Verhagen, C. E.; Wierenga, E. A.; Buffing, A. A.; Chand, M. A.; Faber, W. R.; Das, P. K.
1997-01-01
Borderline leprosy patients often undergo acute changes in immune reactivity that manifest as reversal reaction (RR) in the course of the disease. RR is associated with an exacerbated local delayed-type cellular immune response to Mycobacterium leprae and is responsible for severe tissue damage. We
Chemical reactions in reverse micelle systems
Matson, Dean W.; Fulton, John L.; Smith, Richard D.; Consani, Keith A.
1993-08-24
This invention is directed to conducting chemical reactions in reverse micelle or microemulsion systems comprising a substantially discontinuous phase including a polar fluid, typically an aqueous fluid, and a microemulsion promoter, typically a surfactant, for facilitating the formation of reverse micelles in the system. The system further includes a substantially continuous phase including a non-polar or low-polarity fluid material which is a gas under standard temperature and pressure and has a critical density, and which is generally a water-insoluble fluid in a near critical or supercritical state. Thus, the microemulsion system is maintained at a pressure and temperature such that the density of the non-polar or low-polarity fluid exceeds the critical density thereof. The method of carrying out chemical reactions generally comprises forming a first reverse micelle system including an aqueous fluid including reverse micelles in a water-insoluble fluid in the supercritical state. Then, a first reactant is introduced into the first reverse micelle system, and a chemical reaction is carried out with the first reactant to form a reaction product. In general, the first reactant can be incorporated into, and the product formed in, the reverse micelles. A second reactant can also be incorporated in the first reverse micelle system which is capable of reacting with the first reactant to form a product.
Mass transfer with complex reversible chemical reactions. II: Parallel reversible chemical reactions
Versteeg, Geert; van Beckum, F.P.H.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria
1990-01-01
An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and
Mass transfer with complex reversible chemical reactions. II: parallel reversible chemical reactions
Versteeg, G.F.; Kuipers, J.A.M.; Beckum, van F.P.H.; van Swaaij, W.P.M.
1990-01-01
An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and
Lovrić, Milivoj
2017-01-01
Three fast and reversible electrode reactions that are connected by two reversible chemical reactions that are permanently in the equilibrium are analysed theoretically for square wave voltammetry. The dependence of peak potentials on the dimensionless equilibrium constants of chemical reactions is calculated. The influence of the basic thermodynamic parameters on the square wave voltammetric responses is analysed.
Reversible aqueous zinc/manganese oxide energy storage from conversion reactions
Energy Technology Data Exchange (ETDEWEB)
Pan, Huilin; Shao, Yuyan; Yan, Pengfei; Cheng, Yingwen; Han, Kee Sung; Nie, Zimin; Wang, Chongmin; Yang, Jihui; Li, Xiaolin; Bhattacharya, Priyanka; Mueller, Karl T.; Liu, Jun
2016-04-18
Rechargeable aqueous batteries are attracting growing interest for energy storage due to their low cost and high safety. Fundamental understanding of highly reversible aqueous reactions is critical for building high-performance batteries. Herein, we studied the reversibility of Zn/MnO2 battery chemistry in mild aqueous MnSO4 electrolytes. α-MnO2 nanofibers were used as a high performance cathode. Our study provides good evidence for a conversion reaction mechanism through reversible formation of short nanorods and nanoparticle aggregates. This reversible conversion reaction provides an operating voltage of 1.44 V, high capacity of 285 mAh g-1, excellent rate and capacity retention of 92% after 5000 cycles. Zn metal anode also shows high reversibility in the mild aqueous MnSO4 electrolytes. The highly reversible and stable chemistries in aqueous Zn/MnO2 batteries open new opportunity for energy storage technologies with potentially high energy density, high safety, and low cost.
Properties of the reverse transcription reaction in mRNA quantification
DEFF Research Database (Denmark)
Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie
2004-01-01
BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...
Chemical boundary layers in CVD II. Reversible reactions
Croon, de M.H.J.M.; Giling, L.J.
1990-01-01
In addition to irreversible reactions, which were treated in part I, reversible reactions in the gas phase have beenstudied using the concept of the chemical boundary layer. The analysis is given for the situations in which either the forwardor the back reaction is dominant. Two conceptual models
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Exploratory urinary metabolomics of type 1 leprosy reactions.
Mayboroda, Oleg A; van Hooij, Anouk; Derks, Rico; van den Eeden, Susan J F; Dijkman, Karin; Khadge, Saraswoti; Thapa, Pratibha; Kunwar, Chhatra B; Hagge, Deanna A; Geluk, Annemieke
2016-04-01
Leprosy is an infectious disease caused by Mycobacterium leprae that affects the skin and nerves. Although curable with multidrug therapy, leprosy is complicated by acute inflammatory episodes called reactions, which are the major causes of irreversible neuropathy in leprosy that occur before, during, and even after treatment. Early diagnosis and prompt treatment of reactions reduces the risk of permanent disability. This exploratory study investigated whether urinary metabolic profiles could be identified that correlate with early signs of reversal reactions (RR). A prospective cohort of leprosy patients with and without reactions and endemic controls was recruited in Nepal. Urine-derived metabolic profiles were measured longitudinally. Thus, a conventional area of biomarker identification for leprosy was extended to non-invasive urine testing. It was found that the urinary metabolome could be used to discriminate endemic controls from untreated patients with mycobacterial disease. Moreover, metabolic signatures in the urine of patients developing RR were clearly different before RR onset compared to those at RR diagnosis. This study indicates that urinary metabolic profiles are promising host biomarkers for the detection of intra-individual changes during acute inflammation in leprosy and could contribute to early treatment and prevention of tissue damage. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Degradation of microcystin-RR using boron-doped diamond electrode
International Nuclear Information System (INIS)
Zhang Chunyong; Fu Degang; Gu Zhongze
2009-01-01
Microcystins (MCs), produced by blue-green algae, are one of the most common naturally occurring toxins found in natural environment. The presence of MCs in drinking water sources poses a great threat to people's health. In this study, the degradation behavior of microcystin-RR on boron-doped diamond (BDD) electrode was investigated under galvanostatic conditions. Such parameters as reaction time, supporting electrolyte and applied current density were varied in order to determine their effects on this oxidation process. The experimental results revealed the suitability of electrochemical processes employing BDD electrode for removing MC-RR from the solution. However, the efficient removal of MC-RR only occurred in the presence of sodium chloride that acted as redox mediators and the reaction was mainly affected by the chloride concentration (c NaCl ) and applied current density (I appl ). Full and quick removal of 0.50 μg/ml MC-RR in solution was achieved when the operating conditions of c NaCl and I appl were 20 mM and 46.3 mA/cm 2 , or 35 mM and 18.2 mA/cm 2 respectively. The kinetics for MC-RR degradation followed a pesudo-first order reaction in most cases, indicating the process was under mass transfer control. As a result of its excellent performance, the BDD technology could be considered as a promising alternative to promote the degradation of MC-RR than chlorination in drinking water supplies.
Directory of Open Access Journals (Sweden)
Fiaz S. Mohammed
2015-12-01
Full Text Available The reversible reaction of carbon dioxide (CO2 with primary amines to form alkyl-ammonium carbamates is demonstrated in this work to reduce amine reactivity against nucleophilic substitution reactions with benzophenone and phenyl isocyanate. The reversible formation of carbamates has been recently exploited for a number of unique applications including the formation of reversible ionic liquids and surfactants. For these applications, reduced reactivity of the carbamate is imperative, particularly for applications in reactions and separations. In this work, carbamate formation resulted in a 67% reduction in yield for urea synthesis and 55% reduction for imine synthesis. Furthermore, the amine reactivity can be recovered upon reversal of the carbamate reaction, demonstrating reversibility. The strong nucleophilic properties of amines often require protection/de-protection schemes during bi-functional coupling reactions. This typically requires three separate reaction steps to achieve a single transformation, which is the motivation behind Green Chemistry Principle #8: Reduce Derivatives. Based upon the reduced reactivity, there is potential to employ the reversible carbamate reaction as an alternative method for amine protection in the presence of competing reactions. For the context of this work, CO2 is envisioned as a green protecting agent to suppress formation of n-phenyl benzophenoneimine and various n-phenyl–n-alky ureas.
A copper-mediated reverse aromatic Finkelstein reaction in ionic liquid
Directory of Open Access Journals (Sweden)
Anh T.H. Nguyen
2018-03-01
Full Text Available We have developed a general method for reverse aromatic Finkelstein reactions. Good reaction yields were obtained when aryl iodides or aryl bromides were treated with copper halide salts as promoters in a 1-butyl-3-methylimidazolium bromide ([BMIM]Br ionic liquid (IL solvent at 140 °C for 8 h. Preliminary investigation supported that the copper salts were also the halide sources in halogen exchange reactions. The optimized conditions are applicable to a variety of substrates and have excellent functional group tolerance. Additionally, the [BMIM]Br solvent showed good stability for at least 10 consecutive runs. Results indicated that the [BMIM]Br solvent was recyclable for reverse aromatic Finkelstein reactions.
Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions
Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van
1990-01-01
An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and
Mass transfer with complex reversible chemical reactions—I. Single reversible chemical reaction
Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van
1989-01-01
An improved numerical technique was used in order to develop an absorption model with which it is possible to calculate rapidly absorption rates for the phenomenon of mass transfer accompanied by a complex reversible chemical reaction. This model can be applied for the calculation of the mass
The Forward-Reverse Algorithm for Stochastic Reaction Networks
Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro
2015-01-01
In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem
Analysis of Brownian Dynamics Simulations of Reversible Bimolecular Reactions
Lipková, Jana
2011-01-01
A class of Brownian dynamics algorithms for stochastic reaction-diffusion models which include reversible bimolecular reactions is presented and analyzed. The method is a generalization of the λ-bcȳ model for irreversible bimolecular reactions which was introduced in [R. Erban and S. J. Chapman, Phys. Biol., 6(2009), 046001]. The formulae relating the experimentally measurable quantities (reaction rate constants and diffusion constants) with the algorithm parameters are derived. The probability of geminate recombination is also investigated. © 2011 Society for Industrial and Applied Mathematics.
Procedures for Decomposing a Redox Reaction into Half-Reaction
Fishtik, Ilie; Berka, Ladislav H.
2005-01-01
A simple algorithm for a complete enumeration of the possible ways a redox reaction (RR) might be uniquely decomposed into half-reactions (HRs) using the response reactions (RERs) formalism is presented. A complete enumeration of the possible ways a RR may be decomposed into HRs is equivalent to a complete enumeration of stoichiometrically…
Characterization of reversible reactions of isocyanides with molybdenum dithiolate complexes
International Nuclear Information System (INIS)
Miller, D.J.; DuBois, M.R.
1980-01-01
Dimeric molybdenum complexes with bridging dithiocarbonimidate ligands of the formula [C 5 H 5 MoS 2 CNR] 2 (where R = CH 3 , CH 2 C 6 H 5 , C 6 H 11 , and n-C 4 H 9 ) have been synthesized and characterized. The syntheses involve the room-temperature reactions of excess isocyanides with solutions of the dimeric complex [C 5 H 5 MoSC 3 H 6 S] 2 . During the course of these reactions, propene is displaced from the sulfur atoms of the bridging dithiolate ligands. Addition of excess alkene reverses the above reactions. Equilibrium constants have been calculated for the following reactions by integration of NMR resonances: [CH 3 C 5 H 4 MoSC 2 H 4 S] 2 + RNC reversible (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + C == C, K 1 = 2.9 +- 0.2; (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + RNC reversible [CH 3 C 5 H 4 MoS 2 CNR] 2 + C == C, K 2 = 0.7 +- 0.1 (R = CH 2 C 6 H 5 ). The dithiocarbonimidate complexes react cleanly with the electrophiles CH 3 OSO 2 F and HOSO 2 CF 3 to form [C 5 H 5 MoS 2 CNRR'] 2 2+ where R' = H or CH 3 . These products have been characterized by spectral and conductivity methods. The reactions of the dithiocarbonimidate complexes with reducing agents and with carbon monoxide are discussed. 1 figure, 2 tables
Wheeldon, R.; Atkinson, R.; Dawes, A.; Levinson, R.
2012-07-01
Background and purpose : Chemistry examinations can favour the deployment of algorithmic procedures like Le Chatelier's Principle (LCP) rather than reasoning using chemical principles. This study investigated the explanatory resources which high school students use to answer equilibrium problems and whether the marks given for examination answers require students to use approaches beyond direct application of LCP. Sample : The questionnaire was administered to 162 students studying their first year of advanced chemistry (age 16/17) in three high achieving London high schools. Design and methods : The students' explanations of reversible chemical systems were inductively coded to identify the explanatory approaches used and interviews with 13 students were used to check for consistency. AS level examination questions on reversible reactions were analysed to identify the types of explanations sought and the students' performance in these examinations was compared to questionnaire answers. Results : 19% of students used a holistic explanatory approach: when the rates of forward and reverse reactions are correctly described, recognising their simultaneous and mutually dependent nature. 36% used a mirrored reactions approach when the connected nature of the forward and reverse reactions is identified, but not their mutual dependency. 42% failed to recognize the interdependence of forward and reverse reactions (reactions not connected approach). Only 4% of marks for AS examination questions on reversible chemical systems asked for responses which went beyond either direct application of LCP or recall of equilibrium knowledge. 37% of students attained an A grade in their AS national examinations. Conclusions : Examinations favour the application of LCP making it possible to obtain the highest grade with little understanding of reversible chemical systems beyond a direct application of this algorithm. Therefore students' understanding may be attenuated so that they are
REACTIONAL STATES IN MULTIBACILLARY HANSEN DISEASE PATIENTS DURING MULTIDRUG THERAPY
Directory of Open Access Journals (Sweden)
José A.C. NERY
1998-11-01
Full Text Available It is well known that reactions are commonplace occurrences during the course of leprosy disease. Stigmatization may even be attributable to reactions which are also responsible for the worsening of neural lesions. A cohort of 162 newly-diagnosed baciloscopically positive patients from the Leprosy Care Outpatient Clinic of the Oswaldo Cruz Foundation (FIOCRUZ was selected for this study. While 46% of the multibacillary (MB patients submitted to the 24 fixed-dose multidrug therapy (MDT regimen suffered reactions during treatment, it was found that all MBs were susceptible and that constant attention and care were required at all times. Fourteen per cent were classified as BB, 52% as BL, and 33% as LL. None of the variables under study, such as, sex, age, clinical form, length of illness, length of dermatological lesions, baciloscopic index (BI, or degree of disability proved to be associate with reaction among the patients studied. Reversal Reaction (RR occurred in 45%, and Erythema Nodosum Leprosum (ENL occurred in 55%. Among BB patients who developed reactions (15 patients, 93% presented RR; while among the LL patients who developed reactions (34 patients, 91% presented ENL. Likewise, ENL was very frequent among those with disseminate lesions, while RR was most often observed in patients with segmentary lesions. RR was also most likely to occur during the initial months of treatment. It was demonstrated that the recurrence rate of ENL was significantly higher than that of RR. Neither grade of disability nor BI was shown to be associated with RR and ENL reaction. However, the RR rate was significantly higher among patients showing BI 3.Reações são ocorrências comuns no curso da hanseníase e são responsáveis pelo agravamento das lesões neurais. Uma coorte de 162 pacientes recém-diagnosticados, baciloscopicamente positivos, em acompanhamento no Ambulatório de Hanseníase da Fundação Oswaldo Cruz (FIOCRUZ foi selecionada para estudo
Time-reversal asymmetry: polarization and analyzing power in nuclear reactions
International Nuclear Information System (INIS)
Rioux, C.; Roy, R.; Slobodrian, R.J.; Conzett, H.E.
1984-01-01
Measurements of the proton polarization in the reactions 7 Li( 3 He, p vector) 9 Be and 9 Be( 3 He, p vector) 11 B and of the analyzing powers in the inverse reactions, initiated by polarized protons at the same center-of-mass energies, show significant differences. This implies the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction 2 H( 3 He, p vector) 4 He and its inverse have also been investigated and show smaller differences. A discussion of instrumental asymmetries is presented
Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions
Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van
1990-01-01
An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and concentration profiles for a wide range of processes and conditions, for both film and penetration model. With the aid of this mass transfer model it is demonstrated that the absorption rates in syst...
Single-molecule stochastic times in a reversible bimolecular reaction
Keller, Peter; Valleriani, Angelo
2012-08-01
In this work, we consider the reversible reaction between reactants of species A and B to form the product C. We consider this reaction as a prototype of many pseudobiomolecular reactions in biology, such as for instance molecular motors. We derive the exact probability density for the stochastic waiting time that a molecule of species A needs until the reaction with a molecule of species B takes place. We perform this computation taking fully into account the stochastic fluctuations in the number of molecules of species B. We show that at low numbers of participating molecules, the exact probability density differs from the exponential density derived by assuming the law of mass action. Finally, we discuss the condition of detailed balance in the exact stochastic and in the approximate treatment.
Lipke, Mark C; Neumeyer, Felix; Tilley, T Don
2014-04-23
Solid samples of η(3)-silane complexes [PhBP(Ph)3]RuH(η(3)-H2SiRR') (R,R' = Et2, 1a; PhMe, 1b; Ph2, 1c, MeMes, 1d) decompose when exposed to dynamic vacuum. Gas-phase H2/D2 exchange between isolated, solid samples of 1c-d3 and 1c indicate that a reversible elimination of H2 is the first step in the irreversible decomposition. An efficient solution-phase trap for hydrogen, the 16-electron ruthenium benzyl complex [PhBP(Ph)3]Ru[η(3)-CH2(3,5-Me2C6H3)] (3) reacts quantitatively with H2 in benzene via elimination of mesitylene to form the η(5)-cyclohexadienyl complex [PhBP(Ph)3]Ru(η(5)-C6H7) (4). This H2 trapping reaction was utilized to drive forward and quantify the elimination of H2 from 1b,d in solution, which resulted in the decomposition of 1b,d to form 4 and several organosilicon products that could not be identified. Reaction of {[PhBP(Ph)3]Ru(μ-Cl)}2 (2) with (THF)2Li(SiHMes2) forms a new η(3)-H2Si species [PhBP(Ph)3]Ru[CH2(2-(η(3)-H2SiMes)-3,5-Me2C6H2)] (5) which reacts with H2 to form the η(3)-H2SiMes2 complex [PhBP(Ph)3]RuH(η(3)-H2SiMes2) (1e). Complex 1e was identified by NMR spectroscopy prior to its decomposition by elimination of Mes2SiH2 to form 4. DFT calculations indicate that an isomer of 5, the 16-electron silylene complex [PhBP(Ph)3]Ru(μ-H)(═SiMes2), is only 2 kcal/mol higher in energy than 5. Treatment of 5 with XylNC (Xyl = 2,6-dimethylphenyl) resulted in trapping of [PhBP(Ph)3]Ru(μ-H)(═SiMes2) to form the 18-electron silylene complex [PhBP(Ph)3]Ru(CNXyl)(μ-H)(═SiMes2) (6). A closely related germylene complex [PhBP(Ph)3]Ru[CN(2,6-diphenyl-4-MeC6H2)](H)(═GeH(t)Bu) (8) was prepared from reaction of (t)BuGeH3 with the benzyl complex [PhBP(Ph)3]Ru[CN(2,6-diphenyl-4-MeC6H2)][η(1)-CH2(3,5-Me2C6H3)] (7). Single crystal XRD analysis indicated that unlike for 6, the hydride ligand in 8 is a terminal hydride that does not engage in 3c-2e Ru-H → Ge bonding. Complex 1b is an effective precatalyst for the catalytic Ge-H dehydrocoupling
Effect of Sex on Reverse Remodeling in Chronic Systolic Heart Failure.
Aimo, Alberto; Vergaro, Giuseppe; Castiglione, Vincenzo; Barison, Andrea; Pasanisi, Emilio; Petersen, Christina; Chubuchny, Vladyslav; Giannoni, Alberto; Poletti, Roberta; Maffei, Silvia; Januzzi, James L; Passino, Claudio; Emdin, Michele
2017-10-01
This study sought to investigate sex-related differences in reverse remodeling (RR). RR, that is, the recovery from left ventricular (LV) dilation and dysfunction in response to treatment for heart failure (HF), is associated with improved prognosis. Data from patients with stable systolic HF (LV ejection fraction [LVEF] of sex. Women showed a higher incidence of RR (41% vs. 27%, respectively; p 35%, according to current indication for device implantation, and LVEF definition of HF with reduced or mid-range EF). In the whole population, female sex was an independent predictor of RR (hazard ratio: 1.54; 95% confidence interval: 1.11 to 2.14; p = 0.011), together with cause of HF, disease duration, and left bundle branch block. Female sex was again an independent predictor of RR in all LVEF categories. Reverse remodeling is more frequent among women, regardless of cause and severity of LV dysfunction. Female sex is an independent predictor of RR in all categories of LV systolic dysfunction. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
The Forward-Reverse Algorithm for Stochastic Reaction Networks
Bayer, Christian
2015-01-07
In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which we solve a set of deterministic optimization problems where the SRNs are replaced by the classical ODE rates; then, during the second phase, the Monte Carlo version of the EM algorithm is applied starting from the output of the previous phase. Starting from a set of over-dispersed seeds, the output of our two-phase method is a cluster of maximum likelihood estimates obtained by using convergence assessment techniques from the theory of Markov chain Monte Carlo.
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Fratto, Brian E; Katz, Evgeny
2015-05-18
Reversible logic gates, such as the double Feynman gate, Toffoli gate and Peres gate, with 3-input/3-output channels are realized using reactions biocatalyzed with enzymes and performed in flow systems. The flow devices are constructed using a modular approach, where each flow cell is modified with one enzyme that biocatalyzes one chemical reaction. The multi-step processes mimicking the reversible logic gates are organized by combining the biocatalytic cells in different networks. This work emphasizes logical but not physical reversibility of the constructed systems. Their advantages and disadvantages are discussed and potential use in biosensing systems, rather than in computing devices, is suggested. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks
Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro
2016-01-01
In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem
Enzymatic reactions in reversed micelles
Hilhorst, M.H.
1984-01-01
It has been recognised that enzymes in reversed micelles have potential for application in chemical synthesis. Before these expectations will be realised many problems must be overcome. This thesis deals with some of them.
In Chapter 1 the present knowledge about reversed micelles and
National Research Council Canada - National Science Library
McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L
2005-01-01
...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...
Vas Bhat, R.D.; Kuipers, J.A.M.; Versteeg, G.F.
2000-01-01
An absorption model to study gas–liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although
The role of reversed kinematics and double kinematic solutions in nuclear reactions studies
International Nuclear Information System (INIS)
Kaplan, M.; Parker, W.E.; Moses, D.J.; Lacey, R.; Alexander, J.M.
1993-01-01
The advantages of reversed kinematics in nuclear reactions studies are discussed, with particular emphasis on the origin of double solutions in the reaction kinematics. This possibility for double solutions does not exist in normal kinematics, and provides the basis for a new method of imposing important experimental constraints on the uniqueness of fitting complex observations. By gating on one or the other of the two solutions, light particle kinematics can be greatly influenced in coincidence measurements. The power of the method is illustrated with data for the reaction 1030 MeV 121 Sb+ 27 Al, where charged particle emissions arise from several different sources. (orig.)
Vas bhat, R.D.; Kuipers, J.A.M.; Versteeg, Geert
2000-01-01
An absorption model to study gas¿liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although
An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks
Bayer, Christian
2016-01-06
In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce an efficient two-phase algorithm in which the first phase is deterministic and it is intended to provide a starting point for the second phase which is the Monte Carlo EM Algorithm.
Asymmetric effect of mechanical stress on the forward and reverse reaction catalyzed by an enzyme.
Directory of Open Access Journals (Sweden)
Collin Joseph
Full Text Available The concept of modulating enzymatic activity by exerting a mechanical stress on the enzyme has been established in previous work. Mechanical perturbation is also a tool for probing conformational motion accompanying the enzymatic cycle. Here we report measurements of the forward and reverse kinetics of the enzyme Guanylate Kinase from yeast (Saccharomyces cerevisiae. The enzyme is held in a state of stress using the DNA spring method. The observation that mechanical stress has different effects on the forward and reverse reaction kinetics suggests that forward and reverse reactions follow different paths, on average, in the enzyme's conformational space. Comparing the kinetics of the stressed and unstressed enzyme we also show that the maximum speed of the enzyme is comparable to the predictions of the relaxation model of enzyme action, where we use the independently determined dissipation coefficient [Formula: see text] for the enzyme's conformational motion. The present experiments provide a mean to explore enzyme kinetics beyond the static energy landscape picture of transition state theory.
