Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase.

Science.gov (United States)

Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano

2017-01-17

Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

Reverse transcriptase inhibitors as microbicides.

Science.gov (United States)

Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido

2012-01-01

The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

Directory of Open Access Journals (Sweden)

Edward J. Steele

2017-11-01

Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

Science.gov (United States)

Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

2016-01-01

Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

Science.gov (United States)

Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

2002-12-01

Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

Science.gov (United States)

Zanetti, Maurizio

2017-02-01

Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

Science.gov (United States)

Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

2016-06-01

Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

Science.gov (United States)

Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

2015-10-01

Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

Science.gov (United States)

Zhao, Chen; Pyle, Anna Marie

2017-12-01

The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

Directory of Open Access Journals (Sweden)

Dolores Bautista-España

Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

Science.gov (United States)

Collins, Kathleen; Nilsen, Timothy W

2013-08-01

Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

Science.gov (United States)

Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

1972-01-01

Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

Directory of Open Access Journals (Sweden)

Ajay Kumar

2010-01-01

Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

Science.gov (United States)

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

International Nuclear Information System (INIS)

Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

2011-01-01

LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

Directory of Open Access Journals (Sweden)

Anna Figueiredo

2006-11-01

Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

Directory of Open Access Journals (Sweden)

Yong Teng

2014-02-01

Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

2010-03-26

The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2009-07-01

HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

Science.gov (United States)

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

International Nuclear Information System (INIS)

Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

2004-01-01

Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

2013-11-01

Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

DEFF Research Database (Denmark)

Lundgren, Jens

2008-01-01

BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

OpenAIRE

DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

2012-01-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

Science.gov (United States)

Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

2018-01-02

The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

Directory of Open Access Journals (Sweden)

Oluwafeyisetan O. Adebiyi

2015-12-01

Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

International Nuclear Information System (INIS)

Zhu Hanneng; Chen Wenying; Xiong Sidong

2000-01-01

Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

NARCIS (Netherlands)

Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

2013-01-01

The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

Science.gov (United States)

Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

2016-04-01

Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma

OpenAIRE

Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

2018-01-01

Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

Energy Technology Data Exchange (ETDEWEB)

Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

2011-12-08

RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

NARCIS (Netherlands)

R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)

2013-01-01

textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

DEFF Research Database (Denmark)

Borges, Álvaro H; Lundh, Andreas; Tendal, Britta

2016-01-01

BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M

2018-01-01

Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

Reverse transcriptase inhibitors as potential colorectal microbicides.

Science.gov (United States)

Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

2009-05-01

We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

Science.gov (United States)

Sivan, Sree Kanth; Manga, Vijjulatha

2010-06-01

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

NARCIS (Netherlands)

Oude Essink, B. B.; Das, A. T.; Berkhout, B.

1995-01-01

Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

DEFF Research Database (Denmark)

Kirk, Ole; Lundgren, Jens D; Pedersen, Court

2003-01-01

BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.

Science.gov (United States)

Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V

2011-12-20

Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

Directory of Open Access Journals (Sweden)

Elisabeth Humphris-Narayanan

Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

Science.gov (United States)

Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

2008-10-01

Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

Science.gov (United States)

Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

2013-10-01

High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

NMR structure of the HIV-1 reverse transcriptase thumb subdomain

Energy Technology Data Exchange (ETDEWEB)

Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

2016-12-15

The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

NARCIS (Netherlands)

Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

2004-01-01

Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

Science.gov (United States)

Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

2017-02-01

Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

OpenAIRE

Nicolas Sluis-Cremer

2014-01-01

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

Apoptosis and reduced cell proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA.

Science.gov (United States)

Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin

2010-01-01

The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.

Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A.

Science.gov (United States)

Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong

2007-06-30

Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

Science.gov (United States)

Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

2009-01-01

We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

International Nuclear Information System (INIS)

Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

1999-01-01

We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

Science.gov (United States)

Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

2016-01-01

Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

Nicolas Sluis-Cremer

2013-11-01

Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

International Nuclear Information System (INIS)

Starnes, M.C.

1988-01-01

2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

Directory of Open Access Journals (Sweden)

Ilaria eSciamanna

2016-02-01

Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

Science.gov (United States)

Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

2016-02-01

In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

Science.gov (United States)

Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

2018-05-03

Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.

Science.gov (United States)

Sharma, Mamta; Saravolatz, Louis D

2013-02-01

Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

NARCIS (Netherlands)

Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,

2015-01-01

BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

NARCIS (Netherlands)

Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.

2015-01-01

BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage.

Science.gov (United States)

Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X

2014-07-01

Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2010-03-01

Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

NARCIS (Netherlands)

Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

2010-01-01

Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

Directory of Open Access Journals (Sweden)

Lucianna Helene Santos

2015-11-01

Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

Hypoxia induces telomerase reverse transcriptase (TERT gene expression in non-tumor fish tissues in vivo: the marine medaka (Oryzias melastigma model

Directory of Open Access Journals (Sweden)

Mok Helen OL

2006-09-01

Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This

A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

Science.gov (United States)

Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

2015-08-01

The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

Science.gov (United States)

Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

2013-06-18

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

NARCIS (Netherlands)

Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

2011-01-01

The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

International Nuclear Information System (INIS)

Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong

2007-01-01

The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation

In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

Energy Technology Data Exchange (ETDEWEB)

Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn

2007-04-06

The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.

Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

OpenAIRE

Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

2008-01-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

Directory of Open Access Journals (Sweden)

Ma Bi

2017-10-01

Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

Czech Academy of Sciences Publication Activity Database

Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

2016-01-01

Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

2011-01-01

We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

Science.gov (United States)

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

Science.gov (United States)

Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

2009-06-01

Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

Directory of Open Access Journals (Sweden)

Stefanou Nikolaos

2010-08-01

Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

International Nuclear Information System (INIS)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

2015-01-01

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

Energy Technology Data Exchange (ETDEWEB)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

2015-10-23

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

Expression of human telomerase reverse transcriptase protein in oral epithelial dysplasia and oral squamous cell carcinoma: An immunohistochemical study

Science.gov (United States)

Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao

2016-01-01

Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were

APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

Directory of Open Access Journals (Sweden)

Weizi Liang

Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss.

Science.gov (United States)

Zhu, Tao; Niu, Deng-Ke

2013-03-05

Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.

An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

DEFF Research Database (Denmark)

Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

2004-01-01

Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

Directory of Open Access Journals (Sweden)

Lapadula Giuseppe

2007-05-01

Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

Science.gov (United States)

Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

2000-05-18

To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

Science.gov (United States)

Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

2014-04-01

A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats

Science.gov (United States)

Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin

2011-01-01

In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice.

Science.gov (United States)

Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue

2013-05-01

To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

International Nuclear Information System (INIS)

Ferkous, F.; Saihi, Y.

2018-01-01

Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

NARCIS (Netherlands)

I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

2015-01-01

textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

Science.gov (United States)

Wang, Shuwen; Zhu, Jiyue

2003-05-23

The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

Science.gov (United States)

Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

2004-01-01

The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

Science.gov (United States)

A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali

2015-11-27

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

2015-01-01

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

Directory of Open Access Journals (Sweden)

Isabel Hostettler

2014-12-01

Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

Telomerase reverse transcriptase promoter mutations in bladder cancer

DEFF Research Database (Denmark)

Allory, Yves; Beukers, Willemien; Sagrera, Ana

2014-01-01

for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...

The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

Directory of Open Access Journals (Sweden)

Gronenborn Angela M

2010-05-01

Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

Science.gov (United States)

Tarasova, O A; Filimonov, D A; Poroikov, V V

2017-10-01

Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2009-11-01

Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations.

Science.gov (United States)

Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark

2013-11-01

BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

Science.gov (United States)

Schuster, W; Brennicke, A

1987-01-01

We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

Directory of Open Access Journals (Sweden)

Marcin Kierczak

2009-10-01

Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

Directory of Open Access Journals (Sweden)

Madeleine Zerbato

Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

Science.gov (United States)

Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

2011-02-01

Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

OpenAIRE

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-01-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

DEFF Research Database (Denmark)

Fox, Zoe; Phillips, Andrew; Cohen, Cal

2008-01-01

the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

Directory of Open Access Journals (Sweden)

Niu Meijuan

2004-10-01

Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

Reverse transcriptase directs viral evolution in a deep ocean methane seep

Science.gov (United States)

Paul, B. G.; Bagby, S. C.

2013-12-01

Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors.

Science.gov (United States)

Sluis-Cremer, Nicolas

2014-07-31

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme

Science.gov (United States)

Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni

2005-01-01

Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

Science.gov (United States)

Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

2012-08-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.

Science.gov (United States)

Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

2018-01-01

Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

Directory of Open Access Journals (Sweden)

Warrilow David

2008-12-01

Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

Unique case of oligoastrocytoma with recurrence and grade progression: Exhibiting differential expression of high mobility group-A1 and human telomerase reverse transcriptase

Science.gov (United States)

Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni

2016-01-01

Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647

A novel peptide-nucleotide dual vaccine of human telomerase reverse transcriptase induces a potent cytotoxic T-cell response in vivo

International Nuclear Information System (INIS)

Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun

2007-01-01

Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers

A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

OpenAIRE

Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

2015-01-01

Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

Nicolas Sluis-Cremer

2014-07-01

Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

Extensive Mutagenesis of the Conserved Box E Motif in Duck Hepatitis B Virus P Protein Reveals Multiple Functions in Replication and a Common Structure with the Primer Grip in HIV-1 Reverse Transcriptase

OpenAIRE

Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael

2012-01-01

Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...

Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy.

Science.gov (United States)

Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N

2005-05-01

To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.

Resveratrol reverses morphine-induced neuroinflammation in morphine-tolerant rats by reversal HDAC1 expression

Directory of Open Access Journals (Sweden)

Ru-Yin Tsai

2016-06-01

Conclusion: Resveratrol restores the antinociceptive effect of morphine by reversing morphine infusion-induced spinal cord neuroinflammation and increase in TNFR1 expression. The reversal of the morphine-induced increase in TNFR1 expression by resveratrol is partially due to reversal of the morphine infusion-induced increase in HDAC1 expression. Resveratrol pretreatment can be used as an adjuvant in clinical pain management for patients who need long-term morphine treatment or with neuropathic pain.

A trypsin inhibitor from rambutan seeds with antitumor, anti-HIV-1 reverse transcriptase, and nitric oxide-inducing properties.

Science.gov (United States)

Fang, Evandro Fei; Ng, Tzi Bun

2015-04-01

Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.

Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

Science.gov (United States)

Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

2007-10-01

Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

S. Ganguly

2008-01-01

Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

Structural optimization of N1-aryl-benzimidazoles for the discovery of new non-nucleoside reverse transcriptase inhibitors active against wild-type and mutant HIV-1 strains.

Science.gov (United States)

Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania

2018-02-01

Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.

Science.gov (United States)

Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M

2017-12-01

Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

OpenAIRE

Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

2014-01-01

The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

Science.gov (United States)

Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

2017-07-11

Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

The reverse transcription inhibitor abacavir shows anticancer activity in prostate cancer cell lines.

Directory of Open Access Journals (Sweden)

Francesca Carlini

Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.

Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

Science.gov (United States)

Ngai, Patrick H K; Ng, T B

2003-11-14

From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity.

Science.gov (United States)

Li, An; Ziehr, Jessica L; Johnson, Kenneth A

2017-04-21

Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

DEFF Research Database (Denmark)

Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy

2011-01-01

Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...

The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family.

Science.gov (United States)

Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong

2012-01-01

1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

Science.gov (United States)

Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

2016-09-30

We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor.

Science.gov (United States)

Markowitz, Martin; Sarafianos, Stefan G

2018-07-01

4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India.

Science.gov (United States)

Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami

2017-06-01

We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

Science.gov (United States)

Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

2012-04-01

The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

ST6Gal1, Cox-2 and HB-EGF mRNA Expression in Breast Cancer

Directory of Open Access Journals (Sweden)

Aliakbar Taherian

2015-01-01

Full Text Available Background: ST6Gal1, Cox-2 and HB-EGF genes are involved in different tumors and their enhanced expressions often correlate with poor prognosis. In this study we assay the expressions of these genes by reverse transcriptase-PCR in 54 breast cancer samples. Methods: Tissue samples were either formalin-fixed for histopathological examination or frozen for reverse transcriptase-PCR. Image program was used for the densitometry of the image of the gels and the expression of different genes was normalized with beta actin expression. The student's t-test and correlation matrix were used for data analyses. Results: We observed significantly higher expressions of ST6Gal1 (P= 0.040, Cox- 2 (P= 0.001 and HB-EGF (P= 0.009 in the tumor region compared to the margin samples. A significant correlation was found between HB-EGF and Cox-2 expression (P= 0.001. There was a positive correlation between total score, tumor size, histology grade and nuclear grade but there was a reverse correlation between age and tumor size, histology grade and total score. Conclusion: Expressions of ST6Gal1, Cox-2 and HB-EGF in breast tumor samples in this and a number of other studies emphasize their role as important markers in breast cancer. The use of medications to inhibit either their individual expressions or the possible inhibition of all three genes may improve patient survival and prevent metastasis.

Molecular cloning of Kuruma shrimp Marsupenaeus japonicus endonuclease-reverse transcriptase and its positive role in white spot syndrome virus and Vibrio alginolyticus infection.

Science.gov (United States)

Ma, Xiongchao; Sun, Baozhen; Zhu, Fei

2018-02-01

This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.

Molecular docking of (5E)-3-(2-aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione on HIV-1 reverse transcriptase: novel drug acting on enzyme.

Science.gov (United States)

Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan

2012-01-01

The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.

Pharmacokinetics and tolerability of the new second-generation nonnucleoside reverse- transcriptase inhibitor KM-023 in healthy subjects

Directory of Open Access Journals (Sweden)

Cha YJ

2014-09-01

Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600

Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

International Nuclear Information System (INIS)

Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin

2008-01-01

Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

Science.gov (United States)

Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

2016-05-01

Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) using pre-steady-state kinetics.

Science.gov (United States)

Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S

2014-06-01

The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.

In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection.

Science.gov (United States)

Giacobbi, Nicholas S; Sluis-Cremer, Nicolas

2017-07-01

Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.

Comparison of single and boosted protease inhibitor versus nonnucleoside reverse transcriptase inhibitor-containing cART regimens in antiretroviral-naïve patients starting cART after January 1, 2000

DEFF Research Database (Denmark)

Mocroft, A; Horban, A; Clumeck, N

2006-01-01

increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Probing the communication of deoxythymidine triphosphate in HIV-1 reverse transcriptase by communication maps and interaction energy studies.

Science.gov (United States)

Gnanasekaran, Ramachandran

2017-11-08

We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

Science.gov (United States)

Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

2014-01-01

The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447

Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

Science.gov (United States)

Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

2016-05-01

Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer.

Directory of Open Access Journals (Sweden)

Lin Bai

Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.

Etravirine and rilpivirine resistance in HIV-1 subtype CRF01_AE-infected adults failing non-nucleoside reverse transcriptase inhibitor-based regimens.

Science.gov (United States)

Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat

2011-01-01

We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.

The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients

Science.gov (United States)

Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita

2018-01-01

Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

Expression of NAD(P)H quinone dehydrogenase 1 (NQO1) is increased in the endometrium of women with endometrial cancer and women with polycystic ovary syndrome

DEFF Research Database (Denmark)

Atiomo, William; Shafiee, Mohamad Nasir; Chapman, Caroline

2017-01-01

of differentially expressed genes identified by RNA sequencing, including NAD(P)H quinone dehydrogenase 1 (NQO1), was validated by quantitative reverse transcriptase PCR validation (n = 76) and in the cancer genome atlas UCEC (uterine corpus endometrioid carcinoma) RNA sequencing data set (n = 381). The expression...

Immortalization of Human Fetal Hepatocyte by Ectopic Expression of Human Telomerase Reverse Transcriptase, Human Papilloma Virus (E7) and Simian Virus 40 Large T (SV40 T) Antigen Towards Bioartificial Liver Support.

Science.gov (United States)

Giri, Shibashish; Bader, Augustinus

2014-09-01

Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a

Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

Science.gov (United States)

Mo, Yiqun; Wan, Rong; Zhang, Qunwei

2012-01-01

Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

Inhibition of human immunodeficiency virus type 1 infection by the candidate microbicide dapivirine, a nonnucleoside reverse transcriptase inhibitor.

Science.gov (United States)

Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R

2009-02-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.

Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

Science.gov (United States)

Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

2009-01-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331

MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

Directory of Open Access Journals (Sweden)

Ammad Ahmad Farooqi

2018-04-01

Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.

Science.gov (United States)

Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D

2006-11-15

TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial.

Science.gov (United States)

Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H

2015-12-15

Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

Active methamphetamine use is associated with transmitted drug resistance to non-nucleoside reverse transcriptase inhibitors in individuals with HIV infection of unknown duration.

Science.gov (United States)

Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M

2007-01-01

Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.

A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

International Nuclear Information System (INIS)

Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key

2016-01-01

Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

Energy Technology Data Exchange (ETDEWEB)

Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)

2016-08-26

Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

Science.gov (United States)

Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

2017-06-16

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

[The efficacy of autocatalytic casapse-3 driven by human telomerase reverse transcriptase promoter on human ovarian carcinoma].

Science.gov (United States)

Song, Yue; Shen, Keng; Yu, Jing-rong

2007-11-06

To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase

Evaluation of estrogen receptor alpha and beta and progesterone receptor expression and correlation with clinicopathologic factors and proliferative marker Ki-67 in breast cancers

DEFF Research Database (Denmark)

Rosa, Fabíola E; Caldeira, José R F; Felipes, Joice

2008-01-01

To elucidate the molecular profile of hormonal steroid receptor status, we analyzed ER-alpha, ER-beta, and PGR mRNA and protein expression in 80 breast carcinomas using reverse transcriptase polymerase chain reaction (RT-PCR), quantitative RT-PCR, and immunohistochemical analysis. Qualitative ana...

Active Methamphetamine Use is Associated with Transmitted Drug Resis-tance to Non-Nucleoside Reverse Transcriptase Inhibitors in Individuals with HIV Infection of Unknown Duration

Science.gov (United States)

Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M

2007-01-01

Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691

Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission.

Science.gov (United States)

Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido

2013-09-01

Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

Molecular Docking Studies of Marine Diterpenes as Inhibitors of Wild-Type and Mutants HIV-1 Reverse Transcriptase

Directory of Open Access Journals (Sweden)

Alessandra M. T. de Souza

2013-10-01

Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.

Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

Science.gov (United States)

Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

2010-12-12

Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients enrolled in the D:A:D study: a multi-cohort collaboration

DEFF Research Database (Denmark)

Sabin, Caroline A; Worm, Signe W; Weber, Rainer

2008-01-01

cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...

Increased IL-10 mRNA and IL-23 mRNA expression in multiple sclerosis: interferon-beta treatment increases IL-10 mRNA expression while reducing IL-23 mRNA expression

DEFF Research Database (Denmark)

Krakauer, M.; Sorensen, P.; Khademi, M.

2008-01-01

volunteers served to confirm initial findings. mRNA was analyzed by real-time reverse transcriptase polymerase chain reaction (PCR). RESULTS: We found elevated expression of interleukin (IL)-23 and IL-10 in untreated MS patients. IFN-beta therapy increased IL-10 and decreased IL-23 expression independently...... of the regulatory cytokine IL-10. The elevated IL-23 mRNA levels in MS patients are noteworthy in view of the newly discovered IL-23-driven Th17 T-cell subset, which is crucial in animal models of MS. Since IFN-beta therapy resulted in decreased IL-23 mRNA levels, the Th17 axis could be another target of IFN...

Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

Science.gov (United States)

Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

2013-12-23

At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

Directory of Open Access Journals (Sweden)

Meytal Galilee

2018-01-01

Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

Identification of transcription-factor genes expressed in the Arabidopsis female gametophyte

Directory of Open Access Journals (Sweden)

Kang Il-Ho

2010-06-01

Full Text Available Abstract Background In flowering plants, the female gametophyte is typically a seven-celled structure with four cell types: the egg cell, the central cell, the synergid cells, and the antipodal cells. These cells perform essential functions required for double fertilization and early seed development. Differentiation of these distinct cell types likely involves coordinated changes in gene expression regulated by transcription factors. Therefore, understanding female gametophyte cell differentiation and function will require dissection of the gene regulatory networks operating in each of the cell types. These efforts have been hampered because few transcription factor genes expressed in the female gametophyte have been identified. To identify such genes, we undertook a large-scale differential expression screen followed by promoter-fusion analysis to detect transcription-factor genes transcribed in the Arabidopsis female gametophyte. Results Using quantitative reverse-transcriptase PCR, we analyzed 1,482 Arabidopsis transcription-factor genes and identified 26 genes exhibiting reduced mRNA levels in determinate infertile 1 mutant ovaries, which lack female gametophytes, relative to ovaries containing female gametophytes. Spatial patterns of gene transcription within the mature female gametophyte were identified for 17 transcription-factor genes using promoter-fusion analysis. Of these, ten genes were predominantly expressed in a single cell type of the female gametophyte including the egg cell, central cell and the antipodal cells whereas the remaining seven genes were expressed in two or more cell types. After fertilization, 12 genes were transcriptionally active in the developing embryo and/or endosperm. Conclusions We have shown that our quantitative reverse-transcriptase PCR differential-expression screen is sufficiently sensitive to detect transcription-factor genes transcribed in the female gametophyte. Most of the genes identified in this

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.

Science.gov (United States)

Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang

2017-12-01

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

Science.gov (United States)

Spackman, Erica; Suarez, David L

2005-01-01

Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

International Nuclear Information System (INIS)

Freeman-Wittig, M.J.B.

1986-01-01

The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

Directory of Open Access Journals (Sweden)

Rami Kantor

2005-04-01

Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

Histamine H1 receptors are expressed in mouse and frog semicircular canal sensory epithelia.

Science.gov (United States)

Botta, Laura; Tritto, Simona; Perin, Paola; Laforenza, Umberto; Gastaldi, Giulia; Zampini, Valeria; Zucca, Gianpiero; Valli, Stefano; Masetto, Sergio; Valli, Paolo

2008-03-05

Histamine-related drugs are commonly used in the treatment of vertigo and related vestibular disorders. Their site and mechanism of action, however, are still poorly understood. To increase our knowledge of the histaminergic system in the vestibular organs, we have investigated the expression of H1 and H3 histamine receptors in the frog and mouse semicircular canal sensory epithelia. Analysis was performed by mRNA reverse transcriptase-PCR, immunoblotting and immunocytochemistry experiments. Our data show that both frog and mouse vestibular epithelia express H1 receptors. Conversely no clear evidence for H3 receptors expression was found.

Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

Science.gov (United States)

Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

1998-08-01

An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

Structural and Preclinical Studies of Computationally Designed Non-Nucleoside Reverse Transcriptase Inhibitors for Treating HIV infection

Energy Technology Data Exchange (ETDEWEB)

Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.

2017-02-06

The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.

On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

Directory of Open Access Journals (Sweden)

Sukrit Silas

2017-07-01

Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

Energy Technology Data Exchange (ETDEWEB)

Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)

2017-12-15

Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

Discovery of dapivirine, a nonnucleoside HIV-1 reverse transcriptase inhibitor, as a broad-spectrum antiviral against both influenza A and B viruses.

Science.gov (United States)

Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun

2017-09-01

The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.

Telomerase reverse transcriptase locus polymorphisms and cancer risk: a field synopsis and meta-analysis.

Science.gov (United States)

Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato

2012-06-06

Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic

Tetrahymena telomerase protein p65 induces conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse transcriptase and TER assembly mutants.

Science.gov (United States)

Berman, Andrea J; Gooding, Anne R; Cech, Thomas R

2010-10-01

The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.

Risk Factors for Incident Diabetes in a Cohort Taking First-Line Nonnucleoside Reverse Transcriptase Inhibitor-Based Antiretroviral Therapy.

Science.gov (United States)

Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen

2016-03-01

Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.

Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility.

Science.gov (United States)

Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W

2012-05-01

Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

Science.gov (United States)

Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

2017-11-08

The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

Porcine UCHL1: genomic organization, chromosome localization and expression analysis

DEFF Research Database (Denmark)

Larsen, Knud; Madsen, Lone Bruhn; Bendixen, Christian

2012-01-01

to and protection from Parkinson’s disease. Here we report cloning, characterization, expression analysis and mapping of porcine UCHL1. The UCHL1 cDNA was amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using oligonucleotide primers derived from in silico sequences. The porcine cDNA codes...... in developing porcine embryos. UCHL1 transcript was detected as early as 40 days of gestation. A significant decrease in UCHL1 transcript was detected in basal ganglia from day 60 to day 115 of gestation...

Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

Science.gov (United States)

Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

2017-02-01

Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

From reverse transcription to human brain tumors

Directory of Open Access Journals (Sweden)

Dmitrenko V. V.

2013-05-01

Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line

Selective suppression of autocatalytic caspase-3 driven by two-step transcriptional amplified human telomerase reverse transcriptase promoter on ovarian carcinoma growth in vitro and in mice.

Science.gov (United States)

Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng

2014-07-01

The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.

A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

Science.gov (United States)

Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang

2010-01-01

A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

Directory of Open Access Journals (Sweden)

Yanrui Li

2010-01-01

Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip

Directory of Open Access Journals (Sweden)

Yanling Xia

2018-04-01

Full Text Available Objective Molecular cloning and bioinformatics analysis of annexin A2 (ANXA2 gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. Methods The reverse transcriptase polymerase chain reaction (RT-PCR was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer (Cervus Nippon hortulorum and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR. Results The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus. Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period. Conclusion ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

Science.gov (United States)

Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

2003-05-01

Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

Association of telomerase reverse transcriptase promoter mutations with clinicopathological features and prognosis of thyroid cancer: a meta-analysis

Directory of Open Access Journals (Sweden)

Su X

2016-11-01

Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation

Introducing Catastrophe-QSAR. Application on Modeling Molecular Mechanisms of Pyridinone Derivative-Type HIV Non-Nucleoside Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

Marius Lazea

2011-12-01

Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.

CDX2 gene expression in acute lymphoblastic leukemia

International Nuclear Information System (INIS)

Arnaoaut, H.H.; Mokhtar, D.A.; Samy, R.M.; Omar, Sh.A.; Khames, S.A.

2014-01-01

CDX genes are classically known as regulators of axial elongation during early embryogenesis. An unsuspected role for CDX genes has been revealed during hematopoietic development. The CDX gene family member CDX2 belongs to the most frequent aberrantly expressed proto-oncogenes in human acute leukemias and is highly leukemogenic in experimental models. We used reversed transcriptase polymerase chain reaction (RT-PCR) to determine the expression level of CDX2 gene in 30 pediatric patients with acute lymphoblastic leukemia (ALL) at diagnosis and 30 healthy volunteers. ALL patients were followed up to detect minimal residual disease (MRD) on days 15 and 42 of induction. We found that CDX2 gene was expressed in 50% of patients and not expressed in controls. Associations between gene expression and different clinical and laboratory data of patients revealed no impact on different findings. With follow up, we could not confirm that CDX2 expression had a prognostic significance.

Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

Directory of Open Access Journals (Sweden)

Parvathi Chary

Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro.

Science.gov (United States)

Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L

1999-12-17

Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

3D-QSAR CoMFA of a series of DABO derivatives as HIV-1 reverse transcriptase non-nucleoside inhibitors.

Science.gov (United States)

de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão

2008-08-01

A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.

In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

Directory of Open Access Journals (Sweden)

Johannes Van Staden

2010-10-01

Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.

MAEWEST expression in flower development of two petunia species.

Science.gov (United States)

Segatto, Ana Lúcia A; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B; Monte-Bello, Carolina C; Dornelas, Marcelo C; Margis, Rogerio; Freitas, Loreta B

2013-07-03

Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription-quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions.

MAEWEST Expression in Flower Development of Two Petunia Species

Directory of Open Access Journals (Sweden)

Ana Lúcia A. Segatto

2013-07-01

Full Text Available Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae, adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively by reverse transcriptase polymerase chain reaction (RT-PCR, reverse transcription–quantitative PCR (qRT-PCR and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions.

Hyperuricemia Induces Wnt5a/Ror2 Gene Expression, Epithelial–Mesenchymal Transition, and Kidney Tubular Injury in Mice

Directory of Open Access Journals (Sweden)

Wiwit Ananda Wahyu Setyaningsih

2018-03-01

Full Text Available Background: Hyperuricemia contributes to kidney injury, characterized by tubular injury with epithelial–mesenchymal transition (EMT. Wnt5a/Ror2 signaling drives EMT in many kidney pathologies. This study sought to evaluate the involvement of Wnt5a/Ror2 in hyperuricemia-induced EMT in kidney tubular injury. Methods: A hyperuricemia model was performed in male Swiss background mice (3 months old, 30–40 g with daily intraperitoneal injections of 125 mg/kg body weight (BW of uric acid. The mice were terminated on day 7 (UA7, n=5 and on day 14 (UA14, n=5. Allopurinol groups (UAl7 and UAl14, each n=5 were added with oral 50 mg/kg BW of allopurinol treatment. The serum uric acid level was quantified, and tubular injury was assessed based on PAS staining. Reverse transcriptase-PCR was done to quantify Wnt5a, Ror2, E-cadherin, and vimentin expressions. IHC staining was done for E-cadherin and collagen I. We used the Shapiro–Wilk for normality testing and one-way ANOVA for variance analysis with a P<0.05 as significance level using SPSS 22 software. Results: The hyperuricemia groups had a higher uric acid level, which was associated with a higher tubular injury score. Meanwhile, the allopurinol groups had a significantly lower uric acid level and tubular injury than the uric acid groups. Reverse transcriptase-PCR revealed downregulation of the E-cadherin expression. While vimentin and collagen I expression are upregulated, which was associated with a higher Wnt5a expression. However, the allopurinol groups had reverse results. Immunostaining revealed a reduction in E-cadherin staining in the epithelial cells and collagen I positive staining in the epithelial cells and the interstitial areas. Conclusion: Hyperuricemia induced tubular injury, which might have been mediated by EMT through the activation of Wnt5a.

TNF-alpha expression by resident microglia and infiltrating leukocytes in the central nervous system of mice with experimental allergic encephalomyelitis

DEFF Research Database (Denmark)

Renno, T; Krakowski, M; Piccirillo, C

1995-01-01

in the pathology of multiple sclerosis and its animal model experimental allergic encephalomyelitis (EAE). We used reverse transcriptase (RT)-PCR to study the kinetics, cellular source, and regulation of cytokine gene expression in the central nervous system (CNS) of SJL/J mice with myelin basic protein......, the majority of which were identified as microglia and macrophages by their Mac-1 phenotype. Microglia could be discriminated by their low expression of CD45. Incubation of freshly derived, adult microglia from normal, uninfiltrated, CNS with activated Th1 supernatant induced the production of TNF-alpha m...

Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

LENUS (Irish Health Repository)

Bansode, Vijay B

2011-10-13

Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

Directory of Open Access Journals (Sweden)

Mengjuan Zhu

2016-03-01

Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite of extensive proliferation

International Nuclear Information System (INIS)

Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha

2005-01-01

Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols

A comparison of the ability of rilpivirine (TMC278 and selected analogues to inhibit clinically relevant HIV-1 reverse transcriptase mutants

Directory of Open Access Journals (Sweden)

Johnson Barry C

2012-12-01

Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.

Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

International Nuclear Information System (INIS)

Lund, Kaleb C.; Wallace, Kendall B.

2008-01-01

Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

Expression profiling identifies genes involved in emphysema severity

Directory of Open Access Journals (Sweden)

Bowman Rayleen V

2009-09-01

Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a major public health problem. The aim of this study was to identify genes involved in emphysema severity in COPD patients. Gene expression profiling was performed on total RNA extracted from non-tumor lung tissue from 30 smokers with emphysema. Class comparison analysis based on gas transfer measurement was performed to identify differentially expressed genes. Genes were then selected for technical validation by quantitative reverse transcriptase-PCR (qRT-PCR if also represented on microarray platforms used in previously published emphysema studies. Genes technically validated advanced to tests of biological replication by qRT-PCR using an independent test set of 62 lung samples. Class comparison identified 98 differentially expressed genes (p p Gene expression profiling of lung from emphysema patients identified seven candidate genes associated with emphysema severity including COL6A3, SERPINF1, ZNHIT6, NEDD4, CDKN2A, NRN1 and GSTM3.

Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

Directory of Open Access Journals (Sweden)

Mark A Winters

Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

Isolation and characterization of differentially expressed genes in ...

African Journals Online (AJOL)

USER

Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

Analysis of the Kinetics and Regulation of Cytokine Gene Expression During the Primary In Vivo Immune Response to Killed Brucella Abortus

Science.gov (United States)

1992-08-10

Purified protein derivative of Mycobacterium tuberculosis and excretory-secretory antigen(s) of Toxocara canis expand in vitro human T cells with...day after immunization viii 47 49 LIST OF TABLES I. PCR primers and Southern blot probes of Th 11Th2 cytokines II. Cytokine mRNA levels in Thyl...sensitive quantitative reverse transcriptase-polymerase chain reaction (RT- PCR ) assay to measure changes in Thl and Th2 cytokine gene expression during

[Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury].

Science.gov (United States)

Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B

2018-02-06

Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

[Construction of autocatalytic caspase-3 driven by amplified human telomerase reverse transcriptase promoter and its enhanced efficacy of inducing apoptosis in human ovarian carcinoma].

Science.gov (United States)

Song, Yue; Shen, Keng; He, Chun-Xia

2007-09-01

To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells

Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

DEFF Research Database (Denmark)

Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

2012-01-01

We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations.

Science.gov (United States)

Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P

2000-05-04

Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

Directory of Open Access Journals (Sweden)

Jessica H Brehm

Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

Pre-existing mutations in reverse transcriptase of hepatitis B virus in treatment-naive Chinese patients with chronic hepatitis B.

Directory of Open Access Journals (Sweden)

Jie Xu

Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.

Detrimental effect of expression of Bt endotoxin Cry1Ac on in vitro ...

Indian Academy of Sciences (India)

(50 U) of reverse transcriptase. This cDNA pool ... reverse primers for each and 0.2 μL Taq polymerase (1 U). The initial ..... learned from B.t. toxin genes; in Genetic engineering (ed) JK ... KO 2007 Improved drought tolerance without undesired.

[Expression of gamma interferon during HPV and Chlamydia trachomatis infection in cervical samples].

Science.gov (United States)

Colín-Ferreyra, María Del Carmen; Mendieta-Zerón, Hugo; Romero-Figueroa, María Del Socorro; Martínez-Madrigal, Migdania; Martínez-Pérez, Sergio; Domínguez-García, María Victoria

2015-02-01

The aim of this study was to mesure the expression of gamma interferon in HPV and Chlamydia trachomatis infection in squamous intraepithelial lesions. Samples from 100 patients diagnosed by colposcopy with or without squamous intraepithelial lesions were used in the present study. Each patient was found to be infected by HPV and C.trachomatis. Relative gamma interferon mRNA expression was assessed using a real-time reverse transcriptase PCR assay (RT-PCR). The relative units of expression of gamma interferon mRNA were 13, 1.8 and 0.3, for HPV and C.trachomatis co-infection, or HPV or C.trachomatis infection, respectively. HPV and C.trachomatis could overstimulate the expression of gamma interferon. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

Science.gov (United States)

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

NARCIS (Netherlands)

Oude Essink, B. B.; Berkhout, B.

1999-01-01

Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

Cloning and expression analysis of a novel ammonium transporter gene from eichhornia

International Nuclear Information System (INIS)

Li, Y.; Yan, G.; Zheng, L.

2014-01-01

In order to explore the molecular mechanism for Eichhornia crassipes to transport ammonium from outside, we cloned a novel ammonium transporter (EcAMT) gene from E. crassipes and identified its function by using yeast complementation experiment. The full-length cDNA of EcAMT contains a 1506 nucletide-long open reading frame which encodes a protein of 501 amino acids. Bioinformatics analysis predicted that EcAMT had 8 transmembrane regions. The expressions of EcAMT gene under three different nitrogen conditions were evaluated by quantitative reverse transcriptase PCR (qRT-PCR) and the results showed that the expression of EcAMT gene was up-regulated under nitrogen starvation. Our study results revealed some molecular mechanism of E. crassipes to absorb the ammonium in eutrophic water. (author)

Expression of the RET/PTC fusion gene as a marker for papillary carcinoma in Hashimoto's thyroiditis

DEFF Research Database (Denmark)

Wirtschafter, A; Schmidt, R; Rosen, D

1997-01-01

specific genes in patients diagnosed with Hashimoto's disease. The newly identified oncogenes RET/PTC1 and RET/PTC3 provide useful and specific markers of the early stages of papillary carcinoma as they are highly specific for malignant cells. Using a sensitive and specific reverse transcriptase......-polymerase chain reaction (RT-PCR) assay, we found messenger RNA (mRNA) expression for the RET/PTC1 and RET/PTC3 oncogenes in 95% of the Hashimoto's patients studied. All Hashimoto's patients presenting without histopathologic evidence of papillary thyroid cancer showed molecular genetic evidence of cancer...

Differentially displayed expressed sequence tags in Melipona scutellaris (Hymenoptera, Apidae, Meliponini) development.

Science.gov (United States)

Santana, Flávia A; Nunes, Francis M F; Vieira, Carlos U; Machado, Maria Alice M S; Kerr, Warwick E; Silva, Wilson A; Bonetti, Ana Maria

2006-03-01

We have compared gene expression, using the Differential Display Reverse Transcriptase-Polymerase Chain Reaction (DDRT-PCR) technique, by means of mRNA profile in Melipona scutellaris during ontogenetic postembryonic development, in adult worker, and in both Natural and Juvenile Hormone III-induced adult queen. Six, out of the nine ESTs described here, presented differentially expressed in the phases L1 or L2, or even in both of them, suggesting that key mechanisms to the development of Melipona scutellaris are regulated in these stages. The combination HT11G-AP05 revealed in L1 and L2 a product which matches to thioredoxin reductase protein domain in the Clostridium sporogenes, an important protein during cellular oxidoreduction processes. This study represents the first molecular evidence of differential gene expression profiles toward a description of the genetic developmental traits in the genus Melipona.

Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture

DEFF Research Database (Denmark)

Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic

2005-01-01

RNA and protein could be detected. The data suggest that iNOS expression may be a molecular mechanism mediating the adaptive response of trigeminal ganglia cells to the serum free stressful stimulus the culture environment provides. It may act as a cellular signalling molecule that is expressed after cell......Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascular......, reverse transcriptase polymerase chain reaction (RT-PCR) and Western blotting. In trigeminal ganglia cells not subjected to culture, endothelial (e) and neuronal (n) but not inducible (i) NOS mRNA and protein were detected. Culture of rat neurones resulted in a rapid axonal outgrowth of NOS positive...

The role of cortisol and interleukin-10 gene expression patterns in ...

African Journals Online (AJOL)

International Journal of Biological and Chemical Sciences ... were detected using reverse transcriptase polymerase chain reaction method. ... and interleukin-10 genes to reinstate homeostasis through modulation of the immune response.

Development of a quantitative competitive reverse transcriptase polymerase chain reaction for the quantification of growth hormone gene expression in pigs

Directory of Open Access Journals (Sweden)

Maurício Machaim Franco

2003-01-01

Full Text Available After the advent of the genome projects, followed by the discovery of DNA polymorphisms, basic understanding of gene expression is the next focus to explain the association between polymorphisms and the level of gene expression, as well as to demonstrate the interaction among genes. Among the various techniques for the investigation of transcriptional profiling involving patterns of gene expression, quantitative PCR is the simplest analytical laboratory technique. The objective of this work was to analyze two strategies of a competitive PCR technique for the quantification of the pig growth hormone (GH gene expression. A pair of primers was designed targeting exons 3 and 5, and two competitive PCR strategies were performed, one utilizing a specific amplicon as a competitor, and the other utilizing a low-stringency PCR amplicon as a competitor. The latter strategy proved to be easier and more efficient, offering an accessible tool that can be used in any kind of competitive reaction, facilitating the study of gene expression patterns for both genetics and diagnostics of infectious diseases.

Endogenous α-crystallin inhibits expression of caspase-3 induced by hypoxia in retinal neurons.

Science.gov (United States)

Ying, Xi; Peng, Yanli; Zhang, Jiaping; Wang, Xingli; Wu, Nan; Zeng, Yuxiao; Wang, Yi

2014-08-28

To investigate the expression of endogenous, hypoxic stress-induced α-crystallin and caspase-3 in rat retinal neurons in vitro. Retinal neurons were cultured from Long-Evans rats. The expression of endogenous α-crystallin was analyzed by immunohistochemistry and reverse transcriptase-polymerase chain reaction (RT-PCR). Furthermore, hypoxic exposure was performed in cultured cells, and the expression of endogenous α-crystallin and caspase-3 was assayed by Western blotting. Positive α-crystallin staining was observed in cultured retinal neurons, and expression of endogenous α-crystallin mRNA peaked 3-5d after inoculation (Pendogenous, hypoxic stress-induced α-crystallin expression increased gradually, peaking 6h after hypoxia. The expression was more abundant compared to the control (Pendogenous α-crystallin in retinal neurons, especially over-expression induced by hypoxic stress, results in the down regulation of caspase-3. The data suggest that endogenous α-crystallin may act as an endogenous neuroprotective factor in retinal neurons. Copyright © 2014 Elsevier Inc. All rights reserved.

Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

Directory of Open Access Journals (Sweden)

Markus Hecht

Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

Investigation of hTERT gene expression levels in two cell lines infected by high-risk human papilloma virus

Directory of Open Access Journals (Sweden)

Maryam Akhtari

2016-07-01

Full Text Available Background: Human papilloma virus (HPV is one of the most important factors in cervical cancer. Viral sequences are integrated into the host cell genome. In mild cases the virus causes skin damages, in severe cases it leads to cancer. Like many other cancers, telomerase gene expression was increased in cervical cancer. This enzyme is a reverse transcriptase that contains two common subunits: i catalytic protein called human telomerase reverse transcriptase (hTERT and, ii RNA sequence called hTR. hTERT expression is hardly found in any somatic tissues. Detection of high telomerase activity in human cells, lead to tumor genesis. So hTERT can be used as a diagnostic tool in cancer detection. Methods: This experimental study was carried out from May 2013 to April 2014 in Nanobiotechnology Research Center, Baqiyatallah University of Medical Sciences in Tehran, Iran. Caski and Hela cancer cell lines were used which contain HPV16 and HPV18 respectively. Cell lines were cultured and total RNA was extracted. Following normalization agent glyceraldehyde-3-phosphate dehydrogenase (GADPH, hTERT expression level was determining by real-time PCR method. For each sample, the expression level of hTERT and GAPDH were quantified as copy numbers (per reaction using the standard curve. Finally, hTERT levels in Hela and Caski cell lines were compared quantitatively by t-test using GraphPad statistic software version 5 (San Diego, CA, USA. Results: According to the charts real-time PCR, hTERT gene expression in Hela and Caski cancer cell lines is significantly different (t=0.0319. Conclusion: All results confirm that hTERT expression levels in Hela and Caski cell lines are significantly different and the level of hTERT expression in the Caski cell line was slightly higher than that of Hela cell line. The significant difference between hTERT mRNA expression levels reported here could be used as a tumor marker for HPV16 and HPV18 in cervical cancer.

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

Science.gov (United States)

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

Directory of Open Access Journals (Sweden)

Winny Xie

2013-12-01

Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

Development and Characterization of a Vaginal Film Containing Dapivirine, a Non- nucleoside Reverse Transcriptase Inhibitor (NNRTI), for prevention of HIV-1 sexual transmission.

Science.gov (United States)

Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia

2011-06-01

Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.

A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

Science.gov (United States)

Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

2007-01-01

Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

Comparison of Inhibitory Effect of Curcumin Nanoparticles and Free Curcumin in Human Telomerase Reverse Transcriptase Gene Expression in Breast Cancer

Directory of Open Access Journals (Sweden)

Nosratollah Zarghami

2013-02-01

Full Text Available Purpose: Telomerase is expressed in most cancers, including breast cancer. Curcumin, a polyphenolic compound that obtained from the herb of Curcuma longa, has many anticancer effects. But, its effect is low due to poor water solubility. In order to improve its solubility and drug delivery, we have utilized a β-cyclodextrin-curcumin inclusion complex. Methods: To evaluate cytotoxic effects of cyclodextrin-curcumin and free curcumin, MTT assay was done. Cells were treated with equal concentration of cyclodextrin-curcumin and free curcumin. Telomerase gene expression level in two groups was compared by Real-time PCR. Results: MTT assay demonstrated that β-cyclodextrin-curcumin enhanced curcumin delivery in T47D breast cancer cells. The level of telomerase gene expression in cells treated with cyclodextrin-curcumin was lower than that of cells treated with free curcumin (P=0.001. Conclusion: Results are suggesting that cyclodextrin-curcumin complex can be more effective than free curcumin in inhibition of telomerase expression.

Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

Science.gov (United States)

Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

2008-09-01

We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

Transcriptional expression of type I interferon response genes and stability of housekeeping genes in the human endometrium and endometriosis

DEFF Research Database (Denmark)

Vestergaard, Anna L; Knudsen, Ulla B; Munk, Torben

2011-01-01

Endometriosis is a painful chronic female disease defined by the presence of endometrial tissue implants in ectopic locations. The pathogenesis is much debated, and type I interferons could be involved. The expression of genes of the type I interferon response were profiled by a specific PCR Array...... of RNA obtained from ectopic and eutopic endometrium collected from 9 endometriosis patients and 9 healthy control women. Transcriptional expression levels of selected interferon-regulated and housekeeping genes were investigated by real-time quantitative reverse transcriptase PCR (qRT-PCR). Stably...... expressed housekeeping genes for valid normalization of transcriptional studies of endometrium and endometriosis have not yet been published. Here, seven housekeeping genes were evaluated for stability using the GeNorm and NormFinder software. A normalization factor based on HMBS, TBP, and YWHAZ expression...

Telomere-independent functions of telomerase in nuclei, cytoplasm, and mitochondria

Energy Technology Data Exchange (ETDEWEB)

Chiodi, Ilaria; Mondello, Chiara, E-mail: mondello@igm.cnr.it [Istituto di Genetica Molecolare, Consiglio Nazionale delle Ricerche, Pavia (Italy)

2012-09-28

Telomerase canonical activity at telomeres prevents telomere shortening, allowing chromosome stability and cellular proliferation. To perform this task, the catalytic subunit (telomerase reverse transcriptase, TERT) of the enzyme works as a reverse transcriptase together with the telomerase RNA component (TERC), adding telomeric repeats to DNA molecule ends. Growing evidence indicates that, besides the telomeric-DNA synthesis activity, TERT has additional functions in tumor development and is involved in many different biological processes, among which cellular proliferation, gene expression regulation, and mitochondrial functionality. TERT has been shown to act independently of TERC in the Wnt-β-catenin signaling pathway, regulating the expression of Wnt target genes, which play a role in development and tumorigenesis. Moreover, TERT RNA-dependent RNA polymerase activity has been found, leading to the genesis of double-stranded RNAs that act as precursor of silencing RNAs. In mitochondria, a TERT TERC-independent reverse transcriptase activity has been described that could play a role in the protection of mitochondrial integrity. In this review, we will discuss some of the extra-telomeric functions of telomerase.

Differentially displayed expressed sequence tags in Melipona scutellaris (Hymenoptera, Apidae, Meliponini development

Directory of Open Access Journals (Sweden)

Santana Flávia A.

2006-01-01

Full Text Available We have compared gene expression, using the Differential Display Reverse Transcriptase - Polymerase Chain Reaction (DDRT-PCR technique, by means of mRNA profile in Melipona scutellaris during ontogenetic postembryonic development, in adult worker, and in both Natural and Juvenile Hormone III-induced adult queen. Six, out of the nine ESTs described here, presented differentially expressed in the phases L1 or L2, or even in both of them, suggesting that key mechanisms to the development of Melipona scutellaris are regulated in these stages. The combination HT11G-AP05 revealed in L1 and L2 a product which matches to thioredoxin reductase protein domain in the Clostridium sporogenes, an important protein during cellular oxidoreduction processes. This study represents the first molecular evidence of differential gene expression profiles toward a description of the genetic developmental traits in the genus Melipona.

A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

Directory of Open Access Journals (Sweden)

Meng Shuang

2010-06-01

Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

International Nuclear Information System (INIS)

Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

2006-01-01

Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

Bcl-x(L) expression in vivo in rheumatoid synovium.

LENUS (Irish Health Repository)

Busteed, S

2012-02-03

To examine the expression of the apoptosis regulatory protein, Bcl-x(L), in the synovium of patients with rheumatoid arthritis (RA) and osteoarthritis (OA). Immunohistochemistry for Bcl-x(L) was carried out on synovial samples from patients with RA and OA. Reverse transcriptase polymerase chain reaction (RT-PCR) and Western blot analysis were performed to qualitatively examine the expression of Bcl-x(L). Bcl-x(L) expression was detected in the lining, endothelium and inflammatory cells of both RA (n=20) and OA (n=10) samples. However, there was significantly more expression in the lining of RA synovium compared to OA (77 vs 61%, p<0.05). Many of the positive cells in the RA subsynovium were noted to be plasma cells. There was a significant correlation between Bcl-x(L) expression and the number of inflammatory cells in the subsynovium of RA and OA patients (r (s)=0.376, p<0.05, n=30). Age and disease duration did not correlate with Bcl-x(L) expression in rheumatoid patients. Bcl-x(L) may play a role in the extended survival of synoviocytes and inflammatory cells in rheumatoid synovium.

Pattern of somatostatin receptors expression in normal and bladder cancer tissue samples.

Science.gov (United States)

Karavitakis, Markos; Msaouel, Pavlos; Michalopoulos, Vassilis; Koutsilieris, Michael

2014-06-01

Known risks factors for bladder cancer progression and recurrence are limited regarding their prognostic ability. Therefore identification of molecular determinants of disease progression could provide with more specific prognostic information and could be translated into new approaches for biomarker development. In the present study we evaluated, the expression patterns of somatostatin receptors 1-5 (SSTRs) in normal and tumor bladder tissues. The expression of SSTR1-5 was characterized in 45 normal and bladder cancer tissue samples using reverse transcriptase-polymerase chain reaction (RT-PCR). SSTR1 was expressed in 24 samples, SSTR2 in 15, SSTR3 in 23, SSTR4 in 16 and SSTR5 in all but one sample. Bladder cancer tissue samples expressed lower levels of SSTR3. Co-expression of SSTRs was associated with superficial disease. Our results demonstrate, for the first time, that there is expression of SSTR in normal and bladder cancer urothelium. Further studies are required to evaluate the prognostic and therapeutic significance of these findings. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

Science.gov (United States)

Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

2017-11-22

Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P ＜ 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

Science.gov (United States)

Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

2014-01-01

Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

DEFF Research Database (Denmark)

D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

2008-01-01

cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

K70Q adds high-level tenofovir resistance to "Q151M complex" HIV reverse transcriptase through the enhanced discrimination mechanism.

Directory of Open Access Journals (Sweden)

Atsuko Hachiya

2011-01-01

Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.

Design, synthesis and antiviral evaluation of novel heteroarylcarbothioamide derivatives as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and RDDP functions.

Science.gov (United States)

Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo

2017-08-31

In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Application of 3D-QSAR, Pharmacophore, and Molecular Docking in the Molecular Design of Diarylpyrimidine Derivatives as HIV-1 Nonnucleoside Reverse Transcriptase Inhibitors.

Science.gov (United States)

Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi

2018-05-11

Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.

Expression and location of α-fetoprotein during rat colon development

Science.gov (United States)

Liu, Xiao-Yan; Dong, Dan; Sun, Peng; Du, Jun; Gu, Luo; Ge, Ying-Bin

2009-01-01

AIM: To investigate the expression of α-fetoprotein (AFP), a cancer-associated fetal glycoprotein, and its involvement during rat colon development. METHODS: Colons from Sprague-Dawley rat fetuses, young and adult (8 wk old) animals were used in this study. Expression levels of AFP in colons of different development stage were detected by reverse-transcriptase PCR (RT-PCR) and Western blotting. To identify the cell location of AFP in the developing rat colons, double-immunofluorescent staining was performed using antibodies to specific cell markers and AFP, respectively. RESULTS: The highest levels of AFP mRNA were detected in colons of rats at embryonic day 18.5 (e18.5). Compared to e18.5 d, the AFP expression was significantly decreased during rat development [85% for e20.5, P colon from the embryo to the weaning stage by immunofluorescence and presents 72-kDa isoform in the developing rat colons by Western blotting. The dynamic expression of AFP in the various developmental stages of the colon indicates that AFP might be involved in many aspects of colon development. PMID:19360917

Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

Science.gov (United States)

Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

2017-09-01

It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

Heat stress and sudden infant death syndrome--stress gene expression after exposure to moderate heat stress

DEFF Research Database (Denmark)

Rohde, Marianne Cathrine; Corydon, Thomas Juhl; Hansen, Jakob

2013-01-01

The aim of the present study was to investigate stress gene expression in cultured primary fibroblasts established from Achilles tendons collected during autopsies from sudden infant death syndrome (SIDS) cases, and age-matched controls (infants dying in a traumatic event). Expression of 4 stress...... responsive genes, HSPA1B, HSPD1, HMOX1, and SOD2, was studied by quantitative reverse transcriptase PCR analysis of RNA purified from cells cultured under standard or various thermal stress conditions. The expression of all 4 genes was highly influenced by thermal stress in both SIDS and control cells. High...... interpersonal variance found in the SIDS group indicated that they represented a more heterogeneous group than controls. The SIDS group responded to thermal stress with a higher expression of the HSPA1B and HSPD1 genes compared to the control group, whereas no significant difference was observed...

Attenuated Expression of DFFB is a Hallmark of Oligodendrogliomas with 1p-Allelic Loss

Directory of Open Access Journals (Sweden)

Fuller Gregory N

2005-09-01

Full Text Available Abstract Allelic loss of chromosome 1p is frequently observed in oligodendroglioma. We screened 177 oligodendroglial tumors for 1p deletions and found 6 tumors with localized 1p36 deletions. Several apoptosis regulation genes have been mapped to this region, including Tumor Protein 73 (p73, DNA Fragmentation Factor subunits alpha (DFFA and beta (DFFB, and Tumor Necrosis Factor Receptor Superfamily Members 9 and 25 (TNFRSF9, TNFRSF25. We compared expression levels of these 5 genes in pairs of 1p-loss and 1p-intact tumors using quantitative reverse-transcriptase PCR (QRTPCR to test if 1p deletions had an effect on expression. Only the DFFB gene demonstrated decreased expression in all tumor pairs tested. Mutational analysis did not reveal DFFB mutations in 12 tested samples. However, it is possible that DFFB haploinsufficiency from 1p allelic loss is a contributing factor in oligodendroglioma development.

CD70 reverse signaling enhances NK cell function and immunosurveillance in CD27-expressing B-cell malignancies.

Science.gov (United States)

Al Sayed, Mohamad F; Ruckstuhl, Carla A; Hilmenyuk, Tamara; Claus, Christina; Bourquin, Jean-Pierre; Bornhauser, Beat C; Radpour, Ramin; Riether, Carsten; Ochsenbein, Adrian F

2017-07-20

The interaction of the tumor necrosis factor receptor (TNFR) CD27 with its ligand CD70 is an emerging target to treat cancer. CD27 signaling provides costimulatory signals to cytotoxic T cells but also increases the frequency of regulatory T cells. Similar to other TNFR ligands, CD70 has been shown to initiate intracellular signaling pathways (CD70 reverse signaling). CD27 is expressed on a majority of B-cell non-Hodgkin lymphoma, but its role in the immune control of lymphoma and leukemia is unknown. We therefore generated a cytoplasmic deletion mutant of CD27 (CD27-trunc) to study the role of CD70 reverse signaling in the immunosurveillance of B-cell malignancies in vivo. Expression of CD27-trunc on malignant cells increased the number of tumor-infiltrating interferon γ-producing natural killer (NK) cells. In contrast, the antitumoral T-cell response remained largely unchanged. CD70 reverse signaling in NK cells was mediated via the AKT signaling pathway and increased NK cell survival and effector function. The improved immune control by activated NK cells prolonged survival of CD27-trunc-expressing lymphoma-bearing mice. Finally, CD70 reverse signaling enhanced survival and effector function of human NK cells in a B-cell acute lymphoblastic leukemia xenotransplants model. Therefore, CD70 reverse signaling in NK cells contributes to the immune control of CD27-expressing B-cell lymphoma and leukemia. © 2017 by The American Society of Hematology.

Expression of sulfonylurea receptors in rat taste buds.

Science.gov (United States)

Liu, Dian-Xin; Liu, Xiao-Min; Zhou, Li-Hong; Feng, Xiao-Hong; Zhang, Xiao-Juan

2011-07-01

To test the possibility that a fast-onset promoting agent repaglinide may initiate prandial insulin secretion through the mechanism of cephalic-phase insulin release, we explored the expression and distribution character of sulfonylurea receptors in rat taste buds. Twenty male Wistar rats aged 10 weeks old were killed after general anesthesia. The circumvallate papillae, fungiform papillae and pancreas tissues were separately collected. Immunohistochemical staining was used to detect the expression and distribution of sulfonylurea receptor 1 (SUR1) or sulfonylurea receptor 2 (SUR2) in rat taste buds. Reverse transcriptase polymerase chain reaction (RT-PCR) was used to analyze the expression of SUR1 or SUR2 mRNA. The pancreatic tissues from the same rat were used as positive control. This is the first study to report that SUR1 is uniquely expressed in the taste buds of fungiform papillae of each rat tongue, while the expression of SUR1 or SUR2 was not detected in the taste buds of circumvallate papillae. SUR1 is selectively expressed in rat taste buds, and its distribution pattern may be functionally relevant, suggesting that the rapid insulin secretion-promoting effect of repaglinide may be exerted through the cephalic-phase secretion pathway mediated by taste buds. Copyright © 2010 Elsevier GmbH. All rights reserved.

Membrane expression of MRP-1, but not MRP-1 splicing or Pgp expression, predicts survival in patients with ESFT.

Science.gov (United States)

Roundhill, E; Burchill, S

2013-07-09

Primary Ewing's sarcoma family of tumours (ESFTs) may respond to chemotherapy, although many patients experience subsequent disease recurrence and relapse. The survival of ESFT cells following chemotherapy has been attributed to the development of resistant disease, possibly through the expression of ABC transporter proteins. MRP-1 and Pgp mRNA and protein expression in primary ESFTs was determined by quantitative reverse-transcriptase PCR (RT-qPCR) and immunohistochemistry, respectively, and alternative splicing of MRP-1 by RT-PCR. We observed MRP-1 protein expression in 92% (43 out of 47) of primary ESFTs, and cell membrane MRP-1 was highly predictive of both overall survival (PMRP-1 was detected in primary ESFTs, although the pattern of splicing variants was not predictive of patient outcome, with the exception of loss of exon 9 in six patients, which predicted relapse (P=0.041). Pgp protein was detected in 6% (38 out of 44) of primary ESFTs and was not associated with patient survival. For the first time we have established that cell membrane expression of MRP-1 or loss of exon 9 is predictive of outcome but not the number of splicing events or expression of Pgp, and both may be valuable factors for the stratification of patients for more intensive therapy.

Expression and clinical significance of Pax6 gene in retinoblastoma

Directory of Open Access Journals (Sweden)

Hai-Dong Huang

2013-07-01

Full Text Available AIM: To discuss the expression and clinical significance of Pax6 gene in retinoblastoma(Rb. METHODS: Totally 15 cases of fresh Rb organizations were selected as observation group and 15 normal retinal organizations as control group. Western-Blot and reverse transcriptase polymerase chain reaction(RT-PCRmethods were used to detect Pax6 protein and Pax6 mRNA expressions of the normal retina organizations and Rb organizations. At the same time, Western Blot method was used to detect the Pax6 gene downstream MATH5 and BRN3b differentiation gene protein level expression. After the comparison between two groups, the expression and clinical significance of Pax6 gene in Rb were discussed. RESULTS: In the observation group, average value of mRNA expression of Pax6 gene was 0.99±0.03; average value of Pax6 gene protein expression was 2.07±0.15; average value of BRN3b protein expression was 0.195±0.016; average value of MATH5 protein expression was 0.190±0.031. They were significantly higher than the control group, and the differences were statistically significant(PCONCLUSION: Abnormal expression of Pax6 gene is likely to accelerate the occurrence of Rb.

