)
Rutian Li
Full Text Available AIMS: The extracellular pH of cancer cells is lower than the intracellular pH. Weakly basic anticancer drugs will be protonated extracellularly and display a decreased intracellular concentration. In this study, we show that copolymeric nanoparticles (NPs are able to overcome this "pH-induced physiological drug resistance" (PIPDR by delivering drugs to the cancer cells via endocytosis rather than passive diffussion. MATERIALS AND METHODS: As a model nanoparticle, Tetradrine (Tet, Pka 7.80 was incorporated into mPEG-PCL. The effectiveness of free Tet and Tet-NPs were compared at different extracellular pHs (pH values 6.8 and 7.4, respectively by MTT assay, morphological observation and apoptotic analysis in vitro and on a murine model by tumor volume measurement, PET-CT scanning and side effect evaluation in vivo. RESULTS: The cytotoxicity of free Tet decreased prominently (P<0.05 when the extracellular pH decreased from 7.4 to 6.8. Meanwhile, the cytotoxicity of Tet-NPs was not significantly influenced by reduced pH. In vivo experiment also revealed that Tet-NPs reversed PIPDR more effectively than other existing methods and with much less side effects. CONCLUSION: The reversion of PIPDR is a new discovered mechanism of copolymeric NPs. This study emphasized the importance of cancer microenvironmental factors in anticancer drug resistance and revealed the superiority of nanoscale drug carrier from a different aspect.
Reverse 201Tl myocardial redistribution induced by coronary artery spasm
International Nuclear Information System (INIS)
Xiang Dingcheng; Yin Jilin; Gong Zhihua; Xie Zhenhong; Zhang Jinhe; Wen Yanfei; Yi Shaodong
2010-01-01
Objective: To investigate the mechanism of reverse redistribution (RR) on dipyridamole 201 Tl myocardial perfusion studies in the patients with coronary artery spasm. Methods: Twenty-six patients with coronary artery spasm and presented as RR on dipyridamole 201 Tl myocardial perfusion studies were enlisted as RR group, while other 16 patients with no coronary artery stenosis nor RR were enlisted as control group. Dipyridamole test was repeated during coronary angiography. Corrected thrombolysis in myocardial infarction (TIMI) frame count (CTFC) and TIMI myocardial perfusion grade (TMPG) were measured at RR related and non-RR related coronary arteries before and after dipyridamole infusion respectively. All of the data were analyzed by Student's t-test or χ 2 -test and correlation analysis. Results: Coronary artery angiography showed slower blood flow and lower myocardial perfusion in RR related vessels when compared with non-RR related vessels in RR group, but there was no significant difference among the main coronary arteries in control group. The perfusion defects of RR area at rest were positively related to slower blood velocity at corresponding coronary arteries (r = 0.79, t =10.18, P 0.05). Conclusion: RR is related to the decreased blood flow and myocardial perfusion induced by coronary artery spasm at rest, which may be improved by stress test such as intravenous dipyridamole infusion. (authors)
Probenazole treatment inhibits anthocyanins biosynthesis via ...
African Journals Online (AJOL)
ELO
2012-01-05
Jan 5, 2012 ... State Key Laboratory of Genetic Engineering and Institute of Plant Biology, School of Life .... was reverse-transcribed with SuperScript reverse transcriptase ..... treated plant have more drought and salt stress tolerance.