On null tests of time-reversal invariance in scattering and reactions
International Nuclear Information System (INIS)
Conzett, H.E.
1993-01-01
There have been suggestions in the literature, both recently and in the more distant past, that, in the lowest-order Born approximation, time-reversal (T)-odd experimental observables in certain reactions are required by T-symmetry to vanish. These observables are the final-state spin-correlation coefficient C xy in the reaction e + e - → τ + τ - and the target analysing power A oy in the inclusive process ep → eX with a polarized proton target. These assertions are in direct conflict with a theorem that states that there can be no null-test of T-symmetry in such processes; that is, T-symmetry does not require any single observable to vanish. This talk addresses the resolution of that conflict
WINKELMAN, JGM; BEENACKERS, AACM
The problem of ps absorption accompanied by a first-order reversible reaction, producing a volatile reaction product, is considered. A general analytical solution is developed for the film model, resulting in explicit relations for the concentration profiles in the film and for the mass transfer
Reverse 201Tl myocardial redistribution induced by coronary artery spasm
International Nuclear Information System (INIS)
Xiang Dingcheng; Yin Jilin; Gong Zhihua; Xie Zhenhong; Zhang Jinhe; Wen Yanfei; Yi Shaodong
2010-01-01
Objective: To investigate the mechanism of reverse redistribution (RR) on dipyridamole 201 Tl myocardial perfusion studies in the patients with coronary artery spasm. Methods: Twenty-six patients with coronary artery spasm and presented as RR on dipyridamole 201 Tl myocardial perfusion studies were enlisted as RR group, while other 16 patients with no coronary artery stenosis nor RR were enlisted as control group. Dipyridamole test was repeated during coronary angiography. Corrected thrombolysis in myocardial infarction (TIMI) frame count (CTFC) and TIMI myocardial perfusion grade (TMPG) were measured at RR related and non-RR related coronary arteries before and after dipyridamole infusion respectively. All of the data were analyzed by Student's t-test or χ 2 -test and correlation analysis. Results: Coronary artery angiography showed slower blood flow and lower myocardial perfusion in RR related vessels when compared with non-RR related vessels in RR group, but there was no significant difference among the main coronary arteries in control group. The perfusion defects of RR area at rest were positively related to slower blood velocity at corresponding coronary arteries (r = 0.79, t =10.18, P 0.05). Conclusion: RR is related to the decreased blood flow and myocardial perfusion induced by coronary artery spasm at rest, which may be improved by stress test such as intravenous dipyridamole infusion. (authors)
Zhou, Yangen; Zhang, Shun; Ding, Yu; Zhang, Leyuan; Zhang, Changkun; Zhang, Xiaohong; Zhao, Yu; Yu, Guihua
2018-06-14
Simultaneous solar energy conversion and storage is receiving increasing interest for better utilization of the abundant yet intermittently available sunlight. Photoelectrodes driving nonspontaneous reversible redox reactions in solar-powered redox cells (SPRCs), which can deliver energy via the corresponding reverse reactions, present a cost-effective and promising approach for direct solar energy harvesting and storage. However, the lack of photoelectrodes having both high conversion efficiency and high durability becomes a bottleneck that hampers practical applications of SPRCs. Here, it is shown that a WO 3 -decorated BiVO 4 photoanode, without the need of extra electrocatalysts, can enable a single-photocatalyst-driven SPRC with a solar-to-output energy conversion efficiency as high as 1.25%. This SPRC presents stable performance over 20 solar energy storage/delivery cycles. The high efficiency and stability are attributed to the rapid redox reactions, the well-matched energy level, and the efficient light harvesting and charge separation of the prepared BiVO 4 . This demonstrated device system represents a potential alternative toward the development of low-cost, durable, and easy-to-implement solar energy technologies. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Vilanova, Pedro
2016-01-07
In this work, we present an extension of the forward-reverse representation introduced in Simulation of forward-reverse stochastic representations for conditional diffusions , a 2014 paper by Bayer and Schoenmakers to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the Expectation-Maximization algorithm to the phase I output. By selecting a set of over-dispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.
Reverse Redistribution in Myocardial Perfusion Imaging: Revisited with 64-slice MDCT
Energy Technology Data Exchange (ETDEWEB)
Lee, Min Kyung; Kim, Jeong Ho; Hwang, Kyung Hoon; Choi, In Suck; Choi, Soo Jin; Choe, Won Sick [Gachon University Gil Hospital, Incheon (Korea, Republic of); Yoon, Min Ki [Good Samaritan Hospital, Pohang (Korea, Republic of)
2010-06-15
The authors report myocardial perfusion imaging of a patient showing reverse redistribution (RR) and a 64-slice multidetector-row computed tomography (MDCT) with corresponding findings. The patient had subendocardial myocardial infarction (MI) with positive electrocardiogram (EMG) findings and elevated levels of cardiac isoenzymes. Experiencing this case emphasizes the importance of complementary correlation of a new diagnostic modality that helps us to understand the nature of RR.
International Nuclear Information System (INIS)
Dey, H.M.; Soufer, R.
1995-01-01
Reverse redistribution (RR) of thallium-201 has been associated with both acute and healed myocardial infarction, and with recent thrombolysis. The physiologic basis for RR in coronary artery disease (CAD) is unclear but may be related to an admixture of viable and scarred myocardium within the RR segment. We performed thallium reinjection imaging at rest to better characterize RR defects in patients with chronic CAD. We found enhanced uptake of 201 Tl in 52% of RR segments after reinjection, consistent with significant regional viability that was not evident on redistribution images. We then used a logistic multiple regression analysis to determine whether RR alone or in combination with other scintigraphic findings could predict patient outcome. The results showed that severe RR was an independent predictor of patient outcome. We conclude that RR may have prognostic significance in chronic CAD. (orig.)
Homayoon, Zahra; Jambrina, Pablo G.; Aoiz, F. Javier; Bowman, Joel M.
2012-07-01
In a previous paper [P. G. Jambrina et al., J. Chem. Phys. 135, 034310 (2011), 10.1063/1.3611400] various calculations of the rate coefficient for the Mu + H2 → MuH + H reaction were presented and compared to experiment. The widely used standard quasiclassical trajectory (QCT) method was shown to overestimate the rate coefficients by several orders of magnitude over the temperature range 200-1000 K. This was attributed to a major failure of that method to describe the correct threshold for the reaction owing to the large difference in zero-point energies (ZPE) of the reactant H2 and product MuH (˜0.32 eV). In this Communication we show that by performing standard QCT calculations for the reverse reaction and then applying detailed balance, the resulting rate coefficient is in very good agreement with the other computational results that respect the ZPE, (as well as with the experiment) but which are more demanding computationally.
Modified lignin: Preparation and use in reversible gel via Diels-Alder reaction.
Zhou, Wanpeng; Zhang, Hui; Chen, Fangeng
2018-02-01
In this study, popular soda lignin was modified with either furan or maleimide ring, and the modified lignins were subjected to reversible Diels-Alder reaction. A new process was proposed to prepare the functionalized lignin. A long chain was introduced to the hydroxyl groups of lignin, and then either the furan or maleimide ring was added to the other end of the chain. The test results confirmed that either the furan ring or the maleimide ring was bound to lignin. Furan- and maleimide-functionalized lignins were also combined to generate crosslinking via Diels-Alder [4+2] cycloaddition reaction. Under appropriate conditions, the formation of a gel was identified, which reverted to liquid state after retro Diels-Alder reaction upon heating at 120°C. This study reveals the significant versatility and potential of the developed strategy for the utilization of lignin-based recyclable networks. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Pagsberg, P.; Ratajczak, E.; Sillesen, A.
1994-01-01
The kinetics of the reversible reaction HONO+NH3 reversible H3N-HONO (1) was studied by monitoring trans-HONO relaxation kinetics. The rate of approach towards equilibrium was studied as a function of the ammonia concentration to obtain values of the rate constants for the forward and reverse rea...
On the graph and systems analysis of reversible chemical reaction networks with mass action kinetics
Rao, Shodhan; Jayawardhana, Bayu; Schaft, Arjan van der
2012-01-01
Motivated by the recent progresses on the interplay between the graph theory and systems theory, we revisit the analysis of reversible chemical reaction networks described by mass action kinetics by reformulating it using the graph knowledge of the underlying networks. Based on this formulation, we
International Nuclear Information System (INIS)
Sorci-Thomas, M.; Babiak, J.; Rudel, L.L.
1990-01-01
Lecithin-cholesterol acyltransferase (LCAT) catalyzes the intravascular synthesis of lipoprotein cholesteryl esters by converting cholesterol and lecithin to cholesteryl ester and lysolecithin. LCAT is unique in that it catalyzes sequential reactions within a single polypeptide sequence. In this report we find that LCAT mediates a partial reverse reaction, the transacylation of lipoprotein cholesteryl oleate, in whole plasma and in a purified, reconstituted system. As a result of the reverse transacylation reaction, a linear accumulation of [3H]cholesterol occurred during incubations of plasma containing high density lipoprotein labeled with [3H]cholesteryl oleate. When high density lipoprotein labeled with cholesteryl [14C]oleate was also included in the incubation the labeled fatty acyl moiety remained in the cholesteryl [14C]oleate pool showing that the formation of labeled cholesterol did not result from hydrolysis of the doubly labeled cholesteryl esters. The rate of release of [3H]cholesterol was only about 10% of the forward rate of esterification of cholesterol using partially purified human LCAT and was approximately 7% in whole monkey plasma. Therefore, net production of cholesterol via the reverse LCAT reaction would not occur. [3H]Cholesterol production from [3H]cholesteryl oleate was almost completely inhibited by a final concentration of 1.4 mM 5,5'-dithiobis(nitrobenzoic acid) during incubation with either purified LCAT or whole plasma. Addition of excess lysolecithin to the incubation system did not result in the formation of [14C]oleate-labeled lecithin, showing that the reverse reaction found here for LCAT was limited to the last step of the reaction. To explain these results we hypothesize that LCAT forms a [14C]oleate enzyme thioester intermediate after its attack on the cholesteryl oleate molecule
NONLINEAR ASTEROSEISMOLOGY OF RR LYRAE
Energy Technology Data Exchange (ETDEWEB)
Molnar, L.; Kollath, Z.; Szabo, R. [Konkoly Observatory, MTA CSFK, H-1121 Budapest, Konkoly Thege Miklos ut 15-17 (Hungary); Bryson, S.; Mullally, F.; Thompson, S. E. [NASA Ames Research Center, MS 244-30, Moffet Field, CA 94035 (United States); Kolenberg, K., E-mail: molnar.laszlo@csfk.mta.hu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge MA 02138 (United States)
2012-09-20
The observations of the Kepler Space Telescope revealed that fundamental-mode RR Lyrae stars may show various radial overtones. The presence of multiple radial modes may allow us to conduct nonlinear asteroseismology: comparison of mode amplitudes and frequency shifts between observations and models. Here we report the detection of three radial modes in the star RR Lyr, the eponym of the class, using the Kepler short cadence data: besides the fundamental mode, both the first and the ninth overtones can be derived from the data set. RR Lyrae shows period doubling, but switches occasionally to a state where a pattern of six pulsation cycles repeats instead of two. We found hydrodynamic models that show the same three modes and the period-six state, allowing for comparison with the observations.
Kuehn, Charles A.; Moskalik, Pawel; Drury, Jason A.
2017-10-01
Observations by Kepler/K2 have revolutionized the study of RR Lyrae stars by allowing the detection of new phenomna, such as low amplitude additional modes and period doubling, which had not previously been seen from the ground. During campaign 2, K2 observed the globular cluster M4, providiing the first opportunity to study a sizeable group of RR Lyrae stars that belong to a single population; the other RR Lyrae stars that have been observed from space are field stars in the galactic halo and thus belong to an assortment of populations. In this poster we present the results of our study of the RR Lyrae variables in M4 from K2 photometry. We have identified additional, low amplitude pulsation modes in both observed RRc stars. In 3 RRab stars we have found the Blazhko effect with periods of 16.6d, 22.4d, and 44.5d.
Directory of Open Access Journals (Sweden)
Kuehn Charles A
2017-01-01
Full Text Available Observations by Kepler/K2 have revolutionized the study of RR Lyrae stars by allowing the detection of new phenomna, such as low amplitude additional modes and period doubling, which had not previously been seen from the ground. During campaign 2, K2 observed the globular cluster M4, providiing the first opportunity to study a sizeable group of RR Lyrae stars that belong to a single population; the other RR Lyrae stars that have been observed from space are field stars in the galactic halo and thus belong to an assortment of populations. In this poster we present the results of our study of the RR Lyrae variables in M4 from K2 photometry. We have identified additional, low amplitude pulsation modes in both observed RRc stars. In 3 RRab stars we have found the Blazhko effect with periods of 16.6d, 22.4d, and 44.5d.
Nakaya, Masato; Kuwahara, Yuji; Aono, Masakazu; Nakayama, Tomonobu
2011-04-01
The nanoscale control of reversible chemical reactions, the polymerization and depolymerization between C60 molecules, has been investigated. Using a scanning tunneling microscope (STM), the polymerization and depolymerization can be controlled at designated positions in ultrathin films of C60 molecules. One of the two chemical reactions can be selectively induced by controlling the sample bias voltage (V(s)); the application of negative and positive values of V(s) results in polymerization and depolymerization, respectively. The selectivity between the two chemical reactions becomes extremely high when the thickness of the C60 film increases to more than three molecular layers. We conclude that STM-induced negative and positive electrostatic ionization are responsible for the control of the polymerization and depolymerization, respectively.
Introduction to time reversal theory
International Nuclear Information System (INIS)
Henley, E.M.
1987-01-01
Theory and reaction mechanisms relevant to time reversal invariance are reviewed. Consequences of time reversal invariance are presented under the headings of CP tests, electromagnetic moments, weak emissions or absorptions, and scattering reactions. 8 refs., 4 figs
Exploring M33 Through RR Lyrae Stars
Pritzl, Barton J.
2013-01-01
Recent surveys have detected RR Lyrae stars in M33, the Triangulum Galaxy. These variable stars are excellent tracers of ancient stellar populations. The RR Lyrae stars have been used to estimate metallicities at various locations within M33, as well as determining the distance to the galaxy. A summary of the M33 RR Lyrae stars is presented here as well as an analysis on what their properties imply for the unique M33 galaxy
Directory of Open Access Journals (Sweden)
Andressa Regina Vasques
2011-09-01
Full Text Available A adsorção é uma das técnicas empregadas com sucesso para remoção efetiva da cor presente em efluentes têxteis. Com o objetivo de avaliar os diferentes parâmetros adsortivos, bem como determinar a eficiência de um adsorvente alternativo desenvolvido a partir de lodo residual têxtil na remoção de corantes, foram determinadas curvas de cinética de adsorção e isotermas. Por meio dos dados cinéticos e de equilíbrio obtidos, verificou-se que a 25ºC a adsorção foi favorável para todos os corantes, sendo esta a melhor condição para os corantes RO16 e RR2 na ausência de sais. Para o corante RR141, a adição de NaCl aumentou a capacidade de adsorção do adsorvente no equilíbrio e a adição de Na2SO4 favoreceu a adsorção para o corante RO16, ao contrário do que se observou para os outros dois corantes. A quantidade máxima de corante adsorvida por unidade de massa de adsorvente (q max nas melhores condições adsortivas para os corantes RO16, RR2 e RR141 foi de 81,30, 53,48 e 78,74 mg.g-1, respectivamente.The adsorption is one of the techniques that have been successfully used for effective removal of the dyes present in textile effluents. With the objective to evaluate the different adsorptive parameters, as well as determining the efficiency of one alternative adsorbent in the removal of dyes, kinetics and equilibrium data of adsorption were determined. By the kinetic data and of equilibrium, it was verified that the adsorption was favorable for all the dyes in 25ºC, being the best condition for the dye RO16 and RR2 in the total absence of salt. For the dye RR141, the addition of NaCl increased the adsorption capacity of adsorbent in the equilibrium and the addition of Na2SO4 favored the adsorption for the dye RO16, in contrast to what was observed for the two other dyes. The maximum quantity of dye adsorbed per unit mass of adsorbent (q max in the best adsorptive conditions for the dyes RO16, RR2 and RR141 was of 81
Patschorke, J
1979-01-01
In further research on pseudophototropic behaviour in cellular membranes of halobacteria the reversibility of vinylmethylethermaleic anhydride-copolymeres with biological liquids is tested and the basic principles of different colour generating reactions are studied.
Ruan, Jiufeng; Yang, Zhengwen; Huang, Anjun; Zhang, Hailu; Qiu, Jianbei; Song, Zhiguo
2018-05-02
Reversible luminescence modulation of upconversion phosphors has the potential applications as photoswitches and optical memory and data storage devices. Previously, the photochromic reaction was extensively used for the realization of reversible luminescence modulation. It is very necessary to develop other approaches such as thermomchromic reaction to obtain the reversible upconversion luminescence modulation. In this work, the WO 3 :Yb 3+ ,Er 3+ phosphors with various colors were prepared at various temperatures, exhibiting tunable upconversion luminescence attributed to the formation of oxygen vacancies in the host. Upon heat treatment in the reducing atmosphere or air, the WO 3 :Yb 3+ ,Er 3+ phosphors show a reversible thermomchromic property. The reversible upconversion luminescence modulation of WO 3 :Yb 3+ ,Er 3+ phosphors was observed based on thermomchromic reaction. Additionally, the upconversion luminescence modulation is maintained after several cycles, indicating its excellent stability. The WO 3 :Yb 3+ ,Er 3+ phosphors with reversible upconversion luminescence and excellent reproducibility have potential applications as the photoswitches and optical memory and data storage devices.
Wang, Hui; Li, Guoliang; Li, Qian-Shu; Xie, Yaoming; Schaefer, Henry F
2016-03-03
The potential energy profile for the atomic iodine plus water dimer reaction I + (H2O)2 → HI + (H2O)OH has been explored using the "Gold Standard" CCSD(T) method with quadruple-ζ correlation-consistent basis sets. The corresponding information for the reverse reaction HI + (H2O)OH → I + (H2O)2 is also derived. Both zero-point vibrational energies (ZPVEs) and spin-orbit (SO) coupling are considered, and these notably alter the classical energetics. On the basis of the CCSD(T)/cc-pVQZ-PP results, including ZPVE and SO coupling, the forward reaction is found to be endothermic by 47.4 kcal/mol, implying a significant exothermicity for the reverse reaction. The entrance complex I···(H2O)2 is bound by 1.8 kcal/mol, and this dissociation energy is significantly affected by SO coupling. The reaction barrier lies 45.1 kcal/mol higher than the reactants. The exit complex HI···(H2O)OH is bound by 3.0 kcal/mol relative to the asymptotic limit. At every level of theory, the reverse reaction HI + (H2O)OH → I + (H2O)2 proceeds without a barrier. Compared with the analogous water monomer reaction I + H2O → HI + OH, the additional water molecule reduces the relative energies of the entrance stationary point, transition state, and exit complex by 3-5 kcal/mol. The I + (H2O)2 reaction is related to the valence isoelectronic bromine and chlorine reactions but is distinctly different from the F + (H2O)2 system.
Goldenholz, Daniel M; Strashny, Alex; Cook, Mark; Moss, Robert; Theodore, William H
2017-12-01
Clinical epilepsy drug trials have been measuring increasingly high placebo response rates, up to 40%. This study was designed to examine the relationship between the natural variability in epilepsy, and the placebo response seen in trials. We tested the hypothesis that 'reversing' trial direction, with the baseline period as the treatment observation phase, would reveal effects of natural variability. Clinical trial simulations were run with time running forward and in reverse. Data sources were: SeizureTracker.com (patient reported diaries), a randomized sham-controlled TMS trial, and chronically implanted intracranial EEG electrodes. Outcomes were 50%-responder rates (RR50) and median percentage change (MPC). The RR50 results showed evidence that temporal reversal does not prevent large responder rates across datasets. The MPC results negative in the TMS dataset, and positive in the other two. Typical RR50s of clinical trials can be reproduced using the natural variability of epilepsy as a substrate across multiple datasets. Therefore, the placebo response in epilepsy clinical trials may be attributable almost entirely to this variability, rather than the "placebo effect". Published by Elsevier Ltd.
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
International Nuclear Information System (INIS)
Park, Soon Ah; Kim, Dae Weung; Kim, Chang Guhn; Jeong, Jin Won; Kim, Nam Ho; Yun, Kyeong Ho
2009-01-01
This study was performed to investigate the clinical significance of reverse redistribution (RR) phenomenon detected on delayed Tc-99m tetrofosmin myocardial single photon emission computed tomography (SPECT) in patients with acute myocardial infarction after revascularization. A Tc-99m tetrofrosmin myocardial SPECT was performed in 67 consecutive patients after revascularization for acute myocardial infarction. Myocardial SPECT imaging was performed for early imaging at 40 min and for delayed imaging at 180 min after reinjection at myocardial stress. Regional myocardial uptakes were scored by 4-point scoring in the left ventricular wall divided into 17 segments. Reverse redistribution was defined as an increase of more than 2 point in the activity score on the delayed image. Follow-up myocardial SPECT and coronary angiography (CAG) were performed 9 months later. On myocardial SPECT performed following revascularization, RR was observed in 100 of all 319 segments (31%) and in 43 patients (64%). The abnormalities of perfusion and regional wall motion were more severe in the patients with RR compared to those without RR (p<0.05). On follow-up myocardial SPECT, the myocardial perfusion, regional wall motion, and myocardial thickness were significantly improved in the patients with RR (p<0.05) however, these changes were not significant in those without RR. There was no significant difference between the patients with RR and those without RR in the occurrence of restenosis on CAG. In patients with acute myocardial infarction, the regions showing the RR phenomenon on delayed Tc-99m tetrofosmin SPECT may reflect viable myocardium and indicate recovery of salvaged myocardium
Reversible alkyne insertion in the benzannulation reaction of Fischer carbene complexes with alkynes
Energy Technology Data Exchange (ETDEWEB)
Waters, M.L.; Bos, M.E.; Wulff, W.D. [Univ. of Chicago, IL (United States)
1995-12-31
The benzannulation reaction of Fischer carbene complexes with alkynes to give phenols is highly regioselective with terminal alkynes, and reasonably regioselective with internal alkynes. This has been attributed to steric factors in intermediates, where one form is favored due to close contact between the R substituent and a cis-CO ligand. Whether alkyne insertion is kinetically or thermodynamically controlled has not been determined. The authors now have evidence from regioselectivity studies that alkyne insertion into the metal-carbon bond is reversible. Implications of these results and further mechanistic considerations will be presented.
Xu, Xin-sheng; Shi, Lei; Liu, Yi; Ji, Xue-han; Cui, Zhi-feng
2011-04-01
Time-resolved electron spin resonance has been used to study quenching reactions between the antioxidant Vitamin C (VC) and the triplet excited states of 9,10-phenanthrenequinone (PAQ) in ethylene glycol-water (EG-H2O) homogeneous and inhomogeneous reversed micelle solutions. Reversed micelle solutions were used to be the models of physiological environment of biological cell and tissue. In PAQ/EG-H2O homogeneous solution, the excited triplet of PAQ (3PAQ*) abstracts hydrogen atom from solvent EG. In PAQ/VC/EG-H2O solution, 3PAQ* abstracts hydrogen atom not only from solvent EG but also from VC. The quenching rate constant of 3PAQ* by VC is close to the diffusion-controlled value of 1.41 × 108 L/(mol ·s). In hexadecyltrimethylammonium bromide (CTAB)/EG-H2O and aerosol OT (AOT)/EG-H2O reversed micelle solutions, 3PAQ* and VC react around the water-oil interface of the reversed micelle. Exit of 3PAQ* from the lipid phase slows down the quenching reaction. For Triton X-100 (TX-100)/EG-H2O reversed micelle solution, PAQ and VC coexist inside the hydrophilic polyethylene glycol core, and the quenching rate constant of 3PAQ* by VC is larger than those in AOT/EG-H2O and CTAB/EG-H2O reversed micelle solutions, even a little larger than that in EG-H2O homogeneous solution. The strong emissive chemically induced dynamic electron polarization of As.- resulted from the effective TM spin polarization transfer in hydrogen abstraction of 3PAQ* from VC.
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
S-factor measurement of the 13C(p,γ)14N reaction in reverse kinematics
International Nuclear Information System (INIS)
Genard, G; Terwagne, G; Descouvemont, P
2010-01-01
We measure the S-factor of the 13 C(p,γ) 14 N reaction in reverse kinematics for energies ranging from 561 down to 225 keV with a low background experimental setup. The results are compared with previous measurements and an R-matrix treatment is applied to the data in order to obtain the properties of the 511 keV resonance that dominates the cross section at low energies.