Calcitonin directly attenuates collagen type II degradation by inhibition of matrix metalloproteinase expression and activity in articular chondrocytes

DEFF Research Database (Denmark)

Sondergaard, B C; Wulf, H; Henriksen, K

2006-01-01

OBJECTIVE: Calcitonin was recently reported to counter progression of cartilage degradation in an experimental model of osteoarthritis, and the effects were primarily suggested to be mediated by inhibition of subchondral bone resorption. We investigated direct effects of calcitonin on chondrocytes...... by assessing expression of the receptor and pharmacological effects on collagen type II degradation under ex vivo and in vivo conditions. METHODS: Localization of the calcitonin receptor on articular chondrocytes was investigated by immunohistochemistry, and the expression by reverse transcriptase polymerase.......0001-1 microM]. In vivo, cartilage degradation was investigated in ovariectomized (OVX) rats administered with oral calcitonin [2 mg/kg calcitonin] for 9 weeks. RESULTS: The calcitonin receptor was identified in articular chondrocytes by immunohistochemistry and RT-PCR. Calcitonin concentration...

11Beta-HSD type 1 expression in human adipose tissue: impact of gender, obesity, and fat localization

DEFF Research Database (Denmark)

Paulsen, Søren Kildeberg; Pedersen, Steen Bønløkke; Fisker, Sanne

2007-01-01

of the metabolic syndrome. Our objective was to compare 11beta-HSD1 gene expression in different fat depots (visceral, subcutaneous abdominal, and subcutaneous gluteal) in lean and obese men and women. RESEARCH METHODS AND PROCEDURES: A cross-sectional study design was used for healthy patients undergoing minor...... abdominal surgery (lean men, 10), minor gynecological surgery (lean woman, 10), or gastric banding operations (obese men, 10; and obese women, 10). Gene expressions of 11beta-HSD1 in adipose tissue samples were determined by real-time reverse transcriptase polymerase chain reaction (RT-PCR). RESULTS: Lean...... women had lower 11beta-HSD1 gene expression in subcutaneous adipose tissue compared with men (62% lower, p women. 11Beta-HSD1 mRNA in human adipose tissue was higher in obese subjects compared with lean subjects in both women...

Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

International Nuclear Information System (INIS)

Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

1995-06-01

MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

Science.gov (United States)

2007-05-08

deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

Efavirenz or nevirapine in three-drug combination therapy with two nucleoside or nucleotide-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals.

Science.gov (United States)

Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi

2016-12-10

The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure

High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

Science.gov (United States)

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Over-expression of Arabidopsis DnaJ (Hsp40) contributes to NaCl ...

African Journals Online (AJOL)

USER

2010-02-15

Feb 15, 2010 ... levels of DnaJ in their transgenic sense lines exhibited tolerance to NaCl stress. Under 120 mM ... polymerase chain reaction; RT-PCR, reverse transcriptase –. PCR; CTAB ..... Engineering salt tolerance in plants. Curr. Opin.

Expression of the genes dual oxidase 2, lipocalin 2 and regenerating islet-derived 1 alpha in Crohn's disease

DEFF Research Database (Denmark)

Csillag, C.; Nielsen, O.H.; Vainer, Ben

2007-01-01

colonoscopically from 33 CD patients and from 17 control subjects. All controls and 10 CD patients were medication-free at the time of colonoscopy. The Human Genome U133 Plus 2.0 GeneChip Array was used for gene profiling. Hybridization data were analysed with dChip software. Results were confirmed by real......-time reverse transcriptase polymerase chain reaction (RT-PCR). Protein product expression of selected genes was assessed by immunohistochemistry using the Envision+ visualization technique. RESULTS: The expression profile was not homogeneous with the statistical cut-point settings applied. In comparison......, fold change 3.9), codes for a mitogenic protein; this could not be confirmed by RT-PCR. Medication-free patients had no differentially expressed genes as compared with controls. Immunohistochemistry indicated that these proteins were produced by epithelial cells (REG1A, LCN2) and leucocytes (DUOX2...

Insulin-like Growth Factor Receptor 1 mRNA Expression as a Prognostic Marker in Advanced Non-small Cell Lung Cancer

DEFF Research Database (Denmark)

Vilmar, Adam; Santoni-Rugiu, Eric; Cillas, Jesus Garcia-Fon

2014-01-01

BACKGROUND: The insulin-like growth factor 1 receptor (IGF1R) has yet to be established as a biomarker in non-small cell lung cancer (NSCLC) but could prove useful in customized chemotherapy. We explored its prognostic value using both quantitative real-time reverse transcriptase polymerase chain......-points. RESULTS: Surgical tissue samples were available from 33 patients deemed inoperable. IGF1R status varied according to histopathology. Patients with tumors positive for IGF1R mRNA expression had a shorter progression-free and overall survival when compared to the negative sub-group (6.1 vs. 7.4 months, p=0...

Simultaneous sequencing of coding and noncoding RNA reveals a human transcriptome dominated by a small number of highly expressed noncoding genes.

Science.gov (United States)

Boivin, Vincent; Deschamps-Francoeur, Gabrielle; Couture, Sonia; Nottingham, Ryan M; Bouchard-Bourelle, Philia; Lambowitz, Alan M; Scott, Michelle S; Abou-Elela, Sherif

2018-07-01

Comparing the abundance of one RNA molecule to another is crucial for understanding cellular functions but most sequencing techniques can target only specific subsets of RNA. In this study, we used a new fragmented ribodepleted TGIRT sequencing method that uses a thermostable group II intron reverse transcriptase (TGIRT) to generate a portrait of the human transcriptome depicting the quantitative relationship of all classes of nonribosomal RNA longer than 60 nt. Comparison between different sequencing methods indicated that FRT is more accurate in ranking both mRNA and noncoding RNA than viral reverse transcriptase-based sequencing methods, even those that specifically target these species. Measurements of RNA abundance in different cell lines using this method correlate with biochemical estimates, confirming tRNA as the most abundant nonribosomal RNA biotype. However, the single most abundant transcript is 7SL RNA, a component of the signal recognition particle. S tructured n on c oding RNAs (sncRNAs) associated with the same biological process are expressed at similar levels, with the exception of RNAs with multiple functions like U1 snRNA. In general, sncRNAs forming RNPs are hundreds to thousands of times more abundant than their mRNA counterparts. Surprisingly, only 50 sncRNA genes produce half of the non-rRNA transcripts detected in two different cell lines. Together the results indicate that the human transcriptome is dominated by a small number of highly expressed sncRNAs specializing in functions related to translation and splicing. © 2018 Boivin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

Directory of Open Access Journals (Sweden)

Tandale Babasaheb V

2008-12-01

Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

Proteomic analysis of three gonad types of swamp eel reveals genes differentially expressed during sex reversal

OpenAIRE

Sheng, Yue; Zhao, Wei; Song, Ying; Li, Zhigang; Luo, Majing; Lei, Quan; Cheng, Hanhua; Zhou, Rongjia

2015-01-01

A variety of mechanisms are engaged in sex determination in vertebrates. The teleost fish swamp eel undergoes sex reversal naturally and is an ideal model for vertebrate sexual development. However, the importance of proteome-wide scanning for gonad reversal was not previously determined. We report a 2-D electrophoresis analysis of three gonad types of proteomes during sex reversal. MS/MS analysis revealed a group of differentially expressed proteins during ovary to ovotestis to testis transf...

Expression of placental protein 14 by the new endometrial cancer cell line MFE-280 in vitro and by endometrial carcinomas in vivo.

Science.gov (United States)

Hackenberg, R; Loos, S; Nia, A H; Kunzmann, R; Schulz, K D

1998-01-01

MFE-280 endometrial cancer cells express PP14 (placental protein 14) in vitro. PP14 is normally found in the secretory endometrium and in placental tissue. MFE-280 cells, which are tumorigenic in nude mice, were derived from a recurrent, poorly differentiated endometrial carcinoma. The cells were initially grown in suspension culture and later transferred to monolayer cultures. Karyotyping revealed near-diploidy with a complex heterogeneous aberration pattern. MFE-280 cells were positive for the cytokeratins 7, 8, 18 and 19 as well as for vimentin. The expression of PP14 in MFE-280 cells was demonstrated by immunochemistry and reverse transcriptase--polymerase chain reaction. PP14-mRNA was also detected in one out of five endometrial cancer specimen. In tumor tissue the expression of PP14 was not dependent on progestins.

Introduction of a normal human chromosome 8 corrects abnormal phenotypes of Werner syndrome cells immortalized by expressing an hTERT gene

International Nuclear Information System (INIS)

Ariyoshi, Kentaro; Kodama, Seiji; Suzuki, Keiji; Goto, Makoto; Oshimura, Mitsuo; Ishizaki, Kanji; Watanabe, Masami

2009-01-01

Werner syndrome (WS) is an autosomal recessive disease characterized by premature aging and caused by mutations of the WRN gene mapped at 8p12. To examine functional complementation of WS phenotypes, we introduced a normal human chromosome 8 into a strain of WS fibroblasts (WS3RGB) immortalized by expressing a human telomerase reverse transcriptase subunit (hTERT) gene. Here, we demonstrate that the abnormal WS phenotypes including cellular sensitivities to 4-nitroquinoline-1-oxide (4NQO) and hydroxy urea (HU), and chromosomal radiosensitivity at G 2 phase are corrected by expression of the WRN gene mediated by introducing a chromosome 8. This indicates that those multiple abnormal WS phenotypes are derived from a primary, but not secondary, defect in the WRN gene. (author)

5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase.

Science.gov (United States)

Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong

2018-06-18

We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H  = 1.77 μM, IC 50 IN  = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

Science.gov (United States)

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-06-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

Science.gov (United States)

Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

2005-01-01

Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

Interchromosomal insertional translocation at Xq26.3 alters SOX3 expression in an individual with XX male sex reversal.

Science.gov (United States)

Haines, Bryan; Hughes, James; Corbett, Mark; Shaw, Marie; Innes, Josie; Patel, Leena; Gecz, Jozef; Clayton-Smith, Jill; Thomas, Paul

2015-05-01

46,XX male sex reversal occurs in approximately 1: 20 000 live births and is most commonly caused by interchromosomal translocations of the Y-linked sex-determining gene, SRY. Rearrangements of the closely related SOX3 gene on the X chromosome are also associated with 46,XX male sex reversal. It has been hypothesized that sex reversal in the latter is caused by ectopic expression of SOX3 in the developing urogenital ridge where it triggers male development by acting as an analog of SRY. However, altered regulation of SOX3 in individuals with XX male sex reversal has not been demonstrated. Here we report a boy with SRY-negative XX male sex reversal who was diagnosed at birth with a small phallus, mixed gonads, and borderline-normal T. Molecular characterization of the affected individual was performed using array comparative genomic hybridization, fluorescent in situ hybridization of metaphase chromosomes, whole-genome sequencing, and RT-PCR expression analysis of lymphoblast cell lines. The affected male carries ∼774-kb insertion translocation from chromosome 1 into a human-specific palindromic sequence 82 kb distal to SOX3. Importantly, robust SOX3 expression was identified in cells derived from the affected individual but not from control XX or XY cells, indicating that the translocation has a direct effect on SOX3 regulation. This is the first demonstration of altered SOX3 expression in an individual with XX male sex reversal and suggests that SOX3 can substitute for SRY to initiate male development in humans.

High expression of Rac1 is correlated with partial reversed cell polarity and poor prognosis in invasive ductal carcinoma of the breast.

Science.gov (United States)

Liu, Bingbing; Xiong, Jianhua; Liu, Guiqiu; Wu, Jing; Wen, Likun; Zhang, Qin; Zhang, Chuanshan

2017-07-01

The change of cell polarity is usually associated with invasion and metastasis. Partial reverse cell polarity in IDC-NOS may play a role in lymphatic tumor spread. Rac1 is a kind of polarity related protein. It plays an important role in invasion and metastasis in tumors. We here investigated the expression of Rac1 and partial reverse cell polarity status in breast cancer and evaluated their value for prognosis in breast cancer. The association of the expression of Rac1 and MUC-1 with clinicopathological parameters and prognostic significance was evaluated in 162 cases of IDC-NOS paraffin-embedded tissues by immunohistochemical method. The Rac1 messenger RNA expression was measured by real-time polymerase chain reaction in 30 breast cancer patients, which was divided into two groups of partial reverse cell polarity and no partial reverse cell polarity. We found that lymph node metastasis of partial reverse cell polarity patients was higher than no partial reverse cell polarity patients (Z = -4.030, p = 0.000). Rac1 was upregulated in partial reverse cell polarity group than no partial reverse cell polarity group (Z = -3.164, p = 0.002), and there was correlationship between the expression of Rac1 and partial reverse cell polarity status (r s  = 0.249, p = 0.001). The level of Rac1 messenger RNA expression in partial reverse cell polarity group was significantly higher compared to no partial reverse cell polarity group (t = -2.527, p = 0.017). Overexpression of Rac1 and partial reverse cell polarity correlates with poor prognosis of IDC-NOS patients (p = 0.011). Partial reverse cell polarity and lymph node metastasis remained as independent predictors for poor disease-free survival of IDC-NOS (p = 0.023, p = 0.046). Our study suggests that partial reverse cell polarity may lead to poor prognosis of breast cancer. Overexpression of Rac1 may lead to polarity change in IDC-NOS of the breast. Therefore, Rac1 could be a

Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis

OpenAIRE

Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

2014-01-01

Background Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. Methods In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking...

Tissue-specific expression of telomerase reverse transcriptase gene variants in Nicotiana tabacum

Czech Academy of Sciences Publication Activity Database

Jurečková, J.; Sýkorová, Eva; Hafidh, Said; Honys, David; Fajkus, Jiří; Fojtová, M.

2017-01-01

Roč. 245, č. 3 (2017), s. 549-561 ISSN 0032-0935 R&D Projects: GA ČR GA13-06943S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 ; RVO:61389030 Keywords : male gametophyte development * tobacco male gametophyte * allotetraploid nicotiana Subject RIV: EF - Botanics; EF - Botanics (UEB-Q) OBOR OECD: Plant sciences, botany; Plant sciences, botany (UEB-Q) Impact factor: 3.361, year: 2016

Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex That Confer Multinucleoside Drug Resistance

Energy Technology Data Exchange (ETDEWEB)

Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy

2017-04-10

HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.

Proteomic analysis of three gonad types of swamp eel reveals genes differentially expressed during sex reversal.

Science.gov (United States)

Sheng, Yue; Zhao, Wei; Song, Ying; Li, Zhigang; Luo, Majing; Lei, Quan; Cheng, Hanhua; Zhou, Rongjia

2015-05-18

A variety of mechanisms are engaged in sex determination in vertebrates. The teleost fish swamp eel undergoes sex reversal naturally and is an ideal model for vertebrate sexual development. However, the importance of proteome-wide scanning for gonad reversal was not previously determined. We report a 2-D electrophoresis analysis of three gonad types of proteomes during sex reversal. MS/MS analysis revealed a group of differentially expressed proteins during ovary to ovotestis to testis transformation. Cbx3 is up-regulated during gonad reversal and is likely to have a role in spermatogenesis. Rab37 is down-regulated during the reversal and is mainly associated with oogenesis. Both Cbx3 and Rab37 are linked up in a protein network. These datasets in gonadal proteomes provide a new resource for further studies in gonadal development.

The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

Directory of Open Access Journals (Sweden)

Beom Joon Kim

2009-01-01

Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

The effects of calcium on the expression of genes involved in ...

African Journals Online (AJOL)

USER

2010-06-14

Jun 14, 2010 ... Following incubation, RNA was extracted from a 2 mm ... RNA from samples treated with ethylene was used to synthesize first-strand. cDNA using SuperScript II RNase H-Reverse Transcriptase. (Invitrogen .... Effects of calcium and VP on endogenous ethylene production in AZ of tomato pedicel explants.

Local NSAID infusion does not affect protein synthesis and gene expression in human muscle after eccentric exercise

DEFF Research Database (Denmark)

Mikkelsen, U R; Schjerling, P; Helmark, Ida Carøe

2010-01-01

models, and inhibit the exercise-induced satellite cell proliferation and protein synthesis in humans. However, the cellular mechanisms eliciting these responses remain unknown. Eight healthy male volunteers performed 200 maximal eccentric contractions with each leg. To block prostaglandin synthesis...... locally in the skeletal muscle, indomethacin (NSAID) was infused for 7.5 h via microdialysis catheters into m. vastus lateralis of one leg. Protein synthesis was determined by the incorporation of 1,2-(13)C(2) leucine into muscle protein from 24 to 28 h post-exercise. Furthermore, mRNA expression...... of selected genes was measured in muscle biopsies (5 h and 8 days post-exercise) by real-time reverse transcriptase PCR. Myofibrillar and collagen protein synthesis were unaffected by the local NSAID infusion. Five hours post-exercise, the mRNA expression of cyclooxygenase-2 (COX2) was sixfold higher...

Blockade of OX40/OX40 ligand to decrease cytokine messenger RNA expression in acute renal allograft rejection in vitro.

Science.gov (United States)

Wang, Y-L; Li, G; Fu, Y-X; Wang, H; Shen, Z-Y

2013-01-01

The aim of this study was to investigate cytokine messenger RNA (mRNA) expression by peripheral blood mononuclear cells (PBMCs) from renal recipients experiencing acute rejection by blocking OX40-OX40L interactions with recombinant human OX40-Fc fusion protein (rhOX40Fc) in vitro. PBMCs were isolated from 20 recipients experiencing acute rejection episodes (rejection group) and 20 recipients with stable graft function (stable group). Levels of Th1 (interferon [IFN]-γ) and Th2 (interleukin [IL]-4) mRNA expressions by PBMCs were measured using real-time reverse transcriptase-polymerase chain reactions. IFN-γ mRNA expression levels were significantly higher in the rejection than the stable group (P rejection group, rhOX40Fc reduced significantly the expression of IFN-γ and IL-4 mRNA by anti-CD3-monoclonal antibody stimulated PBMCs (P type cytokines. Copyright © 2013 Elsevier Inc. All rights reserved.

Parallel screening of drug-like natural compounds using Caco-2 cell permeability QSAR model with applicability domain, lipophilic ligand efficiency index and shape property: A case study of HIV-1 reverse transcriptase inhibitors

Science.gov (United States)

Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.

2017-10-01

The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.

[Effects of electroacupuncture on hippocampal nNOS expression in rats of post-traumatic stress disorder model].

Science.gov (United States)

Hou, Liang-Qin; Liu, Song; Xiong, Ke-Ren

2013-07-01

To explore the mechanism of electroacupuncture (EA) in the treatment of post-traumatic stress disorder (PTSD). Thirty male Sprague-Dawley rats were randomly divided into a normal group, a model group and an electroacupuncture group. The single prolonged stress (SPS) method was used to set up the PTSD models in latter two groups. After SPS Stimulation, EA group was treated with 2Hz electroacupuncture at Baihui (GV 20) and Zusanli (ST 36) for 30 min, once a day for a week. Reverse transcriptase polymerase chain reaction (RT-PCR) and immuno-histochemistry were used to detect the mRNA and protein expression of nNOS in the hippocampus of rats in the each group. (1) The nNOS mRNA expression in hippocampus in model group was higher than that in normal group (P electroacupuncture treatment, its expression in EA group was lower significantly than that in model group (P Electroacupuncture play a down-regulation effects in the hippocampal nNOS expression, which may be one mechanism of electroacupuncture for treatment of PTSD.

Structure-function relationships during transgenic telomerase expression in Arabidopsis

Czech Academy of Sciences Publication Activity Database

Zachová, D.; Fojtová, Miloslava; Dvořáčková, Martina; Mozgová, I.; Lermontova, I.; Peška, Vratislav; Schubert, I.; Fajkus, Jiří; Sýkorová, Eva

2013-01-01

Roč. 149, č. 1 (2013), s. 114-126 ISSN 0031-9317 R&D Projects: GA AV ČR(CZ) IAA500040801; GA ČR(CZ) ED1.1.00/02.0068 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : RNA-BINDING DOMAIN * REVERSE-TRANSCRIPTASE * NUCLEOLAR LOCALIZATION Subject RIV: BO - Biophysics Impact factor: 3.262, year: 2013

Tenascin in meningioma: expression is correlated with anaplasia, vascular endothelial growth factor expression, and peritumoral edema but not with tumor border shape.

Science.gov (United States)

Kiliç, Türker; Bayri, Yaşar; Ozduman, Koray; Acar, Melih; Diren, Semin; Kurtkaya, Ozlem; Ekinci, Gazanfer; Buğra, Kuyaş; Sav, Aydin; Ozek, M Memet; Pamir, M Necmettin

2002-07-01

Tenascin is an extracellular matrix glycoprotein that is expressed during embryogenesis, inflammation, angiogenesis, and carcinogenesis. The aim of this study was to investigate how tenascin expression relates to histological grade, angiogenesis, and radiological findings in meningiomas. Twenty typical, 20 atypical, and 5 malignant meningiomas were studied retrospectively. Tenascin expression and vascular endothelial growth factor (VEGF) expression in the tumor tissue were investigated by immunohistochemistry. Tenascin messenger ribonucleic acid expression was also studied by comparative reverse transcriptase-polymerase chain reaction. Magnetic resonance images from each case were assessed for peritumoral edema and tumor border shape. The atypical and malignant meningiomas showed higher levels of tenascin expression than the typical meningiomas. The more sensitive messenger ribonucleic acid-based methods confirmed this finding. Tenascin expression was correlated with peritumoral edema and VEGF expression but not with tumor border shape. In the 13 tumors with marked tenascin expression, peritumoral edema was Grade 0 in one, Grade 1 in three, and Grade 2 in nine specimens. In the same 13 tumors, VEGF expression was Grade 1 in five and Grade 2 in eight specimens, and the findings for tumor border shape were Grade 0 in seven, Grade 1 in four, and Grade 2 in two specimens. In meningiomas, tenascin expression is correlated with anaplasia, tumor-associated edema, and VEGF expression but not with tumor border shape. This protein may play a role in the neoplastic and/or angiogenic processes in atypical and malignant meningiomas and may thus be a potential target for meningioma therapy.

Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues

Science.gov (United States)

Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang

2006-05-01

To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

Sequential emergence and clinical implications of viral mutants with K70E and K65R mutation in reverse transcriptase during prolonged tenofovir monotherapy in rhesus macaques with chronic RT-SHIV infection

Directory of Open Access Journals (Sweden)

Pedersen Niels C

2007-04-01

Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be

Comparison of Inhibitory Effect of Curcumin Nanoparticles and Free Curcumin in Human Telomerase Reverse Transcriptase Gene Expression in Breast Cancer

OpenAIRE

Nosratollah Zarghami; Abbas Rami; Fatemeh Kazemi-Lomedasht

2013-01-01

Purpose: Telomerase is expressed in most cancers, including breast cancer. Curcumin, a polyphenolic compound that obtained from the herb of Curcuma longa, has many anticancer effects. But, its effect is low due to poor water solubility. In order to improve its solubility and drug delivery, we have utilized a β-cyclodextrin-curcumin inclusion complex. Methods: To evaluate cytotoxic effects of cyclodextrin-curcumin and free curcumin, MTT assay was done. Cells were treated with equal concentrati...

Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

Science.gov (United States)

Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

2003-01-01

Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

Molecular cloning and expression patterns of the Vasa gene from Rana nigromaculata (Amphibia: Anura

Directory of Open Access Journals (Sweden)

Rui Jia

2009-06-01

Full Text Available The Vasa protein is a member of the DEAD (Asp-Glu-Alu-Asp box family of ATP-dependent RNA helicases. The Vasa gene is specifically expressed in germ-line cells of many metazoans and is known to play a critical role in gametogenesis and reproductive regulation. In this paper, we isolate the full length cDNA sequence of the Vasa gene from the frog Rana nigromaculata Hallowell, 1861. The open reading frame (ORF encoding 398 amino acid residues has nine conserved motifs. According to the similarities at the amino acid sequenceythe phylogenetic analysis of Vasa gene was consistent with the evolution relationships from chordates to mammals. Furthermore, the expression pattern analysis of RnVasa mRNA, using the technique of Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR, showed a high level of transcripts in testis, ovary and kidney, whereas little to no signal was detected in other tissues, which suggests that it may play a role during gametogenesis.

Molecular and biochemical toxicology

National Research Council Canada - National Science Library

Smart, Robert C; Hodgson, Ernest

2008-01-01

... Expression and Regulation 2.6.1 Northern Analysis 2.6.2 Nuclear Run-On 2.6.3 Promoter Deletion Analysis/Reporter Gene Assays 2.6.4 Microarrays 2.6.5 Reverse Transcriptase-PCR (RT-PCR) and Real-Time P...

Quantitation of the mRNA expression of the epidermal growth factor system

DEFF Research Database (Denmark)

Sørensen, B S; Tørring, N; Bor, M V

2000-01-01

) and for the quantitation of mRNA for the receptors HER-1 and its preferred dimerization partner, HER-2. The method is based on the generation of specific RNA standards, which are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) with the sample RNA and a set of calibrators. The resulting calibration...

Expression Profiles of 12 Late Embryogenesis Abundant Protein Genes from Tamarix hispida in Response to Abiotic Stress

Directory of Open Access Journals (Sweden)

Caiqiu Gao

2014-01-01

Full Text Available Twelve embryogenesis abundant protein (LEA genes (named ThLEA-1 to -12 were cloned from Tamarix hispida. The expression profiles of these genes in response to NaCl, PEG, and abscisic acid (ABA in roots, stems, and leaves of T. hispida were assessed using real-time reverse transcriptase-polymerase chain reaction (RT-PCR. These ThLEAs all showed tissue-specific expression patterns in roots, stems, and leaves under normal growth conditions. However, they shared a high similar expression patterns in the roots, stems, and leaves when exposed to NaCl and PEG stress. Furthermore, ThLEA-1, -2, -3, -4, and -11 were induced by NaCl and PEG, but ThLEA-5, -6, -8, -10, and -12 were downregulated by salt and drought stresses. Under ABA treatment, some ThLEA genes, such as ThLEA-1, -2, and -3, were only slightly differentially expressed in roots, stems, and leaves, indicating that they may be involved in the ABA-independent signaling pathway. These findings provide a basis for the elucidation of the function of LEA genes in future work.

Expression profiles of 12 late embryogenesis abundant protein genes from Tamarix hispida in response to abiotic stress.

Science.gov (United States)

Gao, Caiqiu; Liu, Yali; Wang, Chao; Zhang, Kaimin; Wang, Yucheng

2014-01-01

Twelve embryogenesis abundant protein (LEA) genes (named ThLEA-1 to -12) were cloned from Tamarix hispida. The expression profiles of these genes in response to NaCl, PEG, and abscisic acid (ABA) in roots, stems, and leaves of T. hispida were assessed using real-time reverse transcriptase-polymerase chain reaction (RT-PCR). These ThLEAs all showed tissue-specific expression patterns in roots, stems, and leaves under normal growth conditions. However, they shared a high similar expression patterns in the roots, stems, and leaves when exposed to NaCl and PEG stress. Furthermore, ThLEA-1, -2, -3, -4, and -11 were induced by NaCl and PEG, but ThLEA-5, -6, -8, -10, and -12 were downregulated by salt and drought stresses. Under ABA treatment, some ThLEA genes, such as ThLEA-1, -2, and -3, were only slightly differentially expressed in roots, stems, and leaves, indicating that they may be involved in the ABA-independent signaling pathway. These findings provide a basis for the elucidation of the function of LEA genes in future work.

Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

Science.gov (United States)

Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

2016-06-21

To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

Genetic Network Inference: From Co-Expression Clustering to Reverse Engineering

Science.gov (United States)

Dhaeseleer, Patrik; Liang, Shoudan; Somogyi, Roland

2000-01-01

Advances in molecular biological, analytical, and computational technologies are enabling us to systematically investigate the complex molecular processes underlying biological systems. In particular, using high-throughput gene expression assays, we are able to measure the output of the gene regulatory network. We aim here to review datamining and modeling approaches for conceptualizing and unraveling the functional relationships implicit in these datasets. Clustering of co-expression profiles allows us to infer shared regulatory inputs and functional pathways. We discuss various aspects of clustering, ranging from distance measures to clustering algorithms and multiple-duster memberships. More advanced analysis aims to infer causal connections between genes directly, i.e., who is regulating whom and how. We discuss several approaches to the problem of reverse engineering of genetic networks, from discrete Boolean networks, to continuous linear and non-linear models. We conclude that the combination of predictive modeling with systematic experimental verification will be required to gain a deeper insight into living organisms, therapeutic targeting, and bioengineering.

Detection of hepatitis C virus RNA using reverse transcription PCR

International Nuclear Information System (INIS)

Yap, S.F.

1998-01-01

Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

APOBEC3G inhibits elongation of HIV-1 reverse transcripts.

Directory of Open Access Journals (Sweden)

Kate N Bishop

2008-12-01

Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.

Crystallographic Study of a Novel Sub-Nanomolar Inhibitor Provides Insight on the Binding Interactions of Alkenyldiarylmethanes with Human Immunodeficiency Virus-1 (HIV-1) Reverse Transcriptase†

Science.gov (United States)

Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark

2009-01-01

Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161

Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

Science.gov (United States)

Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

2011-07-01

Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

Effect of human vascular endothelial growth factor gene transfer on endogenous vascular endothelial growth factor mRNA expression in a rat fibroblast and osteoblast culture model.