A meson-exchange isobar model for the {pi}{sup +}d {r_reversible} pp reaction
Energy Technology Data Exchange (ETDEWEB)
Canton, L.; Cattapan, G.; Dortmans, P.J.; Pisent, G. [Istituto Nazionale di Fisica Nucleare, Padua (Italy); Svenne, J.P. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Physics]|[Winnipeg Inst. for Theoretical Physics, Winnipeg, MB (Canada)
1994-10-10
A broad set of observables are calculated for the {pi}{sup +} d {r_reversible} pp reaction with a relatively simple meson-exchange isobar model. The comparison between the calculated results and experimental data (including spin observables), shows that the model gives an overall phenomenologically acceptable description of the reaction around the {Delta} resonance. The effects due to the inclusion of Galilei invariant (pseudovector) recoil term in the {pi}NN vertex, of relativistic corrections to the {rho}-exchange component of the {Delta}N transition potential, and of NN final state interaction in the {pi}{sup +}d {yields} p+p process are also discussed. It is estimated that the model is sufficiently simple to be extended to the case of pion absorption on other light nuclei, in particular {sup 3}He (or tritium). 32 refs., 13 figs.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Lager, Ida; Yilmaz, Jenny Lindberg; Zhou, Xue-Rong; Jasieniecka, Katarzyna; Kazachkov, Michael; Wang, Peng; Zou, Jitao; Weselake, Randall; Smith, Mark A.; Bayon, Shen; Dyer, John M.; Shockey, Jay M.; Heinz, Ernst; Green, Allan; Banas, Antoni; Stymne, Sten
2013-01-01
Acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT) enzymes have central roles in acyl editing of phosphatidylcholine (PC). Plant LPCAT genes were expressed in yeast and characterized biochemically in microsomal preparations of the cells. Specificities for different acyl-CoAs were similar for seven LPCATs from five different species, including species accumulating hydroxylated acyl groups in their seed oil, with a preference for C18-unsaturated acyl-CoA and low activity with palmitoyl-CoA and ricinoleoyl (12-hydroxyoctadec-9-enoyl)-CoA. We showed that Arabidopsis LPCAT1 and LPCAT2 enzymes catalyzed the acylation and de-acylation of both sn positions of PC, with a preference for the sn-2 position. When acyl specificities of the Arabidopsis LPCATs were measured in the reverse reaction, sn-2-bound oleoyl, linoleoyl, and linolenoyl groups from PC were transferred to acyl-CoA to a similar extent. However, a ricinoleoyl group at the sn-2-position of PC was removed 4–6-fold faster than an oleoyl group in the reverse reaction, despite poor utilization in the forward reaction. The data presented, taken together with earlier published reports on in vivo lipid metabolism, support the hypothesis that plant LPCAT enzymes play an important role in regulating the acyl-CoA composition in plant cells by transferring polyunsaturated and hydroxy fatty acids produced on PC directly to the acyl-CoA pool for further metabolism or catabolism. PMID:24189065
Controlling Solid–Liquid Conversion Reactions for a Highly Reversible Aqueous Zinc–Iodine Battery
Energy Technology Data Exchange (ETDEWEB)
Pan, Huilin; Li, Bin; Mei, Donghai; Nie, Zimin; Shao, Yuyan; Li, Guosheng; Li, Xiaohong S.; Han, Kee Sung; Muller, Karl T.; Sprenkle, Vincent L.; Liu, Jun
2017-10-30
Aqueous rechargeable batteries are desirable for many energy storage applications due to their low cost and high safety. However, low capacity and short cycle life are the significant obstacles to their practical applications. Here, we demonstrate a highly reversible aqueous zinc-iodine battery using encapsulated iodine in microporous active carbon fibers (ACFs) as cathode materials through the rational control of solid-liquid conversion reactions. The experiments and density function theory (DFT) calculations were employed to investigate the effects of solvents and properties of carbon hosts, e.g. pore size, surface chemistries, on the adsorption of iodine species. The rational manipulation of the competition between the adsorption in carbon and solvation in electrolytes for iodine species is responsible for the high reversibility and cycling stability. The zinc-iodine batteries deliver a high capacity of 180 mAh g-1 at 1C and a stable cycle life over 3000 cycles with ~90% capacity retention as well as negligible self-discharge. We believe the principles for stabilizing the zinc-iodine system could provide new insight into conversion systems such as Li-S systems.
RR-Interval variance of electrocardiogram for atrial fibrillation detection
Nuryani, N.; Solikhah, M.; Nugoho, A. S.; Afdala, A.; Anzihory, E.
2016-11-01
Atrial fibrillation is a serious heart problem originated from the upper chamber of the heart. The common indication of atrial fibrillation is irregularity of R peak-to-R-peak time interval, which is shortly called RR interval. The irregularity could be represented using variance or spread of RR interval. This article presents a system to detect atrial fibrillation using variances. Using clinical data of patients with atrial fibrillation attack, it is shown that the variance of electrocardiographic RR interval are higher during atrial fibrillation, compared to the normal one. Utilizing a simple detection technique and variances of RR intervals, we find a good performance of atrial fibrillation detection.
Efficacy and safety of sugammadex versus neostigmine in reversing neuromuscular blockade in adults.
Hristovska, Ana-Marija; Duch, Patricia; Allingstrup, Mikkel; Afshari, Arash
2017-08-14
neostigmine group (RR 0.60, 95% CI 0.49 to 0.74; I 2 = 40%; 28 studies, n = 2298; GRADE: moderate quality). Risk of adverse events was 28% in the neostigmine group and 16% in the sugammadex group, resulting in a number needed to treat for an additional beneficial outcome (NNTB) of 8. When looking at specific adverse events, we noted significantly less risk of bradycardia (RR 0.16, 95% CI 0.07 to 0.34; I 2 = 0%; 11 studies, n = 1218; NNTB 14; GRADE: moderate quality), postoperative nausea and vomiting (PONV) (RR 0.52, 95% CI 0.28 to 0.97; I 2 = 0%; six studies, n = 389; NNTB 16; GRADE: low quality) and overall signs of postoperative residual paralysis (RR 0.40, 95% CI 0.28 to 0.57; I 2 = 0%; 15 studies, n = 1474; NNTB 13; GRADE: moderate quality) in the sugammadex group when compared with the neostigmine group. Finally, we found no significant differences between sugammadex and neostigmine regarding risk of serious adverse events (RR 0.54, 95% CI 0.13 to 2.25; I 2 = 0%; 10 studies, n = 959; GRADE: low quality).Application of trial sequential analysis (TSA) indicates superiority of sugammadex for outcomes such as recovery time from T2 to TOFR > 0.9, adverse events, and overall signs of postoperative residual paralysis. Review results suggest that in comparison with neostigmine, sugammadex can more rapidly reverse rocuronium-induced neuromuscular block regardless of the depth of the block. Sugammadex 2 mg/kg is 10.22 minutes (˜ 6.6 times) faster in reversing moderate neuromuscular blockade (T2) than neostigmine 0.05 mg/kg (GRADE: moderate quality), and sugammadex 4 mg/kg is 45.78 minutes (˜ 16.8 times) faster in reversing deep neuromuscular blockade (PTC 1 to 5) than neostigmine 0.07 mg/kg (GRADE: low quality). With an NNTB of 8 to avoid an adverse event, sugammadex appears to have a better safety profile than neostigmine. Patients receiving sugammadex had 40% fewer adverse events compared with those given neostigmine. Specifically, risks of bradycardia (RR 0.16, NNTB 14
Hasanin, Tamer H A; Tsunemine, Yusuke; Tsukahara, Satoshi; Okamoto, Yasuaki; Fujiwara, Terufumi
2011-01-01
The chemiluminescence (CL) emission, observed when rhodamine B (RB) in 1-hexanol-cyclohexane was mixed with cerium(IV) sulfate in sulfuric acid dispersed in a reversed micellar medium of cetyltrimethylammonium chloride (CTAC) in 1-hexanol-cyclohexane/water, was investigated using a flow-injection system. The CL emission from the oxidation reaction of RB with Ce(IV) was found to be stronger in the CTAC reversed micellar solution compared with an aqueous solution. Bearing on the enhancement effect of the CTAC reverse micelles on the RB-Ce(IV) CL, several studies including stopped-flow, fluorescence and electron spin resonance (ESR) spectrometries were performed. Rapid spectral changes of an intermediate in the RB-Ce(IV) reaction in the aqueous and reversed micellar solutions were successfully observed using a stopped-flow method. The effect of the experimental variables, i.e., oxidant concentration, sulfuric acid concentration, the mole fraction of 1-hexanol, water-to-surfactant molar concentration ratio, flow rate, upon the CL intensity was evaluated. Under the experimental conditions optimized for a flow-injection determination of RB based on the new reversed micellar-mediated CL reaction with Ce(IV), a detection limit of 0.08 µmol dm(-3) RB was achieved, and a linear calibration graph was obtained with a dynamic range from 0.5 to 20 µmol dm(-3). The relative standard deviation (n = 6) obtained at an RB concentration of 3 µmol dm(-3) was 3%.
THE RR LYRAE VARIABLES AND HORIZONTAL BRANCH OF NGC 6656 (M22) {sup ,}
Energy Technology Data Exchange (ETDEWEB)
Kunder, Andrea; Walker, Alistair R.; Paredes Alvarez, Leonardo [Cerro Tololo Inter-American Observatory, Casilla 603, La Serena (Chile); Stetson, Peter B. [Dominion Astrophysical Observatory, NRC-Herzberg, National Research Council, Victoria BC, V9E 2E7 (Canada); Cassisi, Santi [INAF-Osservatorio Astronomico di Collurania, Via M. Maggini, I-64100 Teramo (Italy); Layden, Andrew [Bowling Green State University, Bowling Green, OH 43403 (United States); Bono, Giuseppe [Dipartimento di Fisica, Universita di Roma Tor Vergata, Rome (Italy); Catelan, Márcio [Pontificia Universidad Católica de Chile, Departamento de Astronomía y Astrofísica, Av. Vicuña Mackenna 4860, 782-0436 Macul, Santiago (Chile); Clem, James L. [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, LA 70803-4001 (United States); Matsunaga, Noriyuki [Department of Astronomy, School of Science, The University of Tokyo (Japan); Salaris, Maurizio [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom); Lee, Jae-Woo [Korea Astronomy and Space Science Institute, Daejeon 305-348 (Korea, Republic of); Chaboyer, Brian, E-mail: akunder@ctio.noao.edu, E-mail: mcatelan@astro.puc.cl [Department of Physics and Astronomy, Dartmouth College, Hanover, NH 03755 (United States)
2013-11-01
The first calibrated broadband UBVI time-series photometry is presented for the RR Lyrae variable stars in NGC 6656 (M22), with observations spanning a range of 22 years. We have also redetermined the variability types and periods for the RR Lyrae stars identified previously by photographic observations, revising the number of fundamental-mode RR Lyrae variables (RR0) to 10 and the number of first-overtone variables (RR1) to 16. The mean periods of the RR0 and RR1 variables are (P) {sub RR0} = 0.66 ± 0.02 days and (P) {sub RR1} = 0.33 ± 0.01 days, respectively, supporting an Oosterhoff II classification for the cluster. The number ratio of RR1-type to all RR-type variables is N {sub 1}/N{sub RR} = 0.61, also consistent with an Oosterhoff II designation. Both the RR Lyrae stars' minimum light colors and the blue edge of the RR Lyrae instability strip suggest E( B – – V) = 0.36 ± 0.02 mag toward M22. Regarding the HB morphology of M22, we find (B-R)/(B+V+R) = +0.97 ± 0.1 and at least one ''gap'' located in an unusual part of the blue HB, in the middle of the so-called hot HB stars.
Bayer, Christian
2016-02-20
© 2016 Taylor & Francis Group, LLC. ABSTRACT: In this work, we present an extension of the forward–reverse representation introduced by Bayer and Schoenmakers (Annals of Applied Probability, 24(5):1994–2032, 2014) to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, that is, SRNs conditional on their values in the extremes of given time intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the expectation-maximization algorithm to the phase I output. By selecting a set of overdispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.
IDAS-RR: an incident data base system for research reactors
International Nuclear Information System (INIS)
Matsumoto, Kiyoshi; Kohsaka, Atsuo; Kaminaga, Masanori; Murayama, Youji; Ohnishi, Nobuaki; Maniwa, Masaki.
1990-03-01
An Incident Data Base System for Research Reactors, IDAS-RR, has been developed. IDAS-RR has information about abnormal incidents (failures, transients, accidents, etc.) of research reactors in the world. Data reference, input, editing and other functions of IDAS-RR are menu driven. The routine processing and data base management functions are performed by the system software and hardware. PC-9801 equipment was selected as the hardware because of its portability and popularity. IDAS-RR provides effective reference information for the following activities. 1) Analysis of abnormal incident of research reactors, 2) Detail analysis of research reactor behavior in the abnormal incident for building the knowledge base of the reactor emergency diagnostic system for research reactor, 3) Planning counter-measure for emergency situation in the research reactor. This report is a user's manual of IDAS-RR. (author)
International Nuclear Information System (INIS)
Mohr, P.; Angulo, C.; Descouvemont, P.
2005-01-01
The astrophysical reaction rates of the 16 O(α,γ) 20 Ne capture reaction and its reverse 20 Ne(γ,α) 16 O photodisintegration reaction are dominated by a few narrow resonances. Only at very low temperatures direct capture plays a significant role. Usually the reaction rate of photodisintegration reactions is calculated from the reaction rate of the corresponding capture reaction using the detailed balanced theorem. This is only valid for nuclei which are thermalized. The reaction rates of the 16 O(α,γ) 20 Ne capture reaction in the lab and under stellar conditions are identical. However, for the inverse 20 Ne(γ,α) 16 O photodisintegration reaction one finds a significant contribution of the thermally populated first excited state at E x = 1634 keV in 20 Ne. Consequently, the reaction rates of the 20 Ne(γ,α) 16 O photodisintegration reaction are different in the lab and under stellar conditions. It is shown that the detailed balance theorem remains valid for the reaction rates under stellar conditions. Photodisintegration rates in the lab have been measured recently using a quasi-thermal photon spectrum from bremsstrahlung, and a quasi-thermal photon spectrum with superior quality has been suggested using high-energy synchrotron radiation. (author)
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
CIACCIO, EDWARD J.; BIVIANO, ANGELO B.; GAMBHIR, ALOK; EINSTEIN, ANDREW J.; GARAN, HASAN
2014-01-01
Background When atrial fibrillation (AF) is incessant, imaging during a prolonged ventricular RR interval may improve image quality. It was hypothesized that long RR intervals could be predicted from preceding RR values. Methods From the PhysioNet database, electrocardiogram RR intervals were obtained from 74 persistent AF patients. An RR interval lengthened by at least 250 ms beyond the immediately preceding RR interval (termed T0 and T1, respectively) was considered prolonged. A two-parameter scatterplot was used to predict the occurrence of a prolonged interval T0. The scatterplot parameters were: (1) RR variability (RRv) estimated as the average second derivative from 10 previous pairs of RR differences, T13–T2, and (2) Tm–T1, the difference between Tm, the mean from T13 to T2, and T1. For each patient, scatterplots were constructed using preliminary data from the first hour. The ranges of parameters 1 and 2 were adjusted to maximize the proportion of prolonged RR intervals within range. These constraints were used for prediction of prolonged RR in test data collected during the second hour. Results The mean prolonged event was 1.0 seconds in duration. Actual prolonged events were identified with a mean positive predictive value (PPV) of 80% in the test set. PPV was >80% in 36 of 74 patients. An average of 10.8 prolonged RR intervals per 60 minutes was correctly identified. Conclusions A method was developed to predict prolonged RR intervals using two parameters and prior statistical sampling for each patient. This or similar methodology may help improve cardiac imaging in many longstanding persistent AF patients. PMID:23998759
Spectral of electrocardiographic RR intervals to indicate atrial fibrillation
Nuryani, Nuryani; Satrio Nugroho, Anto
2017-11-01
Atrial fibrillation is a serious heart diseases, which is associated on the risk of death, and thus an early detection of atrial fibrillation is necessary. We have investigated spectral pattern of electrocardiogram in relation to atrial fibrillation. The utilized feature of electrocardiogram is RR interval. RR interval is the time interval between a two-consecutive R peaks. A series of RR intervals in a time segment is converted to a signal with a frequency domain. The frequency components are investigated to find the components which significantly associate to atrial fibrillation. A segment is defined as atrial fibrillation or normal segments by considering a defined number of atrial fibrillation RR in the segment. Using clinical data of 23 patients with atrial fibrillation, we find that the frequency components could be used to indicate atrial fibrillation.
Zhao, Xuan; Li, Xue; Gong, Yunhui; Huang, Kevin
2014-01-18
The recently developed solid oxide metal-air redox battery is a new technology capable of high-rate chemistry. Here we report that the performance, reversibility and stability of a solid oxide iron-air redox battery can be significantly improved by nanostructuring energy storage materials from a carbothermic reaction.
Nuclear reaction studies using inverse kinematics
International Nuclear Information System (INIS)
Shapira, D.
1985-01-01
Reaction studies with reversed kinematics refer to studies of nuclear reactions induced by a heavy projectile colliding with lighter target nuclei. The technique of using reversed kinematics is costly in terms of the available center-of-mass energy. Most of the projectile's energy goes into forward motion of the reaction products in the laboratory system. Examples are presented where the use of reversed kinematics techniques has provided new information on certain reaction processes. A list of kinematic properties and advantages they may afford is shown. Clearly the possible studies listed can be done without using reversed kinematics but because of the difficulty associated with some of these studies they were never performed until more energetic heavier beams have become available and the reversed kinematics technique was utilized
RR lyrae variable pulsations and the Oosterhoff groups
International Nuclear Information System (INIS)
Cox, A.N.
1981-01-01
It is concluded that Oosterhoff group I clusters have 0.55 M/sub sun/ stars and group II clusters have 0.65 M/sub sun/ stars. The Y value is always about 0.29. Mean log L/L/sub sun/ values are 1.66 and 1.78 giving M/sub bol/ = 0.60 and 0.30 for the RR Lyrae variables in these two groups of clusters. For field RR Lyrae variables at M = approx. 0.5 M/sub sun/ or less, perhaps M/sub bol/ = 0.90 or even larger as Clube and Jones propose. Apparently all evolution is blueward for RR Lyrae variables, and the color overlap of F and 1H pulsators is not real
Xu, Yan; Schulman, Sam; Dowlatshahi, Dar; Holbrook, Anne M; Simpson, Christopher S; Shepherd, Lois E; Wells, Philip S; Giulivi, Antonio; Gomes, Tara; Mamdani, Muhammad; Khuu, Wayne; Frymire, Eliot; Johnson, Ana P
2017-07-01
Direct oral anticoagulants (DOACs) have expanded the armamentarium for antithrombotic therapy. Although DOAC-related major bleeding was associated with favorable outcomes compared with warfarin in clinical trials, warfarin effects were reversed in bleeding events. Red blood cell transfusions occurred more often in DOAC bleeding events than in warfarin events (52.0% vs 39.5%; adjusted relative risk [aRR], 1.32; 95% CI, 1.19-2.47). However, units of blood products transfused were not different between the two groups. Thirty-four DOAC cases (7.4%) received activated prothrombin complex concentrates or recombinant factor VIIa. In-hospital mortality was lower following DOAC bleeding events (9.8% vs 15.2%; aRR, 0.66; 95% CI, 0.49-0.89), although differences in 30-day mortality did not reach statistical significance (12.6% vs 16.3%; aRR, 0.79; 95% CI, 0.61-1.03). In this unselected cohort of patients with oral anticoagulant-related hemorrhage with high rates of warfarin reversal, in-hospital mortality was lower among DOAC-associated bleeding events. These findings support the safety of DOACs in routine care and present useful baseline measures for evaluations of DOAC-specific reversal agents. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kipriyanov, Alexey A.; Kipriyanov, Alexander A.; Doktorov, Alexander B. [Voevodsky Institute of Chemical Kinetics and Combustion, Siberian Branch of the Russian Academy of Sciences, Novosibirsk 630090, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)
2016-04-14
Specific two-stage reversible reaction A + A↔C↔B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.
Neural Network Control of CSTR for Reversible Reaction Using Reverence Model Approach
Directory of Open Access Journals (Sweden)
Duncan ALOKO
2007-01-01
Full Text Available In this work, non-linear control of CSTR for reversible reaction is carried out using Neural Network as design tool. The Model Reverence approach in used to design ANN controller. The idea is to have a control system that will be able to achieve improvement in the level of conversion and to be able to track set point change and reject load disturbance. We use PID control scheme as benchmark to study the performance of the controller. The comparison shows that ANN controller out perform PID in the extreme range of non-linearity.This paper represents a preliminary effort to design a simplified neutral network control scheme for a class of non-linear process. Future works will involve further investigation of the effectiveness of thin approach for the real industrial chemical process
Gas-phase rate coefficients of the reaction of ozone with four sesquiterpenes at 295 ± 2 K.
Richters, Stefanie; Herrmann, Hartmut; Berndt, Torsten
2015-05-07
The rate coefficients of the reaction of ozone with the four atmospherically relevant sesquiterpenes β-caryophyllene, α-humulene, α-cedrene and isolongifolene were investigated at 295 ± 2 K and atmospheric pressure by at least two independent experimental investigations for each reaction. Relative rate experiments were carried out in a flow tube using two different experimental approaches with GC-MS detection (RR 1) and PTR-MS analysis (RR 2) as the analytical techniques. Absolute rate coefficients were determined in a stopped-flow experiment following the ozone depletion by means of UV spectroscopy. The average rate coefficients from the combined investigations representing the mean values of the different experimental methods are (unit: cm(3) molecule(-1) s(-1)): k(O3+β-caryophyllene) = (1.1 ± 0.3) × 10(-14) (methods: RR 1, RR 2, absolute), k(O3+α-humulene) = (1.2 ± 0.3) × 10(-14) (RR 1, RR 2), k(O3+α-cedrene) = (1.7 ± 0.5) × 10(-16) (RR 2, absolute) and k(O3+isolongifolene) = (1.1 ± 0.5) × 10(-17) (RR 2, absolute). The high ozonolysis rate coefficients for β-caryophyllene and α-humulene agree well with the results by Shu and Atkinson (Int. J. Chem. Kinet., 1994, 26) and lead to short atmospheric lifetimes of about two minutes with respect to the ozone reaction. The relatively small rate coefficients for α-cedrene and isolongifolene differ from the available literature values by a factor of about 2.5-6. Possible reasons for the deviations are discussed. Finally, calibrated sesquiterpene FT-IR spectra were recorded for the first time.
QT/RR hysteresis as a function of RR excitation – implications for risk
Czech Academy of Sciences Publication Activity Database
Halámek, Josef; Jurák, Pavel; Somers, V. K.; Nykodým, J.; Leinveber, P.; Fráňa, P.; Eisenberger, M.; Kára, T.
2005-01-01
Roč. 4, č. 1 (2005), s. 98 [World Congress on Heart Disease - New Trends in Research, Diagnosis and Treatment /12./. 16.07.2005-19.07.2005, Vancouver] Institutional research plan: CEZ:AV0Z20650511 Keywords : ventricular repolarization * RR intervals Subject RIV: FA - Cardiovascular Disease s incl. Cardiotharic Surgery
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Directory of Open Access Journals (Sweden)
Cristiane Fortes Gris
2013-04-01
Full Text Available Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha. The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.Diferenças nos teores de lignina na planta entre cultivares transgênicos RR e convencionais, tem sido relatadas, por vários autores, no entanto, são escassos os trabalhos avaliando a influência da aplicação do glifosato sobre os teores de lignina na planta e em sementes de soja RR. Neste sentido, objetivou-se, com este trabalho, avaliar a qualidade fisiológica de sementes de soja transgênica RR e os teores de lignina de plantas submetidas à pulverização com o herbicida glifosato. Os ensaios foram conduzidos em casa de vegetação e em campo, no munic
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
Time reversal tests in polarized neutron reactions
International Nuclear Information System (INIS)
Asahi, Koichiro; Bowman, J.D.; Crawford, B.
1998-01-01
This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). In recent years the nuclear weak interaction has been studied in the compound nucleus via parity violation. The observed parity-violating effects are strongly enhanced by nuclear structure. The predictions are that the interaction of polarized neutrons with polarized nuclear targets could be also used to perform sensitive tests of time-reversal-violation because of the nuclear enhancements. The author has designed experiments to search for time-reversal violation in neutron-nucleus interactions. He has also developed techniques to polarize neutrons with laser-polarized 3 He gas targets. Using the polarized 3 He neutron spin filter, he has performed two experiments at LANSCE: an absolute neutron beam polarization measurement with an accuracy of 0.2--0.3% and a neutron spin-rotation measurement on a 139 La sample
Adverse drug reactions to CT contrast media in south Korea: Incidence and risk factors
International Nuclear Information System (INIS)
Bae, Kyung Soo; Jeon, Kyung Nyeo; Moon, Jin Il; Choi, Bo Hwa; Baek, Hye Jin; Cho, Soo Buem; Lee, Sang Min; Ha, Ji Young; Choi, Dae Seob; Cho, Jae Min; Na, Jae Beom
2016-01-01
To evaluate the incidence, severity, and risk factors of adverse drug reactions (ADR) to intravenous administration of nonionic iodinated contrast media in computed tomography (CT), and to determine the recurrence rate after premedication in patients with a previous history of ADR. We prospectively recorded all ADR to intravenous CT contrast media in 32313 consecutive outpatients (54572 cases) who underwent contrast enhanced CT examinations. Clinical report forms and electronic medical records were reviewed to search for the incidence of ADR, treatment, and clinical outcome of patients. The risk factors of ADR to CT contrast media (age, sex, history of previous ADR, season) were evaluated using statistical analysis. Of the 54572 cases, a total of 191 (0.35%) had adverse reactions. Of the 191 cases, 157 (82%) were categorized as mild reactions, 29 (15%) were moderate, and 5 (3%) were severe. A total of 165 (86.4%) cases had acute adverse reactions (which occurred within 1 hour after administration), while 26 (13.6%) had delayed adverse reactions (occurred 1 hour after the administration). The rate of ADR was significantly higher in females [relative risk (RR) = 2.05, 95% confidence interval (CI) 1.53-2.75], patients under the age of 60 years (RR = 1.45, 95% CI 1.07-1.98), patients with a history of previous ADR (RR = 6.51, 95% CI 3.13-13.57), and in the spring season (RR = 1.44, 95% CI 1.07-1.95). The recurrence rate after premedication in patients with previous ADR to CT contrast media was 3.2% (8/247). No deaths occurred that were attributed to the contrast media. The incidence of ADR to nonionic CT contrast media was 0.35%; most of which were mild reactions. Risk factors for ADR included female gender, an age of under 60 years, a history of previous ADR, and spring season
Adverse drug reactions to CT contrast media in south Korea: Incidence and risk factors
Energy Technology Data Exchange (ETDEWEB)
Bae, Kyung Soo; Jeon, Kyung Nyeo; Moon, Jin Il; Choi, Bo Hwa; Baek, Hye Jin; Cho, Soo Buem [Dept. of Radiology, Gyeongsang National University Changwon Hospital, Gyeongsang National University School of Medicine, Changwon (Korea, Republic of); Lee, Sang Min; Ha, Ji Young; Choi, Dae Seob; Cho, Jae Min; Na, Jae Beom [Dept. of Radiology, Gyeongsang National University Hospital, Gyeongsang National University School of Medicine, Jinju (Korea, Republic of)
2016-07-15
To evaluate the incidence, severity, and risk factors of adverse drug reactions (ADR) to intravenous administration of nonionic iodinated contrast media in computed tomography (CT), and to determine the recurrence rate after premedication in patients with a previous history of ADR. We prospectively recorded all ADR to intravenous CT contrast media in 32313 consecutive outpatients (54572 cases) who underwent contrast enhanced CT examinations. Clinical report forms and electronic medical records were reviewed to search for the incidence of ADR, treatment, and clinical outcome of patients. The risk factors of ADR to CT contrast media (age, sex, history of previous ADR, season) were evaluated using statistical analysis. Of the 54572 cases, a total of 191 (0.35%) had adverse reactions. Of the 191 cases, 157 (82%) were categorized as mild reactions, 29 (15%) were moderate, and 5 (3%) were severe. A total of 165 (86.4%) cases had acute adverse reactions (which occurred within 1 hour after administration), while 26 (13.6%) had delayed adverse reactions (occurred 1 hour after the administration). The rate of ADR was significantly higher in females [relative risk (RR) = 2.05, 95% confidence interval (CI) 1.53-2.75], patients under the age of 60 years (RR = 1.45, 95% CI 1.07-1.98), patients with a history of previous ADR (RR = 6.51, 95% CI 3.13-13.57), and in the spring season (RR = 1.44, 95% CI 1.07-1.95). The recurrence rate after premedication in patients with previous ADR to CT contrast media was 3.2% (8/247). No deaths occurred that were attributed to the contrast media. The incidence of ADR to nonionic CT contrast media was 0.35%; most of which were mild reactions. Risk factors for ADR included female gender, an age of under 60 years, a history of previous ADR, and spring season.
International Nuclear Information System (INIS)
Bai Xixiang; Liu Weiping
1993-01-01
Some of (p,n),(d,p),(d,n) and (d, 3 He) reactions involving heavy-ions in reversed geometries are proposed for producing the kinematically compressed beams of ions such as 6 He, 7 Be, 8 Li, 11 C, 12 B, 13 N, 15 O and 17 F. A simple facility being constructed to produce and utilize these beams is briefly described
Energy Technology Data Exchange (ETDEWEB)
Plante, Ianik, E-mail: ianik.plante-1@nasa.gov [Wyle Science, Technology & Engineering, 1290 Hercules, Houston, TX 77058 (United States); Devroye, Luc, E-mail: lucdevroye@gmail.com [School of Computer Science, McGill University, 3480 University Street, Montreal H3A 0E9 (Canada)
2015-09-15
Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well.
International Nuclear Information System (INIS)
Plante, Ianik; Devroye, Luc
2015-01-01
Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well
RR Tel: Getting Under the Flux Limit: An Observation with FUSE
Sonnenborn, George (Technical Monitor); Kenyon, Scott J.
2004-01-01
The goal of this program is to acquire a FUSE spectrum of the symbiotic binary RR Tel. With these data, we plan to derive improved constraints on the hot component, the nebula, and perhaps the red giant wind. Based on results from AG Dra, we should also be able to use some line detections to improve atomic parameters for high ionization emission lines. This results would benefit the general FUSE community. As of this writing, the FUSE observation of RR Tel has not been made. Because RR Tel is a very bright UV source, the FUSE team is assessing the likelihood that RR Tel will have an adverse affect on the instrument.
Sato, Hisako; Nakae, Takahiro; Morimoto, Kazuya; Tamura, Kenji
2012-02-28
Vibrational circular dichroism (VCD) spectra were recorded on benzene-d(6) gels formed by chiral low molecular mass gelators (LMGs), trans(RR)- or trans(SS)-N,N'-alkanoyl-1,2-diaminocyclohexane (denoted by RR-C(n) or SS-C(n), respectively; n = the number of carbon atoms in an introduced alkanoyl group). Attention was focused on the effects of alkyl chain length on the structures of the gels. When n was changed from 6 to 12, the signs of the coupled peaks around 1550 cm(-1) in the VCD spectra, which were assigned to the symmetric and asymmetric C=O stretching vibrations from the higher to lower wavenumber, respectively, critically depended on the alkyl chain length. In the case of RR-C(n), for example, the signs of the couplet were plus and minus for n = 8, 9, 10 and 12, while the signs of the same couplet were reversed for n = 6 and 7. The conformations of LMGs in fibrils were determined by comparing the observed IR and VCD spectra with those calculated for a monomeric molecule. The observed reversal of signs in the C=O couplet was rationalized in terms of the different modes of hydrogen bonding. In the case of C(8), C(9), C(10) and C(12), gelator molecules were stacked with their cyclohexyl rings in parallel, forming double anti-parallel chains of intermolecular hydrogen bonds using two pairs of >NH and >C=O groups. In case of C(6) and C(7), gelator molecules were stacked through a single chain of intermolecular hydrogen bonds using a pair of >NH and >C=O groups. The remaining pair of >NH and >C=O groups formed an intramolecular hydrogen bond.
Gauging the Galactic thick disk with RR Lyrae stars
Directory of Open Access Journals (Sweden)
Cruz G.
2012-02-01
Full Text Available In this contribution we present results from the QUEST RR Lyrae Survey of the thick disk. The survey spans ~480 sq. deg. at low latitude |b| < 30°, with multi-epoch VRI observations, obtained with the QUEST-I camera at the 1m Jürgen Stock Schmidt telescope located at the National Astronomical Observatory of Venezuela. This constitutes the first deep RR Lyrae survey of the Galactic thick disk conducted at low galactic latitudes, covering simultaneously a large range in radial (8
Kipriyanov, Alexey A; Kipriyanov, Alexander A; Doktorov, Alexander B
2016-04-14
Specific two-stage reversible reaction A + A ↔ C ↔ B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.
Gary, Ronald K.
2004-01-01
The concentration dependence of (delta)S term in the Gibbs free energy function is described in relation to its application to reversible reactions in biochemistry. An intuitive and non-mathematical argument for the concentration dependence of the (delta)S term in the Gibbs free energy equation is derived and the applicability of the equation to…
NESDIS Blended Rain Rate (RR) Products
National Oceanic and Atmospheric Administration, Department of Commerce — The blended Rain Rate (RR) product is derived from multiple sensors/satellites. The blended products were merged from polar-orbiting and geostationary satellite...
Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate
Directory of Open Access Journals (Sweden)
Cristiane Fortes Gris
2013-04-01
Full Text Available Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha. The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.
Studying RR Lyrae Stars in M4 with K2
Kuehn, Charles A.; Drury, Jason; Moskalik, Pawel
2017-01-01
Observations by Kepler/K2 have revolutionized the study of RR Lyrae stars by allowing the detection of new phenomena, such as low amplitude additional modes and period doubling, which had not previously been seen from the ground. During its campaign 2, K2 observed the globular cluster M4, providing the first opportunity to study a sizeable group of RR Lyrae stars that belong to a single population; the other RR Lyrae stars that have been observed from space are field stars in the galactic halo and thus belong to an assortment of populations. We present the results of our study of the RR Lyrae variables in M4 from K2 photometry. We have identified additional, low amplitude pulsation modes in the two observed RRc stars. In three RRab stars we have found the Blazhko effect with periods of 16.6 days, 22.4 days, and 44.5 days.
Leprosy reactions: coinfections as a possible risk factor
Directory of Open Access Journals (Sweden)
Ana Carolina F. Motta
2012-10-01
Full Text Available OBJECTIVE: This study aimed to determine the frequency of coinfections in leprosy patients and whether there is a relationship between the presence of coinfections and the development of leprosy reactional episodes. METHOD: A cross-sectional study based on an analysis of the medical records of the patients who were treated at the Leprosy Clinics of the Ribeirão Preto Medical School, University of São Paulo, was conducted from 2000 to 2010. Information was recorded regarding the age, sex, clinical status, WHO classification, treatment, presence of reactions and coinfections. Focal and systemic infections were diagnosed based on the history, physical examination, and laboratory tests. Multinomial logistic regression was used to evaluate the associations between the leprosy reactions and the patients' gender, age, WHO classification and coinfections. RESULTS: Two hundred twenty-five patients were studied. Most of these patients were males (155/225 = 68.8% of an average age of 49.31±15.92 years, and the most prevalent clinical manifestation was the multibacillary (MB form (n = 146, followed by the paucibacillary (PB form (n = 79. Erythema nodosum leprosum (ENL was more prevalent (78/122 = 63.9% than the reversal reaction (RR (44/122 = 36.1%, especially in the MB patients (OR 5.07; CI 2.86-8.99; p<0.0001 who exhibited coinfections (OR 2.26; CI 1.56-3.27; p,<0.0001. Eighty-eight (88/225 = 39.1% patients exhibited coinfections. Oral coinfections were the most prevalent (40/88 = 45.5%, followed by urinary tract infections (17/88 = 19.3%, sinusopathy (6/88 = 6.8%, hepatitis C (6/88 = 6.8%, and hepatitis B (6/88 = 6.8%. CONCLUSIONS: Coinfections may be involved in the development and maintenance of leprosy reactions.
Steam in RR Telescopii and Henize 2-38
Energy Technology Data Exchange (ETDEWEB)
Allen, D A [Anglo-Australian Observatory, Epping (Australia); Beattie, D H; Lee, T J; Stewart, J M; Williams, P M
1978-03-01
Low-resolution scans in the 1.9-2.6..mu..m atmospheric window reveal steam (H/sub 2/O) and CO adsorption bands in the spectra of the symbiotic stars RR Tel and He 2-38. The steam absorption in RR Tel is particularly intense while the CO is weak, implying the presence in the system of a Mira variable seen near minimum light. In He 2-38 the steam band is weaker while the CO is stronger, as expected for a Mira seen near maximum.
International Nuclear Information System (INIS)
Fedorov, Yu.V.; Shepel', N.Eh.; Chernikova, E.Yu.; Fedorova, O.A.; Gulakova, E.N.; Avakyan, V.G.; Jonushauskas, G.
2008-01-01
E-Z-Photoisomerization reversible reaction of crown-containing 4-styrylpyridine in the presence of alkali metal perchlorates (Ca 2+ , Mg 2+ , Ba 2+ ) gifted in the formation of complexes with crown-ether fragments, as well as heavy metal perchlorates (Hg 2+ , Cd 2+ ) gifted in the coordination with nitrogen atom of heterocyclic residuum has been studied. Effect of complexing on the photoisomerization is determined by electron spectroscopy and NMR 1 H, structures of the formed Z-isomers are established. The possibility of the E-Z-isomerization control with the use of supramolecular complexing is confirmed by the investigations [ru
A NOVEL APPROACH TO ARRHYTHMIA CLASSIFICATION USING RR INTERVAL AND TEAGER ENERGY
Directory of Open Access Journals (Sweden)
CHANDRAKAR KAMATH
2012-12-01
Full Text Available It is hypothesized that a key characteristic of electrocardiogram (ECG signal is its nonlinear dynamic behaviour and that the nonlinear component changes more significantly between normal and arrhythmia conditions than the linear component. The usual statistical descriptors used in RR (R to R interval analysis do not capture the nonlinear disposition of RR interval variability. In this paper we explore a novel approach to extract the features from nonlinear component of the RR interval signal using Teager energy operator (TEO. The key feature of Teager energy is that it models the energy of the source that generated the signal rather than the energy of the signal itself. Hence any deviations in regular rhythmic activity of the heart get reflected in the Teager energy function. The classification evaluated on MIT-BIH database, with RR interval and mean of Teager energy computed over RR interval as features, exhibits an average accuracy that exceeds 99.79%.
The coefficient of rolling resistance (CoRR) of some pharmaceutical tablets.
Ketterhagen, William R; Bharadwaj, Rahul; Hancock, Bruno C
2010-06-15
Experiments have been conducted to measure the coefficient of rolling resistance (CoRR) of some pharmaceutical tablets and several common materials, such as glass beads and steel ball bearings. CoRR values are required as inputs for discrete element method (DEM) models which can be used to model particulate flows and solid dosage form manufacturing processes. Until now there have been no CoRR data reported for pharmaceutical materials, and thus these new data will help to facilitate more accurate modeling of pharmaceutical systems. Copyright 2010 Elsevier B.V. All rights reserved.
Radial velocities of RR Lyrae stars
International Nuclear Information System (INIS)
Hawley, S.L.; Barnes, T.G. III
1985-01-01
283 spectra of 57 RR Lyrae stars have been obtained using the 2.1-m telescope at McDonald Observatory. Radial velocities were determined using a software cross-correlation technique. New mean radial velocities were determined for 46 of the stars. 11 references
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Schredder, J. M.; Fujita, T.
1984-01-01
The use of reversible chemical reactions for energy transport and storage for parabolic dish networks is considered. Performance and cost characteristics are estimated for systems using three reactions (sulfur-trioxide decomposition, steam reforming of methane, and carbon-dioxide reforming of methane). Systems are considered with and without storage, and in several energy-delivery configurations that give different profiles of energy delivered versus temperature. Cost estimates are derived assuming the use of metal components and of advanced ceramics. (The latter reduces the costs by three- to five-fold). The process that led to the selection of the three reactions is described, and the effects of varying temperatures, pressures, and heat exchanger sizes are addressed. A state-of-the-art survey was performed as part of this study. As a result of this survey, it appears that formidable technical risks exist for any attempt to implement the systems analyzed in this study, especially in the area of reactor design and performance. The behavior of all components and complete systems under thermal energy transients is very poorly understood. This study indicates that thermochemical storage systems that store reactants as liquids have efficiencies below 60%, which is in agreement with the findings of earlier investigators.
Contamination of RR Lyrae stars from Binary Evolution Pulsators
Karczmarek, Paulina; Pietrzyński, Grzegorz; Belczyński, Krzysztof; Stępień, Kazimierz; Wiktorowicz, Grzegorz; Iłkiewicz, Krystian
2016-06-01
Binary Evolution Pulsator (BEP) is an extremely low-mass member of a binary system, which pulsates as a result of a former mass transfer to its companion. BEP mimics RR Lyrae-type pulsations but has different internal structure and evolution history. We present possible evolution channels to produce BEPs, and evaluate the contamination value, i.e. how many objects classified as RR Lyrae stars can be undetected BEPs. In this analysis we use population synthesis code StarTrack.
Zhang, Xian-Bing; Dong, Wen-Yi; Sun, Fei-Yun; Yang, Wei; Dong, Jiao
2014-07-15
A newly designed ozone aerated internal micro-electrolysis filter (OIEF) was developed to investigate its degradation efficiencies and correlated reaction mechanisms of RR2 dye. Complete decolorization and 82% TOC removal efficiency were stably achieved in OIEF process. Based on the comprehensive experimental results, an empirical equation was proposed to illustrate the effects of initial dye concentration and ozone dosage rate on color removal. The results indicated that OIEF process could be operated at wide pH range without significant treatment efficiencies change, while the optimum pH for RR2 dye degradation was 9.0. There were 15, 8 and 6 kinds of identified intermediates during ozonation, IE and OIEF treatment processes, respectively. Less identified intermediates and their lower concentrations in OIEF may attribute to its rather excellent mineralization performance. It was found that ozonation, Fe(2+)/Fe(3+) catalyzed ozonation, the redox reactions of electro-reduction and electro-oxidation are the most important mechanisms in OIEF process. The catalytic effect of Fe(2+)/Fe(3+) would induce mutual conversion between dissolved Fe(2+) and Fe(3+), and then decrease the dissolution rate of ZVI. The excellent treatment performance proved that the OIEF process is one promising technology applied for reactive azo dyes and other refractory wastewater treatment. Copyright © 2014 Elsevier B.V. All rights reserved.
Chemical kinetics and reaction mechanism
International Nuclear Information System (INIS)
Jung, Ou Sik; Park, Youn Yeol
1996-12-01
This book is about chemical kinetics and reaction mechanism. It consists of eleven chapters, which deal with reaction and reaction speed on reaction mechanism, simple reaction by rate expression, reversible reaction and simultaneous reaction, successive reaction, complicated reaction mechanism, assumption for reaction mechanism, transition state theory, successive reaction and oscillating reaction, reaction by solution, research method high except kinetics on reaction mechanism, high reaction of kinetics like pulsed radiolysis.
Dynamic Modeling of Reversible Methanolysis of Jatropha curcas Oil to Biodiesel
Syam, Azhari M.; Hamid, Hamidah A.; Yunus, Robiah; Rashid, Umer
2013-01-01
Many kinetics studies on methanolysis assumed the reactions to be irreversible. The aim of the present work was to study the dynamic modeling of reversible methanolysis of Jatropha curcas oil (JCO) to biodiesel. The experimental data were collected under the optimal reaction conditions: molar ratio of methanol to JCO at 6 : 1, reaction temperature of 60°C, 60 min of reaction time, and 1% w/w of catalyst concentration. The dynamic modeling involved the derivation of differential equations for rates of three stepwise reactions. The simulation study was then performed on the resulting equations using MATLAB. The newly developed reversible models were fitted with various rate constants and compared with the experimental data for fitting purposes. In addition, analysis of variance was done statistically to evaluate the adequacy and quality of model parameters. The kinetics study revealed that the reverse reactions were significantly slower than forward reactions. The activation energies ranged from 6.5 to 44.4 KJ mol−1. PMID:24363616
Artificial Self-Sufficient P450 in Reversed Micelles
Directory of Open Access Journals (Sweden)
Teruyuki Nagamune
2010-04-01
Full Text Available Cytochrome P450s are heme-containing monooxygenases that require electron transfer proteins for their catalytic activities. They prefer hydrophobic compounds as substrates and it is, therefore, desirable to perform their reactions in non-aqueous media. Reversed micelles can stably encapsulate proteins in nano-scaled water pools in organic solvents. However, in the reversed micellar system, when multiple proteins are involved in a reaction they can be separated into different micelles and it is then difficult to transfer electrons between proteins. We show here that an artificial self-sufficient cytochrome P450, which is an enzymatically crosslinked fusion protein composed of P450 and electron transfer proteins, showed micelle-size dependent catalytic activity in a reversed micellar system. Furthermore, the presence of thermostable alcohol dehydrogenase promoted the P450-catalyzed reaction due to cofactor regeneration.
VBLUM photometry of RR Lyrae stars in ω Cen and M4
International Nuclear Information System (INIS)
DeBruijn, J.W.; Lub, J.
1987-01-01
Multicolour VBLUW photometry of RR Lyrae stars in the globular clusters M4 and ω Cen is used to derive information on reddening, blanketing, effective temperatures and gravity of these stars. The methods employed in the literature to determine the reddening of globular clusters from the UBV colours of the RR Lyrae stars are in complete agreement with the results from VBLUW photometry. The most important conclusions of the present work are: the close similarity between the RR Lyrae variables in the field and in globular clusters, and the agreement between the reddenings derived for RR Lyrae in the field and in globular clusters. This means that at least one parameter which normally is taken as a free parameter in studying globular cluster colour magnitude diagrams can be constrained very precisely
[Heart rate variability study based on a novel RdR RR Intervals Scatter Plot].
Lu, Hongwei; Lu, Xiuyun; Wang, Chunfang; Hua, Youyuan; Tian, Jiajia; Liu, Shihai
2014-08-01
On the basis of Poincare scatter plot and first order difference scatter plot, a novel heart rate variability (HRV) analysis method based on scatter plots of RR intervals and first order difference of RR intervals (namely, RdR) was proposed. The abscissa of the RdR scatter plot, the x-axis, is RR intervals and the ordinate, y-axis, is the difference between successive RR intervals. The RdR scatter plot includes the information of RR intervals and the difference between successive RR intervals, which captures more HRV information. By RdR scatter plot analysis of some records of MIT-BIH arrhythmias database, we found that the scatter plot of uncoupled premature ventricular contraction (PVC), coupled ventricular bigeminy and ventricular trigeminy PVC had specific graphic characteristics. The RdR scatter plot method has higher detecting performance than the Poincare scatter plot method, and simpler and more intuitive than the first order difference method.
Unmixing the Galactic halo with RR Lyrae tagging
Belokurov, V.; Deason, A. J.; Koposov, S. E.; Catelan, M.; Erkal, D.; Drake, A. J.; Evans, N. W.
2018-06-01
We show that tagging RR Lyrae stars according to their location in the period-amplitude diagram can be used to shed light on the genesis of the Galactic stellar halo. The mixture of RR Lyrae of ab type, separated into classes along the lines suggested by Oosterhoff, displays a strong and coherent evolution with Galactocentric radius. The change in the RR Lyrae composition appears to coincide with the break in the halo's radial density profile at ˜25 kpc. Using simple models of the stellar halo, we establish that at least three different types of accretion events are necessary to explain the observed RRab behaviour. Given that there exists a correlation between the RRab class fraction and the total stellar content of a dwarf satellite, we hypothesize that the field halo RRab composition is controlled by the mass of the progenitor contributing the bulk of the stellar debris at the given radius. This idea is tested against a suite of cosmological zoom-in simulations of Milky Way-like stellar halo formation. Finally, we study some of the most prominent stellar streams in the Milky Way halo and demonstrate that their RRab class fractions follow the trends established previously.
Period Changes of 23 Field RR Lyrae Stars
Directory of Open Access Journals (Sweden)
Soo-Chang Rey
1994-12-01
Full Text Available The secular period behavior of 23 field RR Lyrae stars is studied in order to determine if the observed period changes could be attributed, at least in the mean, to stellar evolution. The sample of stars is subdivided into two Oosterhoff groups based on the metallicity and period-shift. Despite the small sample size, we found a distinct bias toward positive period changes in the group variables. The period changes of the group variables in globular clusters. This provides yet another support for the Lee, Demarque, and Zinn(1990 evolutionary models of RR Lyrae stars and their explanation of the Sandage period-shift effect.