Science.gov (United States)

Li, Ru; Li, Claire H; Nauth, Aaron; McKee, Michael D; Schemitsch, Emil H

2010-09-01

Vascular endothelial growth factor (VEGF) plays an important role in promoting angiogenesis and osteogenesis during fracture repair. Our previous studies have shown that cell-based VEGF gene therapy enhances bone healing of a rabbit tibia segmental bone defect in vivo. The aim of this project was to examine the effect of exogenous human VEGF on the endogenous rat VEGF messenger RNA (mRNA) expression in a cell-based gene transfer model. Rat fibroblasts and osteoblasts were harvested from the dermal tissue and periosteum, respectively, of Fisher 344 rats. The cells were then cultured and transfected with pcDNA-human VEGF using Superfect reagent (Qiagen). Four experimental groups were created: 1) fibroblast-VEGF; 2) osteoblast-VEGF; 3) nontransfected fibroblast controls; and 4) nontransfected osteoblast controls. The cultured cells were harvested at 1, 3, and 7 days after the gene transfection. The total mRNA was extracted (Trizol; Invitrogen); both human VEGF and rat VEGF mRNA were measured by reverse transcriptase-polymerase chain reaction and quantified by VisionWorksLS. The human VEGF165 mRNA was detected by reverse transcriptase-polymerase chain reaction from transfected fibroblasts and osteoblasts at 1, 3, and 7 days after gene transfection. The human VEGF165 levels peaked at Day 1 and then gradually reduced expression in both transfected fibroblasts and osteoblasts. Two endogenous rat VEGF isoforms were detected in this cell culture model: rat VEGF120 and rat VEGF164. We compared the rat VEGF120 and rat VEGF164 expression level of the fibroblasts or osteoblasts that were transfected with human VEGF165, with nontransfected control cells. Both the transfected fibroblasts and osteoblasts showed greater expression of rat VEGF164 than nontransfected controls at Day 1 (peak level) and Day 3, but not at Day 7. The expression of rat VEGF120 was lower in transfected fibroblasts, but higher in transfected osteoblasts, than the relevant control groups at any time point

OCT-4 expression in follicular and luteal phase endometrium: a pilot study

Directory of Open Access Journals (Sweden)

Huber Johannes C

2010-04-01

Full Text Available Abstract Background The stem cell marker Octamer-4 (OCT-4 is expressed in human endometrium. Menstrual cycle-dependency of OCT-4 expression has not been investigated to date. Methods In a prospective, single center cohort study of 98 women undergoing hysteroscopy during the follicular (n = 49 and the luteal (n = 40 phases of the menstrual cycle, we obtained endometrial samples. Specimens were investigated for OCT-4 expression on the mRNA and protein levels using reverse transcriptase polymerase chain reaction (RT-PCR and immunohistochemistry. Expression of OCT-4 was correlated to menstrual cycle phase. Results Of 89 women sampled, 49 were in the follicular phase and 40 were in the luteal phase. OCT-4 mRNA was detected in all samples. Increased OCT-4 mRNA levels in the follicular and luteal phases was found in 35/49 (71% and 27/40 (68% of women, respectively (p = 0.9. Increased expression of OCT-4 protein was identified in 56/89 (63% samples. Increased expression of OCT-4 protein in the follicular and luteal phases was found in 33/49 (67% and 23/40 (58% of women, respectively (p = 0.5. Conclusions On the mRNA and protein levels, OCT-4 is not differentially expressed during the menstrual cycle. Endometrial OCT-4 is not involved in or modulated by hormone-induced cyclical changes of the endometrium.

Andrographolide reversed 5-FU resistance in human colorectal cancer by elevating BAX expression.

Science.gov (United States)

Wang, Weicheng; Guo, Wenjie; Li, Lele; Fu, Zan; Liu, Wen; Gao, Jian; Shu, Yongqian; Xu, Qiang; Sun, Yang; Gu, Yanhong

2016-12-01

5-FU is the first line therapy for colorectal cancer, however, treatment effect is often hampered by the development of drug resistance or toxicity at high doses. Andrographolide is a natural diterpenoid from Andrographis paniculata which has anti-bacterial, anti-antiviral and anti-inflammation activities. In the current study, we test the hypothesis that Andrographolide reverses 5-FU resistance in colorectal cancer and examine the underlying mechanism. In vitro and vivo studies indicated that Andrographolide treatment significantly re-sensitizes HCT116/5-FUR cells (HCT116 cells which are 5-FU resistant) to cytotoxicity of 5-FU. Mechanism analysis showed that Andrographolide/5-FU co-treatment elevated apoptosis level of HCT116/5-FUR cells with highly increased level of BAX. By using biotin-Andrographolide pull down and cellular thermal shift assay, we found out that Andrographolide can directly target to BAX. Andrographolide-BAX interaction prevented BAX degradation, enhancing mitochondria-mediated apoptosis thus reversed 5-FU resistance while BAX silence diminished this effect. Further, by analyzing patient samples who received 5-FU involved chemotherapy, we found that expression level of BAX is correlated with PFS. Our results here provide a novel combination treatment strategy, especially for patients with 5-FU-resistant tumors expressing low level of BAX. Meanwhile, we also proposed that BAX expression may be a predicted and prognosis marker of 5-FU involved chemotherapy. Copyright © 2016 Elsevier Inc. All rights reserved.

Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

Directory of Open Access Journals (Sweden)

Turyadi Turyadi

2018-01-01

Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

Hyperglycemia decreases preoxiredoxin-2 expression in a middle cerebral artery occlusion model.

Science.gov (United States)

Koh, Phil-Ok

2017-06-01

Diabetes is a major risk factor for stroke and is also associated with worsened outcomes following a stroke. Peroxiredoxin-2 exerts potent neuroprotective effects against oxidative stress. In the present study, we identified altered peroxiredoxin-2 expression in an ischemic stroke model under hyperglycemic conditions. Adult male rats were administrated streptozotocin (40 mg/kg) via intraperitoneal injection to induce diabetes. Middle cerebral artery occlusion (MCAO) was induced surgically 4 weeks after streptozotocin treatment and cerebral cortex tissues were isolated 24 hours after MCAO. Peroxiredoxin-2 expression was evaluated in the cerebral cortex of MCAO-operated animals using a proteomics approach, and was found to be decreased. In addition, the reduction in peroxiredoxin-2 levels was more severe in cerebral ischemia with diabetes compared to animals without diabetes. Reverse-transcriptase PCR and Western blot analyses confirmed the significantly reduced peroxiredoxin-2 expression in MCAO-operated animals under hyperglycemic conditions. It is an accepted fact that peroxiredoxin-2 has antioxidative activity against ischemic injury. Thus, the findings of this study suggest that a more severe reduction in peroxiredoxin-2 under hyperglycemic conditions leads to worsened brain damage during cerebral ischemia with diabetes.

High Frequency Electromagnetic Field Induces Lipocalin 2 Expression in

Directory of Open Access Journals (Sweden)

Amaneh Mohammadi Roushandeh

2010-06-01

Full Text Available Objective(sNeutrophil gelatinase-associated lipocalin (NGAL/Lcn2, comprise a group of small extracellular proteins with a common β-sheet-dominated 3-dimensional structure. In the past, it was assumed that the predominant role of lipocalin was acting as transport proteins. Recently it has been found that oxidative stress induces Lcn2 expression. It has been also proved that electromagnetic field (EMF produces reactive oxygen species (ROS in different tissues. Expression of Lcn2 following exposure to electromagnetic field has been investigated in this study. Materials and MethodsBalb/c mice (8 weeks old were exposed to 3 mT, 50 HZ EMF for 2 months, 4 hr/day. Afterwards, the mice were sacrificed by cervical dislocation and livers were removed. The liver specimens were stained with Haematoxylin- Eosin (H&E and analyzed under an optical microscope. Total RNA was extracted from liver and reverse transcription was performed by SuperScript III reverse transcriptase with 1 µg of total RNA. Assessment of Lcn2 expression was performed by semiquantitative and real time- PCR.ResultsThe light microscopic studies revealed that the number of lymphocyte cells was increased compared to control and dilation of sinosoids was observed in the liver. Lcn2 was up-regulated in the mice exposed to EMF both in mRNA and protein levels.ConclusionTo the extent of our knowledge, this is the first report dealing with up-regulation of Lcn2 in liver after exposure to EMF. The up-regulation might be a compensatory response that involves cell defense pathways and protective effects against ROS. However, further and complementary studies are required in this regards.

Safety, tolerability and pharmacokinetics of doravirine, a novel HIV non-nucleoside reverse transcriptase inhibitor, after single and multiple doses in healthy subjects.

Science.gov (United States)

Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R

2015-01-01

Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once

Body composition and metabolic outcomes after 96 weeks of treatment with ritonavir-boosted lopinavir plus either nucleoside or nucleotide reverse transcriptase inhibitors or raltegravir in patients with HIV with virological failure of a standard first-line antiretroviral therapy regimen: a substudy of the randomised, open-label, non-inferiority SECOND-LINE study.

Science.gov (United States)

Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A

2017-01-01

Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N

Application of anti-listerial bacteriocins: monitoring enterocin expression by multiplex relative reverse transcription-PCR.

Science.gov (United States)

Williams, D Ross; Chanos, Panagiotis

2012-12-01

Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.

Placental growth factor expression is reversed by antivascular endothelial growth factor therapy under hypoxic conditions.

Science.gov (United States)

Zhou, Ai-Yi; Bai, Yu-Jing; Zhao, Min; Yu, Wen-Zhen; Huang, Lv-Zhen; Li, Xiao-Xin

2014-08-01

Clinical trials have revealed that the antivascular endothelial growth factor (VEGF) therapies are effective in retinopathy of prematurity (ROP). But the low level of VEGF was necessary as a survival signal in healthy conditions, and endogenous placental growth factor (PIGF) is redundant for development. The purpose of this study was to elucidate the PIGF expression under hypoxia as well as the influence of anti-VEGF therapy on PIGF. CoCl2-induced hypoxic human umbilical vein endothelial cells (HUVECs) were used for an in vitro study, and oxygen-induced retinopathy (OIR) mice models were used for an in vivo study. The expression patterns of PIGF under hypoxic conditions and the influence of anti-VEGF therapy on PIGF were evaluated by quantitative reverse transcription-polymerase chain reaction (RTPCR). The retinal avascular areas and neovascularization (NV) areas of anti-VEGF, anti-PIGF and combination treatments were calculated. Retina PIGF concentration was evaluated by ELISA after treatment. The vasoactive effects of exogenous PIGF on HUVECs were investigated by proliferation and migration studies. PIGF mRNA expression was reduced by hypoxia in OIR mice, in HUVECs under hypoxia and anti-VEGF treatment. However, PIGF expression was reversed by anti-VEGF therapy in the OIR model and in HUVECs under hypoxia. Exogenous PIGF significantly inhibited HUVECs proliferation and migration under normal conditions, but it stimulated cell proliferation and migration under hypoxia. Anti-PIGF treatment was effective for neovascular tufts in OIR mice (P<0.05). The finding that PIGF expression is iatrogenically up-regulated by anti-VEGF therapy provides a consideration to combine it with anti-PIGF therapy.

Inflammatory responses to induced infectious endometritis in mares resistant or susceptible to persistent endometritis

DEFF Research Database (Denmark)

Christoffersen, Mette; Woodward, Elizabeth; Bojesen, Anders Miki

2012-01-01

. Endometrial biopsies were obtained 3, 12, 24 and 72 hours (h) after bacterial inoculation and blood samples were obtained during the 7 day period post bacterial inoculation. Expression levels of cytokines and SAA were determined by quantitative real-time reverse transcriptase PCR (qRT-PCR)....

Altered expression of versican and hyaluronan in melanocytic tumors of dogs.

Science.gov (United States)

Docampo, María-José; Rabanal, Rosa M; Miquel-Serra, Laia; Hernández, Daniel; Domenzain, Clelia; Bassols, Anna

2007-12-01

To analyze the expression of versican and hyaluronan in melanocytomas and malignant melanomas of dogs, to correlate their expression with expression of the hyaluronan receptor CD44, and to identify enzymes responsible for the synthesis and degradation of hyaluronan in canine dermal fibroblasts and canine melanoma cell lines. 35 biopsy specimens from melanocytic tumors of dogs, canine primary dermal fibroblasts, and 3 canine melanoma cell lines. Versican, hyaluronan, and CD44 were detected in tumor samples by use of histochemical or immunohistochemical methods. Expression of hyaluronan-metabolizing enzymes was analyzed with a reverse transcriptase-PCR assay. Versican was found only in some hair follicles and around some blood vessels in normal canine skin, whereas hyaluronan was primarily found within the dermis. Hyaluronan was found in connective tissue of the oral mucosa. Versican and, to a lesser extent, hyaluronan were significantly overexpressed in malignant melanomas, compared with expression in melanocytomas. No significant difference was found between malignant tumors from oral or cutaneous origin. The expression of both molecules was correlated, but hyaluronan had a more extensive distribution than versican. Versican and hyaluronan were mainly associated with tumor stroma. Canine fibroblasts and melanoma cell lines expressed hyaluronan synthase 2 and 3 (but not 1) and hyaluronidase 1 and 2. Versican may be useful as a diagnostic marker for melanocytic tumors in dogs. Knowledge of the enzymes involved in hyaluronan metabolism could reveal new potential therapeutic targets.

Expression and biological-clinical significance of hTR, hTERT and CKS2 in washing fluids of patients with bladder cancer

Directory of Open Access Journals (Sweden)

Talesa Vincenzo N

2010-10-01

Full Text Available Abstract Background at present, pathogenesis of bladder cancer (BC has not been fully elucidated. Aim of this study is to investigate the role of human telomerase RNA (hTR, human telomerase reverse transcriptase (hTERT and CDC28 protein kinase regulatory subunit 2 (CKS2 in bladder carcinogenesis and their possible clinical significance; Methods the transcript levels of hTR, hTERT and CKS2 were quantified by Real time reverse transcriptase chain reaction in exfoliated cells from bladder washings of 36 patients with BC and 58 controls. The statistical significance of differences between BC bearing patients and control groups, in the general as well as in the stratified analysis (superficial or invasive BC, was assessed by Student's t test. Non parametric Receiver Operating Characteristics analysis (ROC was performed to ascertain the accuracy of study variables to discriminate between BC and controls. The clinical value of concomitant examination of hTR, hTERT and CKS2 was evaluated by logistic regression analysis; Results a significant decrease in hTR and a significant increase in hTERT or CKS2 gene expression were found between BC bearing patients and controls, as well as in the subgroups analysis. The area under the curve (AUC indicated an average discrimination power for the three genes, both in the general and subgroups analysis, when singularly considered. The ability to significantly discriminate between superficial and invasive BC was observed only for hTR transcript levels. A combined model including hTR and CKS2 was the best one in BC diagnosis; Conclusions our results, obtained from a sample set particularly rich of exfoliated cells, provide further molecular evidence on the involvement of hTR, hTERT and CKS2 gene expression in BC carcinogenesis. In particular, while hTERT and CKS2 gene expression seems to have a major involvement in the early stages of the disease, hTR gene expression, seems to be more involved in progression. In

Fatty acid composition and desaturase gene expression in flax (Linum usitatissimum L.).

Science.gov (United States)

Thambugala, Dinushika; Cloutier, Sylvie

2014-11-01

Little is known about the relationship between expression levels of fatty acid desaturase genes during seed development and fatty acid (FA) composition in flax. In the present study, we looked at promoter structural variations of six FA desaturase genes and their relative expression throughout seed development. Computational analysis of the nucleotide sequences of the sad1, sad2, fad2a, fad2b, fad3a and fad3b promoters showed several basic transcriptional elements including CAAT and TATA boxes, and several putative target-binding sites for transcription factors, which have been reported to be involved in the regulation of lipid metabolism. Using semi-quantitative reverse transcriptase PCR, the expression patterns throughout seed development of the six FA desaturase genes were measured in six flax genotypes that differed for FA composition but that carried the same desaturase isoforms. FA composition data were determined by phenotyping the field grown genotypes over four years in two environments. All six genes displayed a bell-shaped pattern of expression peaking at 20 or 24 days after anthesis. Sad2 was the most highly expressed. The expression of all six desaturase genes did not differ significantly between genotypes (P = 0.1400), hence there were no correlations between FA desaturase gene expression and variations in FA composition in relatively low, intermediate and high linolenic acid genotypes expressing identical isoforms for all six desaturases. These results provide further clues towards understanding the genetic factors responsible for FA composition in flax.

Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

Science.gov (United States)

Patick, A K; Boritzki, T J; Bloom, L A

1997-10-01

Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

Prevalence of Ambler class A β-lactamases and ampC expression in cephalosporin-resistant isolates of Acinetobacter baumannii.

Science.gov (United States)

Rezaee, Mohammad Ahangarzadeh; Pajand, Omid; Nahaei, Mohammad Reza; Mahdian, Reza; Aghazadeh, Mohammad; Ghojazadeh, Morteza; Hojabri, Zoya

2013-07-01

We examined the prevalence of various cephalosporins' resistance mechanisms in Acinetobacter baumannii clinical isolates. Phenotypic and molecular detection of Ambler classes A, B and D β-lactamases was performed on 75 isolates. Clonal relatedness was defined using Repetitive Extragenic Palindromic PCR. PCR mapping was used to examine the linkage of insertion sequences and the ampC gene, and ampC expression was analyzed by TaqMan reverse transcriptase-PCR. Twenty-six (37%) isolates carried at least one of the blaPER-1 or blaTEM-1. Sixty-nine (98.5%) out of 70 cephalosporin-resistant isolates had insertions upstream of the ampC gene, of which 48 (69%) and 6 (8%) were identified as ISAba1and ISAba125, respectively. Higher level of expression was obtained in resistant isolates lacking ISAba1/ampC combination in comparison with that in positive ones. The ability to up-regulate the expression of ampC gene in association with different insertion elements has become an important factor in A. baumannii resistance to cephalosporins. Copyright © 2013 Elsevier Inc. All rights reserved.

Development of a reverse genetics system to generate a recombinant Ebola virus Makona expressing a green fluorescent protein

Energy Technology Data Exchange (ETDEWEB)

Albariño, César G., E-mail: calbarino@cdc.gov; Wiggleton Guerrero, Lisa; Lo, Michael K.; Nichol, Stuart T.; Towner, Jonathan S.

2015-10-15

Previous studies have demonstrated the potential application of reverse genetics technology in studying a broad range of aspects of viral biology, including gene regulation, protein function, cell entry, and pathogenesis. Here, we describe a highly efficient reverse genetics system used to generate recombinant Ebola virus (EBOV) based on a recent isolate from a human patient infected during the 2014–2015 outbreak in Western Africa. We also rescued a recombinant EBOV expressing a fluorescent reporter protein from a cleaved VP40 protein fusion. Using this virus and an inexpensive method to quantitate the expression of the foreign gene, we demonstrate its potential usefulness as a tool for screening antiviral compounds and measuring neutralizing antibodies. - Highlights: • Recombinant Ebola virus (EBOV) derived from Makona variant was rescued. • New protocol for viral rescue allows 100% efficiency. • Modified EBOV expresses a green fluorescent protein from a VP40-fused protein. • Modified EBOV was tested as tool to screen antiviral compounds and measure neutralizing antibodies.

Development of a reverse genetics system to generate a recombinant Ebola virus Makona expressing a green fluorescent protein

International Nuclear Information System (INIS)

Albariño, César G.; Wiggleton Guerrero, Lisa; Lo, Michael K.; Nichol, Stuart T.; Towner, Jonathan S.

2015-01-01

Previous studies have demonstrated the potential application of reverse genetics technology in studying a broad range of aspects of viral biology, including gene regulation, protein function, cell entry, and pathogenesis. Here, we describe a highly efficient reverse genetics system used to generate recombinant Ebola virus (EBOV) based on a recent isolate from a human patient infected during the 2014–2015 outbreak in Western Africa. We also rescued a recombinant EBOV expressing a fluorescent reporter protein from a cleaved VP40 protein fusion. Using this virus and an inexpensive method to quantitate the expression of the foreign gene, we demonstrate its potential usefulness as a tool for screening antiviral compounds and measuring neutralizing antibodies. - Highlights: • Recombinant Ebola virus (EBOV) derived from Makona variant was rescued. • New protocol for viral rescue allows 100% efficiency. • Modified EBOV expresses a green fluorescent protein from a VP40-fused protein. • Modified EBOV was tested as tool to screen antiviral compounds and measure neutralizing antibodies

Regulation of MYCN expression in human neuroblastoma cells

International Nuclear Information System (INIS)

Jacobs, Joannes FM; Bokhoven, Hans van; Leeuwen, Frank N van; Hulsbergen-van de Kaa, Christina A; Vries, I Jolanda M de; Adema, Gosse J; Hoogerbrugge, Peter M; Brouwer, Arjan PM de

2009-01-01

Amplification of the MYCN gene in neuroblastoma (NB) is associated with a poor prognosis. However, MYCN-amplification does not automatically result in higher expression of MYCN in children with NB. We hypothesized that the discrepancy between MYCN gene expression and prognosis in these children might be explained by the expression of either MYCN-opposite strand (MYCNOS) or the shortened MYCN-isoform (ΔMYCN) that was recently identified in fetal tissues. Both MYCNOS and ΔMYCN are potential inhibitors of MYCN either at the mRNA or at the protein level. Expression of MYCN, MYCNOS and ΔMYCN was measured in human NB tissues of different stages. Transcript levels were quantified using a real-time reverse transcriptase polymerase chain reaction assay (QPCR). In addition, relative expression of these three transcripts was compared to the number of MYCN copies, which was determined by genomic real-time PCR (gQPCR). Both ΔMYCN and MYCNOS are expressed in all NBs examined. In NBs with MYCN-amplification, these transcripts are significantly higher expressed. The ratio of MYCN:ΔMYCN expression was identical in all tested NBs. This indicates that ΔMYCN and MYCN are co-regulated, which suggests that ΔMYCN is not a regulator of MYCN in NB. However, the ratio of MYCNOS:MYCN expression is directly correlated with NB disease stage (p = 0.007). In the more advanced NB stages and NBs with MYCN-amplification, relatively more MYCNOS is present as compared to MYCN. Expression of the antisense gene MYCNOS might be relevant to the progression of NB, potentially by directly inhibiting MYCN transcription by transcriptional interference at the DNA level. The MYCNOS:MYCN-ratio in NBs is significantly correlated with both MYCN-amplification and NB-stage. Our data indicate that in NB, MYCN expression levels might be influenced by MYCNOS but not by ΔMYCN

Cell-Specific Expression of Homospermidine Synthase, the Entry Enzyme of the Pyrrolizidine Alkaloid Pathway in Senecio vernalis, in Comparison with Its Ancestor, Deoxyhypusine Synthase1

Science.gov (United States)

Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich

2002-01-01

Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485

Expression of cytokines in chicken peripheral mononuclear blood cells (PMBCs exposed to probiotic strains and Salmonella Enteritidis

Directory of Open Access Journals (Sweden)

Eva Husáková

2015-01-01

Full Text Available The mRNA expression of interleukin (IL-1β, LITAF, iNOS, macrophage inflammatory protein (MIP1-ß, and K60 were examined in peripheral blood mononuclear cells (PMBCs. The PMBCs were isolated from the chicken blood and in vitro exposed to the probiotic strains E. faecium AL41, E. faecium H31, L. fermentum AD1, and infected with Salmonella enterica serovar Enteritidis (SE147. The PMBCs were evaluated for mRNA expression levels at 24 h and 48 h post infection (p.i. using the reverse transcriptase polymerase chain reaction (RT-PCR. The level of expression of IL-1ß and MIP1-ß was upregulated (P S. Enteritidis + E. faecium AL41 group 48 h p.i. compared to 24 h p.i. Similarly, expression of LITAF was upregulated (P S. Enteritidis (SE group 48 h p.i. In PMBCs treated with E. faecium H31 and S. Enteritidis expression of IL-1ß (P P P E. faecium AL41 demonstrated the highest immunostimulatory effect on expression of selected cytokines by chicken PMBCs after Salmonella infection. It is supposed that the differences in cytokine induction within SE groups are related to lymphocytes isolated from different animals.

Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel

Science.gov (United States)

Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella

2005-01-01

The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡

Science.gov (United States)

Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

2011-01-01

Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

Science.gov (United States)

Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

2017-08-02

Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

Directory of Open Access Journals (Sweden)

Soo-Huey Yap

2007-12-01

Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

Fine-mapping identifies multiple prostate cancer risk loci at 5p15, one of which associates with TERT expression

Science.gov (United States)

Kote-Jarai, Zsofia; Saunders, Edward J.; Leongamornlert, Daniel A.; Tymrakiewicz, Malgorzata; Dadaev, Tokhir; Jugurnauth-Little, Sarah; Ross-Adams, Helen; Al Olama, Ali Amin; Benlloch, Sara; Halim, Silvia; Russel, Roslin; Dunning, Alison M.; Luccarini, Craig; Dennis, Joe; Neal, David E.; Hamdy, Freddie C.; Donovan, Jenny L.; Muir, Ken; Giles, Graham G.; Severi, Gianluca; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A.; Schumacher, Fredrick; Henderson, Brian E.; Le Marchand, Loic; Lindstrom, Sara; Kraft, Peter; Hunter, David J.; Gapstur, Susan; Chanock, Stephen; Berndt, Sonja I.; Albanes, Demetrius; Andriole, Gerald; Schleutker, Johanna; Weischer, Maren; Canzian, Federico; Riboli, Elio; Key, Tim J.; Travis, Ruth C.; Campa, Daniele; Ingles, Sue A.; John, Esther M.; Hayes, Richard B.; Pharoah, Paul; Khaw, Kay-Tee; Stanford, Janet L.; Ostrander, Elaine A.; Signorello, Lisa B.; Thibodeau, Stephen N.; Schaid, Dan; Maier, Christiane; Vogel, Walther; Kibel, Adam S.; Cybulski, Cezary; Lubinski, Jan; Cannon-Albright, Lisa; Brenner, Hermann; Park, Jong Y.; Kaneva, Radka; Batra, Jyotsna; Spurdle, Amanda; Clements, Judith A.; Teixeira, Manuel R.; Govindasami, Koveela; Guy, Michelle; Wilkinson, Rosemary A.; Sawyer, Emma J.; Morgan, Angela; Dicks, Ed; Baynes, Caroline; Conroy, Don; Bojesen, Stig E.; Kaaks, Rudolf; Vincent, Daniel; Bacot, François; Tessier, Daniel C.; Easton, Douglas F.; Eeles, Rosalind A.

2013-01-01

Associations between single nucleotide polymorphisms (SNPs) at 5p15 and multiple cancer types have been reported. We have previously shown evidence for a strong association between prostate cancer (PrCa) risk and rs2242652 at 5p15, intronic in the telomerase reverse transcriptase (TERT) gene that encodes TERT. To comprehensively evaluate the association between genetic variation across this region and PrCa, we performed a fine-mapping analysis by genotyping 134 SNPs using a custom Illumina iSelect array or Sequenom MassArray iPlex, followed by imputation of 1094 SNPs in 22 301 PrCa cases and 22 320 controls in The PRACTICAL consortium. Multiple stepwise logistic regression analysis identified four signals in the promoter or intronic regions of TERT that independently associated with PrCa risk. Gene expression analysis of normal prostate tissue showed evidence that SNPs within one of these regions also associated with TERT expression, providing a potential mechanism for predisposition to disease. PMID:23535824

The Effect of 5 FU on the Expression of Transforming Growth Factor Beta-1 (Tgf-1 in Cultured Tendon Cells

Directory of Open Access Journals (Sweden)

Zeynep Karacor Altuntas

2014-10-01

Full Text Available This study investigated the effect of the treatment with 1 min exposures to 5-fluorouracil (5-FU  on the expression of TGF-beta 1 in cultured tendon cells. Fibroblasts cultured from the flexor tendons of dog paws were treated with 3 different doses of 5-FU ( control, 5-15-25 mgr /ml for 1 minute.  After 5-FU exposure  the expression of TGF –beta 1 were tested by real time Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR at 3rd and 7th days. There were no statistically significant differences in the expression levels of the TGF-b1 gene between the control group and all other groups on day 3 and 7 (p>0.05.However, when the percentage changes in the TGF-BETA1 gene expression on days 3–7 were compared, there were statistically significant differences and this was maximally observed with 89% +12 (p<0.05 in the group treated with 25-mg/ml 5-FU.  We conclude that 1min. 5-FU application may be  sufficient to prevent adhesions in tendon healing by limiting the expression of TGF-BETA1. 

Expression of osteoblast and osteoclast regulatory genes in the bone marrow microenvironment in multiple myeloma

DEFF Research Database (Denmark)

Kristensen, Ida B; Christensen, Jacob Haaber; Lyng, Maria Bibi

2014-01-01

Multiple myeloma (MM) lytic bone disease (LBD) is caused by osteoclast activation and osteoblast inhibition. RANK/RANKL/OPG play central roles in osteoclast activation and Wnt inhibitor DKK1 in osteoblast inhibition. The role of other Wnt inhibitors is less clear. We evaluated gene expression...... of osteoclast regulators (RANK, RANKL, OPG, TRAIL, MIP1A), Wnt inhibitors (DKK1, SFRP2, SFRP3, sclerostin, WIF1) and osteoblast transcription factors (RUNX2, osterix) by quantitative reverse transcriptase polymerase chain reaction (RT-PCR) in the bone marrow (BM) microenvironment using snap-frozen BM biopsies...... radiographs and the bone resorption marker CTX-1. Protein levels were evaluated by enzyme-linked immunosorbent assay (ELISA) and immunohistochemistry. Among Wnt inhibitors, only SFRP3 and DKK1 were significantly overexpressed in advanced LBD, correlating with protein levels. SFRP3 correlated with CTX-1. Our...

Effectiveness of gene expression profiling for response prediction of rectal cancer to preoperative radiotherapy

International Nuclear Information System (INIS)

Ojima, Eiki; Inoue, Yasuhiro; Miki, Chikao; Kusunoki, Masato; Mori, Masaki

2007-01-01

Our aim was to determine whether the expression levels of specific genes could predict clinical radiosensitivity in human colorectal cancer. Radioresistant colorectal cancer cell lines were established by repeated X-ray exposure (total, 100 Gy), and the gene expressions of the parent and radioresistant cell lines were compared in a microarray analysis. To verify the microarray data, we carried out a reverse transcriptase-polymerase chain reaction analysis of identified genes in clinical samples from 30 irradiated rectal cancer patients. A comparison of the intensity data for the parent and three radioresistant cell lines revealed 17 upregulated and 142 downregulated genes in all radioresistant cell lines. Next, we focused on two upregulated genes, PTMA (prothymosin α) and EIF5a2 (eukaryotic translation initiation factor 5A), in the radioresistant cell lines. In clinical samples, the expression of PTMA was significantly higher in the minor effect group than in the major effect group (P=0.004), but there were no significant differences in EIF5a2 expression between the two groups. We identified radiation-related genes in colorectal cancer and demonstrated that PTMA may play an important role in radiosensitivity. Our findings suggest that PTMA may be a novel marker for predicting the effectiveness of radiotherapy in clinical cases. (author)

Prostacyclin synthase expression and epigenetic regulation in nonsmall cell lung cancer.