Iitani, Kenta; Chien, Po-Jen; Suzuki, Takuma; Toma, Koji; Arakawa, Takahiro; Iwasaki, Yasuhiko; Mitsubayashi, Kohji
2018-02-23
Volatile organic compounds (VOCs) exhaled in breath have huge potential as indicators of diseases and metabolisms. Application of breath analysis for disease screening and metabolism assessment is expected since breath samples can be noninvasively collected and measured. In this research, a highly sensitive and selective biochemical gas sensor (bio-sniffer) for gaseous acetaldehyde (AcH) was developed. In the AcH bio-sniffer, a reverse reaction of alcohol dehydrogenase (ADH) was employed for reducing AcH to ethanol and simultaneously consuming a coenzyme, reduced form of nicotinamide adenine dinucleotide (NADH). The concentration of AcH can be quantified by fluorescence detection of NADH that was consumed by reverse reaction of ADH. The AcH bio-sniffer was composed of an ultraviolet light-emitting diode (UV-LED) as an excitation light source, a photomultiplier tube (PMT) as a fluorescence detector, and an optical fiber probe, and these three components were connected with a bifurcated optical fiber. A gas-sensing region of the fiber probe was developed with a flow-cell and an ADH-immobilized membrane. In the experiment, after optimization of the enzyme reaction conditions, the selectivity and dynamic range of the AcH bio-sniffer were investigated. The AcH bio-sniffer showed a short measurement time (within 2 min) and a broad dynamic range for determination of gaseous AcH, 0.02-10 ppm, which encompassed a typical AcH concentration in exhaled breath (1.2-6.0 ppm). Also, the AcH bio-sniffer exhibited a high selectivity to gaseous AcH based on the specificity of ADH. The sensor outputs were observed only from AcH-contained standard gaseous samples. Finally, the AcH bio-sniffer was applied to measure the concentration of AcH in exhaled breath from healthy subjects after ingestion of alcohol. As a result, a significant difference of AcH concentration between subjects with different aldehyde dehydrogenase type 2 (ALDH2) phenotypes was observed. The AcH bio-sniffer can be
QT/RR Coupling and Gender Differences
Czech Academy of Sciences Publication Activity Database
Halámek, Josef; Jurák, Pavel; Lipoldová, J.; Leinveber, Pavel
2010-01-01
Roč. 37, - (2010), s. 365-368 ISSN 0276-6574 R&D Projects: GA ČR GA102/08/1129 Institutional research plan: CEZ:AV0Z20650511 Keywords : THEW * QT/RR model * EXPDC Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering http://cinc.mit.edu/archives/2010/pdf/0365.pdf
Identification of atrial fibrillation using electrocardiographic RR-interval difference
Eliana, M.; Nuryani, N.
2017-11-01
Automated detection of atrial fibrillation (AF) is an interesting topic. It is an account of very dangerous, not only as a trigger of embolic stroke, but it’s also related to some else chronical disease. In this study, we analyse the presence of AF by determining irregularities of RR-interval. We utilize the interval comparison to measure the degree of irregularities of RR-interval in a defined segment. The series of RR-interval is segmented with the length of 10 of them. In this study, we use interval comparison for the method. We were comparing all of the intervals there each other. Then we put the threshold to define the low difference and high difference (δ). A segment is defined as AF or Normal Sinus by the number of high δ, so we put the tolerance (β) of high δ there. We have used this method to test the 23 patients data from MIT-BIH. Using the approach and the clinical data we find accuracy, sensitivity, and specificity of 84.98%, 91.99%, and 77.85% respectively.
Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.
2003-01-01
An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical
International Nuclear Information System (INIS)
Masuda, Yasuhiro
1993-01-01
In this report, the papers on symmetry violation under space reflection and time reversal and neutron spin, neutron spin rotation and P-violation, parity nonconservation in neutron capture reaction, some advantage of the search for CP-violation in neutron scattering, dynamic polarization of 139 La target, alexandrite laser for optical pumping, polarized 3 He system for T- and P-violation neutron experiments, control of neutron spin in T-violation neutron experiment, symmetry regarding time and space and angular distribution and angular correlation of radiation and particle beams, T-violation due to low temperature nuclear polarization and axion exploration using nuclear transition are collected. (K.I.)
2012-05-08
... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-80,485] R.R. Donnelley, Inc... workers of R.R. Donnelley, Inc., Bloomsburg, Pennsylvania (subject firm). The Department's Notice of... eligibility to apply for worker adjustment assistance for workers and former workers of R.R. Donnelley, Inc...
Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo
2004-01-01
We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...
Mechanism of blood pressure and R-R variability: insights from ganglion blockade in humans
Zhang, Rong; Iwasaki, Kenichi; Zuckerman, Julie H.; Behbehani, Khosrow; Crandall, Craig G.; Levine, Benjamin D.; Blomqvist, C. G. (Principal Investigator)
2002-01-01
Spontaneous blood pressure (BP) and R-R variability are used frequently as 'windows' into cardiovascular control mechanisms. However, the origin of these rhythmic fluctuations is not completely understood. In this study, with ganglion blockade, we evaluated the role of autonomic neural activity versus other 'non-neural' factors in the origin of BP and R-R variability in humans. Beat-to-beat BP, R-R interval and respiratory excursions were recorded in ten healthy subjects (aged 30 +/- 6 years) before and after ganglion blockade with trimethaphan. The spectral power of these variables was calculated in the very low (0.0078-0.05 Hz), low (0.05-0.15 Hz) and high (0.15-0.35 Hz) frequency ranges. The relationship between systolic BP and R-R variability was examined by cross-spectral analysis. After blockade, R-R variability was virtually abolished at all frequencies; however, respiration and high frequency BP variability remained unchanged. Very low and low frequency BP variability was reduced substantially by 84 and 69 %, respectively, but still persisted. Transfer function gain between systolic BP and R-R interval variability decreased by 92 and 88 % at low and high frequencies, respectively, while the phase changed from negative to positive values at the high frequencies. These data suggest that under supine resting conditions with spontaneous breathing: (1) R-R variability at all measured frequencies is predominantly controlled by autonomic neural activity; (2) BP variability at high frequencies (> 0.15 Hz) is mediated largely, if not exclusively, by mechanical effects of respiration on intrathoracic pressure and/or cardiac filling; (3) BP variability at very low and low frequencies (rhythmicity; and (4) the dynamic relationship between BP and R-R variability as quantified by transfer function analysis is determined predominantly by autonomic neural activity rather than other, non-neural factors.
International Nuclear Information System (INIS)
Wu, Shijia; Li, Qi; Duan, Nuo; Wang, Zhouping; Ma, Haile
2016-01-01
Microcystin-RR (MC-RR) is a highly acute hepatotoxin produced by cyanobacteria. It is harmful to both humans and the environment. A novel aptamer was identified by the systemic evolution of ligands by exponential enrichment (SELEX) method as a recognition element for determination of MC-RR in aquatic products. The graphene oxide (GO) SELEX strategy was adopted to generate aptamers with high affinity and specificity. Of the 50 aptamer candidates tested, sequence RR-33 was found to display high affinity and selectivity, with a dissociation constant of 45.7 ± 6.8 nM. Aptamer RR-33 therefore was used as the recognition element in a fluorometric assay that proceeds as follows: (1) Biotinylated aptamer RR-33 is immobilized on the streptavidinylated wells of a microtiterplate, and carboxyfluorescein (FAM) labelled complementary DNA is then allowed to hybridize. (2) After removal of excess (unbound) cDNA, sample containing MC-RR is added and incubated at 37 °C for 2 h. (3) Displaced free cDNA is washed away and fluorescence intensity measured at excitation/emission wavelengths of 490/515 nm. The calibration plot is linear in the 0.20 to 2.5 ng·mL −1 concentration range, and the limit of detection is 80 pg·mL −1 . The results indicate that the GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins. The detection scheme was applied to the determination of MC-RR in (spiked) water, mussel and fish and gave recoveries between 91 and 98 %. The method compares favorably to a known ELISA. Conceivably, this kind of assay is applicable to other toxins for which appropriate aptamers are available. (author)
Ridge Regression and Other Kernels for Genomic Selection with R Package rrBLUP
Directory of Open Access Journals (Sweden)
Jeffrey B. Endelman
2011-11-01
Full Text Available Many important traits in plant breeding are polygenic and therefore recalcitrant to traditional marker-assisted selection. Genomic selection addresses this complexity by including all markers in the prediction model. A key method for the genomic prediction of breeding values is ridge regression (RR, which is equivalent to best linear unbiased prediction (BLUP when the genetic covariance between lines is proportional to their similarity in genotype space. This additive model can be broadened to include epistatic effects by using other kernels, such as the Gaussian, which represent inner products in a complex feature space. To facilitate the use of RR and nonadditive kernels in plant breeding, a new software package for R called rrBLUP has been developed. At its core is a fast maximum-likelihood algorithm for mixed models with a single variance component besides the residual error, which allows for efficient prediction with unreplicated training data. Use of the rrBLUP software is demonstrated through several examples, including the identification of optimal crosses based on superior progeny value. In cross-validation tests, the prediction accuracy with nonadditive kernels was significantly higher than RR for wheat ( L. grain yield but equivalent for several maize ( L. traits.
Adipose tissue (P)RR regulates insulin sensitivity, fat mass and body weight.
Shamansurova, Zulaykho; Tan, Paul; Ahmed, Basma; Pepin, Emilie; Seda, Ondrej; Lavoie, Julie L
2016-10-01
We previously demonstrated that the handle-region peptide, a prorenin/renin receptor [(P)RR] blocker, reduces body weight and fat mass and may improve insulin sensitivity in high-fat fed mice. We hypothesized that knocking out the adipose tissue (P)RR gene would prevent weight gain and insulin resistance. An adipose tissue-specific (P)RR knockout (KO) mouse was created by Cre-loxP technology using AP2-Cre recombinase mice. Because the (P)RR gene is located on the X chromosome, hemizygous males were complete KO and had a more pronounced phenotype on a normal diet (ND) diet compared to heterozygous KO females. Therefore, we challenged the female mice with a high-fat diet (HFD) to uncover certain phenotypes. Mice were maintained on either diet for 9 weeks. KO mice had lower body weights compared to wild-types (WT). Only hemizygous male KO mice presented with lower total fat mass, higher total lean mass as well as smaller adipocytes compared to WT mice. Although food intake was similar between genotypes, locomotor activity during the active period was increased in both male and female KO mice. Interestingly, only male KO mice had increased O2 consumption and CO2 production during the entire 24-hour period, suggesting an increased basal metabolic rate. Although glycemia during a glucose tolerance test was similar, KO males as well as HFD-fed females had lower plasma insulin and C-peptide levels compared to WT mice, suggesting improved insulin sensitivity. Remarkably, all KO animals exhibited higher circulating adiponectin levels, suggesting that this phenotype can occur even in the absence of a significant reduction in adipose tissue weight, as observed in females and, thus, may be a specific effect related to the (P)RR. (P)RR may be an important therapeutic target for the treatment of obesity and its associated complications such as type 2 diabetes.
International Nuclear Information System (INIS)
Beck, H.G.E.
1979-01-01
A model is presented for the 1/f noise in ion-implanted resistors. The resistance was changed by a reverse bias voltage. The model explains the experimentally found square dependence between the relative 1/f noise intensity C/C 0 and the relative change in resistance R/R 0 . (author)
DISTANCE SCALE ZERO POINTS FROM GALACTIC RR LYRAE STAR PARALLAXES
Energy Technology Data Exchange (ETDEWEB)
Benedict, G. Fritz; McArthur, Barbara E.; Barnes, Thomas G. [McDonald Observatory, University of Texas, Austin, TX 78712 (United States); Feast, Michael W. [Centre for Astrophysics, Cosmology and Gravitation, Astronomy Department, University of Cape Town, Rondebosch 7701 (South Africa); Harrison, Thomas E. [Department of Astronomy, New Mexico State University, Las Cruces, NM 88003 (United States); Bean, Jacob L.; Kolenberg, Katrien [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Menzies, John W.; Laney, C. D. [South African Astronomical Observatory, Observatory 7935 (South Africa); Chaboyer, Brian [Department of Physics and Astronomy, Dartmouth College, Hanover, NH 03755 (United States); Fossati, Luca [Department of Physics and Astronomy, Open University, Milton Keynes MK7 6AA (United Kingdom); Nesvacil, Nicole [Institute of Astronomy, University of Vienna, A-1180 Vienna (Austria); Smith, Horace A. [Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824 (United States); Kochukhov, Oleg [Department of Physics and Astronomy, Uppsala University, 75120 Uppsala (Sweden); Nelan, Edmund P.; Taylor, Denise [STScI, Baltimore, MD 21218 (United States); Shulyak, D. V. [Institute of Astrophysics, Georg-August-University, Friedrich-Hund-Platz 1, D-37077 Goettingen (Germany); Freedman, Wendy L. [The Observatories, Carnegie Institution of Washington, Pasadena, CA 91101 (United States)
2011-12-15
We present new absolute trigonometric parallaxes and proper motions for seven Population II variable stars-five RR Lyr variables: RZ Cep, XZ Cyg, SU Dra, RR Lyr, and UV Oct; and two type 2 Cepheids: VY Pyx and {kappa} Pav. We obtained these results with astrometric data from Fine Guidance Sensors, white-light interferometers on Hubble Space Telescope. We find absolute parallaxes in milliseconds of arc: RZ Cep, 2.12 {+-} 0.16 mas; XZ Cyg, 1.67 {+-} 0.17 mas; SU Dra, 1.42 {+-} 0.16 mas; RR Lyr, 3.77 {+-} 0.13 mas; UV Oct, 1.71 {+-} 0.10 mas; VY Pyx, 6.44 {+-} 0.23 mas; and {kappa} Pav, 5.57 {+-} 0.28 mas; an average {sigma}{sub {pi}}/{pi} = 5.4%. With these parallaxes, we compute absolute magnitudes in V and K bandpasses corrected for interstellar extinction and Lutz-Kelker-Hanson bias. Using these RR Lyrae variable star absolute magnitudes, we then derive zero points for M{sub V} -[Fe/H] and M{sub K} -[Fe/H]-log P relations. The technique of reduced parallaxes corroborates these results. We employ our new results to determine distances and ages of several Galactic globular clusters and the distance of the Large Magellanic Cloud. The latter is close to that previously derived from Classical Cepheids uncorrected for any metallicity effect, indicating that any such effect is small. We also discuss the somewhat puzzling results obtained for our two type 2 Cepheids.
Directory of Open Access Journals (Sweden)
FIGUEIREDO Luiz Tadeu Moraes
1997-01-01
Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination
Nonlinear Convective Models of RR Lyrae Stars
Feuchtinger, M.; Dorfi, E. A.
The nonlinear behavior of RR Lyrae pulsations is investigated using a state-of-the-art numerical technique solving the full time-dependent system of radiation hydrodynamics. Grey radiative transfer is included by a variable Eddington-factor method and we use the time-dependent turbulent convection model according to Kuhfuss (1986, A&A 160, 116) in the version of Wuchterl (1995, Comp. Phys. Comm. 89, 19). OPAL opacities extended by the Alexander molecule opacities at temperatures below 6000 K and an equation of state according to Wuchterl (1990, A&A 238, 83) close the system. The resulting nonlinear system is discretized on an adaptive mesh developed by Dorfi & Drury (1987, J. Comp. Phys. 69, 175), which is important to provide the necessary spatial resolution in critical regions like ionization zones and shock waves. Additionally, we employ a second order advection scheme, a time centered temporal discretizaton and an artificial tensor viscosity in order to treat discontinuities. We compute fundamental as well first overtone models of RR Lyrae stars for a grid of stellar parameters both with and without convective energy transport in order to give a detailed picture of the pulsation-convection interaction. In order to investigate the influence of the different features of the convection model calculations with and without overshooting, turbulent pressure and turbulent viscosity are performed and compared with each other. A standard Fourier decomposition is used to confront the resulting light and radial velocity variations with recent observations and we show that the well known RR Lyrae phase discrepancy problem (Simon 1985, ApJ 299, 723) can be resolved with these stellar pulsation computations.
Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels
2011-12-01
Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.
DEFF Research Database (Denmark)
Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte
2012-01-01
To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...
The suppression of radiation reaction and laser field depletion in laser-electron beam interaction
Ong, J. F.; Moritaka, T.; Takabe, H.
2018-03-01
The effects of radiation reaction (RR) have been studied extensively by using the interaction of ultraintense lasers with a counter-propagating relativistic electron. At the laser intensity at the order of 1023 W/cm2, the effects of RR are significant in a few laser periods for a relativistic electron. However, a laser at such intensity is tightly focused and the laser energy is usually assumed to be fixed. Then, the signal of RR and energy conservation cannot be guaranteed. To assess the effects of RR in a tightly focused laser pulse and the evolution of the laser energy, we simulated this interaction with a beam of 109 electrons by means of a Particle-In-Cell method. We observe that the effects of RR are suppressed due to the ponderomotive force and accompanied by a non-negligible amount of laser field energy reduction. This is because the ponderomotive force prevents the electrons from approaching the center of the laser pulse and leads to an interaction at the weaker field region. At the same time, the laser energy is absorbed through ponderomotive acceleration. Thus, the kinetic energy of the electron beam has to be carefully selected such that the effects of RR become obvious.
The VMC survey - XXVI. Structure of the Small Magellanic Cloud from RR Lyrae stars
Muraveva, T.; Subramanian, S.; Clementini, G.; Cioni, M.-R. L.; Palmer, M.; van Loon, J. Th.; Moretti, M. I.; de Grijs, R.; Molinaro, R.; Ripepi, V.; Marconi, M.; Emerson, J.; Ivanov, V. D.
2018-01-01
We present results from the analysis of 2997 fundamental mode RR Lyrae variables located in the Small Magellanic Cloud (SMC). For these objects, near-infrared time series photometry from the VISTA survey of the Magellanic Clouds system (VMC) and visual light curves from the OGLE IV (Optical Gravitational Lensing Experiment IV) survey are available. In this study, the multi-epoch Ks-band VMC photometry was used for the first time to derive intensity-averaged magnitudes of the SMC RR Lyrae stars. We determined individual distances to the RR Lyrae stars from the near-infrared period-absolute magnitude-metallicity (PM_{K_s}Z) relation, which has some advantages in comparison with the visual absolute magnitude-metallicity (MV-[Fe/H]) relation, such as a smaller dependence of the luminosity on interstellar extinction, evolutionary effects and metallicity. The distances we have obtained were used to study the three-dimensional structure of the SMC. The distribution of the SMC RR Lyrae stars is found to be ellipsoidal. The actual line-of-sight depth of the SMC is in the range 1-10 kpc, with an average depth of 4.3 ± 1.0 kpc. We found that RR Lyrae stars in the eastern part of the SMC are affected by interactions of the Magellanic Clouds. However, we do not see a clear bimodality observed for red clump stars, in the distribution of RR Lyrae stars.
First Kepler Results on RR Lyrae Stars
DEFF Research Database (Denmark)
Kolenberg, K.; Szabó, R.; Kurtz, D. W.
2010-01-01
We present the first results of our analyses of selected RR Lyrae stars for which data have been obtained by the Kepler Mission. As expected, we find a significant fraction of the RRab stars to show the Blazhko effect, a still unexplained phenomenon that manifests itself as periodic amplitude and...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Energy Technology Data Exchange (ETDEWEB)
Dagle, Robert A.; Platon, Alexandru; Datye, Abhaya K.; Vohs, John M.; Wang, Yong; Palo, Daniel R.
2008-03-07
Pd/ZnO/Al2O3 catalysts were studied for water-gas-shift (WGS), methanol steam reforming, and reverse-water-gas-shift (RWGS) reactions. WGS activity was found to be dependent on the Pd:Zn ratio with a maximum activity obtained at approximately 0.50, which was comparable to that of a commercial Pt-based catalyst. The catalyst stability was demonstrated for 100 hours time-on-stream at a temperature of 3600C without evidence of metal sintering. WGS reaction rates were approximately 1st order with respect to CO concentration, and kinetic parameters were determined to be Ea = 58.3 kJ mol-1 and k0 = 6.1x107 min-1. During methanol steam reforming, the CO selectivities were observed to be lower than the calculated equilibrium values over a range of temperatures and steam/carbon ratios studied while the reaction rate constants were approximately of the same magnitude for both WGS and methanol steam reforming. These results indicate that although Pd/ZnO/Al2O3 are active WGS catalysts, WGS is not involved in methanol steam reforming. RWGS rate constants are on the order of about 20 times lower than that of methanol steam reforming, suggesting that RWGS reaction could be one of the sources for small amount of CO formation in methanol steam reforming.
Characterization of ion implanted silicon by the electrolytic reverse current
International Nuclear Information System (INIS)
Hueller, J.; Pham, M.T.
1977-01-01
The current voltage behaviour of ion implanted silicon electrodes in HF electrolyte is investigated. The electrolytic reverse current, i.e. the reaction rate of the minority carrier limited reactions is found to increase. The current increase depends on the implanted dose and layer stripping. Reason for the increased reverse current can be referred to radiation damage acting as generation centres for minority carriers. Measurement of the electrolytic reverse current can be used for determining damage profiles. Layer stripping is carried out by anodic dissolution in the same electrolyte. The sensitivity of this new method for characterizing ion implanted silicon layers lies at 10 11 to 10 12 atoms/cm 2 . (author)
Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate
Gris,Cristiane Fortes; Pinho,Edila Vilela de Resende Von; Carvalho,Maria Laene de Moreira; Diniz,Rafael Parreira; Andrade,Thaís de
2013-01-01
Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the muni...
Characterization of the VVV Survey RR Lyrae Population across the Southern Galactic Plane
International Nuclear Information System (INIS)
Minniti, Dante; Palma, Tali; Pullen, Joyce; Tissera, Patricia; Dékány, Istvan; Majaess, Daniel; Rejkuba, Marina; Valenti, Elena; Alonso-García, Javier; Catelan, Marcio; Contreras Ramos, Rodrigo; Zoccali, Manuela; Gonzalez, Oscar A.; Hempel, Maren; Irwin, Mike; Lucas, Philip W.; Saito, Roberto K.
2017-01-01
Deep near-IR images from the VISTA Variables in the Vía Láctea (VVV) Survey were used to search for RR Lyrae stars in the Southern Galactic plane. A sizable sample of 404 RR Lyrae of type ab stars was identified across a thin slice of the fourth Galactic quadrant (295° < ℓ < 350°, −2.°24 < b < −1.°05). The sample’s distance distribution exhibits a maximum density that occurs at the bulge tangent point, which implies that this primarily Oosterhoff type I population of RRab stars does not trace the bar delineated by their red clump counterparts. The bulge RR Lyrae population does not extend beyond ℓ ∼ 340°, and the sample’s spatial distribution presents evidence of density enhancements and substructure that warrants further investigation. Indeed, the sample may be employed to evaluate Galactic evolution models, and is particularly lucrative since half of the discovered RR Lyrae are within reach of Gaia astrometric observations.
Characterization of the VVV Survey RR Lyrae Population across the Southern Galactic Plane
Energy Technology Data Exchange (ETDEWEB)
Minniti, Dante; Palma, Tali; Pullen, Joyce; Tissera, Patricia [Departamento de Ciencias Físicas, Facultad de Ciencias Exactas, Universidad Andrés Bello, Av. Fernández Concha 700, Las Condes, Santiago (Chile); Dékány, Istvan [Astronomisches Rechen-Institut, Zentrum fuer Astronomie der Universitaet Heidelberg, Moenchhofstr. 12-14, D-69120 Heidelberg (Germany); Majaess, Daniel [Mount Saint Vincent University, Halifax, Nova Scotia (Canada); Rejkuba, Marina; Valenti, Elena [European Southern Observatory, Karl-Schwarszchild-Str. 2, D-85748 Garching bei Muenchen (Germany); Alonso-García, Javier; Catelan, Marcio; Contreras Ramos, Rodrigo; Zoccali, Manuela [Instituto Milenio de Astrofísica, Santiago (Chile); Gonzalez, Oscar A. [Institute for Astronomy, University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom); Hempel, Maren [Pontificia Universidad Católica de Chile, Instituto de Astrofisica, Av. Vicuna Mackenna 4860, Santiago (Chile); Irwin, Mike [Institute of Astronomy, Cambridge University, Cambridge, CB3 0HA (United Kingdom); Lucas, Philip W. [Department of Astronomy, University of Hertfordshire, Hertfordshire (United Kingdom); Saito, Roberto K. [Departamento de Física, Universidade Federal de Santa Catarina, Trindade 88040-900, Florianópolis, SC (Brazil)
2017-04-01
Deep near-IR images from the VISTA Variables in the Vía Láctea (VVV) Survey were used to search for RR Lyrae stars in the Southern Galactic plane. A sizable sample of 404 RR Lyrae of type ab stars was identified across a thin slice of the fourth Galactic quadrant (295° < ℓ < 350°, −2.°24 < b < −1.°05). The sample’s distance distribution exhibits a maximum density that occurs at the bulge tangent point, which implies that this primarily Oosterhoff type I population of RRab stars does not trace the bar delineated by their red clump counterparts. The bulge RR Lyrae population does not extend beyond ℓ ∼ 340°, and the sample’s spatial distribution presents evidence of density enhancements and substructure that warrants further investigation. Indeed, the sample may be employed to evaluate Galactic evolution models, and is particularly lucrative since half of the discovered RR Lyrae are within reach of Gaia astrometric observations.