LENUS (Irish Health Repository)

Cathcart, Mary-Clare

2012-02-01

BACKGROUND: Prostacyclin synthase (PGIS) metabolizes prostaglandin H(2), into prostacyclin. This study aimed to determine the expression profile of PGIS in nonsmall cell lung cancer (NSCLC) and examine potential mechanisms involved in PGIS regulation. METHODS: PGIS expression was examined in human NSCLC and matched controls by reverse transcriptase polymerase chain reaction (RT-PCR), Western analysis, and immunohistochemistry. A 204-patient NSCLC tissue microarray was stained for PGIS and cyclooxygenase 2 (COX2) expression. Staining intensity was correlated with clinical parameters. Epigenetic mechanisms underpinning PGIS promoter expression were examined using RT-PCR, methylation-specific PCR, and chromatin immunoprecipitation analysis. RESULTS: PGIS expression was reduced\\/absent in human NSCLC protein samples (P < .0001), but not mRNA relative to matched controls. PGIS tissue expression was higher in squamous cell carcinoma (P = .004) and in male patients (P < .05). No significant correlation of PGIS or COX2 expression with overall patient survival was observed, although COX2 was prognostic for short-term (2-year) survival (P < .001). PGIS mRNA expression was regulated by DNA CpG methylation and histone acetylation in NSCLC cell lines, with chromatin remodeling taking place directly at the PGIS gene. PGIS mRNA expression was increased by both demethylation agents and histone deacetylase inhibitors. Protein levels were unaffected by demethylation agents, whereas PGIS protein stability was negatively affected by histone deacetylase inhibitors. CONCLUSIONS: PGIS protein expression is reduced in NSCLC, and does not correlate with overall patient survival. PGIS expression is regulated through epigenetic mechanisms. Differences in expression patterns between mRNA and protein levels suggest that PGIS expression and protein stability are regulated post-translationally. PGIS protein stability may have an important therapeutic role in NSCLC.

Microarray analysis of the gene expression profile in triethylene glycol dimethacrylate-treated human dental pulp cells.

Science.gov (United States)

Torun, D; Torun, Z Ö; Demirkaya, K; Sarper, M; Elçi, M P; Avcu, F

2017-11-01

Triethylene glycol dimethacrylate (TEGDMA) is an important resin monomer commonly used in the structure of dental restorative materials. Recent studies have shown that unpolymerized resin monomers may be released into the oral environment and cause harmful biological effects. We investigated changes in the gene expression profiles of TEGDMA-treated human dental pulp cells (hDPCs) following short- (1-day) and long-term (7-days) exposure. HDPCs were exposed to a noncytotoxic concentration of TEGDMA, and gene expression profiles were evaluated by microarray analysis. The results were confirmed by quantitative reverse-transcriptase PCR (qRT PCR). In total, 1282 and 1319 genes (up- or down-regulated) were differentially expressed compared with control group after the 1- and 7-day incubation periods, respectively. Biological ontology-based analyses revealed that metabolic, cellular, and developmental processes constituted the largest groups of biological functional processes. qRT-PCR analysis on bone morphogenetic protein-2 (BMP-2), BMP-4, secreted protein, acidic, cysteine-rich, collagen type I alpha 1, oxidative stress-induced growth inhibitor 1, MMP3, interleukin-6, and heme oxygenase-1 genes confirmed the changes in expression observed in the microarray analysis. Our results suggest that TEGDMA can change the many functions of hDPCs through large changes in gene expression levels and complex interactions with different signaling pathways.

Characterisation of a human acid-sensing ion channel (hASIC1a) endogenously expressed in HEK293 cells.

Science.gov (United States)

Gunthorpe, M J; Smith, G D; Davis, J B; Randall, A D

2001-08-01

Acid-sensing ion channels (ASICs) are a new and expanding family of proton-gated cation (Na+/Ca2+) channels that are widely expressed in sensory neurons and the central nervous system. Their distribution suggests that they may play a critical role in the sensation of the pain that accompanies tissue acidosis and may also be important in detecting the subtle pH variations that occur during neuronal signalling. Here, using whole-cell patch-clamp electrophysiology and reverse transcriptase-polymerase chain reaction (RT-PCR), we show that HEK293 cells, a commonly used cell line for the expression and characterisation of many ion channels, functionally express an endogenous proton-gated conductance attributable to the activity of human ASIC1a. These data therefore represent the first functional characterisation of hASIC1 and have many important implications for the use of HEK293 cells as a host cell system for the study of ASICs, vanilloid receptor-1 and any other proton-gated channel. With this latter point in mind we have devised a simple desensitisation strategy to selectively remove the contribution of hASIC1a from proton-gated currents recorded from HEK293 cells expressing vanilloid receptor-1.

Upregulation of neurokinin-1 receptor expression in the lungs of patients with sarcoidosis.

LENUS (Irish Health Repository)

O'Connor, Terence M

2012-02-03

Substance P (SP) is a proinflammatory neuropeptide that is secreted by sensory nerves and inflammatory cells. Increased levels of SP are found in sarcoid bronchoalveolar lavage fluid. SP acts by binding to the neurokinin-1 receptor and increases secretion of tumor necrosis factor-alpha in many cell types. We sought to determine neurokinin-1 receptor expression in patients with sarcoidosis compared with normal controls. Neurokinin-1 receptor messenger RNA and protein expression were below the limits of detection by reverse transcriptase-polymerase chain reaction and immunohistochemistry in peripheral blood mononuclear cells of healthy volunteers (n = 9) or patients with stage 1 or 2 pulmonary sarcoidosis (n = 10), but were detected in 1\\/9 bronchoalveolar lavage cells of controls compared with 8\\/10 patients with sarcoidosis (p = 0.012) and 2\\/9 biopsies of controls compared with 9\\/10 patients with sarcoidosis (p = 0.013). Immunohistochemistry localized upregulated neurokinin-1 receptor expression to bronchial and alveolar epithelial cells, macrophages, lymphocytes, and sarcoid granulomas. The patient in whom neurokinin-1 receptor was not detected was taking corticosteroids. Incubation of the type II alveolar and bronchial epithelial cell lines A549 and SK-LU 1 with dexamethasone downregulated neurokinin-1 receptor expression. Upregulated neurokinin-1 receptor expression in patients with sarcoidosis may potentiate substance P-induced proinflammatory cytokine production in patients with sarcoidosis.

Fine-mapping identifies multiple prostate cancer risk loci at 5p15, one of which associates with TERT expression

DEFF Research Database (Denmark)

Kote-Jarai, Zsofia; Saunders, Edward J; Leongamornlert, Daniel A

2013-01-01

Associations between single nucleotide polymorphisms (SNPs) at 5p15 and multiple cancer types have been reported. We have previously shown evidence for a strong association between prostate cancer (PrCa) risk and rs2242652 at 5p15, intronic in the telomerase reverse transcriptase (TERT) gene that...

A role for prostaglandins in rapid cycling suggested by episode-specific gene expression shifts in peripheral blood mononuclear cells

DEFF Research Database (Denmark)

Gurvich, Artem; Begemann, Martin; Dahm, Liane

2014-01-01

and quantitative real-time reverse transcriptase polymerase chain reaction for prostaglandin D2 synthase (PTGDS), aldo-ketoreductase family 1, member C3 (AKR1C3), cyclooxygenase-2 (PAN means all splice variants) (COX2PAN ), prostaglandin-endoperoxide synthase 2 (PTGS2), and purinergic receptor P2X, ligand...

Differential expression of Toll-like receptor pathway genes in chicken embryo fibroblasts from chickens resistant and susceptible to Marek's disease.

Science.gov (United States)

Haunshi, Santosh; Cheng, Hans H

2014-03-01

The Toll-like receptor (TLR) signaling pathway is one of the innate immune defense mechanisms against pathogens in vertebrates and invertebrates. However, the role of TLR in non-MHC genetic resistance or susceptibility to Marek's disease (MD) in the chicken is yet to be elucidated. Chicken embryo fibroblast (CEF) cells from MD susceptible and resistant lines were infected either with Marek's disease virus (MDV) or treated with polyionosinic-polycytidylic acid, a synthetic analog of dsRNA, and the expression of TLR and pro-inflammatory cytokines was studied at 8 and 36 h posttreatment by quantitative reverse transcriptase PCR. Findings of the present study reveal that MDV infection and polyionosinic-polycytidylic acid treatment significantly elevated the mRNA expression of TLR3, IL6, and IL8 in both susceptible and resistant lines. Furthermore, basal expression levels in uninfected CEF for TLR3, TLR7, and IL8 genes were significantly higher in resistant chickens compared with those of susceptible chickens. Our results suggest that TLR3 together with pro-inflammatory cytokines may play a significant role in genetic resistance to MD.

Endogenous and ectopic expression of telomere regulating genes in chicken embryonic fibroblasts

International Nuclear Information System (INIS)

Michailidis, Georgios; Saretzki, Gabriele; Hall, Judith

2005-01-01

In this study, we compared the endogenous expression of genes encoding telomere regulating proteins in cultured chicken embryonic fibroblasts (CEFs) and 10-day-old chicken embryos. CEFs maintained in vitro senesced and senescence was accompanied by reduced telomere length, telomerase activity, and expression of the chicken (c) TRF1 gene. There was no change in TRF2 gene expression although the major TRF2 transcript identified in 10-day-old chicken embryos encoded a truncated TRF2 protein (TRF2'), containing an N-terminal dimerisation domain but lacking a myb-related DNA binding domain and nuclear localisation signal. Senescence of the CEFs in vitro was associated with the loss of the TRF2' transcript, indicative of a novel function for the encoded protein. Senescence was also coupled with decreased expression of RAD51, but increased RAD52 expression. These data support that RAD51 independent recombination mechanisms do not function in vitro to maintain chicken telomeres. To attempt to rescue the CEFs from replicative senescence, we stably transfected passage 3 CEFs with the human telomerase reverse transcriptase (hTERT) catalytic subunit. While hTERT expression was detected in the stable transfectants neither telomerase activity nor the stabilisation of telomere length was observed, and the transfectant cells senesced at the same passage number as the untransfected cells. These data indicate that the human TERT is incompatible with the avian telomere maintenance apparatus and suggest the functioning of a species specific telomere system in the avian

Morphology, sex steroid level and gene expression analysis in gonadal sex reversal of triploid female (XXX) rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Xu, Gefeng; Huang, Tianqing; Jin, Xian; Cui, Cunhe; Li, Depeng; Sun, Cong; Han, Ying; Mu, Zhenbo

2016-02-01

In non-mammalian vertebrates, estrogens and expressions of cyp19a1 and foxl2 play critical roles in maintaining ovary differentiation and development, while dmrt1 and sox9 are male-specific genes in testicular differentiation and are highly conserved. In order to deeply understand the morphological change, sex steroids level and molecular mechanism of triploid female gonadal reversal in rainbow trout, we studied the ovary morphology, tendency of estradiol-17β (E2) and testosterone (T) levels and the relative expressions of dmrt1, cyp19a1, sox9 and foxl2 in juvenile and adult fish. Our results demonstrated that the development of triploid female gonads in rainbow trout went through arrested development, oocytes dedifferentiation, ovary reconstruction and sex reversal finally. During early gonadal development (154-334 days post-fertilization), the expressions of foxl2 and cyp19a1 increased linearly, while expressions of dmrt1 and sox9 were extremely suppressed, and E2 level was higher, while T level was lower. During the mid-to-late period of triploid female gonadal development (574-964 days post-fertilization), the expressions of dmrt1 and sox9 remained high and were very close to the quantity of diploid male genes, and T levels were even reaching diploid male plasma concentrations, while expressions of cyp19a1 and foxl2 were decreased, leading to decrease in E2 level. We realized that the development model of rainbow trout triploid female gonads was extremely rare, and the regulatory mechanism was very special. Genes involved in gonadal development and endogenous estrogens are pivotal factors in fish natural sex reversal.

Placenta-specific novel splice variants of Rho GDP dissociation inhibitor β are highly expressed in cancerous cells

Directory of Open Access Journals (Sweden)

Hatakeyama Keiichi

2012-12-01

Full Text Available Abstract Background Alternative splicing of pre-mRNA transcripts not only plays a role in normal molecular processes but is also associated with cancer development. While normal transcripts are ubiquitously expressed in normal tissues, splice variants created through abnormal alternative splicing events are often expressed in cancer cells. Although the Rho GDP dissociation inhibitor β (ARHGDIB gene has been found to be ubiquitously expressed in normal tissues and involved in cancer development, the presence of splice variants of ARHGDIB has not yet been investigated. Results Validation analysis for the presence of and exon structures of splice variants of ARHGDIB, performed using reverse-transcriptase polymerase chain reaction and DNA sequencing, successfully identified novel splice variants of ARHGDIB, that is, 6a, 6b, and 6c, in colon, pancreas, stomach, and breast cancer cell lines. Quantitative real-time polymerase chain reaction analysis showed that these variants were also highly expressed in normal placental tissue but not in other types of normal tissue. Conclusions Expression of ARHGDIB variants 6a, 6b, and 6c appears to be restricted to cancer cells and normal placental tissue, suggesting that these variants possess cancer-specific functions and, as such, are potential cancer-related biomarkers.

Immunohistochemical detection of human telomerase reverse transcriptase in oral cancer and pre-cancer

Directory of Open Access Journals (Sweden)

Jayanthi Palani

2011-01-01

Conclusion: There was increased expression of hTERT protein in OSCC and leukoplakia samples when compared to normal oral mucosa. The cellular localization, LI and LS in OSF were significantly different from OSCC and leukoplakia.

Oxidized low-density lipoproteins may induce expression of monocyte chemotactic protein-3 in atherosclerotic plaques

International Nuclear Information System (INIS)

Jang, Moon Kyoo; Kim, Ji Young; Jeoung, Nam Ho; Kang, Mi Ae; Choi, Myung-Sook; Oh, Goo Taeg; Nam, Kyung Tak; Lee, Won-Ha; Park, Yong Bok

2004-01-01

Genes induced or suppressed by oxidized low-density lipoproteins (oxLDL) in human monocytic THP-1 cells were searched using the differential display reverse transcriptase polymerase chain reaction. One of the differentially expressed (up-regulated) cDNA fragments was found to contain sequences corresponding to monocyte chemotactic protein-3 (MCP-3). The stimulatory effect of the oxLDL on the expression of MCP-3 mRNA was both time- and dose-dependent. Treatment with GF109203X and genistein, inhibitors of protein kinase C and tyrosine kinase, respectively, had no effect on the induction of MCP-3 mRNA by oxLDL, while treatment with cycloheximide inhibited the induction. The induction was reproduced by the lipid components in oxLDL such as 9-HODE and 13-HODE, which are known to activate the peroxisome proliferator-activated receptor γ (PPARγ). Introduction of an endogenous PPARγ ligand, 15d-PGJ2, in the culture of THP-1 cells resulted in the induction of MCP-3 gene expression. Furthermore, analyses of human atherosclerotic plaques revealed that the expressional pattern of MCP-3 in the regions of neointimal and necrotic core overlapped with that of PPARγ. These results suggest that oxLDL delivers its signal for MCP-3 expression via PPARγ, which may be further related to the atherogenesis

Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

Science.gov (United States)

Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

2014-01-01

During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

The Effect of Laminin-1-Doped Nanoroughened Implant Surfaces: Gene Expression and Morphological Evaluation

Directory of Open Access Journals (Sweden)

Humberto Osvaldo Schwartz-Filho

2012-01-01

Full Text Available Aim. This study aimed to observe the morphological and molecular effect of laminin-1 doping to nanostructured implant surfaces in a rabbit model. Materials and Methods. Nanostructured implants were coated with laminin-1 (test; dilution, 100 μg/mL and inserted into the rabbit tibiae. Noncoated implants were used as controls. After 2 weeks of healing, the implants were removed and subjected to morphological analysis using scanning electron microscopy (SEM and gene expression analysis using the real-time reverse transcriptase-polymerase chain reaction (RT-PCR. Results. SEM revealed bony tissue attachment for both control and test implants. Real-time RT-PCR analysis showed that the expression of osteoblast markers RUNX-2, osteocalcin, alkaline phosphatase, and collagen I was higher (1.62-fold, 1.53-fold, 1.97-fold, and 1.04-fold, resp. for the implants modified by laminin-1 relative to the control. All osteoclast markers investigated in the study presented higher expression on the test implants than controls as follows: tartrate-resistant acid phosphatase (1.67-fold, calcitonin receptor (1.35-fold, and ATPase (1.25-fold. The test implants demonstrated higher expression of inflammatory markers interleukin-10 (1.53-fold and tumour necrosis factor-α (1.61-fold relative to controls. Conclusion. The protein-doped surface showed higher gene expression of typical genes involved in the osseointegration cascade than the control surface.

MR molecular imaging of tumours using ferritin heavy chain reporter gene expression mediated by the hTERT promoter

Energy Technology Data Exchange (ETDEWEB)

Yang, Yan [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China); The First Affiliated Hospital of ChengDu Medical College, Department of Radiology, ChengDu (China); Gong, Ming-fu; Yang, Hua; Zhang, Song; Wang, Guang-xian; Su, Tong-sheng; Wen, Li; Zhang, Dong [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China)

2016-11-15

Using the human telomerase reverse transcriptase (hTERT) promoter and the modified ferritin heavy chain (Fth) reporter gene, reporter gene expression for MRI was examined in telomerase positive and negative tumour cells and xenografts. Activity of the reporter gene expression vector Lenti-hTERT-Fth1-3FLAG-Puro was compared to constitutive CMV-driven expression and to the untransfected parental control in five tumour cell lines: A549, SKOV3, 293T, U2OS and HPDLF. In vitro, transfected cells were evaluated for FLAG-tagged protein expression, iron accumulation and transverse relaxation. In vivo, tumours transduced by lentiviral vector injection were imaged using T2*WI. Changes in tumour signal intensity were validated by histology. Only telomerase positive tumour cells expressed FLAG-tagged Fth and displayed an increase in R2* above the parental control, with a corresponding change in T2*WI. In addition, only telomerase positive tumours, transduced by injection of the reporter gene expression construct, exhibited a change in signal intensity on T2*WI. Tumour histology verified the expression of FLAG-tagged Fth and iron accumulation in telomerase positive tissue. Reporter gene expression for MRI, using the Fth reporter and the hTERT promoter, may be a useful strategy for the non-invasive diagnosis of many types of cancer. (orig.)

Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

Science.gov (United States)

Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

2011-12-01

Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

Alteration of microRNA expression of human dental pulp cells during odontogenic differentiation.

Science.gov (United States)

Gong, Qimei; Wang, Runfu; Jiang, Hongwei; Lin, Zhengmei; Ling, Junqi

2012-10-01

MicroRNAs (miRNAs) play momentous roles in various biological processes including cell differentiation. However, little is known about the role of miRNAs in human dental pulp cells (hDPCs) during odontogenic differentiation. The aims of this study were to investigate the expression of miRNAs in the primary culture of hDPCs when incubated in odontogenic medium. The potential characteristics of hDPCs were investigated by miRNA microarray and real-time reverse transcriptase polymerase chain reaction. Bioinformatics (ie, target prediction, Gene Ontology analysis, and Kyoto Encyclopedia of Genes and Genomes mapping tools) were applied for predicting the complementary target genes of miRNAs and their biological functions. A total of 22 miRNAs were differentially expressed in which 12 miRNAs up-regulated and 10 miRNAs down-regulated in differentiated hDPCs compared with the control. The target genes of differential miRNAs were predicted to associate with several biological functions and signaling pathways including the mitogen-activated protein kinase (MAPK) and the Wnt signaling pathway. The differential expression miRNAs may be involved in governing hDPC odontogenic differentiation, thus contributing to the future investigations of regulatory mechanisms in reparative dentin formation and dental pulp regeneration. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

2-Methyl-3-buten-2-ol (MBO) synthase expression in Nostoc punctiforme leads to over production of phytols.

Science.gov (United States)

Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak

2015-01-01

Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.

P-gp expression levels in the erythrocytes of brown trout: a new tool for aquatic sentinel biomarker development.

Science.gov (United States)

Valton, Emeline; Wawrzyniak, Ivan; Amblard, Christian; Combourieu, Bruno; Bayle, Marie-Laure; Desmolles, François; Kwiatkowski, Fabrice; Penault-Llorca, Frédérique; Bamdad, Mahchid

2017-09-01

P-glycoprotein (P-gp) is a ubiquitous membrane detoxification pump involved in cellular defence against xenobiotics. Blood is a hub for the trade and transport of physiological molecules and xenobiotics. Our recent studies have highlighted the expression of a 140-kDa P-gp in brown trout erythrocytes in primary cell culture and its dose-dependent response to Benzo[a]pyrene pollutant. The purpose of this study was focused on using P-gp expression in brown trout erythrocytes as a biomarker for detecting the degree of river pollution. abcb1 gene and P-gp expression level were analysed by reverse transcriptase-PCR and Western blot, in the erythrocytes of brown trouts. The latter were collected in upstream and downstream of four rivers in which 17 polycyclic aromatic hydrocarbons and 348 varieties of pesticides micro-residues were analysed by liquid chromatography and mass spectrometry. The abcb1 gene and the 140-kDa P-gp were not expressed in trout erythrocytes from uncontaminated river. In contrast, they are clearly expressed in contaminated rivers, in correlation with the river pollution degree and the nature of the pollutants. This biological tool may offer considerable advantages since it provides an effective response to the increasing need for an early biomarker.

EXPRESSION OF GROWTH HORMONE (PhGH GENE AND ANALYSIS OF INSULINE-LIKE GROWTH FACTOR I (IGF-I PRODUCTION IN AFRICAN CATFISH (Clarias gariepinus TRANSGENIC F-1

Directory of Open Access Journals (Sweden)

Huria Marnis

2013-12-01

Full Text Available We have previously produced F-1 transgenic of African catfish from crosses between founder transgenic female and non transgenic male. The aim of this study was to evaluate distribution and expression PhGH growth hormone gene transgenic African catfish organs and to measure the concentration of IGF-I in plasma. Transgene was detected using the PCR method in various organs, namely pituitary, brain, liver, heart, spleen, kidney, intestine, stomach, muscle, gill, and eye. Transgene expression levels were analyzed using the method of quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR. Plasma samples were analyzed for Insuline-like Growth Factor (IGF-I using Enzyme Linked Immunosorbent Assay (ELISA method. The results showed that the PhGH was detected and expressed in all organs of the transgenic African catfish (F-1. Liver exhibited the highest level of PhGH mRNA (23 x 106 copies. The plasma IGF-I levels in transgenic individuals were not significant than non transgenic. The higher level of exogenous PhGH gene expression may not represent the production of IGF-1.

Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

DEFF Research Database (Denmark)

Koch, Birgit; Nybroe, Ole

2006-01-01

A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

Prediction of the binding mode and resistance profile for a dual-target pyrrolyl diketo acid scaffold against HIV-1 integrase and reverse-transcriptase-associated ribonuclease H.

Science.gov (United States)

Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng

2018-06-27

The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.

Role of the functional MNS16A VNTR-243 variant of the human telomerase reverse transcriptase gene in progression and response to therapy of patients with non-Hodgkin's B-cell lymphomas.

Science.gov (United States)

Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K

2015-04-01

MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.

Properties of the reverse transcription reaction in mRNA quantification

DEFF Research Database (Denmark)

Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie

2004-01-01

BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...

NCBI nr-aa BLAST: CBRC-DDIS-06-0095 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DDIS-06-0095 gb|AAX19886.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excel...sa] gb|AAX19887.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excelsa] AAX19886.1 1e-44 25% ...

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

OpenAIRE

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

Prior regular exercise reverses the decreased effects of sleep deprivation on brain-derived neurotrophic factor levels in the hippocampus of ovariectomized female rats.

Science.gov (United States)

Saadati, Hakimeh; Sheibani, Vahid; Esmaeili-Mahani, Saeed; Darvishzadeh-Mahani, Fatemeh; Mazhari, Shahrzad

2014-11-01

Previous studies indicated that brain-derived neurotrophic factor (BDNF) is the main candidate to mediate the beneficial effects of exercise on cognitive function in sleep deprived male rats. In addition, our previous findings demonstrate that female rats are more vulnerable to the deleterious effects of sleep deprivation on cognitive performance and synaptic plasticity. Therefore, the current study was designed to investigate the effects of treadmill exercise and/or sleep deprivation (SD) on the levels of BDNF mRNA and protein in the hippocampus of female rats. Intact and ovariectomized (OVX) female Wistar rats were used in the present experiment. The exercise protocol was four weeks treadmill running and sleep deprivation was accomplished using the multiple platform method. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and immunoblot analysis were used to evaluate the level of BDNF mRNA and protein in the rat hippocampus respectively. Our results showed that protein and mRNA expression of BDNF was significantly (psleep deprived OVX rats under exercise conditions had a significant (peffect against hippocampus-related functions and impairments induced by sleep deprivation probably by inducing BDNF expression. Copyright © 2014 Elsevier B.V. All rights reserved.

T-lymphocyte cytokine mRNA expression in cystic echinococcosis.

Science.gov (United States)

Fauser, S; Kern, P

1997-04-01

In the present study we investigated cytokine mRNA expression by peripheral blood mononuclear cells (PBMC) from patients with cystic echinococcosis (CE) after stimulation with different antigens. By using reverse transcriptase polymerase chain reaction (RT-PCR) we could demonstrate that restimulation with crude Echinococcus granulosus antigen (Eg-Ag) induced or enhanced Th2 cytokine mRNA expression, especially IL-5 (by using antigen from sheep cyst fluid) in 23 out of 26 investigated CE patients and IL-10 (by using antigen from camel cyst fluid) in 10 out of 10 investigated CE patients. In contrast, IL-5 mRNA expression was absent in PBMC of healthy controls after Eg-Ag stimulation. To determine the specificity of this reaction we stimulated PBMC from 11 CE patients with crude Echinococcus multilocularis antigen (Em-Ag) and PBMC from 8 CE patients with Toxocara canis antigen (Tc-Ag). We found that the PBMC of patients showed a similar mRNA cytokine pattern on stimulation with Em-Ag when compared with Eg-Ag stimulation. The cytokine mRNA pattern on stimulation with Tc-Ag, however, resembled the cytokine mRNA pattern of unstimulated PBMC. Furthermore, the stimulation of PBMC with crude Mycobacterium tuberculosis antigen (H37Ra) and purified protein derivative (PPD) of M. tuberculosis revealed distinct IL-5 mRNA expression in all investigated CE patients, whereas in healthy controls IL-5 mRNA expression was very weak or totally absent. Thus, our results indicate an induction of Th2 cytokine mRNA expression in CE patients, which is frequently observed in parasite infections. Interestingly, this response persists after stimulation with tuberculosis antigens, which normally induce Th1 response.

Integration of ethylene and jasmonic acid signaling pathways in the expression of maize defense protein Mir1-CP.

Science.gov (United States)

Ankala, A; Luthe, D S; Williams, W P; Wilkinson, J R

2009-12-01

In plants, ethylene and jasmonate control the defense responses to multiple stressors, including insect predation. Among the defense proteins known to be regulated by ethylene is maize insect resistance 1-cysteine protease (Mir1-CP). This protein is constitutively expressed in the insect-resistant maize (Zea mays) genotype Mp708; however, its abundance significantly increases during fall armyworm (Spodoptera frugiperda) herbivory. Within 1 h of herbivory by fall armyworm, Mir1-CP accumulates at the feeding site and continues to increase in abundance until 24 h without any increase in its transcript (mir1) levels. To resolve this discrepancy and elucidate the role of ethylene and jasmonate in the signaling of Mir1-CP expression, the effects of phytohormone biosynthesis and perception inhibitors on Mir1-CP expression were tested. Immunoblot analysis of Mir1-CP accumulation and quantitative reverse-transcriptase polymerase chain reaction examination of mir1 levels in these treated plants demonstrate that Mir1-CP accumulation is regulated by both transcript abundance and protein expression levels. The results also suggest that jasmonate functions upstream of ethylene in the Mir1-CP expression pathway, allowing for both low-level constitutive expression and a two-stage defensive response, an immediate response involving Mir1-CP accumulation and a delayed response inducing mir1 transcript expression.

Intermittent Hypoxia Alters Gene Expression in Peripheral Blood Mononuclear Cells of Healthy Volunteers.

Science.gov (United States)

Polotsky, Vsevolod Y; Bevans-Fonti, Shannon; Grigoryev, Dmitry N; Punjabi, Naresh M

2015-01-01

Obstructive sleep apnea is associated with high cardiovascular morbidity and mortality. Intermittent hypoxia of obstructive sleep apnea is implicated in the development and progression of insulin resistance and atherosclerosis, which have been attributed to systemic inflammation. Intermittent hypoxia leads to pro-inflammatory gene up-regulation in cell culture, but the effects of intermittent hypoxia on gene expression in humans have not been elucidated. A cross-over study was performed exposing eight healthy men to intermittent hypoxia or control conditions for five hours with peripheral blood mononuclear cell isolation before and after exposures. Total RNA was isolated followed by gene microarrays and confirmatory real time reverse transcriptase PCR. Intermittent hypoxia led to greater than two fold up-regulation of the pro-inflammatory gene toll receptor 2 (TLR2), which was not increased in the control exposure. We hypothesize that up-regulation of TLR2 by intermittent hypoxia may lead to systemic inflammation, insulin resistance and atherosclerosis in patients with obstructive sleep apnea.

Negative correlation of LIV-1 and E-cadherin expression in hepatocellular carcinoma cells.