Genetic divergence of roundup ready (RR) soybean cultivars ...
African Journals Online (AJOL)
The aim of this study was to estimate the genetic diversity in 74 RR soybean cultivars from different Brazilian breeding programs. ... chosen SSR markers were effective in assessing the genetic diversity among genotypes, besides proving to be ...
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
Pan, Yunping; Zhang, Fangfang; Liu, Ru; Jing, Yan; Shen, Jihong; Li, Zhongjian; Zhu, Huaijie
2014-06-01
To explore the characteristics of RR-Lorenz plot in persistent atrial fibrillation (AF) patients complicating with escape beats and rhythm though ambulatory electrocardiogram. The 24-hour ambulatory electrocardiogram of 291 persistent AF patients in second affiliated hospital of Zhengzhou university from July 2005 to April 2013 were retrospectively analyzed and the RR interval and the QRS wave were measured. Patients were divided into two groups according to the distribution of the RR-Lorenz point [AF without escape beats and rhythm group (Group A, n = 259) and AF with escape beats and rhythm group (Group B, n = 32)]. The characteristics of RR-Lorenz plot between the two groups were compared. (1) Fan-shaped RR-Lorenz plots were evidenced in Group A. (2)In Group B, 30 cases showed fan-shaped with L-shaped and a short dense rods along 45° line. The proportion of escape beats and rhythm was 0.28% (275/98 369) -14.06% (11 263/80 112) . The other 2 cases in group B showed no typical RR-Lorenz plots features. RR-Lorenz plot could help to quickly diagnose persistent AF complicating with escape beats and rhythm according to the typical RR-Lorenz plot characteristics in 24-hour ambulatory electrocardiogram.
A HIGH-VELOCITY BULGE RR LYRAE VARIABLE ON A HALO-LIKE ORBIT
International Nuclear Information System (INIS)
Kunder, Andrea; Storm, J.; Rich, R. M.; Hawkins, K.; Poleski, R.; Johnson, C. I.; Shen, J.; Li, Z.-Y.; Cordero, M. J.; Nataf, D. M.; Bono, G.; Walker, A. R.; Koch, A.; De Propris, R.; Udalski, A.; Szymanski, M. K.; Soszynski, I.; Pietrzynski, G.; Ulaczyk, K.; Wyrzykowski, Ł.
2015-01-01
We report on the RR Lyrae variable star, MACHO 176.18833.411, located toward the Galactic bulge and observed within the data from the ongoing Bulge RR Lyrae Radial Velocity Assay, which has the unusual radial velocity of −372 ± 8 km s −1 and true space velocity of −482 ± 22 km s −1 relative to the Galactic rest frame. Located less than 1 kpc from the Galactic center and toward a field at (l, b) = (3, −2.5), this pulsating star has properties suggesting it belongs to the bulge RR Lyrae star population, yet a velocity indicating it is abnormal, at least with respect to bulge giants and red clump stars. We show that this star is most likely a halo interloper and therefore suggest that halo contamination is not insignificant when studying metal-poor stars found within the bulge area, even for stars within 1 kpc of the Galactic center. We discuss the possibility that MACHO 176.18833.411 is on the extreme edge of the bulge RR Lyrae radial velocity distribution, and also consider a more exotic scenario in which it is a runaway star moving through the Galaxy
The globular cluster ω Centauri and its RR Lyrae variables
International Nuclear Information System (INIS)
Dickens, R.J.
1989-07-01
The significance of some of the unusual characteristics of the globular cluster ωCentauri in various fundamental problems is explored. Interest is centred on the properties of the cluster RR Lyraes, and what they can contribute to studies of early cluster chemical enrichment, stellar pulsation, the distance scale, stellar evolution, stellar ages and the Oosterhoff period-shift problem. This article, which is intended to highlight problems and progress rather than give a comprehensive review, includes new results based on photometry of the RR Lyraes, red giants, subgiants, horizontal-branch and main sequence stars in the cluster. (author)
Spectrophotometry of RR Telescopii
International Nuclear Information System (INIS)
Walker, A.R.
1977-01-01
The strongest emission lines in the nova-like variable RR Telescopii were measured during late 1974 using a spectrum scanner. The wavelength range 3350 to 7700 A was scanned with a resolution of 50 A. The results are compared with published spectrophotometry covering the period 1961 to 72, with the conclusion that few changes have taken place in the last 6 yr. No evidence was found that suggested the existence of a cool star, nor was there any indication of night-to-night changes in the emission line intensities. The spectrophotometry of the past 15 yr is consistent with an expanding shell, the emission from this shell being caused by high-energy radiation from an underlying star. (author)
RR LYRAE ATMOSPHERICS: WRINKLES OLD AND NEW. A PREVIEW
International Nuclear Information System (INIS)
Preston, George W.
2011-01-01
I report some results of an echelle spectroscopic survey of RR Lyrae stars begun in 2006 that I presented in my Henry Norris Lecture of 2010 January 4. Topics include (1) atmospheric velocity gradients, (2) phase-dependent envelope turbulence as it relates to Peterson's discoveries of axial rotation on the horizontal branch and to Stothers' explanation of the Blazhko effect, (3) the three apparitions of hydrogen emission during a pulsation cycle, (4) the occurrence of He I lines in emission and absorption, (5) detection of He II emission and metallic line doubling in Blazhko stars, and finally (6) speculation about what helium observations of RR Lyrae stars in omega Centauri might tell us about the putative helium populations and the horizontal branch of that strange globular cluster.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Directory of Open Access Journals (Sweden)
Ji Yeon Kwon
2013-09-01
Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.
Huang, Wenmin; Li, Dunhai; Liu, Yongding
2014-09-01
Microcystin-RR (MC-RR) has been suggested to induce apoptosis in tobacco BY-2 cells through mitochondrial dysfunction including the loss of mitochondrial membrane potential (ΔΨm). To further elucidate the mechanisms involved in MC-RR induced apoptosis in tobacco BY-2 cells, we have investigated the role of mitochondrial electron transport chain (ETC) as a potential source for reactive oxygen species (ROS). Tobacco BY-2 cells after exposure to MC-RR (60mg/L) displayed apoptotic changes in association with an increased production of ROS and loss of ΔΨm. All of these adverse effects were significantly attenuated by ETC inhibitors including Rotenone (2μmol/L, complex I inhibitor) and antimycin A (0.01μmol/L, complex III inhibitor), but not by thenoyltrifluoroacetone (5μmol/L, complex II inhibitor). These results suggest that mitochondrial ETC plays a key role in mediating MC-RR induced apoptosis in tobacco BY-2 cells through an increased mitochondrial production of ROS. Copyright © 2014. Published by Elsevier B.V.
QT-RR relationships and suitable QT correction formulas for halothane-anesthetized dogs.
Tabo, Mitsuyasu; Nakamura, Mikiko; Kimura, Kazuya; Ito, Shigeo
2006-10-01
Several QT correction (QTc) formulas have been used for assessing the QT liability of drugs. However, they are known to under- and over-correct the QT interval and tend to be specific to species and experimental conditions. The purpose of this study was to determine a suitable formula for halothane-anesthetized dogs highly sensitive to drug-induced QT interval prolongation. Twenty dogs were anesthetized with 1.5% halothane and the relationship between the QT and RR intervals were obtained by changing the heart rate under atrial pacing conditions. The QT interval was corrected for the RR interval by applying 4 published formulas (Bazett, Fridericia, Van de Water, and Matsunaga); Fridericia's formula (QTcF = QT/RR(0.33)) showed the least slope and lowest R(2) value for the linear regression of QTc intervals against RR intervals, indicating that it dissociated changes in heart rate most effectively. An optimized formula (QTcX = QT/RR(0.3879)) is defined by analysis of covariance and represents a correction algorithm superior to Fridericia's formula. For both Fridericia's and the optimized formula, QT-prolonging drugs (d,l-sotalol, astemizole) showed QTc interval prolongation. A non-QT-prolonging drug (d,l-propranolol) failed to prolong the QTc interval. In addition, drug-induced changes in QTcF and QTcX intervals were highly correlated with those of the QT interval paced at a cycle length of 500 msec. These findings suggest that Fridericia's and the optimized formula, although the optimized is a little bit better, are suitable for correcting the QT interval in halothane-anesthetized dogs and help to evaluate the potential QT prolongation of drugs with high accuracy.
A HIGH-VELOCITY BULGE RR LYRAE VARIABLE ON A HALO-LIKE ORBIT
Energy Technology Data Exchange (ETDEWEB)
Kunder, Andrea; Storm, J. [Leibniz-Institut für Astrophysik Potsdam (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Rich, R. M. [Department of Physics and Astronomy, University of California at Los Angeles, Los Angeles, CA 90095-1562 (United States); Hawkins, K. [Institute of Astronomy, Madingley Road, Cambridge CB3 0HA (United Kingdom); Poleski, R. [Department of Astronomy, Ohio State University, 140 W. 18th Avenue, Columbus, OH 43210 (United States); Johnson, C. I. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Shen, J.; Li, Z.-Y. [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China); Cordero, M. J. [Astronomisches Rechen-Institut: Zentrum für Astronomie, Mönchhofstr. 12-14, D-69120 Heidelberg (Germany); Nataf, D. M. [Research School of Astronomy and Astrophysics, The Australian National University, Canberra, ACT 2611 (Australia); Bono, G. [Dipartimento di Fisica, Universita di Roma Tor Vergata, Via della Ricerca Scientifica 1, I-00133 Roma (Italy); Walker, A. R. [Cerro Tololo Inter-American Observatory, National Optical Astronomy Observatory, Casilla 603, La Serena (Chile); Koch, A. [Landessternwarte, Zentrum für Astronomie der Universität Heidelberg, Königstuhl 12, D-69117 Heidelberg (Germany); De Propris, R. [Finnish Centre for Astronomy with ESO (FINCA), University of Turku, Turku (Finland); Udalski, A.; Szymanski, M. K.; Soszynski, I.; Pietrzynski, G.; Ulaczyk, K.; Wyrzykowski, Ł. [Warsaw University Observatory, Al. Ujazdowskie 4, 00-478 Warszawa (Poland); and others
2015-07-20
We report on the RR Lyrae variable star, MACHO 176.18833.411, located toward the Galactic bulge and observed within the data from the ongoing Bulge RR Lyrae Radial Velocity Assay, which has the unusual radial velocity of −372 ± 8 km s{sup −1} and true space velocity of −482 ± 22 km s{sup −1} relative to the Galactic rest frame. Located less than 1 kpc from the Galactic center and toward a field at (l, b) = (3, −2.5), this pulsating star has properties suggesting it belongs to the bulge RR Lyrae star population, yet a velocity indicating it is abnormal, at least with respect to bulge giants and red clump stars. We show that this star is most likely a halo interloper and therefore suggest that halo contamination is not insignificant when studying metal-poor stars found within the bulge area, even for stars within 1 kpc of the Galactic center. We discuss the possibility that MACHO 176.18833.411 is on the extreme edge of the bulge RR Lyrae radial velocity distribution, and also consider a more exotic scenario in which it is a runaway star moving through the Galaxy.
Duff, M. J.; Capdessus, R.; Del Sorbo, D.; Ridgers, C. P.; King, M.; McKenna, P.
2018-06-01
The effects of the radiation reaction (RR) force on thin foils undergoing radiation pressure acceleration (RPA) are investigated. Using QED-particle-in-cell simulations, the influence of the RR force on the collective electron dynamics within the target can be examined. The magnitude of the RR force is found to be strongly dependent on the target thickness, leading to effects which can be observed on a macroscopic scale, such as changes to the distribution of the emitted radiation and the target dynamics. This suggests that such parameters may be controlled in experiments at multi-PW laser facilities. In addition, the effects of the RR force are characterized in terms of an average radiation emission angle. We present an analytical model which, for the first time, describes the effect of the RR force on the collective electron dynamics within the ‘light-sail’ regime of RPA. The predictions of this model can be tested in future experiments with ultra-high intensity lasers interacting with solid targets.
The effect of Livermore OPAL opacities on the evolutionary masses of RR Lyrae stars
Yi, Sukyoung; Lee, Young-Wook; Demarque, Pierre
1993-01-01
We have investigated the effect of the new Livermore OPAL opacities on the evolution of horizontal-branch (HB) stars. This work was motivated by the recent stellar pulsation calculations using the new Livermore opacities, which suggest that the masses of double-mode RR Lyrae stars are 0.1-0.2 solar mass larger than those based on earlier opacities. Unlike the pulsation calculations, we find that the effect of opacity change on the evolution of HB stars is not significant. In particular, the effect of the mean masses of RR Lyrae stars is very small, showing a decrease of only 0.01-0.02 solar mass compared to the models based on old Cox-Stewart opacities. Consequently, with the new Livermore OPAL opacities, both the stellar pulsation and evolution models now predict approximately the same masses for the RR Lyrae stars. Our evolutionary models suggest that the mean masses of the RR Lyrae stars are about 0.76 and about 0.71 solar mass for M15 (Oosterhoff group II) and M3 (group I), respectively. If (alpha/Fe) = 0.4, these values are decreased by about 0.03 solar mass. Variations of the mean masses of RR Lyrae stars with HB morphology and metallicity are also presented.
Carbon and oxygen abundances of field RR Lyrae stars. I. Carbon abundances
International Nuclear Information System (INIS)
Butler, D.; Manduca, A.; Deming, D.; Bell, R.A.
1982-01-01
From an analysis of KPNO 4-m echelle plates and simultaneous uvbyβ photometry, we have determined carbon abundances and carbon-to-iron ratios for a large number of field RR Lyrae stars having [Fe/H]> or approx. =-1.2. It is found that these field RR Lyrae stars: stars which are known to be in an advanced evolutionary state: have carbon-to-iron ratios which are similar to those of unevolved stars
Characterization of excited-state reactions with instant spectra of fluorescence kinetics
International Nuclear Information System (INIS)
Tomin, Vladimir I.; Ushakou, Dzmitryi V.
2015-01-01
Comprehensible knowledge of the excited-state proton transfer processes in organic compounds is overwhelmingly important not only for physics, but also chemistry and Life Sciences, since they play a key role in main processes of photosynthesis and functioning of biological organisms. Moreover compounds with Excited-State Intramolecular Proton Transfer (ESIPT) are in the focus of the interest of scientists throughout the world, because dual fluorescence spectra of such objects corresponding to two forms of molecular structure (normal and photoproduct) are very sensitive to characteristics of molecular microenvironment. This property allows to use such substances as fluorescent probes for diverse applications in chemistry and Life Sciences. But at the same time studying of proton transfer processes is not simple, because this process is characterized by extremely fast times (on picoseconds time scale and less order) and very often contribution of reverse reactions is essentially complicates an interpretation of observed properties of dual fluorescence. Hence, understanding of a role of reversible reactions is crucial for a comprehensive description of all processes accompanying excited state reactions. We discuss new approach for treatment ESIPT reaction on the basis of experimentally measured instant spectra of dual fluorescence and temporal behavior of ratiometric signal of normal to tautomer form intensities. Simple analytical expressions show in transparent way how to distinguish a degree of reverse reaction contribution to ratiometric signal. A validation of the approach under consideration is fulfilled with two different flavonols – 3-hydroxyflavone and 4′-(Dimethylamino)-3-hydroxyflavone – representing two extreme cases in affecting reversible reaction on dual emission. A comparing of new approach and traditional method when we analyze kinetics of separate the N* and T* fluorescence bands decays, has been carried out. - Highlights: • The excited
Characterization of excited-state reactions with instant spectra of fluorescence kinetics
Energy Technology Data Exchange (ETDEWEB)
Tomin, Vladimir I., E-mail: tomin@apsl.edu.pl; Ushakou, Dzmitryi V.
2015-10-15
Comprehensible knowledge of the excited-state proton transfer processes in organic compounds is overwhelmingly important not only for physics, but also chemistry and Life Sciences, since they play a key role in main processes of photosynthesis and functioning of biological organisms. Moreover compounds with Excited-State Intramolecular Proton Transfer (ESIPT) are in the focus of the interest of scientists throughout the world, because dual fluorescence spectra of such objects corresponding to two forms of molecular structure (normal and photoproduct) are very sensitive to characteristics of molecular microenvironment. This property allows to use such substances as fluorescent probes for diverse applications in chemistry and Life Sciences. But at the same time studying of proton transfer processes is not simple, because this process is characterized by extremely fast times (on picoseconds time scale and less order) and very often contribution of reverse reactions is essentially complicates an interpretation of observed properties of dual fluorescence. Hence, understanding of a role of reversible reactions is crucial for a comprehensive description of all processes accompanying excited state reactions. We discuss new approach for treatment ESIPT reaction on the basis of experimentally measured instant spectra of dual fluorescence and temporal behavior of ratiometric signal of normal to tautomer form intensities. Simple analytical expressions show in transparent way how to distinguish a degree of reverse reaction contribution to ratiometric signal. A validation of the approach under consideration is fulfilled with two different flavonols – 3-hydroxyflavone and 4′-(Dimethylamino)-3-hydroxyflavone – representing two extreme cases in affecting reversible reaction on dual emission. A comparing of new approach and traditional method when we analyze kinetics of separate the N* and T* fluorescence bands decays, has been carried out. - Highlights: • The excited
Directory of Open Access Journals (Sweden)
He Ningjia
2008-01-01
Full Text Available Abstract Background The most abundant family of insect cuticular proteins, the CPR family, is recognized by the R&R Consensus, a domain of about 64 amino acids that binds to chitin and is present throughout arthropods. Several species have now been shown to have more than 100 CPR genes, inviting speculation as to the functional importance of this large number and diversity. Results We have identified 156 genes in Anopheles gambiae that code for putative cuticular proteins in this CPR family, over 1% of the total number of predicted genes in this species. Annotation was verified using several criteria including identification of TATA boxes, INRs, and DPEs plus support from proteomic and gene expression analyses. Two previously recognized CPR classes, RR-1 and RR-2, form separate, well-supported clades with the exception of a small set of genes with long branches whose relationships are poorly resolved. Several of these outliers have clear orthologs in other species. Although both clades are under purifying selection, the RR-1 variant of the R&R Consensus is evolving at twice the rate of the RR-2 variant and is structurally more labile. In contrast, the regions flanking the R&R Consensus have diversified in amino-acid composition to a much greater extent in RR-2 genes compared with RR-1 genes. Many genes are found in compact tandem arrays that may include similar or dissimilar genes but always include just one of the two classes. Tandem arrays of RR-2 genes frequently contain subsets of genes coding for highly similar proteins (sequence clusters. Properties of the proteins indicated that each cluster may serve a distinct function in the cuticle. Conclusion The complete annotation of this large gene family provides insight on the mechanisms of gene family evolution and clues about the need for so many CPR genes. These data also should assist annotation of other Anopheles genes.
Rajic, Ljiljana; Fallahpour, Noushin; Yuan, Songhu; Alshawabkeh, Akram N
2014-12-15
Electrode polarity reversal is evaluated for electrochemical transformation of trichloroethylene (TCE) in aqueous solution using flow-through reactors with mixed metal oxide electrodes and Pd catalyst. The study tests the hypothesis that optimizing electrode polarity reversal will generate H2O2 in Pd presence in the system. The effect of polarity reversal frequency, duration of the polarity reversal intervals, current intensity and TCE concentration on TCE removal rate and removal mechanism were evaluated. TCE removal efficiencies under 6 cycles h(-1) were similar in the presence of Pd catalyst (50.3%) and without Pd catalyst (49.8%), indicating that Pd has limited impact on TCE degradation under these conditions. The overall removal efficacies after 60 min treatment under polarity reversal frequencies of 6, 10, 15, 30 and 90 cycles h(-1) were 50.3%, 56.3%, 69.3%, 34.7% and 23.4%, respectively. Increasing the frequency of polarity reversal increases TCE removal as long as sufficient charge is produced during each cycle for the reaction at the electrode. Electrode polarity reversal shifts oxidation/reduction and reduction/oxidation sequences in the system. The optimized polarity reversal frequency (15 cycles h(-1) at 60 mA) enables two reaction zones formation where reduction/oxidation occurs at each electrode surface. Published by Elsevier Ltd.
In Situ Insight into Reversible O2 Gas-Solid Reactions
DEFF Research Database (Denmark)
Wegeberg, Christina
2016-01-01
Non-porous crystalline solids containing a series of cationic tetracobalt complexes reversibly, selectively and stoichiometrically chemisorb dioxygen in temperature/O2 partial pressure induced processes involving the oxidation of cobalt with concurrent reduction of two equivalents of sorbed O2 to...
Dual kinetic curves in reversible electrochemical systems.
Directory of Open Access Journals (Sweden)
Michael J Hankins
Full Text Available We introduce dual kinetic chronoamperometry, in which reciprocal relations are established between the kinetic curves of electrochemical reactions that start from symmetrical initial conditions. We have performed numerical and experimental studies in which the kinetic curves of the electron-transfer processes are analyzed for a reversible first order reaction. Experimental tests were done with the ferrocyanide/ferricyanide system in which the concentrations of each component could be measured separately using the platinum disk/gold ring electrode. It is shown that the proper ratio of the transient kinetic curves obtained from cathodic and anodic mass transfer limited regions give thermodynamic time invariances related to the reaction quotient of the bulk concentrations. Therefore, thermodynamic time invariances can be observed at any time using the dual kinetic curves for reversible reactions. The technique provides a unique possibility to extract the non-steady state trajectory starting from one initial condition based only on the equilibrium constant and the trajectory which starts from the symmetrical initial condition. The results could impact battery technology by predicting the concentrations and currents of the underlying non-steady state processes in a wide domain from thermodynamic principles and limited kinetic information.
Directory of Open Access Journals (Sweden)
Michael James Lewis
2013-05-01
Full Text Available Multifractal properties of electrocardiographic inter-beat (RR time-series offer insight into its long-term correlation structure, independently of RR variability. Here we quantify multifractal characteristics of RR data during 24-hour diurnal-nocturnal activity in healthy participants. We tested the hypotheses that (1 age, gender and aerobic fitness influence RR multifractal properties, and that (2 these are influenced by circadian variation.Seventy adults (39 males aged 19-58 years and of various fitness levels were monitored using 24-hour ECG. Participants were dichotomised by median age and fitness for sub-group analysis. Gender and fitness were independent of age (p=0.1, p>0.5. Younger/older group ages were substantially different (p<0.0005 and were independent of gender and fitness. Multifractality was quantified using the probability spectrum of Hölder exponents (h, from which modal h (h* and the full-width and half-widths at half-maximum measures (FWHM, HWHM+ and HWHM- were derived. FWHM decreased (p=0.004 and h* increased (p=0.011 in older people, indicating diminished long-range RR correlations and weaker anti-persistent behavior. Anti-persistent correlation (h* was strongest in the youngest/fittest individuals and weakest in the oldest/least fit individuals (p=0.015. Long-range correlation (HWHM+/FWHM was strongest in the fittest males and weakest in the least fit females (p=0.007-0.033.Multifractal RR characteristics in our healthy participants showed strong age-dependence with diminished long-range anti-persistent correlation in older people. Circadian variation of these characteristics was influenced by fitness and gender: fitter males and females of all ages had the greatest degree of multifractality or long-range order. Multifractal characterisation appears to be a useful method for exploring the physiological basis of long-term correlation structure in RR time-series as well as the benefits thereon of physical fitness training.
Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Cesare Bonacina
2010-01-01
Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.