Directory of Open Access Journals (Sweden)

Rongxi Shen

Full Text Available LIV-1, a zinc transporter, is a mediator downstream of STAT3 both in zebrafish and mammalian cells, and is involved in epithelial-mesenchymal transition (EMT. Despite LIV-1 participates in cancer growth and metastasis, little is known about the association of LIV-1 with human liver cancer development. Therefore, the expression of LIV-1 mRNA was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR in 4 cultured cell lines (3 carcinoma and 1 normal liver cell lines, and the localization of LIV-1 protein was investigated by immunohistochemistry. Expression of LIV-1 protein was analyzed by Western blot both in 4 cultured cell lines and 120 liver tissues (100 carcinoma and 20 histologically normal tissues, and the relationship between its expression and clinicopathological finding was investigated in 100 hepatocellular carcinoma(HCC tissues. Then stable siRNA expressing Hep-G2 cells were generated to assess the function of LIV-1 in liver cancer cells. We found that LIV-1 mRNA was more highly expressed in liver cancer cell lines compared to normal liver cell line. Western blot showed the expression of LIV-1 was higher in 61% liver carcinoma tissues than that in normal liver tissues. Down-regulated LIV-1 cells showed significant inhibition of proliferation in vitro and reduction of tumor growth in vivo. Furthermore, E-cadherin expression increased in LIV-1 siRNA expressing Hep-G2. These findings indicated that LIV-1 may induce the EMT in HCC cells.

Molecular cloning and expression profile of an ATP-binding cassette (ABC) transporter gene from the hemipteran insect Nilaparvata lugens.

Science.gov (United States)

Zha, W J; Li, S H; Zhou, L; Chen, Z J; Liu, K; Yang, G C; Hu, G; He, G C; You, A Q

2015-03-30

The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. In insects, ABC transporters have important functions in the transport of molecules, and are also involved in insecticide resistance, metabolism, and development. In this study, the Nilaparvata lugens Stal (Hemiptera: Delphacidae) ABCG (NlABCG) gene was identified and characterized. The complete mRNA sequence of NlABCG was 2608-bp long, with an open reading frame of 2064 bp encoding a protein comprised of 687 amino acids. The conserved regions include three N-glycosylation and 34 phosphorylation sites, as well as seven transmembrane domains. The amino acid identity with the closely related species Acyrthosiphon pisum was 42.8%. Developmental expression analysis using quantitative real-time reverse transcriptase PCR suggested that the NlABCG transcript was expressed at all developmental stages of N. lugens. The lowest expression of NlABCG was in the 1st instar, and levels increased with larval growth. The transcript profiles of NlABCG were analyzed in various tissues from a 5th instar nymph, and the highest expression was observed in the midgut. These results suggest that the sequence, characteristics, and expression of NlABCG are highly conserved, and basic information is provided for its functional analysis.

Expression of biomineralization-related ion transport genes in Emiliania huxleyi.

Science.gov (United States)

Mackinder, Luke; Wheeler, Glen; Schroeder, Declan; von Dassow, Peter; Riebesell, Ulf; Brownlee, Colin

2011-12-01

Biomineralization in the marine phytoplankton Emiliania huxleyi is a stringently controlled intracellular process. The molecular basis of coccolith production is still relatively unknown although its importance in global biogeochemical cycles and varying sensitivity to increased pCO₂ levels has been well documented. This study looks into the role of several candidate Ca²⁺, H⁺ and inorganic carbon transport genes in E. huxleyi, using quantitative reverse transcriptase PCR. Differential gene expression analysis was investigated in two isogenic pairs of calcifying and non-calcifying strains of E. huxleyi and cultures grown at various Ca²⁺ concentrations to alter calcite production. We show that calcification correlated to the consistent upregulation of a putative HCO₃⁻ transporter belonging to the solute carrier 4 (SLC4) family, a Ca²⁺/H⁺ exchanger belonging to the CAX family of exchangers and a vacuolar H⁺-ATPase. We also show that the coccolith-associated protein, GPA is downregulated in calcifying cells. The data provide strong evidence that these genes play key roles in E. huxleyi biomineralization. Based on the gene expression data and the current literature a working model for biomineralization-related ion transport in coccolithophores is presented. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

Study on radiation regulation of hypoxia inducible factor-1α expression and its correlation with hepatoma radiosensitivity

International Nuclear Information System (INIS)

Jin Wensen; Kong Zhaolu; Shen Zhifen; Tong Shungao; Ji Huajun; Jin Yizun

2008-01-01

Objective: To study the regulation of hypoxia inducible factor-1α (HIF-1α) expression in hepatoma cells after irradiation and the expression of HIF-1α effect on the radiosensitivity of heptoma cells. Methods: HepG2 cells were pretreated by Cobalt chloride (COCl 2 ), a chemical hypoxia agent, to induce and stabilize the expression of HIF-1α, and then exposed to different γ-irradiation doses. Clonogenic assay was used to evaluate HepG2 cell survival fraction (SF) after irradiation under normoxia and chemical hypoxia. Reverse transcriptase polymerase chain reaction (RT-PCR) and immunoblot assay (Western blot) were utilized to detect the changes of intracellular HIF-1α on the level of transcripation and translation. Results: Cell survival level was elevated by chemical hypoxia and there was a statistical difference between chemical hypoxic group and normoxic group. The ratios of SF(SF co /SF o 2 )on two different conditions were increased with irradiation doses. Meanwhile, the irradiation induced up-regulation of HIF-1α in dose-dependent manner. The expression of HIF-1α was correlated with HepG2 cell survival level to some extent. Conclusions: Irradiation could up-regulate the level of HIF-1α expression in HepG2 cells under chemical hypoxic condition. The cells survival level might be influenced by the changes in HIF-1α expression. (authors)

Peroxisome Proliferator-Activated Receptor γ Regulates the Expression of Lipid Phosphate Phosphohydrolase 1 in Human Vascular Endothelial Cells

Directory of Open Access Journals (Sweden)

Yazi Huang

2014-01-01

Full Text Available Lipid phosphate phosphohydrolase 1 (LPP1, a membrane ectophosphohydrolase regulating the availability of bioactive lipid phosphates, plays important roles in cellular signaling and physiological processes such as angiogenesis and endothelial migration. However, the regulated expression of LPP1 remains largely unknown. Here, we aimed to examine a role of peroxisome proliferator-activated receptor γ (PPARγ in the transcriptional control of LPP1 gene expression. In human umbilical vein endothelial cells (HUVECs, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR demonstrated that activation of PPARγ increased the mRNA level of LPP1. Chromatin immunoprecipitation assay showed that PPARγ binds to the putative PPAR-responsive elements (PPREs within the 5′-flanking region of the human LPP1 gene. Genomic fragment containing 1.7-kilobase of the promoter region was cloned by using PCR. The luciferase reporter assays demonstrated that overexpression of PPARγ and rosiglitazone, a specific ligand for PPARγ, could significantly upregulate the reporter activity. However, site-directed mutagenesis of the PPRE motif abolished the induction. In conclusion, our results demonstrated that PPARγ transcriptionally activated the expression of LPP1 gene in ECs, suggesting a potential role of PPARγ in the metabolism of phospholipids.

A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

Directory of Open Access Journals (Sweden)

Sandra J Laney

2008-06-01

Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

Medium-chain triglycerides promote macrophage reverse cholesterol transport and improve atherosclerosis in ApoE-deficient mice fed a high-fat diet.

Science.gov (United States)

Zhang, Xinsheng; Zhang, Yong; Liu, Yinghua; Wang, Jin; Xu, Qing; Yu, Xiaoming; Yang, Xueyan; Liu, Zhao; Xue, Changyong

2016-09-01

We previously observed that medium-chain triglycerides (MCTs) could reduce body fat mass and improve the metabolism of cholesterol. We hypothesized that MCTs can improve atherosclerosis by promoting the reverse cholesterol transport (RCT) process. Therefore, the objective of this study was to investigate the roles of MCTs in macrophage RCT and the progression of atherosclerosis. To test this hypothesis, 30 4-week-old ApoE-deficient (ApoE(-/-)) mice were randomly divided into 2 groups and fed a diet of 2% MCTs or long-chain triglycerides (LCTs) for 16 weeks. Ten age- and sex-matched C57BL/6J mice were fed a diet of 2% LCTs as the control. Macrophage-to-feces RCT was assessed in vivo by intraperitoneal injection of RAW 264.7 macrophages containing (3)H-labeled cholesterol, and atherosclerotic plaques were measured. The mRNA and protein expressions were determined by reverse transcriptase polymerase chain reaction and Western blot analyses, respectively. There was a greater decrease in body fat mass, atherosclerotic plaques, and an improvement in serum lipid profiles. In addition, the MCT mice group showed an increase in (3)H-tracer in the feces and a decrease in the liver. Significantly higher levels of mRNA and protein expression of hepatic ATP-binding cassette transporter A1, ATP-binding cassette transporter G5, cholesterol 7α-hydroxylase, and intestinal ATP-binding cassette transporter G8, as well as lower levels of expression of intestinal Niemann-Pick C1-like 1, were found in the MCT group. These results suggest that MCTs could obviously promote macrophage RCT and improve atherosclerosis in ApoE(-/-) mice, indicating that MCTs have the potential to prevent cardiovascular disease. Copyright © 2016 Elsevier Inc. All rights reserved.

Alteration in transforming growth factor-β receptor expression in gallbladder disease: implications of chronic cholelithiasis and chronic Salmonella typhi infection

Directory of Open Access Journals (Sweden)

Yogesh D. Walawalkar

2016-08-01

Full Text Available Gallbladder cancer prevalence is ever increasing with Salmonella typhi chronic infection being one of the predisposing factors. Altered ratios or expression of transforming growth factor-β (TGF-β receptors and changes in its function are associated with loss in anti-proliferative effects of TGF-β and cancer progression. Using reverse transcriptase polymerase chain reaction we monitor any changes in TGF-β receptor gene expression. We simultaneously screen for S. typhi within the samples. From 73 patients undergoing cholecystectomy 39-50% had significant expression (P<0.05 of TGF-β receptor (TβR- I and TβR-II during chronic cholelithiasis as compared to the remaining 19-23% with acute chronic cholelithiasis. There was no significant increase in TβR-III receptor expression. Patient’s positive for S. typhi (7/73 did not show any significant changes in expression of these receptors, thus indicating no direct relation in regulating the host TGFβ-signaling pathway. Further analysis on expression of downstream Smad components revealed that patients with up-regulated TGFβ receptor expression show >2-fold increase in the RSmads and Co-Smads with a >2-fold decrease in I-Smads. Thus gain of TβR-I and II expression in epithelial cells of the gallbladder was associated with chronic inflammatory stages of the gallbladder disease.

tlpA gene expression is required for arginine and bicarbonate chemotaxis in Helicobacter pylori.

Science.gov (United States)

Cerda, Oscar A; Núñez-Villena, Felipe; Soto, Sarita E; Ugalde, José Manuel; López-Solís, Remigio; Toledo, Héctor

2011-01-01

About half of the human population is infected with Helicobacter pylori, a bacterium causing gastritis, peptic ulcer and progression to gastric cancer. Chemotaxis and flagellar motility are required for colonization and persistence of H. pylori in the gastric mucus layer. It is not completely clear which chemical gradients are used by H. pylori to maintain its position. TlpA, a chemotaxis receptor for arginine/ bicarbonate, has been identified. This study aimed to find out whether tlpA gene expression is required for the chemotactic response to arginine/bicarbonate. Wild-type motile H. pylori ATCC 700392 and H. pylori ATCC 43504, a strain having an interrupted tlpA gene, were used. Also, a tlpA-knockout mutant of H. pylori 700392 (H. pylori 700-tlpA::cat) was produced by homologous recombination. Expression of tlpA was assessed by a Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) assay. Chemotaxis was measured as a Relative Chemotaxis Response (RCR) by a modified capillary assay. H. pylori 700392 presented chemotaxis to arginine and sodium bicarbonate. H. pylori 700-tlpA::cat showed neither tlpA gene expression nor chemotaxis towards arginine and bicarbonate. Besides confirming that TlpA is a chemotactic receptor for arginine/bicarbonate in H. pylori, this study showed that tlpA gene expression is required for arginine/bicarbonate chemotaxis.

tlpA gene expression is required for arginine and bicarbonate chemotaxis in Helicobacter pylori

Directory of Open Access Journals (Sweden)

Oscar A Cerda

2011-01-01

Full Text Available About half of the human population is infected with Helicobacter pylori, a bacterium causing gastritis, peptic ulcer and progression to gastric cancer. Chemotaxis and flagellar motility are required for colonization and persistence of H. pylori in the gastric mucus layer. It is not completely clear which chemical gradients are used by H. pylori to maintain its position. TlpA, a chemotaxis receptor for arginine/ bicarbonate, has been identified. This study aimed to find out whether tlpA gene expression is required for the chemotactic response to arginine/bicarbonate. Wild-type motile H. pylori ATCC 700392 and H. pylori ATCC 43504, a strain having an interrupted tlpA gene, were used. Also, a tlpA-knockout mutant of H. pylori 700392 (H. pylori 700-tlpA::cat was produced by homologous recombination. Expression of tlpA was assessed by a Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR assay. Chemotaxis was measured as a Relative Chemotaxis Response (RCR by a modified capillary assay. H. pylori 700392 presented chemotaxis to arginine and sodium bicarbonate. H. pylori 700-tlpA::cat showed neither tlpA gene expression nor chemotaxis towards arginine and bicarbonate. Besides confirming that TlpA is a chemotactic receptor for arginine/bicarbonate in H. pylori, this study showed that tlpA gene expression is required for arginine/bicarbonate chemotaxis.

High level expression of human epithelial β-defensins (hBD-1, 2 and 3 in papillomavirus induced lesions

Directory of Open Access Journals (Sweden)

Chong Kong T

2006-09-01

Full Text Available Abstract Background Epithelial defensins including human β-defensins (hBDs and α-defensins (HDs are antimicrobial peptides that play important roles in the mucosal defense system. However, the role of defensins in papillomavirus induced epithelial lesions is unknown. Results Papilloma tissues were prospectively collected from 15 patients with recurrent respiratory papillomatosis (RRP and analyzed for defensins and chemokine IL-8 expression by quantitative, reverse-transcriptase polymerase chain reaction (RT-PCR assays. HBD-1, -2 and -3 mRNAs were detectable in papilloma samples from all RRP patients and the levels were higher than in normal oral mucosal tissues from healthy individuals. Immunohistochemical analysis showed that both hBD-1 and 2 were localized in the upper epithelial layers of papilloma tissues. Expression of hBD-2 and hBD-3 appeared to be correlated as indicated by scatter plot analysis (r = 0.837, p Conclusion Human β-defensins are upregulated in respiratory papillomas. This novel finding suggests that hBDs might contribute to innate and adaptive immune responses targeted against papillomavirus-induced epithelial lesions.

Identification and expression profile of GbAGL2, a C-class gene from ...

Indian Academy of Sciences (India)

Prakash

2009-12-03

Dec 3, 2009 ... transcriptase-polymerase chain reaction (RT-PCR) and quantitative real-time ..... the productive organs such as gynoecia, stamens, carpels ..... a Values obtained from 20 plants from wt and 20 transgenic plants expressing ...

Quantitative evaluation of interleukin-12 p40 gene expression in peripheral blood mononuclear cells.

Science.gov (United States)

Conte, Enrico; Nigro, Luciano; Fagone, Evelina; Drago, Francesco; Cacopardo, Bruno

2008-01-01

The heterodimeric cytokine IL-12 (composed of a p35 and a p40 subunit) is produced primarily by monocytes, macrophages and B cells. In vitro and in vivo experiments have demonstrated the crucial role of IL-12 in initiating and establishing both innate immunity and T cell-mediated resistance to intracellular pathogens, including Leishmania donovani, Toxoplasma gondii, Listeria monocytogenes, and Mycobacterium tuberculosis. Assessment of cytokine expression has thus become crucial to understand host responses to infections. In this study, by using the reverse transcriptase-real time PCR we developed a highly specific and sensitive assay to quantitatively evaluate IL-12p40 mRNA transcription levels in peripheral blood mononuclear cells (PBMCs) stimulated with PHA vs. unstimulated cells. We also used the ELISA to evaluate bioactive IL-12 release in culture supernatants. We provide evidence that IL-12 p40 mRNA levels were significantly up-regulated in PHA-activated PBMCs. These results were correlated with data of IL-12 levels obtained by ELISA.

Reverse mode Na+/Ca2+ exchange mediated by STIM1 contributes to Ca2+ influx in airway smooth muscle following agonist stimulation

Directory of Open Access Journals (Sweden)

Fox Jane

2010-12-01

Full Text Available Abstract Background Agonist stimulation of airway smooth muscle (ASM results in IP3 mediated Ca2+ release from the sarcoplasmic reticulum followed by the activation of store operated and receptor operated non-selective cation channels. Activation of these non-selective channels also results in a Na+ influx. This localised increase in Na+ levels can potentially switch the Na+/Ca2+ exchanger into reverse mode and so result in a further influx of Ca2+. The aim of this study was to characterise the expression and physiological function of the Na+/Ca2+ exchanger in cultured human bronchial smooth muscle cells and determine its contribution to agonist induced Ca2+ influx into these cells. Methods The expression profile of NCX (which encodes the Na+/Ca2+ exchanger homologues in cultured human bronchial smooth muscle cells was determined by reverse transcriptase PCR. The functional activity of reverse mode NCX was investigated using a combination of whole cell patch clamp, intracellular Ca2+ measurements and porcine airway contractile analyses. KB-R7943 (an antagonist for reverse mode NCX and target specific siRNA were utilised as tools to inhibit NCX function. Results NCX1 protein was detected in cultured human bronchial smooth muscle cells (HBSMC cells and NCX1.3 was the only mRNA transcript variant detected. A combination of intracellular Na+ loading and addition of extracellular Ca2+ induced an outwardly rectifying current which was augmented following stimulation with histamine. This outwardly rectifying current was inhibited by 10 μM KB-R7943 (an antagonist of reverse mode NCX1 and was reduced in cells incubated with siRNA against NCX1. Interestingly, this outwardly rectifying current was also inhibited following knockdown of STIM1, suggesting for the first time a link between store operated cation entry and NCX1 activation. In addition, 10 μM KB-R7943 inhibited agonist induced changes in cytosolic Ca2+ and induced relaxation of porcine

Gene expression profiling in woman with women with breast cancer in a Saudi population

International Nuclear Information System (INIS)

Amer, Saud M. Bin; Maqbool, Z.; Nirmal, Maimoona S.; Hussain, Syed S.; Jeprel, Hatim A.; Qattan, Amal T.; Tulbah, Asma M.; Malik, Osama A.; Al-Tweigeri, Taher A.

2008-01-01

Objective was to generate consensus gene expression profiles of invasive breast tumors from a small cohort of Saudi females and to explore the possibility that they may be broadly conserved between Caucasian and Middle Eastern populations. This study was performed at King Faisal Specialist Hospital and Research Center, Riyadh, Kingdom of Saudi Arabia, from January 2005 to January 2007. Gene expression profiles were generated from 38 invasive breast tumors and 8 tumor adjacent tissues (TATs) using BD Atlas cDNA expression arrays containing 1176 genes. Results were confirmed by reverse transcriptase polymerase chain reaction and analyzed by 2-dimensional unsupervised hierarchical clustering. The analysis identified 48 differentially expressed genes in tumors from which 25 are already reported by various western studies. Forty-three of these genes were also differentially expressed in TATs. The same data set has been able to distinguish between tumors and the TAT's, interestingly by using only 4 of the differentially expressed genes. Moreover, we were able to group the patients according to prognosis to an extent by hierarchical clustering. Our results indicate that expression profiles between Saudi females with breast cancer and the Caucasian population are conserved to some extent, and can be used to classify patients according to prognostic groups. We also suggest 3 differentially expressed genes (IGHG3, CDK3 and RPS9) in tumors may have a novel role in breast cancer. In addition, the role of TATs is much more essential in breast cancer and needs to be explored thoroughly. (author)

Transgene expression of Drosophila melanogaster nucleoside kinase reverses mitochondrial thymidine kinase 2 deficiency.

Science.gov (United States)

Krishnan, Shuba; Zhou, Xiaoshan; Paredes, João A; Kuiper, Raoul V; Curbo, Sophie; Karlsson, Anna

2013-02-15

A strategy to reverse the symptoms of thymidine kinase 2 (TK2) deficiency in a mouse model was investigated. The nucleoside kinase from Drosophila melanogaster (Dm-dNK) was expressed in TK2-deficient mice that have been shown to present with a severe phenotype caused by mitochondrial DNA depletion. The Dm-dNK(+/-) transgenic mice were shown to be able to rescue the TK2-deficient mice. The Dm-dNK(+/-)TK2(-/-) mice were normal as judged by growth and behavior during the observation time of 6 months. The Dm-dNK-expressing mice showed a substantial increase in thymidine-phosphorylating activity in investigated tissues. The Dm-dNK expression also resulted in highly elevated dTTP pools. The dTTP pool alterations did not cause specific mitochondrial DNA mutations or deletions when 6-month-old mice were analyzed. The mitochondrial DNA was also detected at normal levels. In conclusion, the Dm-dNK(+/-)TK2(-/-) mouse model illustrates how dTMP synthesized in the cell nucleus can compensate for loss of intramitochondrial dTMP synthesis in differentiated tissue. The data presented open new possibilities to treat the severe symptoms of TK2 deficiency.

Expression of GABAergic receptors in mouse taste receptor cells.

Directory of Open Access Journals (Sweden)

Margaret R Starostik

Full Text Available BACKGROUND: Multiple excitatory neurotransmitters have been identified in the mammalian taste transduction, with few studies focused on inhibitory neurotransmitters. Since the synthetic enzyme glutamate decarboxylase (GAD for gamma-aminobutyric acid (GABA is expressed in a subset of mouse taste cells, we hypothesized that other components of the GABA signaling pathway are likely expressed in this system. GABA signaling is initiated by the activation of either ionotropic receptors (GABA(A and GABA(C or metabotropic receptors (GABA(B while it is terminated by the re-uptake of GABA through transporters (GATs. METHODOLOGY/PRINCIPAL FINDINGS: Using reverse transcriptase-PCR (RT-PCR analysis, we investigated the expression of different GABA signaling molecules in the mouse taste system. Taste receptor cells (TRCs in the circumvallate papillae express multiple subunits of the GABA(A and GABA(B receptors as well as multiple GATs. Immunocytochemical analyses examined the distribution of the GABA machinery in the circumvallate papillae. Both GABA(A-and GABA(B- immunoreactivity were detected in the peripheral taste receptor cells. We also used transgenic mice that express green fluorescent protein (GFP in either the Type II taste cells, which can respond to bitter, sweet or umami taste stimuli, or in the Type III GAD67 expressing taste cells. Thus, we were able to identify that GABAergic receptors are expressed in some Type II and Type III taste cells. Mouse GAT4 labeling was concentrated in the cells surrounding the taste buds with a few positively labeled TRCs at the margins of the taste buds. CONCLUSIONS/SIGNIFICANCE: The presence of GABAergic receptors localized on Type II and Type III taste cells suggests that GABA is likely modulating evoked taste responses in the mouse taste bud.

Differential expression profiling of membrane proteins by quantitative proteomics in a human mesenchymal stem cell line undergoing osteoblast differentiation

DEFF Research Database (Denmark)

Foster, Leonard J; Zeemann, Patricia A; Li, Chen

2005-01-01

in a cell model of hMSCs established by overexpression of human telomerase reverse-transcriptase gene. We identified 463 unique proteins with extremely high confidence, including all known markers of hMSCs (e.g., SH3 [CD71], SH2 [CD105], CD166, CD44, Thy1, CD29, and HOP26 [CD63]) among 148 integral membrane...

Docking and 3-D QSAR studies on indolyl aryl sulfones. Binding mode exploration at the HIV-1 reverse transcriptase non-nucleoside binding site and design of highly active N-(2-hydroxyethyl)carboxamide and N-(2-hydroxyethyl)carbohydrazide derivatives.

Science.gov (United States)

Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano

2005-01-13

Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.

NEW DRUGS NEW TARGETS AND NOVEL ANTIRETROVIRALS

African Journals Online (AJOL)

2005-11-02

Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).

RAS/ERK modulates TGFbeta-regulated PTEN expression in human pancreatic adenocarcinoma cells.

Science.gov (United States)

Chow, Jimmy Y C; Quach, Khai T; Cabrera, Betty L; Cabral, Jennifer A; Beck, Stayce E; Carethers, John M

2007-11-01

Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is rarely mutated in pancreatic cancers, but its regulation by transforming growth factor (TGF)-beta might mediate growth suppression and other oncogenic actions. Here, we examined the role of TGFbeta and the effects of oncogenic K-RAS/ERK upon PTEN expression in the absence of SMAD4. We utilized two SMAD4-null pancreatic cell lines, CAPAN-1 (K-RAS mutant) and BxPc-3 (WT-K-RAS), both of which express TGFbeta surface receptors. Cells were treated with TGFbeta1 and separated into cytosolic/nuclear fractions for western blotting with phospho-SMAD2, SMAD 2, 4 phospho-ATP-dependent tyrosine kinases (Akt), Akt and PTEN antibodies. PTEN mRNA levels were assessed by reverse transcriptase-polymerase chain reaction. The MEK1 inhibitor, PD98059, was used to block the downstream action of oncogenic K-RAS/ERK, as was a dominant-negative (DN) K-RAS construct. TGFbeta increased phospho-SMAD2 in both cytosolic and nuclear fractions. PD98059 treatment further increased phospho-SMAD2 in the nucleus of both pancreatic cell lines, and DN-K-RAS further improved SMAD translocation in K-RAS mutant CAPAN cells. TGFbeta treatment significantly suppressed PTEN protein levels concomitant with activation of Akt by 48 h through transcriptional reduction of PTEN mRNA that was evident by 6 h. TGFbeta-induced PTEN suppression was reversed by PD98059 and DN-K-RAS compared with treatments without TGFbeta. TGFbeta-induced PTEN expression was inversely related to cellular proliferation. Thus, oncogenic K-RAS/ERK in pancreatic adenocarcinoma facilitates TGFbeta-induced transcriptional down-regulation of the tumor suppressor PTEN in a SMAD4-independent manner and could constitute a signaling switch mechanism from growth suppression to growth promotion in pancreatic cancers.

Subcellular Localization of Patched and Smoothened, the Receptors for Sonic Hedgehog Signaling, in the Hippocampal Neuron

OpenAIRE

Petralia, Ronald S.; Schwartz, Catherine M.; Wang, Ya-Xian; Mattson, Mark P.; Yao, Pamela J.

2011-01-01

Cumulative evidence suggests that, aside from patterning the embryonic neural tube, Sonic hedgehog (Shh) signaling plays important roles in the mature nervous system. In this study, we investigate the expression and localization of the Shh signaling receptors, Patched (Ptch) and Smoothened (Smo), in the hippocampal neurons of young and mature rats. Reverse transcriptase-polymerase chain reaction and immunoblotting analyses show that the expression of Ptch and Smo remains at a moderate level i...

Novel HBV recombinants between genotypes B and C in 3'-terminal reverse transcriptase (RT) sequences are associated with enhanced viral DNA load, higher RT point mutation rates and place of birth among Chinese patients.

Science.gov (United States)

Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong

2018-01-01

As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.

Matrix metalloprotease-3 expression in the medial plica and pannus-like tissue in knees from patients with medial compartment osteoarthritis.

Science.gov (United States)

Wang, Hwai-Shi; Kuo, Pei-Yin; Yang, Chih-Chang; Lyu, Shaw-Ruey

2011-03-01

The severity of cartilage degeneration is positively correlated with the severity of the pathologic change of medial plica. However, knowledge of the pathogenic mechanisms and the impact of plica on cartilage destruction is limited. The aim of the present study was therefore to investigate matrix metalloprotease-3 (MMP-3) expression in the plica isolated from patients with medial compartment osteoarthritis of the knee. Immunohistochemistry showed that MMP-3 was highly expressed in pannus-like tissue and the plica. Western blotting of culture supernatants showed that interleukin-1β (IL-1β) treatment induced MMP-3 release by cells isolated from pannus tissue or the plica. Furthermore, reverse transcriptase polymerase chain reaction and real-time polymerase chain reaction analysis showed that MMP-3 mRNA levels were increased after IL-1β treatment of the cultured cells. MMP-3 and IL-1β mRNAs were expressed in the plica and pannus-like tissue, with MMP-3 mRNA being expressed at significantly higher levels in the plica than in normal synovial membrane and highly expressed in the plica at different stages in osteoarthritis (OA) patients. Pannus-like tissue and the plica express IL-1β and MMP-3. Moreover, MMP-3 mRNA and protein expression in the plica may contribute to the pathogenesis of OA. © 2011 Blackwell Publishing Limited.

Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

DEFF Research Database (Denmark)

Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

2012-01-01

Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

Expression Profile of IL-35 mRNA in Gingiva of Chronic Periodontitis and Aggressive Periodontitis Patients: A Semiquantitative RT-PCR Study

Directory of Open Access Journals (Sweden)

Nagaraj B. Kalburgi

2013-01-01

Full Text Available Background. Proinflammatory and anti-inflammatory cytokines play a key role in the pathogenesis of periodontal diseases. Secretion of bioactive IL-35 has been described by T regulatory cells ( and is required for their maximal suppressive activity. are involved in the modulation of local immune response in chronic periodontitis patients. Objective. Hence, the present study was aimed to investigate the expression of IL-35 mRNA in chronic periodontitis and aggressive periodontitis patients. Materials and Methods. The present study was carried out in 60 subjects, which included 20 chronic periodontitis patients, 20 aggressive periodontitis patients, and 20 periodontally healthy controls. IL-35 mRNA expression in gingival tissue samples of all subjects was semiquantitatively analyzed using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR. Results. The present study demonstrated the expression of IL-35 mRNA in gingival tissues of all the three groups. IL-35 mRNA expression was highest in chronic periodontitis subjects ( as compared to the aggressive periodontitis group ( and least seen in healthy patients (. Conclusion. The increased expression of IL-35 in chronic and aggressive periodontitis suggests its possible role in pathogenesis of periodontitis. Future studies done on large samples with intervention will strengthen our result.

KCC2a expression in a human fetal lens epithelial cell line.