Analysis of a selected sample of RR Lyrae stars in the LMC from OGLE-III
International Nuclear Information System (INIS)
Chen Bing-Qiu; Jiang Bi-Wei; Yang Ming
2013-01-01
A systematic study of RR Lyrae stars is performed using a selected sample of 655 objects in the Large Magellanic Cloud (LMC) with long-term observations and numerous measurements from the Optical Gravitational Lensing Experiment III project. The phase dispersion method and linear superposition of the harmonic oscillations are used to derive the pulsation frequency and properties of light variation. It is found that a dichotomy exists in Oosterhoff Type I and Oosterhoff Type II for RR Lyrae stars in the LMC. Due to our strict criteria for identifying a frequency, a lower limit for the incidence rate of Blazhko modulation in the LMC is estimated in various subclasses of RR Lyrae stars. For fundamental-mode RR Lyrae stars, the rate of 7.5% is smaller than the previous result. In the case of the first-overtone RR Lyrae variables, the rate of 9.1% is relatively high. In addition to the Blazhko variables, 15 objects are identified to pulsate in the fundamental/first-overtone double mode. Furthermore, four objects show a period ratio around 0.6, which makes them very likely to be rare pulsators in the fundamental/second-overtone double mode. (research papers)
Quantifying fluctuations in reversible enzymatic cycles and clocks
Wierenga, Harmen; ten Wolde, Pieter Rein; Becker, Nils B.
2018-04-01
Biochemical reactions are fundamentally noisy at a molecular scale. This limits the precision of reaction networks, but it also allows fluctuation measurements that may reveal the structure and dynamics of the underlying biochemical network. Here, we study nonequilibrium reaction cycles, such as the mechanochemical cycle of molecular motors, the phosphorylation cycle of circadian clock proteins, or the transition state cycle of enzymes. Fluctuations in such cycles may be measured using either of two classical definitions of the randomness parameter, which we show to be equivalent in general microscopically reversible cycles. We define a stochastic period for reversible cycles and present analytical solutions for its moments. Furthermore, we associate the two forms of the randomness parameter with the thermodynamic uncertainty relation, which sets limits on the timing precision of the cycle in terms of thermodynamic quantities. Our results should prove useful also for the study of temporal fluctuations in more general networks.
Kepler photometry of the prototypical Blazhko star RR Lyr: an old friend seen in a new light
DEFF Research Database (Denmark)
Kolenberg, Katrien; Bryson, S.; Szabó, R.
2011-01-01
We present our analysis of the long-cadence Kepler data for the well-studied Blazhko star RR Lyr, gathered during the first two quarters of the satellite's observations and covering a total of 127 d. Besides being of great importance for our understanding of RR Lyrae stars in general, these RR Lyr...... data can be regarded as a case study for observations of bright stars with Kepler. Kepler can perform high-precision photometry on targets like RR Lyr, as the saturated flux is conserved to a very high degree. The Kepler data on RR Lyr are revolutionary in several respects. Even with long......-cadence sampling (one measurement per 29.4 min), the unprecedented precision (star's extreme light-curve variations in detail. The multiplet structures at the main frequency and its harmonics, typical for Blazhko stars, are clearly detected up...
GAUGE R&R FOR AN OPTICAL MICROMETER INDUSTRIAL TYPE MACHINE
Directory of Open Access Journals (Sweden)
Georgia A. Louka
2010-12-01
Full Text Available The measurement of the uncertainty of a metric system, as 'Gauge R&R' and the collation of results between the Xbar & R and the ANOVA method, are extended in this essay. In an academic school laboratory we accomplished a sequence of measurements with the use of an Optical Micrometer Industrial Type Machine (MUL 300. This paper analyzes the measurement system that used in the laboratory and checks the reasons of the variability's provocation that observed in the machine, between the theoretical calculations and measurements. In order to find out this problem, we will use the 'Gage Repeatability and Reproducibility' technique of Measurement System Analysis (M.S.A.. This technique uses analysis of variance. In addition, will use Minitab program in order to find out the factors that we have in the whole experiment as enlarge the problem of measurements. In this paper, a statistical method using the correlation between Gage R&R and process capability indices is proposed for evaluating the adequacy of the acceptance criteria of P/T ratio. Finally, a comparative analysis has also been performed for evaluating the accuracy of Gage R&R between two methods (ANOVA and R- Xbar method. Hopefully, the results of this research can provide a useful reference for quality practitioners in various industries.
Nahid Sırrı Örik’in Romanlarında Aile
Sayar, Feyza
2013-01-01
In this study, The six novels of Nahid Sırrı Örik Kıskanmak, Yıldız Olmak Kolay mı?, Tersine Giden Yol, Gece Olmadan, Sultan Hamid Düşerken, Kozmopolitler were examined in terms of family approach. In the first section of the study, Nahid Sırrı Örik's life, art and works were mentioned. In the second section, generally novels in Turkish Literature which are on the subject of family were mentioned. In the third section, the plot is studied. In the fourth section family and in the fifth sect...
Directory of Open Access Journals (Sweden)
Cristiane Fortes Gris
2010-04-01
Full Text Available Têm-se levantado à hipótese de que cultivares de soja RR possuem teores de lignina superiores aos convencionais, o que proporciona maior resistência a danos mecânicos e maior impermeabilidade do tegumento das sementes. Objetivou-se avaliar a qualidade fisiológica e o teor de lignina no tegumento das sementes de soja convencional e RR colhidas em três épocas, em Lavras-MG. Para tanto, as sementes colhidas nos estádios R7, R8 e após 20 dias de retardamento da colheita (R8+20, foram submetidas aos testes para avaliação da qualidade fisiológica e teor de lignina. As cultivares convencionais e RR avaliadas foram: BRS 133 vs BRS 245 RR, BRS 134 vs BRS 247 RR, Conquista vs Valiosa RR, Celeste vs Baliza RR e Jataí vs Silvânia RR. Foram realizados os testes de peso de mil sementes, germinação, envelhecimento acelerado, condutividade elétrica, dano mecânico, índice de velocidade de emergência, germinação após a imersão das sementes em água e teor de lignina no tegumento de sementes. Com exceção do teor de lignina no tegumento de sementes para o contraste Jataí vs Silvânia RR, não foram observadas diferenças entre os materiais RR e convencional, tendo, neste caso, a cv Silvânia RR apresentado resultados superiores aos da convencional. No entanto, houve diferença de comportamento entre os cultivares quanto à tolerância ao retardamento da colheita. Observou-se redução significativa na porcentagem de germinação e vigor das sementes avaliadas com o retardamento da colheita.One has raised the hypothesis that the RR soybean cultivars posses lignin contents higher than those of the conventional ones. The present work was conducted with the purpose of evaluating the physiological quality and lignin content in the coat of the conventional and RR soybean seeds collected in three times in Lavras-MG. To that end, the seeds collected at stages R7, R8 and after 20 days of collection delay (R8+20 were submitted to the tests for
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Calcium abundance of RR Lyrae variables in ω Centaurri and M22
International Nuclear Information System (INIS)
Manduca, A.; Bell, R.A.
1978-01-01
Freeman and Rodgers observed 25 RR Lyrae variables in ω Cen and reported a range in calcium abundance from [Ca/H] = -0.4 to -1.6. This result, however, has been difficult to reconcile with other recent studies of the giant branch of ω Cen. with a model-atmosphere grid covering the physical parameters expected for RR Lyrae variables, Freeman and Rodgers's data were reanalyzed, by use of their basic method of theoretical relations among the equivalent widths of the K, H4b, and H delta lines and [Ca/H] but with an alternative, synthetic-spectrum approach to the calibration of these relations. When interpreted with the present calibration, the data yield a range in calcium abundance from [Ca/H] = -1.0 to -1.9 for the ω Cen RR Lyrae variables. This calibration applied to the M22 data of Butler et al gives [Ca/H] = -1.25 for M22. 2 figures, 1 table
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Directory of Open Access Journals (Sweden)
Muthu Ganesan Rajaram
2018-05-01
Full Text Available (1 Background: To increase the biochemical productivity and to reduce the production cost of microalgal biodiesel, this study aimed to investigate the effects of CO2 on biomass, fatty acids, carbon-hydrogen, and biochemical accumulation of the marine diatom, Amphora coffeaeformis RR03 (A. coffeaeformis RR03. (2 Methods: Fatty acid composition of the dry biomass of A. coffeaeformis RR03 was analysed using Gas chromatography-mass spectrometry (GC-MS. (3 Results: The results showed that A. coffeaeformis RR03 contained high biomass productivity and biochemical composition in different cultivation conditions. A. coffeaeformis RR03 showed maximum growth of 5.2 × 106/mL on 21st day cultivation under CO2 supply. The bio-crude oil production from A. coffeaeformis RR03 was 36.19 megajoule (MJ. GC-MS analysis found that the dry biomass of A. coffeaeformis RR03 contained maximum of 47.72% fatty acids of 16-octadecanoic acid methyl ester (10:12 and 19.58% pentadecanoic acid, 13-methyl-, and methyl ester (9.24. (4 Conclusion: The results of this study may suggest that a novel diatom of A. coffeaeformis RR03 could be a suitable candidate for biocrude production in order to meet the future demand of energy.
Rapid Hydrogen Shift Reactions in Acyl Peroxy Radicals
DEFF Research Database (Denmark)
Knap, Hasse Christian; Jørgensen, Solvejg
2017-01-01
-shift with X = 6, 7, 8, or 9) in the hydroperoxy acyl peroxy radicals, this H-shift is a reversible reaction and it scrambles between two peroxides, hydroperoxy acyl peroxy and peroxy peroxoic acid radicals. The forward reaction rate constants of the 1,X-OOH H-shift reactions are estimated to be above 103 s–1...... with transition state theory corrected with Eckart quantum tunnelling correction. The ratio between the forward and reverse reaction rate constant of the 1,X-OOH H-shift reactions is around ∼105. Therefore, the equilibrium is pushed toward the production of peroxy peroxoic acid radicals. These very fast 1,X-OOH H......We have used quantum mechanical chemical calculations (CCSD(T)-F12a/cc-pVDZ-F12//M06-2X/aug-cc-pVTZ) to investigate the hydrogen shift (H-shift) reactions in acyl peroxy and hydroperoxy acyl peroxy radicals. We have focused on the H-shift reactions from a hydroperoxy group (OOH) (1,X-OOH H...
Luminescence quenching by reversible ionization or exciplex formation/dissociation.
Ivanov, Anatoly I; Burshtein, Anatoly I
2008-11-20
The kinetics of fluorescence quenching by both charge transfer and exciplex formation is investigated, with an emphasis on the reversibility and nonstationarity of the reactions. The Weller elementary kinetic scheme of bimolecular geminate ionization and the Markovian rate theory are shown to lead to identical results, provided the rates of the forward and backward reactions account for the numerous recontacts during the reaction encounter. For excitation quenching by the reversible exciplex formation, the Stern-Volmer constant is specified in the framework of the integral encounter theory. The bulk recombination affecting the Stern-Volmer quenching constant makes it different for pulse excited and stationary luminescence. The theory approves that the free energy gap laws for ionization and exciplex formation are different and only the latter fits properly the available data (for lumiflavin quenching by aliphatic amines and aromatic donors) in the endergonic region.
Recycling tires? Reversible crosslinking of poly(butadiene).
Trovatti, Eliane; Lacerda, Talita M; Carvalho, Antonio J F; Gandini, Alessandro
2015-04-01
Furan-modified poly(butadiene) prepared by the thiol-ene click reaction is crosslinked with bismaleimides through the Diels-Alder reaction, giving rise to a novel recyclable elastomer. This is possible because of the thermal reversibility of the adducts responsible for the formation of the network. The use of this strategy provides the possibility to produce recyclable tires. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Requirements for DNA strand transfer during reverse transcription in mutant HIV-1 virions
Berkhout, B.; van Wamel, J.; Klaver, B.
1995-01-01
Retroviruses convert their RNA genome into a DNA form by means of reverse transcription. According to the current model of reverse transcription, two strand transfer reactions are needed to synthesize a full-length DNA genome. Because reverse transcription is initiated close to the 5' end of the RNA
The effect of catalyst support on the RWGS reaction
International Nuclear Information System (INIS)
Laosiripojana, N.; Sutthisripok, W.
2004-01-01
'Full text:' Methane steam reforming is generally applied in order to produce synthesis gas mainly consist of hydrogen and carbon monoxide for later utilization in SOFC. This reaction is always carried out with the water gas shift reaction over a catalyst at elevated temperatures resulting in some carbon dioxide production. The CO/CO2 production selectivity strongly depends on the influence of water gas shift reaction. It was observed that the reactivity of this reaction depended on the type of support material. Stabilities, activities, and kinetics of the reverse water gas shift reaction (RWGS) for commercial nickel on CeO2, ZrO2, CeO2-ZrO2, TiO2, MgO, and Al2O3 supports were studied in order to observe the influence of the support on this reaction. According to the experiment, the activities of Ni/CeO2 toward the reverse water gas shift reaction (RWGS) were very high, and reached equilibrium level at approximately 600 o C (where the conversion of CO2 was closed to 1). Other oxide supports provided lower activities toward this reaction. It was observed that the activity of Ni/Al2O3 toward this reaction was the lowest. The kinetics of this reaction was also studied. Carbon dioxide presented positive effect on the reverse water gas shift reaction. The reaction orders in carbon dioxide were observed to be positive partial value between 0-1. It slightly decreased with increasing temperature for Ni/ CeO2 and Ni/CeO2-ZrO2, whereas it seemed to be independent of the operating temperature for other materials in the range of conditions studied. Hydrogen also showed positive effect on the reverse water gas shift reaction for all materials. The reaction order in hydrogen for all materials was observed to be the positive value and less than one for the range of conditions studied. The approximate values for all catalysts were between 0.45-0.65, and seemed to be independent of the operating temperature. The estimated values of the apparent activation energy for RWGS reaction
RR Lyrae star distance scale and kinematics from inner bulge to 50 kpc
Directory of Open Access Journals (Sweden)
Dambis Andrei
2017-01-01
Full Text Available We use the currently most complete sample of ∼ 3500 type ab RR Lyraes in our Galaxy with available radial-velocity and [Fe/H] measurements to perform a statisticalparallax analysis for a subsample of ∼ 600 type ab RR Lyraes located within 5 kpc from the Sun to refine the parameters of optical and WISE W1-band period-metallicityluminosity relations and adjust our preliminary distances. The new zero point implies the rescaled estimates for the solar Galactocentric distance (RG = 7.99 ± 0.37 kpc and the LMC distance modulus (DMLMC = 18.39 ±0.09. We use the kinematic data for the entire sample to explore the dependence of the halo and thick-disk RR Lyrae velocity ellipsoids on Galactocentric distance from the inner bulge out to R ∼ 50 kpc.
How decision reversibility affects motivation.
Bullens, Lottie; van Harreveld, Frenk; Förster, Jens; Higgins, Tory E
2014-04-01
The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making, strengthening prevention-related motivation relatively more than promotion-related motivation. If so, then decision reversibility should have effects associated with the relative differences between prevention and promotion motivation. In 5 studies, we manipulated the reversibility of a decision and used different indicators of regulatory focus motivation to test these predictions. Specifically, Study 1 tested for differences in participants' preference for approach versus avoidance strategies toward a desired end state. In Study 2, we used speed and accuracy performance as indicators of participants' regulatory motivation, and in Study 3, we measured global versus local reaction time performance. In Study 4, we approached the research question in a different way, making use of the value-from-fit hypothesis (Higgins, 2000, 2002). We tested whether a fit between chronic regulatory focus and focus induced by the reversibility of the decision increased participants' subjective positive feelings about the decision outcome. Finally, in Study 5, we tested whether regulatory motivation, induced by decision reversibility, also influenced participants' preference in specific product features. The results generally support our hypothesis showing that, compared to irreversible decisions, reversible decisions strengthen a prevention focus more than a promotion focus. Implications for research on decision making are discussed.
Response of Haloalkaliphilic Archaeon Natronococcus Jeotgali RR17 to Hypergravity
Thombre, Rebecca S.; Bhalerao, Aniruddha R.; Shinde, Vinaya D.; Dhar, Sunil Kumar; Shouche, Yogesh S.
2017-06-01
The survival of archaeabacteria in extreme inhabitable environments on earth that challenge organismic survival is ubiquitously known. However, the studies related to the effect of hypergravity on the growth and proliferation of archaea are unprecedented. The survival of organisms in hypergravity and rocks in addition to resistance to cosmic radiations, pressure and other extremities is imperative to study the possibilities of microbial travel between planets and endurance in hyperaccelerative forces faced during ejection of rocks from planets. The current investigation highlights the growth of an extremophilic archaeon isolated from a rocky substrate in hypergravity environment. The haloalkaliphilic archaeon, Natronococcus jeotgali RR17 was isolated from an Indian laterite rock, submerged in the Arabian sea lining Coastal Maharashtra, India. The endolithic haloarchaeon was subjected to hypergravity from 56 - 893 X gusing acceleration generated by centrifugal rotation. The cells of N. jeotgali RR17 proliferated and demonstrated good growth in hypergravity (223 X g). This is the first report on isolation of endolithic haloarchaeon N. jeotgali RR17 from an Indian laterite rock and its ability to proliferate in hypergravity. The present study demonstrates the ability of microbial life to survive and proliferate in hypergravity. Thus the inability of organismic growth in hypergravity may no longer be a limitation for astrobiology studies related to habitability of substellar objects, brown dwarfs and other planetary bodies in the universe besides planet earth.
HIV-1 reverse transcription initiation: a potential target for novel antivirals?
Abbink, Truus E. M.; Berkhout, Ben
2008-01-01
Reverse transcription is an essential step in the retroviral life cycle, as it converts the genomic RNA into DNA. In this review, we describe recent developments concerning the initiation step of this complex, multi-step reaction. During initiation of reverse transcription, a cellular tRNA primer is
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
Schröder, Henning; Sawall, Mathias; Kubis, Christoph; Selent, Detlef; Hess, Dieter; Franke, Robert; Börner, Armin; Neymeyr, Klaus
2016-07-13
If for a chemical reaction with a known reaction mechanism the concentration profiles are accessible only for certain species, e.g. only for the main product, then often the reaction rate constants cannot uniquely be determined from the concentration data. This is a well-known fact which includes the so-called slow-fast ambiguity. This work combines the question of unique or non-unique reaction rate constants with factor analytic methods of chemometrics. The idea is to reduce the rotational ambiguity of pure component factorizations by considering only those concentration factors which are possible solutions of the kinetic equations for a properly adapted set of reaction rate constants. The resulting set of reaction rate constants corresponds to those solutions of the rate equations which appear as feasible factors in a pure component factorization. The new analysis of the ambiguity of reaction rate constants extends recent research activities on the Area of Feasible Solutions (AFS). The consistency with a given chemical reaction scheme is shown to be a valuable tool in order to reduce the AFS. The new methods are applied to model and experimental data. Copyright © 2016 Elsevier B.V. All rights reserved.
Lu, Hongwei; Zhang, Chenxi; Sun, Ying; Hao, Zhidong; Wang, Chunfang; Tian, Jiajia
2015-08-01
Predicting the termination of paroxysmal atrial fibrillation (AF) may provide a signal to decide whether there is a need to intervene the AF timely. We proposed a novel RdR RR intervals scatter plot in our study. The abscissa of the RdR scatter plot was set to RR intervals and the ordinate was set as the difference between successive RR intervals. The RdR scatter plot includes information of RR intervals and difference between successive RR intervals, which captures more heart rate variability (HRV) information. By RdR scatter plot analysis of one minute RR intervals for 50 segments with non-terminating AF and immediately terminating AF, it was found that the points in RdR scatter plot of non-terminating AF were more decentralized than the ones of immediately terminating AF. By dividing the RdR scatter plot into uniform grids and counting the number of non-empty grids, non-terminating AF and immediately terminating AF segments were differentiated. By utilizing 49 RR intervals, for 20 segments of learning set, 17 segments were correctly detected, and for 30 segments of test set, 20 segments were detected. While utilizing 66 RR intervals, for 18 segments of learning set, 16 segments were correctly detected, and for 28 segments of test set, 20 segments were detected. The results demonstrated that during the last one minute before the termination of paroxysmal AF, the variance of the RR intervals and the difference of the neighboring two RR intervals became smaller. The termination of paroxysmal AF could be successfully predicted by utilizing the RdR scatter plot, while the predicting accuracy should be further improved.
Compound nucleus studies withy reverse kinematics
International Nuclear Information System (INIS)
Moretto, L.G.
1985-06-01
Reverse kinematics reactions are used to demonstrate the compound nucleus origin of intermediate mass particles at low energies and the extension of the same mechanism at higher energies. No evidence has appeared in our energy range for liquid-vapor equilibrium or cold fragmentation mechanisms. 11 refs., 12 figs
Flow distribution in ET-RR-1 core
International Nuclear Information System (INIS)
Khattab, M.; Mina, A.R.
1989-01-01
In nuclear reactors the flow may be arranged through individual bundles by orifices to achieve better thermal performance. A model based on constant pressure drop across different core regions is developed to determine the flow distribution in reactor core. The friction and grids in the bundles as well as the orifices diameters have an influence on modifying the flow distribution. The application of the proposed model on ET-RR-1 gives reasonable prediction of flow distribution
Reverse micelles as suitable microreactor for increased biohydrogen production
Energy Technology Data Exchange (ETDEWEB)
Pandey, Anjana [Nanotechnology and Molecular Biology Laboratory, Centre of Biotechnology, University of Allahabad, Allahabad 211002 (India); Pandey, Ashutosh [Centre of Energy Studies, MNNIT, Allahabad 211004 (India)
2008-01-15
Reverse micelles have been shown to act as efficient microreactors for enzymic reactions and whole cell entrapment in organic (non-aqueous) media wherein the reactants are protected from denaturation by the surrounding organic solvent. These micelles are thermodynamically stable, micrometer sized water droplets dispersed in an organic phase by a surfactant. It has been observed that when whole cells of photosynthetic bacteria (Rhodopseudomonas sphaeroides or Rhodobacter sphaeroides 2.4.1) are entrapped inside these reverse micelles, the H{sub 2} production enhanced from 25 to 35 folds. That is, 1.71mmol(mgprotein){sup -1}h{sup -1} in case of R. sphaeroides which is 25 fold higher in benzene-sodium lauryl sulfate reverse micelles. Whereas, in case of R. sphaeroides 2.4.1 the H{sub 2} production was increased by 35 fold within AOT-isooctane reverse micelles i.e. 11.5mmol(mgprotein){sup -1}h{sup -1}. The observations indicate that the entrapment of whole cells of microbes within reverse micelles provides a novel and efficient technique to produce hydrogen by the inexhaustible biological route. The two microorganisms R. sphaeroides 2.4.1 (a photosynthetic bacteria) and Citrobacter Y19 (a facultative anaerobic bacteria) together are also entrapped within AOT-isooctane and H{sub 2} production was measured i.e. 69mmol(mgprotein){sup -1}h{sup -1}. The nitrogenase enzyme responsible for hydrogen production by R. sphaeroides/R. sphaeroides 2.4.1 cells is oxygen sensitive, and very well protected within reverse micelles by the use of combined approach of two cells (R. sphaeroides 2.4.1 and Citrobacter Y19). In this case glucose present in the medium of Citrobacter Y19 serves double roles in enhancing the sustained production rate of hydrogen. Firstly, it quenches the free O{sub 2}liberated as a side product of reaction catalyzed by nitrogenase, which is O{sub 2} labile. Secondly, organic acid produced by this reaction is utilized by the Citrobacter Y19 as organic substrate in
VizieR Online Data Catalog: Mid-infrared study of RR Lyrae stars (Gavrilchenko+, 2014)
Gavrilchenko, T.; Klein, C. R.; Bloom, J. S.; Richards, J. W.
2015-02-01
The first goal was to find a large sample of WISE-observed RR Lyrae stars. A data base of previously identified RR Lyrae stars was created, combining information from General Catalogue of Variable Stars (GCVS), All Sky Automated Survey (ASAS), SIMBAD, VizieR, and individual papers. For many of the sources in this data base the only available data were the coordinates and RR Lyrae classification. When provided, information about the period, distance, subclass, and magnitude for several different wavebands was also stored. If a single source appeared in multiple surveys or papers, information from all relevant surveys was included, with markers indicating contradicting measurements between surveys. The resulting data base contains about 17000 sources, of which about 5000 sources have documented V-band periods. (3 data files).
Experimental study of line reversal symmetry in the reactions anti pp→π-π+ and π+p→pπ+ at 6 GeV/c
International Nuclear Information System (INIS)
Stein, N.A.
1977-01-01
The differential cross sections were measured for several two body and quasi-two body baryon exchange scattering channels at 6 GeV/c in a spark chamber-counter experiment utilizing the Brookhaven National Laboratory Multi-Particle Spectrometer. Among these is a comparison study of anti pp→π - π + and its line reversed partner π + p→pπ + in the range t/sub min/ > t > -1.5 (GeV/c) 2 . For the first time structure analogous to the striking dip in the backward elastic scattering reaction at t approx. -0.15 (GeV/c) 2 is observed in the annihilation reaction. The structure which appears as a break in the t slope at t approx. -0.40 (GeV/c) 2 and perhaps a shallow dip at that point, demonstrates the strong role played by absorption in these channels
Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li
2015-07-01
Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Measurement and theory of turbulence in RR Lyrae
International Nuclear Information System (INIS)
Benz, W.; Stellingwerf, R.F.