Science.gov (United States)

Lauf, Peter K; Di Fulvio, Mauricio; Srivastava, Vinita; Sharma, Neelima; Adragna, Norma C

2012-01-01

The fetal human lens epithelial cell (LEC) line (FHL124) possesses all four K(+)Cl(-) (KCC) cotransporter isoforms, KCC1-4, despite KCC2 being typically considered a neuronal isoform. Since at least two spliced variants, KCC2a and KCC2b, are co-expressed in cells of the central nervous system, this study sought to define the KCC2 expression profile in FHL124 cells. KCC2a, but not KCC2b transcripts were detected by reverse transcriptase polymerase chain reaction (RT-PCR). Proteins of molecular weights ranging from 95 to 135 kDa were found by Western blotting using non-variant specific anti-KCC2 antibodies directed against two different regions of the KCC2 proteins, and by biotinylation suggesting membrane expression. Immunofluorescence revealed membrane and punctate cytoplasmic staining for KCC2. Low levels of cytosolic αA and αB crystallines, and neuron-specific enolase were also detected contrasting with the strong membrane immunofluorescence staining for the Na/K ATPase α1 subunit. Since the lack of neuron-specific expression of the KCC2b variant in non-neuronal tissues has been proposed under control of a neuron-restrictive silencing element in the KCC2 gene, we hypothesize that this control may be lifted for the KCC2a variant in the FHL124 epithelial cell culture, a non-neuronal tissue of ectodermal origin. Copyright © 2012 S. Karger AG, Basel.

Geomagnetic Field (Gmf) and Plant Evolution: Investigating the Effects of Gmf Reversal on Arabidopsis thaliana Development and Gene Expression.

Science.gov (United States)

Bertea, Cinzia M; Narayana, Ravishankar; Agliassa, Chiara; Rodgers, Christopher T; Maffei, Massimo E

2015-11-30

One of the most stimulating observations in plant evolution is a correlation between the occurrence of geomagnetic field (GMF) reversals (or excursions) and the moment of the radiation of Angiosperms. This led to the hypothesis that alterations in GMF polarity may play a role in plant evolution. Here, we describe a method to test this hypothesis by exposing Arabidopsis thaliana to artificially reversed GMF conditions. We used a three-axis magnetometer and the collected data were used to calculate the magnitude of the GMF. Three DC power supplies were connected to three Helmholtz coil pairs and were controlled by a computer to alter the GMF conditions. Plants grown in Petri plates were exposed to both normal and reversed GMF conditions. Sham exposure experiments were also performed. Exposed plants were photographed during the experiment and images were analyzed to calculate root length and leaf areas. Arabidopsis total RNA was extracted and Quantitative Real Time-PCR (qPCR) analyses were performed on gene expression of CRUCIFERIN 3 (CRU3), copper transport protein1 (COTP1), Redox Responsive Transcription Factor1 (RRTF1), Fe Superoxide Dismutase 1, (FSD1), Catalase3 (CAT3), Thylakoidal Ascorbate Peroxidase (TAPX), a cytosolic Ascorbate Peroxidase1 (APX1), and NADPH/respiratory burst oxidase protein D (RbohD). Four different reference genes were analysed to normalize the results of the qPCR. The best of the four genes was selected and the most stable gene for normalization was used. Our data show for the first time that reversing the GMF polarity using triaxial coils has significant effects on plant growth and gene expression. This supports the hypothesis that GMF reversal contributes to inducing changes in plant development that might justify a higher selective pressure, eventually leading to plant evolution.

(3,4-dihydroisoquinolin-2(1H)-yl)

Indian Academy of Sciences (India)

Administrator

HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.

New targets and novel antiretrovirals | Wood | Southern African ...

African Journals Online (AJOL)

Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). These ARV classes ...

Using RNA-seq to determine patterns of sex-bias in gene expression in the brain of the sex-role reversed Gulf Pipefish (Syngnathus scovelli).

Science.gov (United States)

Beal, Andria P; Martin, F Douglas; Hale, Matthew C

2018-02-01

Sex-bias in gene expression is a widespread mechanism for controlling the development of phenotypes that differ between males and females. Most studies on sex-bias in gene expression have focused on species that exhibit traditional sex-roles (male-male competition and female parental care). By contrast the Syngnathid fishes (sea horses, pipefish, and sea dragons) are a group of organisms where many species exhibit male brooding and sex-role reversal (female-female competition for mates and paternal parental care), and little is known about how patterns of sex-bias in gene expression vary in species with sex-role reversal. Here we utilize RNA-seq technology to investigate patterns of sex-bias in gene expression in the brain tissue of the Gulf Pipefish (Syngnathus scovelli) a species that exhibits sex-role reversal. Gene expression analysis identified 73 sex-biased genes, 26 genes upregulated in females and 47 genes upregulated in males. Gene ontology analysis found 52 terms enriched for the sex-biased genes in a wide range of pathways suggesting that multiple functions and processes differ between the sexes. We focused on two areas of interest: sex steroids/hormones and circadian rhythms, both of which exhibited sex-bias in gene expression, and are known to influence sexual development in other species. Lastly, the work presented herein contributes to a growing body of genome data available for the Syngnathids, increasing our knowledge on patterns of gene expression in these unusual fishes. Copyright © 2017 Elsevier B.V. All rights reserved.

Investigation of PAX3/7-FKHR fusion genes and IGF2 gene expression in rhabdomyosarcoma tumors.

Science.gov (United States)

de Souza, Robson Ramos; Oliveira, Indhira Dias; Caran, Eliana Maria Monteiro; Alves, Maria Teresa de Seixas; Abib, Simone; Toledo, Silvia Regina Caminada

2012-12-01

The purpose of our study was to investigate the prevalence of the PAX3/7-FKHR fusion genes and quantify the IGF2 gene expression in rhabdomyosarcoma (RMS) samples. Soft tissue sarcomas account 5% of childhood cancers and 50% of them are RMS. Morphological evaluation of pediatric RMS has defined two histological subtypes, embryonal (ERMS) and alveolar (ARMS). Chromosomal analyses have demonstrated two translocations associated with ARMS, resulting in the PAX3/7-FKHR rearrangements. Reverse transcriptase-polymerase chain reaction (RT-PCR) is extremely useful in the diagnosis of ARMS positive for these rearrangements. Additionally, several studies have shown a significant involvement of IGF pathway in the pathogenesis of RMS. The presence of PAX3/7-FKHR gene fusions was studied in 25 RMS samples from patients attending the IOP-GRAACC/UNIFESP and three RMS cell lines by RT-PCR. IGF2 gene expression was quantified by qPCR and related with clinic pathological parameters. Of the 25 samples, nine (36%) were ARMS and 16 (64%) were ERMS. PAX3/7-FKHR gene fusions expression was detected in 56% of ARMS tumor samples. IGF2 overexpression was observed in 80% of samples and could indicate an important role of this pathway in RMS biology. Copyright © 2012 Elsevier Ltd. All rights reserved.

Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

Science.gov (United States)

Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

2013-11-05

Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

Selection of reference genes for gene expression studies in heart failure for left and right ventricles.

Science.gov (United States)

Li, Mengmeng; Rao, Man; Chen, Kai; Zhou, Jianye; Song, Jiangping

2017-07-15

Real-time quantitative reverse transcriptase-PCR (qRT-PCR) is a feasible tool for determining gene expression profiles, but the accuracy and reliability of the results depends on the stable expression of selected housekeeping genes in different samples. By far, researches on stable housekeeping genes in human heart failure samples are rare. Moreover the effect of heart failure on the expression of housekeeping genes in right and left ventricles is yet to be studied. Therefore we aim to provide stable housekeeping genes for both ventricles in heart failure and normal heart samples. In this study, we selected seven commonly used housekeeping genes as candidates. By using the qRT-PCR, the expression levels of ACTB, RAB7A, GAPDH, REEP5, RPL5, PSMB4 and VCP in eight heart failure and four normal heart samples were assessed. The stability of candidate housekeeping genes was evaluated by geNorm and Normfinder softwares. GAPDH showed the least variation in all heart samples. Results also indicated the difference of gene expression existed in heart failure left and right ventricles. GAPDH had the highest expression stability in both heart failure and normal heart samples. We also propose using different sets of housekeeping genes for left and right ventricles respectively. The combination of RPL5, GAPDH and PSMB4 is suitable for the right ventricle and the combination of GAPDH, REEP5 and RAB7A is suitable for the left ventricle. Copyright © 2017 Elsevier B.V. All rights reserved.

Prevention of diet-induced obesity by safflower oil: insights at the levels of PPARalpha, orexin, and ghrelin gene expression of adipocytes in mice.

Science.gov (United States)

Zhang, Zhong; Li, Qiang; Liu, Fengchen; Sun, Yuqian; Zhang, Jinchao

2010-03-15

The aim of this study was to investigate the prevention of diet-induced obesity by a high safflower oil diet and adipocytic gene expression in mice. Forty 3-week-old C57BL/6 mice were randomly divided into three groups: control group (CON, 5% lard + 5% safflower oil), high lard group (LAR, 45% lard + 5% safflower oil), and high safflower oil group (SAF, 45% safflower oil + 5% lard). After 10 weeks, 10 mice of the LAR group were switched to high safflower oil diet (LAR-SAF). Ten weeks later, glucose tolerance tests were performed by intraperitoneal injection of glucose. Circulating levels of lipid and insulin were measured and white adipose tissues were taken for gene chip and reverse transcriptase-polymerase chain reaction analysis. The LAR group showed higher body weight, adiposity index, insulin, and lipids than the CON group (P<0.05). The body weight in the LAR-SAF group decreased after dietary reversal. The plasma biochemical profiles decreased in the LAR-SAF and SAF groups (P<0.05) compared with those of the LAR group. The blood glucose level of the LAR-SAF group was reduced during intraperitoneal glucose tolerance test compared with that of the LAR group. The LAR-SAF group had lower levels of Orexin and Ghrelin gene expression, whereas the level of PPARalpha gene expression was significantly enhanced compared with that of the LAR group. So, the SAF diet can alter adipocytic adiposity-related gene expression and result in effective amelioration of diet-induced obesity.

Depleted aldehyde dehydrogenase 1A1 (ALDH1A1) reverses cisplatin resistance of human lung adenocarcinoma cell A549/DDP.

Science.gov (United States)

Wei, Yunyan; Wu, Shuangshuang; Xu, Wei; Liang, Yan; Li, Yue; Zhao, Weihong; Wu, Jianqing

2017-01-01

Cisplatin is the standard first-line chemotherapeutic agent for the treatment of non-small cell lung cancer (NSCLC). However, resistance to chemotherapy has been a major obstacle in the management of NSCLC. Aldehyde dehydrogenase 1A1 (ALDH1A1) overexpression has been observed in a variety of cancers, including lung cancer. The purpose of this study was to investigate the effect of ALDH1A1 expression on cisplatin resistance and explore the mechanism responsible. Reverse transcriptase-PCR was applied to measure the messenger RNA expression of ALDH1A1, while Western blot assay was employed to evaluate the protein expression of ALDH1A1, B-cell lymphoma 2, Bcl-2-like protein 4, phospho-protein kinase B (p-AKT) and AKT. A short hairpin RNA was used to knockdown ALDH1A1 expression. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was used to determine the effect of ALDH1A1 decrease on cell viability. The cell apoptotic rate was tested using flow cytometry assay. ALDH1A1 is overexpressed in cisplatin resistant cell line A549/DDP, compared with A549. ALDH1A1 depletion significantly decreased A549/DDP proliferation, increased apoptosis, and reduced cisplatin resistance. In addition, the phosphoinositide 3-kinase (PI3K) / AKT pathway is activated in A549/DDP, and ALDH1A1 knockdown reduced the phosphorylation level of AKT. Moreover, the combination of ALDH1A1-short hairpin RNA and PI3K/AKT pathway inhibitor LY294002 markedly inhibited cell viability, enhanced apoptotic cell death, and increased cisplatin sensitivity. These results suggest that ALDH1A1 depletion could reverse cisplatin resistance in human lung cancer cell line A549/DDP, and may act as a potential target for the treatment of lung cancers resistant to cisplatin. © 2016 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

Suicide Inhibitors of Reverse Transcriptase in the Therapy of AIDS and Other Retroviruses

Science.gov (United States)

1989-07-01

are shown below. One of the first, [N-(L-3-tran carboxyxiran-2-carbonyl)-L-leucyl]-amido (4-guanido) butane was isolated from Asperg /II japonicus and...using uridine nucleosides to enhance the antiviral selectivity. j, Synthesis of Uridine 2’ and 3*-Ribosoiroxr’es 3*-uridine spiroxirane was...system used (Figure 2). Also shown in this figure is the enhanced sensitivity of the vaccif recombinant HIV-RT to Foscarnet when expressed in monkey kidney

Expression profile of genes during resistance reversal in a temephos selected strain of the dengue vector, Aedes aegypti.

Directory of Open Access Journals (Sweden)

Clare Strode

Full Text Available BACKGROUND: The mosquito Aedes aegypti is one of the most important disease vectors because it transmits two major arboviruses, dengue and yellow fever, which cause significant global morbidity and mortality. Chemical insecticides form the cornerstone of vector control. The organophosphate temephos a larvicide recommended by WHO for controlling Ae. aegypti, however, resistance to this compound has been reported in many countries, including Brazil. METHODOLOGY/PRINCIPAL FINDINGS: The aim of this study was to identify genes implicated in metabolic resistance in an Ae. aegypti temephos resistant strain, named RecR, through microarray analysis. We utilized a custom 'Ae. aegypti detox chip' and validated microarray data through RT-PCR comparing susceptible and resistant individuals. In addition, we analyzed gene expression in 4(th instar larvae from a reversed susceptible strain (RecRev, exposed and unexposed to temephos. The results obtained revealed a set of 13 and 6 genes significantly over expressed in resistant adult mosquitoes and larvae, respectively. One of these genes, the cytochrome P450 CYP6N12, was up-regulated in both stages. RT-PCR confirmed the microarray results and, additionally, showed no difference in gene expression between temephos exposed and unexposed RecRev mosquitoes. This suggested that the differences in the transcript profiles among the strains are heritable due to a selection process and are not caused by immediate insecticide exposure. Reversal of temephos resistance was demonstrated and, importantly, there was a positive correlation between a decrease in the resistance ratio and an accompanying decrease in the expression levels of previously over expressed genes. Some of the genes identified here have also been implicated in metabolic resistance in other mosquito species and insecticide resistant populations of Ae. aegypti. CONCLUSIONS/SIGNIFICANCE: The identification of gene expression signatures associated to

Construction and analysis of the cDNA subtraction library of yeast and mycelial phases of Sporothrix globosa isolated in China: identification of differentially expressed genes*

Science.gov (United States)

Hu, Qing-bi; He, Yu; Zhou, Xun

2015-01-01

Species included in the Sporothrix schenckii complex are temperature-dependent with dimorphic growth and cause sporotrichosis that is characterized by chronic and fatal lymphocutaneous lesions. The putative species included in the Sporothrix complex are S. brasiliensis, S. globosa, S. mexicana, S. pallida, S. schenckii, and S. lurei. S. globosa is the causal agent of sporotrichosis in China, and its pathogenicity appears to be closely related to the dimorphic transition, i.e. from the mycelial to the yeast phase, it adapts to changing environmental conditions. To determine the molecular mechanisms of the switching process that mediates the dimorphic transition of S. globosa, suppression subtractive hybridization (SSH) was used to prepare a complementary DNA (cDNA) subtraction library from the yeast and mycelial phases. Bioinformatics analysis was performed to profile the relationship between differently expressed genes and the dimorphic transition. Two genes that were expressed at higher levels by the yeast form were selected, and their differential expression levels were verified using a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). It is believed that these differently expressed genes are involved in the pathogenesis of S. globosa infection in China. PMID:26642182

Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types.

Science.gov (United States)

Kilian, A; Bowtell, D D; Abud, H E; Hime, G R; Venter, D J; Keese, P K; Duncan, E L; Reddel, R R; Jefferson, R A

1997-11-01

Telomerase is a multicomponent reverse transcriptase enzyme that adds DNA repeats to the ends of chromosomes using its RNA component as a template for synthesis. Telomerase activity is detected in the germline as well as the majority of tumors and immortal cell lines, and at low levels in several types of normal cells. We have cloned a human gene homologous to a protein from Saccharomyces cerevisiae and Euplotes aediculatus that has reverse transcriptase motifs and is thought to be the catalytic subunit of telomerase in those species. This gene is present in the human genome as a single copy sequence with a dominant transcript of approximately 4 kb in a human colon cancer cell line, LIM1215. The cDNA sequence was determined using clones from a LIM1215 cDNA library and by RT-PCR, cRACE and 3'RACE on mRNA from the same source. We show that the gene is expressed in several normal tissues, telomerase-positive post-crisis (immortal) cell lines and various tumors but is not expressed in the majority of normal tissues analyzed, pre-crisis (non-immortal) cells and telomerase-negative immortal (ALT) cell lines. Multiple products were identified by RT-PCR using primers within the reverse transcriptase domain. Sequencing of these products suggests that they arise by alternative splicing. Strikingly, various tumors, cell lines and even normal tissues (colonic crypt and testis) showed considerable differences in the splicing patterns. Alternative splicing of the telomerase catalytic subunit transcript may be important for the regulation of telomerase activity and may give rise to proteins with different biochemical functions.

Cloning, expression, and characterization of cadmium and manganese uptake genes from Lactobacillus plantarum

Energy Technology Data Exchange (ETDEWEB)

Hao, Z.; Chen, S.; Wilson, D.B.

1999-11-01

An Mn{sup 2+} and Cd{sup 2+} uptake gene, mntA, was cloned from Lactobacillus plantarum ATCC 14917 into Escherichia coli. Its expression conferred on E. coli cells increased Cd{sup 2+} sensitivity as well as energy-dependent Cd{sup 2+} uptake activity. Both transcription and translation of mntA were induced by Mn{sup 2+} starvation in L. plantarum, as indicated by reverse transcriptase PCR and immunoblotting. Two Cd{sup 2+} uptake systems have been identified in L. plantarum: one is a high-affinity Mn{sup 2+} and Cd{sup 2+} uptake system that is expressed in Mn{sup 2+}-starved cells, and the other is a nonsaturable Cd{sup 2+} uptake system that is expressed in Cd{sup 2+}-sufficient cells. MntA was not detected in an Mn{sup 2+}-dependent mutant of L. plantarum which had lost high-affinity Mn{sup 2+} and Cd{sup 2+} uptake activity. The results suggest that mntA is the gene encoding the high-affinity Mn{sup 2+} and Cd{sup 2+} transporter. On the basis of its predicted amino acid sequence, MntA belongs to the family of P-type cation-translocating ATPases. The topology and potential Mn{sup 2+}- and Cd{sup 2+}-binding sites of MntA are discussed. A second clone containing a low-affinity Cd{sup 2+} transport system was also isolated.

Impact of psychostimulants and atomoxetine on the expression of 8-hydroxyguanine glycosylase 1 in human cells.

Science.gov (United States)

Schmidt, Andreas Johannes; Clement, Hans-Willi; Gebhardt, Stefan; Hemmeter, Ulrich Michael; Schulz, Eberhard; Krieg, Jürgen-Christian; Kircher, Tilo; Heiser, Philip

2010-06-01

Oxidative DNA damage as one sign of reactive oxygen species induced oxidative stress is an important factor in the pathogenesis of various psychiatric disorders. Altered levels of DNA base damage products as well as the expression of the main repair enzyme 8-hydroxyguanine glycosylase 1 have been described. The aim of the present study was to examine the effects of drugs (amphetamine, methylphenidate and atomoxetine) used in the treatment of attention deficit-hyperactivity disorder on the expression of this enzyme via reverse transcriptase-polymerase chain reaction in human neuroblastoma SH-SY5Y and human monocytic U-937 cells at concentrations of 50, 500 and 5,000 ng/ml. We observed decreased expression of this enzyme for all applied substances. In U-937 cells, the significance level was reached after treatment with 5,000 ng/ml amphetamine as well as after treatment with 50, 500 and 5,000 ng/ml atomoxetine. Incubation of SH-SY5Y cells with 50 and 5,000 ng/ml amphetamine and 5,000 ng/ml methylphenidate led to significant decreases of 8-hydroxyguanine glycosylase 1. As a positive correlation between the expression of 8-hydroxyguanine glycosylase 1 and the level of oxidative DNA damage products has been described, we accordingly consider these substances (amphetamine, methylphenidate and atomoxetine) to possibly play a protective role in this process.

Presence and Expression of Microbial Genes Regulating Soil Nitrogen Dynamics Along the Tanana River Successional Sequence

Science.gov (United States)

Boone, R. D.; Rogers, S. L.

2004-12-01

We report on work to assess the functional gene sequences for soil microbiota that control nitrogen cycle pathways along the successional sequence (willow, alder, poplar, white spruce, black spruce) on the Tanana River floodplain, Interior Alaska. Microbial DNA and mRNA were extracted from soils (0-10 cm depth) for amoA (ammonium monooxygenase), nifH (nitrogenase reductase), napA (nitrate reductase), and nirS and nirK (nitrite reductase) genes. Gene presence was determined by amplification of a conserved sequence of each gene employing sequence specific oligonucleotide primers and Polymerase Chain Reaction (PCR). Expression of the genes was measured via nested reverse transcriptase PCR amplification of the extracted mRNA. Amplified PCR products were visualized on agarose electrophoresis gels. All five successional stages show evidence for the presence and expression of microbial genes that regulate N fixation (free-living), nitrification, and nitrate reduction. We detected (1) nifH, napA, and nirK presence and amoA expression (mRNA production) for all five successional stages and (2) nirS and amoA presence and nifH, nirK, and napA expression for early successional stages (willow, alder, poplar). The results highlight that the existing body of previous process-level work has not sufficiently considered the microbial potential for a nitrate economy and free-living N fixation along the complete floodplain successional sequence.

Effect of immunomodulatory therapy on the endometrial inflammatory response to induced infectious endometritis in susceptible mares

DEFF Research Database (Denmark)

Christoffersen, Mette; Woodward, Elizabeth; Bojesen, Anders Miki

2012-01-01

endometritis based on their endometrial histopathology and ability to clear an induced uterine inflammation. To investigate the effect of immunomodulatory therapy, the mares were inoculated with 10(5) colony forming units (CFU) Escherichia coli in three consecutive estrus cycles in a modified cross-over study...... inoculation. Endometrial biopsies were recovered 3, 24 and 72 h post inoculation. Relative gene-expression analyses were performed by quantitative reverse transcriptase PCR (qRT-PCR). Endometrial gene expression of inflammatory cytokines was modulated by administration of GC. Expression of proinflammatory...

Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus

DEFF Research Database (Denmark)

Dukes, J.P.; King, D.P.; Alexandersen, Søren

2006-01-01

Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...

Beclin 1 Expression is Closely Linked to Colorectal Carcinogenesis and Distant Metastasis of Colorectal Carcinoma

Directory of Open Access Journals (Sweden)

Mei-Ying Zhang

2014-08-01

Full Text Available Beclin 1 participates in development, autophagy, differentiation, anti- apoptosis, neurodegeneration, tumorigenesis and cancer progression. The roles of Beclin 1 in colorectal carcinogenesis and its subsequent progression are still unclear. Here, the mRNA and protein expression of Beclin 1 were determined in colorectal carcinoma and matched mucosa by Reverse transcriptase-polymerase chain reaction and Western blot. Immunohistochemistry and in situ hybridization (ISH were performed on tissue microarryer with colorectal carcinoma, adenoma and mucosa. The expression of Beclin 1 mRNA and protein was found to be higher in colorectal carcinoma than matched mucosa by real-time PCR and Western blot (p < 0.05. According to the ISH data, Beclin 1 expression was lower in colorectal non-neoplastic mucosa (NNM than adenoma and carcinoma (p < 0.05. Immunohistochemically, primary carcinoma showed stronger Beclin 1 expression than NNM and metastatic carcinoma in the liver (p < 0.05. Beclin 1 protein expression was negatively related to liver and distant metastasis (p < 0.05, but not correlated with age, sex, depth of invasion, lymphatic or venous invasion, lymph node metastasis, tumor-node-metastasis (TNM staging, differentiation or serum carcinoembryonic antigen (CEA concentration (p > 0.05. Survival analysis indicated that Beclin 1 expression was not linked to favorable prognosis of the patients with colorectal carcinoma (p > 0.05. Cox’s model indicated that depth of invasion and distant metastasis were independent prognostic factors for colorectal carcinomas (p < 0.05. It was suggested that Beclin 1 expression is closely linked to colorectal carcinogenesis and distant metastasis of colorectal carcinoma.

Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

Science.gov (United States)

Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

2014-09-01

Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis.

Science.gov (United States)

Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin

2017-04-01

Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

Dynamics of Colonization and Expression of Pathogenicity Related Genes in Fusarium oxysporum f.sp. ciceri during Chickpea Vascular Wilt Disease Progression.

Directory of Open Access Journals (Sweden)

Medha L Upasani

Full Text Available Fusarium wilt caused by Fusarium oxysporum f.sp. ciceri (Foc is a constant threat to chickpea productivity in several parts of the world. Understanding the molecular basis of chickpea-Foc interaction is necessary to improve chickpea resistance to Foc and thereby the productivity of chickpea. We transformed Foc race 2 using green fluorescent protein (GFP gene and used it to characterize pathogen progression and colonization in wilt-susceptible (JG62 and wilt-resistant (Digvijay chickpea cultivars using confocal microscopy. We also employed quantitative PCR (qPCR to estimate the pathogen load and progression across various tissues of both the chickpea cultivars during the course of the disease. Additionally, the expression of several candidate pathogen virulence genes was analyzed using quantitative reverse transcriptase PCR (qRT-PCR, which showed their characteristic expression in wilt-susceptible and resistant chickpea cultivars. Our results suggest that the pathogen colonizes the susceptible cultivar defeating its defense; however, albeit its entry in the resistant plant, further proliferation is severely restricted providing an evidence of efficient defense mechanism in the resistant chickpea cultivar.

High Laccase Expression by Trametes versicolor in a Simulated Textile Effluent with Different Carbon Sources and PHs

Directory of Open Access Journals (Sweden)

Cristiane Ottoni

2016-08-01

Full Text Available Textile effluents are highly polluting and have variable and complex compositions. They can be extremely complex, with high salt concentrations and alkaline pHs. A fixed-bed bioreactor was used in the present study to simulate a textile effluent treatment, where the white-rot fungus, Trametes versicolor, efficiently decolourised the azo dye Reactive Black 5 over 28 days. This occurred under high alkaline conditions, which is unusual, but advantageous, for successful decolourisation processes. Active dye decolourisation was maintained by operation in continuous culture. Colour was eliminated during the course of operation and maximum laccase (Lcc activity (80.2 U∙L−1 was detected after glycerol addition to the bioreactor. Lcc2 gene expression was evaluated with different carbon sources and pH values based on reverse transcriptase-PCR (polymerase chain reaction. Glycerol was shown to promote the highest lcc2 expression at pH 5.5, followed by sucrose and then glucose. The highest levels of expression occurred between three and four days, which corroborate the maximum Lcc activity observed for sucrose and glycerol on the bioreactor. These results give new insights into the use of T. versicolor in textile dye wastewater treatment with high pHs.

Gene expression related to oxidative stress in the heart of mice after intestinal ischemia

International Nuclear Information System (INIS)

Somaio Neto, Frederico; Ikejiri, Adauto Tsutomu; Bertoletto, Paulo Roberto; Chaves, José Carlos Bertoletto; Teruya, Roberto; Fagundes, Djalma José; Taha, Murched Omar

2014-01-01

Intestinal ischemia-reperfusion is a frequent clinical event associated to injury in distant organs, especially the heart. To investigate the gene expression of oxidative stress and antioxidant defense in the heart of inbred mice subjected to intestinal ischemia and reperfusion (IR). Twelve mice (C57BL / 6) were assigned to: IR Group (GIR) with 60 minutes of superior mesenteric artery occlusion followed by 60 minutes of reperfusion; Control Group (CG) which underwent anesthesia and laparotomy without IR procedure and was observed for 120 minutes. Intestine and heart samples were processed using the RT-qPCR / Reverse transcriptase-quantitative Polymerase Chain Reaction method for the gene expression of 84 genes related to oxidative stress and oxidative defense (Student's 't' test, p < 0.05). The intestinal tissue (GIR) was noted to have an up-regulation of 65 genes (74.71%) in comparison to normal tissue (CG), and 37 genes (44.04%) were hyper-expressed (greater than three times the threshold allowed by the algorithm). Regarding the remote effects of intestinal I/R in cardiac tissue an up-regulation of 28 genes (33.33%) was seen, but only eight genes (9.52%) were hyper-expressed three times above threshold. Four (7.14%) of these eight genes were expressed in both intestinal and cardiac tissues. Cardiomyocytes with smaller and pyknotic nuclei, rich in heterochromatin with rare nucleoli, indicating cardiac distress, were observed in the GIR. Intestinal I/R caused a statistically significant over expression of 8 genes associated with oxidative stress in remote myocardial tissue

Gene expression related to oxidative stress in the heart of mice after intestinal ischemia

Science.gov (United States)

Somaio Neto, Frederico; Ikejiri, Adauto Tsutomu; Bertoletto, Paulo Roberto; Chaves, José Carlos Bertoletto; Teruya, Roberto; Fagundes, Djalma José; Taha, Murched Omar

2014-01-01

Background Intestinal ischemia-reperfusion is a frequent clinical event associated to injury in distant organs, especially the heart. Objective To investigate the gene expression of oxidative stress and antioxidant defense in the heart of inbred mice subjected to intestinal ischemia and reperfusion (IR). Methods Twelve mice (C57BL / 6) were assigned to: IR Group (GIR) with 60 minutes of superior mesenteric artery occlusion followed by 60 minutes of reperfusion; Control Group (CG) which underwent anesthesia and laparotomy without IR procedure and was observed for 120 minutes. Intestine and heart samples were processed using the RT-qPCR / Reverse transcriptase-quantitative Polymerase Chain Reaction method for the gene expression of 84 genes related to oxidative stress and oxidative defense (Student's "t" test, p < 0.05). Results The intestinal tissue (GIR) was noted to have an up-regulation of 65 genes (74.71%) in comparison to normal tissue (CG), and 37 genes (44.04%) were hyper-expressed (greater than three times the threshold allowed by the algorithm). Regarding the remote effects of intestinal I/R in cardiac tissue an up-regulation of 28 genes (33.33%) was seen, but only eight genes (9.52%) were hyper-expressed three times above threshold. Four (7.14%) of these eight genes were expressed in both intestinal and cardiac tissues. Cardiomyocytes with smaller and pyknotic nuclei, rich in heterochromatin with rare nucleoli, indicating cardiac distress, were observed in the GIR. Conclusion Intestinal I/R caused a statistically significant over expression of 8 genes associated with oxidative stress in remote myocardial tissue. PMID:24346830

Gene expression related to oxidative stress in the heart of mice after intestinal ischemia

Energy Technology Data Exchange (ETDEWEB)

Somaio Neto, Frederico; Ikejiri, Adauto Tsutomu; Bertoletto, Paulo Roberto; Chaves, José Carlos Bertoletto [Universidade Federal da Grande Dourados - UFGD, Dourados, MS (Brazil); Teruya, Roberto [Universidade Federal do Mato Grosso do Sul - UFMS, Campo Grande, MS (Brazil); Fagundes, Djalma José, E-mail: fsomaio@cardiol.br; Taha, Murched Omar [Universidade Federal de São Paulo - UNIFESP, São Paulo, SP (Brazil)

2014-02-15

Intestinal ischemia-reperfusion is a frequent clinical event associated to injury in distant organs, especially the heart. To investigate the gene expression of oxidative stress and antioxidant defense in the heart of inbred mice subjected to intestinal ischemia and reperfusion (IR). Twelve mice (C57BL / 6) were assigned to: IR Group (GIR) with 60 minutes of superior mesenteric artery occlusion followed by 60 minutes of reperfusion; Control Group (CG) which underwent anesthesia and laparotomy without IR procedure and was observed for 120 minutes. Intestine and heart samples were processed using the RT-qPCR / Reverse transcriptase-quantitative Polymerase Chain Reaction method for the gene expression of 84 genes related to oxidative stress and oxidative defense (Student's 't' test, p < 0.05). The intestinal tissue (GIR) was noted to have an up-regulation of 65 genes (74.71%) in comparison to normal tissue (CG), and 37 genes (44.04%) were hyper-expressed (greater than three times the threshold allowed by the algorithm). Regarding the remote effects of intestinal I/R in cardiac tissue an up-regulation of 28 genes (33.33%) was seen, but only eight genes (9.52%) were hyper-expressed three times above threshold. Four (7.14%) of these eight genes were expressed in both intestinal and cardiac tissues. Cardiomyocytes with smaller and pyknotic nuclei, rich in heterochromatin with rare nucleoli, indicating cardiac distress, were observed in the GIR. Intestinal I/R caused a statistically significant over expression of 8 genes associated with oxidative stress in remote myocardial tissue.

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

Science.gov (United States)

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

Analysis of the temporal expression of chemokines and chemokine receptors during experimental granulomatous inflammation: role and expression of MIP-1α and MCP-1

Science.gov (United States)

Carollo, Maria; Hogaboam, Cory M; Kunkel, Stephen L; Delaney, Stephen; Christie, Mark I; Perretti, Mauro

2001-01-01

Chemokine expression and function was monitored in an experimental model of granulomatous tissue formation after injection of croton oil in complete Freund's adjuvant (CO/CFA) into mouse dorsal air-pouches up to 28 days. In the first week, mast cell degranulation and leukocyte influx (mononuclear cell, MNC, and polymorphonuclear cell, PMN) were associated with CXCR2, KC and macrophage inflammatory protein (MIP)-2 mRNA expression, as determined by TaqMan® reverse transcriptase-polymerase chain reaction. KC (∼400 pg mg protein−1, n=12) and MIP-2 (∼800 pg mg protein−1, n=12) proteins peaked at day 7, together with myeloperoxidase (MPO) activity. Highest MIP-1α (>1 ng mg protein−1, n=12) levels were measured at day 3. After day 7, a gradual increase in CCR2 and CCR5 mRNA, monocyte chemoattractant protein (MCP)-1 mRNA and protein expression was measured. MCP-1 protein peaked at day 21 (∼150 pg mg protein−1, n=12) and was predominantly expressed by mast cells. A gradual increase in N-acetyl-β-D-glucosaminidase (NAG) activity (maximal at 28 days) was also measured. An antiserum against MIP-1α did not modify the inflammatory response measured at day 7 (except for a 50% reduction in MIP-1α levels), but provoked a significant increase in MPO, NAG and MCP-1 levels as measured at day 21 (n=6, Pvalues (n=8, P<0.05). In conclusion, we have shown that CO/CFA initiates a complex inflammatory reaction in which initial expression of MIP-1α serves a protective role whereas delayed expression of MCP-1 seems to have a genuine pro-inflammatory role. PMID:11704636

Sexual dimorphic expression of DMRT1 and Sox9a during gonadal differentiation and hormone-induced sex reversal in the teleost fish Nile tilapia (Oreochromis niloticus).

Science.gov (United States)

Kobayashi, Tohru; Kajiura-Kobayashi, Hiroko; Guan, Guijun; Nagahama, Yoshitaka

2008-01-01

We examined the expression profiles of tDMRT1 and Sox9a during gonadal sex differentiation and hormone-induced sex reversal. tDMRT1 was detected in the gonial germ-cell-surrounding cells in XY fry specifically before the appearance of any signs of morphological sex differentiation, that is, sex differences in germ cell number and histogenesis, such as differentiation into intratesticular efferent duct or ovarian cavity. The signals became localized in the Sertoli and epithelial cells comprising the efferent duct during gonadal differentiation. After the induction of XY sex reversal with estrogen, tDMRT1 decreased and then disappeared completely. In contrast, tDMRT1 was expressed in the germ-cell-surrounding cells in XX sex reversal with androgen. On the other hand, Sox9a did not show sexual dimorphism before the appearance of sex differences in histogenesis and was not expressed in the efferent duct in the testis. These results suggest that tDMRT1 is a superior testicular differentiation marker in tilapia.

Cloning and expression of SgCYP450-4 from Siraitia grosvenorii

Directory of Open Access Journals (Sweden)

Dongping Tu

2016-10-01

Full Text Available CYP450 plays an essential role in the development and growth of the fruits of Siraitia grosvenorii. However, little is known about the SgCYP450-4 gene in S. grosvenorii. Here, based on transcriptome data, a full-length cDNA sequence of SgCYP450-4 was cloned by reverse transcriptase-polymerase chain reaction (RT-PCR and rapid-amplification of cDNA ends (RACE strategies. SgCYP450-4 is 1677 bp in length (GenBank accession No. AEM42985.1 and contains a complete open reading frame (ORF of 1422 bp. The deduced protein was composed of 473 amino acids, the molecular weight is 54.01 kDa, the theoretical isoelectric point (PI is 8.8, and the protein was predicted to possess cytochrome P450 domains. SgCYP450-4 gene was highly expressed in root, diploid fruit and fruit treated with hormone and pollination. At 10 days after treatment with pollination and hormones, the expression of SgCYP450-4 had the highest level and then decreased over time, which was consistent with the development of fruits of S. Grosvenorii. Hormonal treatment could significantly induce the expression of SgCYP450-4. These results provide a reference for regulation of fruit development and the use of parthenocarpy to generate seedless fruit, and provide a scientific basis for the production of growth regulator application agents.

Role of NLRC5 in progression and reversal of hepatic fibrosis

Energy Technology Data Exchange (ETDEWEB)

Liu, Xuejiao, E-mail: liuxuejiao0615@163.com [School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University, Hefei 230032 (China); Institute for Liver Diseases, Anhui Medical University, Hefei 230032 (China); Wu, Yuting; Yang, Yang; Li, Wanxia; Huang, Cheng; Meng, Xiaoming [School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University, Hefei 230032 (China); Institute for Liver Diseases, Anhui Medical University, Hefei 230032 (China); Li, Jun, E-mail: lj@ahmu.edu.cn [School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University, Hefei 230032 (China); Institute for Liver Diseases, Anhui Medical University, Hefei 230032 (China); School of Pharmacy, Anhui Medical University, Mei Shan load, Hefei 230032, Anhui Province (China)

2016-03-01

Background: NLRC5, as the largest member of NLRs family, has recently been identified as a critical regulator of immune responses through negatively regulating NF-κB which is associated with the development of hepatic fibrosis. However, the expression and potential roles of NLRC5 in hepatic fibrosis and its reversal are still to be defined. Methods: C57BL/6 mice were treatment with carbon tetrachloride (CCl{sub 4}) induce hepatic fibrosis and its reversal. In vitro, models of hepatic fibrosis and its reversal are established by the treatment with TGF-β and MDI. The expression of NLRC5 was determined by RT-PCR, Western blot and immunohistochemistry. Consequently, NLRC5 was overexpressed or knockdown by transfecting PEGFP-C2-NLRC5 or NLRC5-siRNA respectively in the reversal of hepatic fibrosis, and the expression of fibrogenic genes such as α-SMA and Col1α1 was quantified. The NF-κB activity was detected as well. Results: Immunohistochemistry, RT-PCR and Western blot analysis with liver tissues and primary HSCs showed that NLRC5 was highly expressed in hepatic fibrosis and correspondingly decreased in the reversal stage. The differential expression of NLRC5 was confirmed in vitro. Enforced NLRC5 expression increased the expression of α-SMA and Col1α1, and blockade of NLRC5 reduced the fibrotic response. While the opposite expression of phosphorylated NF-kB p65 and phospho-IκBα was found. Conclusion: NLRC5 is differentially expressed in hepatic tissues and hepatic stellate cells during hepatic fibrosis and its reversal. All the data indicated that NLRC5 may play a crucial role in regulating the reversal of hepatic fibrosis through NF-κB signaling pathway. - Highlights: • The activated HSCs can be reverted to quiescent HSCs by MDI treatment. • NLRC5 expressed differentially during different stages of hepatic fibrosis and its reversal. • Enforced NLRC5 in reverted LX-c cells boosted the expression of α-SMA and Col1α1. • Blockade of NLRC5 diminished �

Expression profiles of aquaporins in rat conjunctiva, cornea, lacrimal gland and Meibomian gland.

Science.gov (United States)

Yu, Dongfang; Thelin, William R; Randell, Scott H; Boucher, Richard C

2012-10-01

The aim of the study was to elucidate aquaporin (AQP) family member mRNA expression and protein expression/localization in the rat lacrimal functional unit. The mRNA expression of all rat AQPs (AQP0-9, 11-12) in palpebral, fornical, and bulbar conjunctiva, cornea, lacrimal gland, and Meibomian gland was measured by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) and real time RT-PCR. Antibodies against AQP1, 3, 4, 5, 9, and 11 were used in Western blotting and immunohistochemistry to determine protein expression and distribution. Our study demonstrated characteristic AQP expression profiles in rat ocular tissues. AQP1, 3, 4, 5, 8, 9, 11, and 12 mRNA were detected in conjunctiva. AQP0, 1, 2, 3, 4, 5, 6, 11, and 12 mRNA were expressed in cornea. AQP0, 1, 2, 3, 4, 5, 7, 8, and 11 mRNA were detected in lacrimal gland. AQP1, 3, 4, 5, 7, 8, 9, 11, and 12 mRNA were identified in Meibomian gland. By Western blot, AQP1, 3, 5, and 11 were detected in conjunctiva; AQP1, 3, 5, and 11 were identified in cornea; AQP1, 3, 4, 5, and 11 were detected in lacrimal gland; and AQP1, 3, 4, 5, 9, and 11 were present in Meibomian gland. Immunohistochemistry localized AQPs to distinct sites in the various tissues. This study rigorously analyzed AQPs expression and localization in rat conjunctiva, cornea, lacrimal gland, and Meibomian gland tissues. Our findings provide a comprehensive platform for further investigation into the physiological or pathophysiological relevance of AQPs in ocular surface. Copyright © 2012 Elsevier Ltd. All rights reserved.

Selective Inducible Nitric Oxide Synthase Inhibitor Reversed Zinc Chloride-Induced Spatial Memory Impairment via Increasing Cholinergic Marker Expression.

Science.gov (United States)

Tabrizian, Kaveh; Azami, Kian; Belaran, Maryam; Soodi, Maliheh; Abdi, Khosrou; Fanoudi, Sahar; Sanati, Mehdi; Mottaghi Dastjerdi, Negar; Soltany Rezaee-Rad, Mohammad; Sharifzadeh, Mohammad

2016-10-01

Zinc, an essential micronutrient and biochemical element of the human body, plays structural, catalytic, and regulatory roles in numerous physiological functions. In the current study, the effects of a pretraining oral administration of zinc chloride (10, 25, and 50 mg/kg) for 14 consecutive days and post-training bilateral intra-hippocampal infusion of 1400W as a selective inducible nitric oxide synthase (iNOS) inhibitor (10, 50, and 100 μM/side), alone and in combination, on the spatial memory retention in Morris water maze (MWM) were investigated. Animals were trained for 4 days and tested 48 h after completion of training. Also, the molecular effects of these compounds on the expression of choline acetyltransferase (ChAT), as a cholinergic marker in the CA1 region of the hippocampus and medial septal area (MSA), were evaluated. Behavioral and molecular findings of this study showed that a 2-week oral administration of zinc chloride (50 mg/kg) impaired spatial memory retention in MWM and decreased ChAT expression. Immunohistochemical analysis of post-training bilateral intra-hippocampal infusion of 1400W revealed a significant increase in ChAT immunoreactivity. Furthermore, post-training bilateral intra-hippocampal infusion of 1400W into the CA1 region of the hippocampus reversed zinc chloride-induced spatial memory impairment in MWM and significantly increased ChAT expression in comparison with zinc chloride-treated animals. Taken together, these results emphasize the role of selective iNOS inhibitors in reversing zinc chloride-induced spatial memory deficits via modulation of cholinergic marker expression.

Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa

Directory of Open Access Journals (Sweden)

Aline Aki Tanikawa

2013-08-01

Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.

Cloning of an ADP-ribosylation factor gene from banana (Musa acuminata) and its expression patterns in postharvest ripening fruit.

Science.gov (United States)

Wang, Yuan; Wu, Jing; Xu, Bi-Yu; Liu, Ju-Hua; Zhang, Jian-Bin; Jia, Cai-Hong; Jin, Zhi-Qiang

2010-08-15

A full-length cDNA encoding an ADP-ribosylation factor (ARF) from banana (Musa acuminata) fruit was cloned and named MaArf. It contains an open reading frame encoding a 181-amino-acid polypeptide. Sequence analysis showed that MaArf shared high similarity with ARF of other plant species. The genomic sequence of MaArf was also obtained using polymerase chain reaction (PCR). Sequence analysis showed that MaArf was a split gene containing five exons and four introns in genomic DNA. Reverse-transcriptase PCR was used to analyze the spatial expression of MaArf. The results showed that MaArf was expressed in all the organs examined: root, rhizome, leaf, flower and fruit. Real-time quantitative PCR was used to explore expression patterns of MaArf in postharvest banana. There was differential expression of MaArf associated with ethylene biosynthesis. In naturally ripened banana, expression of MaArf was in accordance with ethylene biosynthesis. However, in 1-methylcyclopropene-treated banana, the expression of MaArf was inhibited and changed little. When treated with ethylene, MaArf expression in banana fruit significantly increased in accordance with ethylene biosynthesis; the peak of MaArf was 3 d after harvest, 11 d earlier than for naturally ripened banana fruits. These results suggest that MaArf is induced by ethylene in regulating postharvest banana ripening. Finally, subcellular localization assays showed the MaArf protein in the cytoplasm. Copyright 2010 Elsevier GmbH. All rights reserved.

[Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

Science.gov (United States)

Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

2014-06-01

To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

Silencing the expression of connexin 43 decreases inflammation and joint destruction in experimental arthritis.

Science.gov (United States)

Tsuchida, Shinji; Arai, Yuji; Kishida, Tsunao; Takahashi, Kenji A; Honjo, Kuniaki; Terauchi, Ryu; Inoue, Hiroaki; Oda, Ryo; Mazda, Osam; Kubo, Toshikazu

2013-04-01

The objective of the present study was to determine whether the expression of connexin 43 (Cx43) effected on inflammatory conditions in rat fibroblast-like synoviocytes (FLS) and on rat model of rheumatoid arthritis (RA). The expression of Cx43 in rat FLS stimulated with lipopolysaccharide (LPS) was confirmed by real-time reverse transcriptase polymerase chain reaction (RT-PCR). The effects of small-interfering RNA targeting Cx43 (siCx43) on pro-inflammatory cytokines and chemokine were assessed by real-time RT-PCR and enzyme-linked immunosorbent assay (ELISA). The therapeutic and side effects of siCx43 in a rat model of collagen-induced arthritis (CIA) were examined by in vivo electroporation method. LPS markedly enhanced Cx43 gene expression in rat FLS, with transfection of siCx43 suppressing the over-expression of pro-inflammatory cytokines and the chemokine. Treatment of CIA rats with siCx43 significantly ameliorated paw swelling, and significantly reduced histological arthritis scores and radiographic scores. In histological appearance of rat ankle joints, siCx43 treatment significantly decreased the number of tartrate-resistant acid phosphatase (TRAP)-positive (osteoclast-like) cells. These findings indicated that siCx43 had anti-inflammatory effects in rat FLS and efficiently inhibited the development of CIA. Cx43 may play an important role in the pathophysiology of RA, and may be a potential target molecule for novel RA therapies. Copyright © 2012 Orthopaedic Research Society.

The differentiation status of primary gonadal germ cell tumors correlates inversely with telomerase activity and the expression level of the gene encoding the catalytic subunit of telomerase

International Nuclear Information System (INIS)

Schrader, Mark; Burger, Angelika M; Müller, Markus; Krause, Hans; Straub, Bernd; Schostak, Martin; Schulze, Wolfgang; Lauke, Heidrun; Miller, Kurt

2002-01-01

The activity of the ribonucleoprotein enzyme telomerase is detectable in germ, stem and tumor cells. One major component of telomerase is human telomerase reverse transcriptase (hTERT), which encodes the catalytic subunit of telomerase. Here we investigate the correlation of telomerase activity and hTERT gene expression and the differentiation status of primary testicular germ cell tumors (TGCT). Telomerase activity (TA) was detected by a quantitative telomerase PCR ELISA, and hTERT mRNA expression was quantified by online RT-PCR in 42 primary testicular germ cell tumors. The control group consisted of benign testicular biopsies from infertile patients. High levels of telomerase activity and hTERT expression were detected in all examined undifferentiated TGCTs and in the benign testicular tissue specimens with germ cell content. In contrast, differentiated teratomas and testicular control tissue without germ cells (Sertoli-cell-only syndrome) showed no telomerase activity and only minimal hTERT expression. These findings demonstrate an inverse relationship between the level of telomerase activity and hTERT mRNA expression and the differentiation state of germ cell tumors. Quantification of telomerase activity and hTERT mRNA expression enables a new molecular-diagnostic subclassification of germ cell tumors that describes their proliferation potential and differentiation status

The differentiation status of primary gonadal germ cell tumors correlates inversely with telomerase activity and the expression level of the gene encoding the catalytic subunit of telomerase

Directory of Open Access Journals (Sweden)

Schulze Wolfgang

2002-11-01

Full Text Available Abstract Background The activity of the ribonucleoprotein enzyme telomerase is detectable in germ, stem and tumor cells. One major component of telomerase is human telomerase reverse transcriptase (hTERT, which encodes the catalytic subunit of telomerase. Here we investigate the correlation of telomerase activity and hTERT gene expression and the differentiation status of primary testicular germ cell tumors (TGCT. Methods Telomerase activity (TA was detected by a quantitative telomerase PCR ELISA, and hTERT mRNA expression was quantified by online RT-PCR in 42 primary testicular germ cell tumors. The control group consisted of benign testicular biopsies from infertile patients. Results High levels of telomerase activity and hTERT expression were detected in all examined undifferentiated TGCTs and in the benign testicular tissue specimens with germ cell content. In contrast, differentiated teratomas and testicular control tissue without germ cells (Sertoli-cell-only syndrome showed no telomerase activity and only minimal hTERT expression. Conclusions These findings demonstrate an inverse relationship between the level of telomerase activity and hTERT mRNA expression and the differentiation state of germ cell tumors. Quantification of telomerase activity and hTERT mRNA expression enables a new molecular-diagnostic subclassification of germ cell tumors that describes their proliferation potential and differentiation status.

Gene expression analysis in lymphoblasts derived from patients with autism spectrum disorder

Directory of Open Access Journals (Sweden)

Yasuda Yuka

2011-05-01

Full Text Available Abstract Background The autism spectrum disorders (ASDs are complex neurodevelopmental disorders that result in severe and pervasive impairment in the development of reciprocal social interaction and verbal and nonverbal communication skills. In addition, individuals with ASD have stereotypical behavior, interests and activities. Rare mutations of some genes, such as neuroligin (NLGN 3/4, neurexin (NRXN 1, SHANK3, MeCP2 and NHE9, have been reported to be associated with ASD. In the present study, we investigated whether alterations in mRNA expression levels of these genes could be found in lymphoblastoid cell lines derived from patients with ASD. Methods We measured mRNA expression levels of NLGN3/4, NRXN1, SHANK3, MeCP2, NHE9 and AKT1 in lymphoblastoid cells from 35 patients with ASD and 35 healthy controls, as well as from 45 patients with schizophrenia and 45 healthy controls, using real-time quantitative reverse transcriptase polymerase chain reaction assays. Results The mRNA expression levels of NLGN3 and SHANK3 normalized by β-actin or TBP were significantly decreased in the individuals with ASD compared to controls, whereas no difference was found in the mRNA expression level of MeCP2, NHE9 or AKT1. However, normalized NLGN3 and SHANK3 gene expression levels were not altered in patients with schizophrenia, and expression levels of NLGN4 and NRXN1 mRNA were not quantitatively measurable in lymphoblastoid cells. Conclusions Our results provide evidence that the NLGN3 and SHANK3 genes may be differentially expressed in lymphoblastoid cell lines from individuals with ASD compared to those from controls. These findings suggest the possibility that decreased mRNA expression levels of these genes might be involved in the pathophysiology of ASD in a substantial population of ASD patients.

Suppression of cancer growth in mice by adeno-associated virus vector-mediated IFN-beta expression driven by hTERT promoter.

Science.gov (United States)

He, Ling Feng; Wang, Yi Gang; Xiao, Tian; Zhang, Kang Jiang; Li, Gong Chu; Gu, Jin Fa; Chu, Liang; Tang, Wen Hao; Tan, Wen-Song; Liu, Xin Yuan

2009-12-28

Adeno-associated virus (AAV) has rapidly become a promising gene delivery vehicle for its excellent advantages of non-immunogenic, low pathogenicity and long-term gene expression in vivo. However, a major obstacle in development of effective AAV vector is the lack of tissue specificity, which caused low efficiency of AAV transfer to target cells. The application of human telomerase reverse transcriptase (hTERT) promoter is a prior targeting strategy for AAV in cancer gene therapy as hTERT activity is transcriptionally upregulated in most cancer cells. In the present work, we investigated whether AAV-mediated human interferon beta (IFN-beta) gene driven by hTERT promoter could specifically express in tumor cells and suppress tumor cell growth. Our data demonstrated that hTERT promoter-driven IFN-beta expression was the tumor-specific, decreased the cell viability of tumor cells but not normal cells, and induced tumor cell apoptosis via activation of caspase pathway and release of cytochrome c. AAV-mediated IFN-beta expression driven by hTERT promoter significantly suppressed the growth of colorectal cancer and lung cancer xenograft in mice and resulted in tumor cells death in vivo. These data suggested that AAVs in combination with hTERT-mediated IFN-beta expression could exert potential antitumor activity and provide a novel targeting approach to clinical gene therapy of varieties of cancers.

Class 1-Selective Histone Deacetylase (HDAC) Inhibitors Enhance HIV Latency Reversal while Preserving the Activity of HDAC Isoforms Necessary for Maximal HIV Gene Expression.

Science.gov (United States)

Zaikos, Thomas D; Painter, Mark M; Sebastian Kettinger, Nadia T; Terry, Valeri H; Collins, Kathleen L

2018-03-15

Combinations of drugs that affect distinct mechanisms of HIV latency aim to induce robust latency reversal leading to cytopathicity and elimination of the persistent HIV reservoir. Thus far, attempts have focused on combinations of protein kinase C (PKC) agonists and pan-histone deacetylase inhibitors (HDIs) despite the knowledge that HIV gene expression is regulated by class 1 histone deacetylases. We hypothesized that class 1-selective HDIs would promote more robust HIV latency reversal in combination with a PKC agonist than pan-HDIs because they preserve the activity of proviral factors regulated by non-class 1 histone deacetylases. Here, we show that class 1-selective agents used alone or with the PKC agonist bryostatin-1 induced more HIV protein expression per infected cell. In addition, the combination of entinostat and bryostatin-1 induced viral outgrowth, whereas bryostatin-1 combinations with pan-HDIs did not. When class 1-selective HDIs were used in combination with pan-HDIs, the amount of viral protein expression and virus outgrowth resembled that of pan-HDIs alone, suggesting that pan-HDIs inhibit robust gene expression induced by class 1-selective HDIs. Consistent with this, pan-HDI-containing combinations reduced the activity of NF-κB and Hsp90, two cellular factors necessary for potent HIV protein expression, but did not significantly reduce overall cell viability. An assessment of viral clearance from in vitro cultures indicated that maximal protein expression induced by class 1-selective HDI treatment was crucial for reservoir clearance. These findings elucidate the limitations of current approaches and provide a path toward more effective strategies to eliminate the HIV reservoir. IMPORTANCE Despite effective antiretroviral therapy, HIV evades eradication in a latent form that is not affected by currently available drug regimens. Pharmacologic latency reversal that leads to death of cellular reservoirs has been proposed as a strategy for

Analysis of gene expression during odontogenic differentiation of cultured human dental pulp cells

Directory of Open Access Journals (Sweden)

Min-Seock Seo

2012-08-01

Full Text Available Objectives We analyzed gene-expression profiles after 14 day odontogenic induction of human dental pulp cells (DPCs using a DNA microarray and sought candidate genes possibly associated with mineralization. Materials and Methods Induced human dental pulp cells were obtained by culturing DPCs in odontogenic induction medium (OM for 14 day. Cells exposed to normal culture medium were used as controls. Total RNA was extracted from cells and analyzed by microarray analysis and the key results were confirmed selectively by reverse-transcriptase polymerase chain reaction (RT-PCR. We also performed a gene set enrichment analysis (GSEA of the microarray data. Results Six hundred and five genes among the 47,320 probes on the BeadChip differed by a factor of more than two-fold in the induced cells. Of these, 217 genes were upregulated, and 388 were down-regulated. GSEA revealed that in the induced cells, genes implicated in Apoptosis and Signaling by wingless MMTV integration (Wnt were significantly upregulated. Conclusions Genes implicated in Apoptosis and Signaling by Wnt are highly connected to the differentiation of dental pulp cells into odontoblast.

Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.

Science.gov (United States)

Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H

2007-07-01

Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.

Optimization of laser capture microdissection and RNA amplification for gene expression profiling of prostate cancer

Directory of Open Access Journals (Sweden)

Vasmatzis George

2007-03-01

Full Text Available Abstract Background To discover prostate cancer biomarkers, we profiled gene expression in benign and malignant cells laser capture microdissected (LCM from prostate tissues and metastatic prostatic adenocarcinomas. Here we present methods developed, optimized, and validated to obtain high quality gene expression data. Results RNase inhibitor was included in solutions used to stain frozen tissue sections for LCM, which improved RNA quality significantly. Quantitative PCR assays, requiring minimal amounts of LCM RNA, were developed to determine RNA quality and concentration. SuperScript II™ reverse transcriptase was replaced with SuperScript III™, and SpeedVac concentration was eliminated to optimize linear amplification. The GeneChip® IVT labeling kit was used rather than the Enzo BioArray™ HighYield™ RNA transcript labeling kit since side-by-side comparisons indicated high-end signal saturation with the latter. We obtained 72 μg of labeled complementary RNA on average after linear amplification of about 2 ng of total RNA. Conclusion Unsupervised clustering placed 5/5 normal and 2/2 benign prostatic hyperplasia cases in one group, 5/7 Gleason pattern 3 cases in another group, and the remaining 2/7 pattern 3 cases in a third group with 8/8 Gleason pattern 5 cases and 3/3 metastatic prostatic adenocarcinomas. Differential expression of alpha-methylacyl coenzyme A racemase (AMACR and hepsin was confirmed using quantitative PCR.

Glucose transporters are expressed in taste receptor cells.

Science.gov (United States)

Merigo, Flavia; Benati, Donatella; Cristofoletti, Mirko; Osculati, Francesco; Sbarbati, Andrea

2011-08-01

In the intestine, changes of sugar concentration generated in the lumen during digestion induce adaptive responses of glucose transporters in the epithelium. A close matching between the intestinal expression of glucose transporters and the composition and amount of the diet has been provided by several experiments. Functional evidence has demonstrated that the regulation of glucose transporters into enterocytes is induced by the sensing of sugar of the enteroendocrine cells through activation of sweet taste receptors (T1R2 and T1R3) and their associated elements of G-protein-linked signaling pathways (e.g. α-gustducin, phospholipase C β type 2 and transient receptor potential channel M5), which are signaling molecules also involved in the perception of sweet substances in the taste receptor cells (TRCs) of the tongue. Considering this phenotypical similarity between the intestinal cells and TRCs, we evaluated whether the TRCs themselves possess proteins of the glucose transport mechanism. Therefore, we investigated the expression of the typical intestinal glucose transporters (i.e. GLUT2, GLUT5 and SGLT1) in rat circumvallate papillae, using immunohistochemistry, double-labeling immunofluorescence, immunoelectron microscopy and reverse transcriptase-polymerase chain reaction analysis. The results showed that GLUT2, GLUT5 and SGLT1 are expressed in TRCs; their immunoreactivity was also observed in cells that displayed staining for α-gustducin and T1R3 receptor. The immunoelectron microscopic results confirmed that GLUT2, GLUT5 and SGLT1 were predominantly expressed in cells with ultrastructural characteristics of chemoreceptor cells. The presence of glucose transporters in TRCs adds a further link between chemosensory information and cellular responses to sweet stimuli that may have important roles in glucose homeostasis, contributing to a better understanding of the pathways implicated in glucose metabolism. © 2011 The Authors. Journal of Anatomy © 2011