1985-01-01
CORAVEL observations of time-dependent turbulence in RR Lyrae are presented. Variation in the width of the mean velocity correlation function implies turbulent velocities that peak at 10 to 15 km/sec for a brief interval of phase near minimum radius. Comparison with a nonlinear pulsation model shows that these amplitudes of the turbulent velocity are expected near the hydrogen ionization zone, again only near minimum radius
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
Energy Technology Data Exchange (ETDEWEB)
Shuvalov, Vladimir A.; Heber, Ulrich
2003-11-01
Photoreactions of dehydrated leaves, isolated broken chloroplasts and PSII membrane fragments of spinach (Spinacia oleracea) were studied at different air humidities and compared with photoreactions of dry fronds of a fern, Polypodium vulgare, and a dry lichen, Parmelia sulcata, which in contrast to spinach are insensitive to photoinactivation in the dry state. Even in very dry air, P700 in the reaction center of photosystem I of dry leaves was oxidized, and the primary quinone acceptor Q{sub A} in the reaction center of photosystem II was photoreduced by low light. These reactions were only very slowly reversed in the dark and saturated under low light intensity. Light-minus-dark difference absorption spectra of the dry leaves, isolated chloroplasts and PSII membrane fragments measured at higher light intensities revealed absorbance changes of {beta}-carotene at 500 nm (light-dependent bleaching) and 980 nm (light-dependent band formation) and bleaching of chlorophyll at 436 and 680 nm with appearance of bands at 450 and 800 nm. Decrease of chlorophyll fluorescence upon strong illumination indicated photoaccumulation of a quencher. All these changes were kinetically related and readily reversible. They are interpreted to show light-induced oxidation of {beta}-carotene (Car) and reduction of chlorophyll-680 (Chl-680) in the reaction center of photosystem II of the dried leaves, chloroplasts and photosystem II particles. The fluorescence quencher was suggested to be Chl-680{sup -} or Car{sup +} in close proximity to P680, the primary electron donor. Appreciable photoaccumulation of reduced pheophytin was only observed in dry leaves after Q{sub A} reduction had been lost during heat treatment of hydrated leaves prior to dehydration. The observations are interpreted to show light-dependent cyclic electron flow within the reaction center of photosystem II in which Chl-680 (or Pheo) is reduced by P680* and Car is oxidized by P680{sup +} with consequent recombination of
International Nuclear Information System (INIS)
Shuvalov, Vladimir A.; Heber, Ulrich
2003-01-01
Photoreactions of dehydrated leaves, isolated broken chloroplasts and PSII membrane fragments of spinach (Spinacia oleracea) were studied at different air humidities and compared with photoreactions of dry fronds of a fern, Polypodium vulgare, and a dry lichen, Parmelia sulcata, which in contrast to spinach are insensitive to photoinactivation in the dry state. Even in very dry air, P700 in the reaction center of photosystem I of dry leaves was oxidized, and the primary quinone acceptor Q A in the reaction center of photosystem II was photoreduced by low light. These reactions were only very slowly reversed in the dark and saturated under low light intensity. Light-minus-dark difference absorption spectra of the dry leaves, isolated chloroplasts and PSII membrane fragments measured at higher light intensities revealed absorbance changes of β-carotene at 500 nm (light-dependent bleaching) and 980 nm (light-dependent band formation) and bleaching of chlorophyll at 436 and 680 nm with appearance of bands at 450 and 800 nm. Decrease of chlorophyll fluorescence upon strong illumination indicated photoaccumulation of a quencher. All these changes were kinetically related and readily reversible. They are interpreted to show light-induced oxidation of β-carotene (Car) and reduction of chlorophyll-680 (Chl-680) in the reaction center of photosystem II of the dried leaves, chloroplasts and photosystem II particles. The fluorescence quencher was suggested to be Chl-680 - or Car + in close proximity to P680, the primary electron donor. Appreciable photoaccumulation of reduced pheophytin was only observed in dry leaves after Q A reduction had been lost during heat treatment of hydrated leaves prior to dehydration. The observations are interpreted to show light-dependent cyclic electron flow within the reaction center of photosystem II in which Chl-680 (or Pheo) is reduced by P680* and Car is oxidized by P680 + with consequent recombination of Car + and Chl-680 - (or Pheo
Directory of Open Access Journals (Sweden)
Raden Wasito
2015-05-01
Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.
Build-up of actinides in irradiated fuel rods of the ET-RR-1 reactor
Energy Technology Data Exchange (ETDEWEB)
Adib, M.; Naguib, K.; Morcos, H.N
2001-09-01
The content concentrations of actinides are calculated as a function of operating reactor regime and cooling time at different percentage of fuel burn-up. The build-up transmutation equations of actinides content in an irradiated fuel are solved numerically .A computer code BAC was written to operate on a PC computer to provide the required calculations. The fuel element of 10% {sup 235}U enrichment of ET-RR-1 reactor was taken as an example for calculations using the BAC code. The results are compared with other calculations for the ET-RR-1 fuel rod. An estimation of fissile build-up content of a proposed new fuel of 20% {sup 235}U enrichment for ET-RR-1 reactor is given. The sensitivity coefficients of build-up plutonium concentrations as a function of cross-section data uncertainties are also calculated.
Hristovska, A-M; Duch, P; Allingstrup, M; Afshari, A
2018-05-01
We compared the efficacy and safety of sugammadex and neostigmine in reversing neuromuscular blockade in adults. Our outcomes were: recovery time from second twitch to train-of-four ratio > 0.9; recovery time from post-tetanic count 1-5 to train-of-four ratio > 0.9; and risk of composite adverse and serious adverse events. We searched for randomised clinical trials irrespective of publication status and date, blinding status, outcomes reported or language. We included 41 studies with 4206 participants. Time to reversal of neuromuscular blockade from second twitch to a train-of-four ratio > 0.9 was 2.0 min with sugammadex 2 mg.kg -1 and 12.9 min with neostigmine 0.05 mg.kg -1 , with a mean difference (MD) (95%CI)) of 10.2 (8.5-12.0) (I 2 = 84%, 10 studies, n = 835, Grades of Recommendation, Assessment, Development and Evaluation (GRADE): moderate quality). Time to reversal of neuromuscular blockade from a post-tetanic count of 1-5 to a train-of-four ratio > 0.9 was 2.9 min with sugammadex 4 mg.kg -1 and 48.8 min with neostigmine 0.07 mg.kg -1 , with a MD (95%CI) of 45.8 (39.4-52.2) (I 2 = 0%, 2 studies, n = 114, GRADE: low quality). There were significantly fewer composite adverse events in the sugammadex group compared with neostigmine, with a risk ratio (95%CI) of 0.60 (0.49-0.74) (I 2 = 40%, 28 studies, n = 2298, number needed to treat (NNT): 8, GRADE: moderate quality). Specifically, the risk of bradycardia (RR (95%CI) 0.16 (0.07-0.34), n = 1218, NNT: 14, GRADE: moderate quality), postoperative nausea and vomiting (RR (95%CI) 0.52 (0.28-0.97), n = 389, NNT: 16, GRADE: low quality) and overall signs of postoperative residual paralysis (RR (95%CI) 0.40 (0.28-0.57), n = 1474, NNT: 13, GRADE: moderate quality) were all reduced. There was no significant difference regarding the risk of serious adverse events (RR 0.54, 95%CI 0.13-2.25, I 2 = 0%, n = 959, GRADE: low quality). Sugammadex reverses neuromuscular blockade more rapidly
Probabilistic safety analysis for control rod drive system of ET-RR-1
International Nuclear Information System (INIS)
Nasr, M.; Nasser, O.
1988-01-01
The International Atomic Energy Agency (IAEA) co-ordinated a Research programme on Probabilistic Safety Analysis (PSA) for research reactors; with the participation of several countries. In the framework of this project (Project Int. 9/063) the Egyptian Atomic Energy Authority decided to perform a PSA study on the ET-RR-1 (Egypt Thermal Research Reactor). The study is conducted in collaboration between the nuclear regulatory and safety centre (NRSC) and the reactor department of the nuclear research centre at Inchass. The present work is a part of the PSA study on ET-RR- it is concerning a probabilistic safety analysis of the control rod drive mechanism
Directory of Open Access Journals (Sweden)
Soukaina Réjiba
2009-07-01
Full Text Available Gemcitabine is a first-line agent for advanced pancreatic cancer therapy. However, its efficacy is often limited by its poor intracellular metabolism and chemoresistance. To exert its antitumor activity, gemcitabine requires to be converted to its active triphosphate form. Thus, our aim was to improve gemcitabine activation using gene-directed enzyme prodrug therapy based on gemcitabine association with the deoxycytidine kinase::uridine monophosphate kinase fusion gene (dCK::UMK and small interference RNA directed against ribonucleotide reductase (RRM2 and thymidylate synthase (TS. In vitro, cytotoxicity was assessed by 3-[4,5-dimethylthiazol-2-yl]-3,5-diphenyl tetrazolium bromide and [3H]thymidine assays. Apoptosis-related gene expression and activity were analyzed by reverse transcription-polymerase chain reaction, Western blot, and ELISA. For in vivo studies, the treatment efficacy was evaluated on subcutaneous and orthotopic pancreatic tumor models. Our data indicated that cell exposure to gemcitabine induced a down-regulation of dCK expression and up-regulation of TS and RR expression in Panc1-resistant cells when compared with BxPc3- and HA-hpc2-sensitive cells. The combination of TS/RRM2 small interference RNA with Ad-dCK::UMK induced a 40-fold decrease of gemcitabine IC50 in Panc1 cells. This strong sensitization was associated to apoptosis induction with a remarkable increase in TRAIL expression and a diminution of gemcitabine-induced nuclear factor-κB activity. In vivo, the gemcitabine-based tritherapy strongly reduced tumor volumes and significantly prolonged mice survival. Moreover, we observed an obvious increase of apoptosis and decrease of cell proliferation in tumors receiving the tritherapy regimens. Together, these findings suggest that simultaneous TS/RRM2-gene silencing and dCK::UMK gene overexpression markedly improved gemcitabine's therapeutic activity. Clearly, this combined strategy warrants further investigation.
Chemical abundances and physical parameters of RR Lyrae stars
International Nuclear Information System (INIS)
Manduca, A.
1980-01-01
A grid of model stellar atmospheres has been calculated with a range of physical parameters which effectively cover RR Lyrae stars over all phases of their pulsation cycle. The models, calculated with the computer program MARCS, are flux-constant and include the effects of convection and line blanketing. Synthetic spectra were calculated for these models from 3000 A to 9600 A at 0.1 A resolution using the computer program SSG. These spectra were used directly in the applications below and were also used to computer theoretical colors on the UBVR, Stromgren uvby, and Walraven systems for the models. The uvby colors were used in determinations of effective temperature and surface gravity from photometry by various observers. The models, synthetic spectra, and colors were then applied to the problems detailed below. The data collected by Freeman and Rodgers (1975) for 25 RR Lyrae stars in ω Cen was reanalyzed with an alternative, synthetic spectrum approach to the calibration of their theoretical relations. The results confirm a wide range in calcium abundance for the stars in the cluster but at much lower values than reported by Freeman and Rodgers: a range of [Ca/H] = -1.0 to -1.9 was found. A theoretical calibration was performed for the ΔS system of determining metal abundances for RR Lyrae stars. The results support the existing empirical calibration of Butler in the range [Fe/H] = -0.6 to -2.2 and indicate how the calibration should be extrapolated to even lower metal abundances. For higher metal abundances, however, our calibration yields [Fe/H] values lower than Butler by as much as 0.4. Possible explanations of this discrepancy are investigated and the implications are discussed
DEFF Research Database (Denmark)
Johansen, Mathias; Wikkelsø, Anne; Lunde, Jens
2015-01-01
BACKGROUND: Treatment with vitamin K antagonists is associated with increased morbidity and mortality. Reversal therapy with prothrombin complex concentrate (PCC) is used increasingly and is recommended in the treatment of patients with bleeding complications undertaking surgical interventions......, as well as patients at high risk of bleeding. Evidence is lacking regarding indication, dosing, efficacy and safety. OBJECTIVES: We assessed the benefits and harms of PCC compared with fresh frozen plasma in the acute medical and surgical setting involving vitamin K antagonist-treated bleeding and non...... finding a beneficial effect of PCC in reducing the volume of fresh frozen plasma (FFP) transfused to reverse the effect of vitamin K antagonist treatment. The number of new occurrences of transfusion of red blood cells (RBCs) did not seem to be associated with the use of PCC (RR 1.08, 95% CI 0.82 to 1...
A surface brightness analysis of eight RR Lyrae stars
International Nuclear Information System (INIS)
Hawley, S.L.; Barnes, T.G. III; Moffett, T.J.
1987-01-01
The authors have used a surface brightness, (V-R) relation to analyze new contemporaneous photometry and radial velocity data for 6 RR-ab type stars and to re-analyze previously published data for RR Lyrae and X Arietis. Systematic effects were found in the surface brightness at phases near minimum radius. Excluding these phases, they determine the slope of the surface brightness relation and the mean radius for each star. They also find a zero point which includes both a distance term and the zero point of the surface brightness relation. The sample includes stars with Preston's metallicity indicator ΔS = 0 to 9, with periods ranging from 0.397 days to 0.651 days. Their results indicate a log(R/R solar ) vs. log P relation in the sense that stars with longer periods have larger radii, in agreement with theoretical predictions. Their radii are consistent with bolometric magnitudes in the range 0.2 - 0.8 magnitude but accurate magnitudes must await a reliable T e - color calibration
Remendable Polymeric Materials Using Reversible Covalent Bonds
2008-12-01
response in poly(ethylene-co-methacrylic acid ) copolymers. Journal of The Royal Society Interface, 4, 405-411. Kavitha, A. A., and N. K. Singha...2007: A tailor-made polymethacrylate bearing a reactive diene in reversible diels-alder reaction. J. Polym. Sci. A Polym. Chem., 45, 4441-4449
76 FR 78805 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines
2011-12-20
... Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation... all Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines. This AD results from mandatory... inspection of the FOHE mounts. We did not change the AD based on this comment. Request To Add Requirement To...
Reversible S-nitrosylation in an engineered azurin
Energy Technology Data Exchange (ETDEWEB)
Tian, Shiliang; Liu, Jing; Cowley, Ryan E.; Hosseinzadeh, Parisa; Marshall, Nicholas M.; Yu, Yang; Robinson, Howard; Nilges, Mark J.; Blackburn, Ninian J.; Solomon, Edward I.; Lu, Yi
2016-04-25
S-Nitrosothiols are known as reagents for NO storage and transportation and as regulators in many physiological processes. Although the S-nitrosylation catalysed by haem proteins is well known, no direct evidence of S-nitrosylation in copper proteins has been reported. Here, we report reversible insertion of NO into a copper–thiolate bond in an engineered copper centre in Pseudomonas aeruginosa azurin by rational design of the primary coordination sphere and tuning its reduction potential by deleting a hydrogen bond in the secondary coordination sphere. The results not only provide the first direct evidence of S-nitrosylation of Cu(II)-bound cysteine in metalloproteins, but also shed light on the reaction mechanism and structural features responsible for stabilizing the elusive Cu(I)–S(Cys)NO species. The fast, efficient and reversible S-nitrosylation reaction is used to demonstrate its ability to prevent NO inhibition of cytochrome bo3 oxidase activity by competing for NO binding with the native enzyme under physiologically relevant conditions.
Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi
2016-12-10
The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure
Menopause, hormone replacement and RR and QT modulation during sleep
Czech Academy of Sciences Publication Activity Database
Lanfranchi, P. A.; Gosselin, N.; Kára, T.; Jurák, Pavel; Somers, V. K.; Denesle, R.; Petit, D.; Carrier, J.; Nadeau, R.; Montplaisir, J.
2005-01-01
Roč. 6, č. 6 (2005), s. 561-566 ISSN 1389-9457 R&D Projects: GA ČR(CZ) GA102/05/0402 Keywords : Sleep * Menopause * RR interval * QT interval * Gender * Hormones Subject RIV: FS - Medical Facilities ; Equipment Impact factor: 2.711, year: 2005
Transport and equilibrium in field-reversed mirrors
International Nuclear Information System (INIS)
Boyd, J.K.
1982-09-01
Two plasma models relevant to compact torus research have been developed to study transport and equilibrium in field reversed mirrors. In the first model for small Larmor radius and large collision frequency, the plasma is described as an adiabatic hydromagnetic fluid. In the second model for large Larmor radius and small collision frequency, a kinetic theory description has been developed. Various aspects of the two models have been studied in five computer codes ADB, AV, NEO, OHK, RES. The ADB code computes two dimensional equilibrium and one dimensional transport in a flux coordinate. The AV code calculates orbit average integrals in a harmonic oscillator potential. The NEO code follows particle trajectories in a Hill's vortex magnetic field to study stochasticity, invariants of the motion, and orbit average formulas. The OHK code displays analytic psi(r), B/sub Z/(r), phi(r), E/sub r/(r) formulas developed for the kinetic theory description. The RES code calculates resonance curves to consider overlap regions relevant to stochastic orbit behavior
International Nuclear Information System (INIS)
Pal, Krishnendu; Das, Biswajit; Banerjee, Kinshuk; Gangopadhyay, Gautam
2015-01-01
We have introduced an approach to nonequilibrium thermodynamics of an open chemical reaction network in terms of the propensities of the individual elementary reactions and the corresponding reverse reactions. The method is a microscopic formulation of the dissipation function in terms of the relative entropy or Kullback-Leibler distance which is based on the analogy of phase space trajectory with the path of elementary reactions in a network of chemical process. We have introduced here a fluctuation theorem valid for each opposite pair of elementary reactions which is useful in determining the contribution of each sub-reaction on the nonequilibrium thermodynamics of overall reaction. The methodology is applied to an oligomeric enzyme kinetics at a chemiostatic condition that leads the reaction to a nonequilibrium steady state for which we have estimated how each step of the reaction is energy driven or entropy driven to contribute to the overall reaction. (paper)
Cai, Yong-Feng; Li, Li; Luo, Meng-Xian; Yang, Ke-Fang; Lai, Guo-Qiao; Jiang, Jian-Xiong; Xu, Li-Wen
2011-05-01
A detailed experimental investigation of an aza-Michael reaction of aniline and chalcone is presented. A series of Cinchona alkaloid-derived organocatalysts with different functional groups were prepared and used in the aza-Michael and retro-aza-Michael reaction. There was an interesting finding that a complete reversal of stereoselectivity when a benzoyl group was introduced to the cinchonine and cinchonidine. The chirality amplification vs. time proceeds in the quinine-derived organocatalyst containing silicon-based bulky group, QN-TBS, -catalyzed aza-Michael reaction under solvent-free conditions. In addition, we have demonstrated for the first time that racemization was occurred in suitable solvents under mild conditions due to retro-aza-Michael reaction of the Michael adduct of aniline with chalcone. These indicate the equilibrium of retro-aza-Michael reaction and aza-Michael reaction produce the happening of chirality amplification in aza-Michael reaction and racemization via retro-aza-Michael reaction under different conditions, which would be beneficial to the development of novel chiral catalysts for the aza-Michael reactions. Copyright © 2011 Wiley-Liss, Inc.
Reaction Formulation: A Bibliography.
Pedrini, D. T.; Pedrini, Bonnie C.
Reaction formation was studied by Sigmund Freud. This defense mechanism may be related to repression, substitution, reversal, and compensation (or over-compensation). Alfred Adler considered compensation a basic process in his individual psychology. Anna Freud discussed some defense mechanisms, and Bibring, Dwyer, Huntington, and Valenstein…
Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; Van Den Berg, Albert; Olthuis, Wouter; Pascual-García, César
2017-01-01
The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used
Schnippel, K; Firnhaber, C; Berhanu, R; Page-Shipp, L; Sinanovic, E
2018-04-01
To estimate the provider costs of managing adverse drug reactions (ADRs) to standard long-course treatment for multidrug- and rifampicin-resistant tuberculosis (MDR/RR-TB) according to South African guidelines. We parameterised a published Markov health state model for MDR/RR-TB with guidelines-based, bottom-up public-sector provider costing of ADR management. Frequency of ADR occurrence was extracted from the literature. Costs were estimated over 10 years, discounted 3% annually and tested using probabilistic sensitivity analysis. On average, guidelines-based costing of moderate ADRs weighted by the frequency of occurrence was US$135.76 (standard deviation [SD] US$17.18) and the cost of serious ADRs was US$521.29 (SD US$55.99). We estimated that the incremental costs of ADR management were US$380.17 annually per patient initiating MDR/RR-TB treatment. The incremental costs of ADR management for the public health sector in South Africa was US$4.76 million, 8.3% of the estimated cohort costs of MDR/RR-TB treatment ($57.55 million) for the 2015 cohort of 12 527 patients. Management of multiple ADRs and serious ADRs, which are common during the first 6 months of standard, long-course MDR/RR-TB treatment, substantially increases provider treatment costs. These results need to be taken into account when comparing regimen costs, and highlight the urgent need to identify drug regimens with improved safety profiles.
Giuseppone, Nicolas; Schmitt, Jean-Louis; Schwartz, Evan; Lehn, Jean-Marie
2005-04-20
Sc(OTf)(3) efficiently catalyzes the self-sufficient transimination reaction between various types of C=N bonds in organic solvents, with turnover frequencies up to 3600 h(-)(1) and rate accelerations up to 6 x 10(5). The mechanism of the crossover reaction in mixtures of amines and imines is studied, comparing parallel individual reactions with coupled equilibria. The intrinsic kinetic parameters for isolated reactions cannot simply be added up when several components are mixed, and the behavior of the system agrees with the presence of a unique mediator that constitutes the core of a network of competing reactions. In mixed systems, every single amine or imine competes for the same central hub, in accordance with their binding affinity for the catalyst metal ion center. More generally, the study extends the basic principles of constitutional dynamic chemistry to interconnected chemical transformations and provides a step toward dynamic systems of increasing complexity.
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
Mitsuda's reactions: induced by BCG in the normal Rhesus ("Macacca mulatta"
Directory of Open Access Journals (Sweden)
M. J. Pereira Filho
1955-12-01
Full Text Available The reversals of Mitsuda's reactions induced by BCG have been objected to based on the possiblem interference of other determination causes of the phenomenon: tuberculous primo-infections, communicants of unsuspected leprosy, revearsals due to other causes, such as anti-diphteric and anti-tetanic vaccination, etc. In order to study the problem, we have used Rhesus monkeys (Macaca mulatta, which were reared in isolation, in an attempt to avoid the referred to interferences. Prior to the experiments, all animals were tested and found negative to radiograph, tuberculin and lepromin tests and were then submitted to the application of BCG vaccine (from 1 to 3 days old, in different doses and by different via. At different times, after the application of BCG, they were again submitted to the radiographic, tuberculin and lepromin tests. In the tables I to IV the experiences were summarised. From the experiments, the following conclusions were reached: 1 - From 12 Rhesus that received BCG 11 showed reversals of the Mitsuda reaction (91.7%. 2 - These reverseals took place both in tests effected shortly after BCG (from 6 days to 2 months, and tests effected much later (from 7 to 12 months after BCG. 3 - Some differences were found in the results, according to the dosis and the application via of the BCG. a - The testicular and peritonela via (0,02g were the only that determined strong positive Mitsuda's reactions (+++. b - By oral via, animals that received high dosis (0.6g and 1.2 g, there resulted uniform and regular reversals, even though of low intensity (+; but from those who got small doses (0.2 g. one showed no reversals in all tests, and the other presented reversals in the 2nd and 3rd tests only, also with low positivity (+. 4 In the 2nd and 3rd Mitsuda's reactions in the same animals, positivity was always precocious (generally within 48 hours, one getting the impression that there occurs a sensibilization of the animal body by the antigen with
A primordial and reversible TCA cycle in a facultatively chemolithoautotrophic thermophile.
Nunoura, Takuro; Chikaraishi, Yoshito; Izaki, Rikihisa; Suwa, Takashi; Sato, Takaaki; Harada, Takeshi; Mori, Koji; Kato, Yumiko; Miyazaki, Masayuki; Shimamura, Shigeru; Yanagawa, Katsunori; Shuto, Aya; Ohkouchi, Naohiko; Fujita, Nobuyuki; Takaki, Yoshihiro; Atomi, Haruyuki; Takai, Ken
2018-02-02
Inorganic carbon fixation is essential to sustain life on Earth, and the reductive tricarboxylic acid (rTCA) cycle is one of the most ancient carbon fixation metabolisms. A combination of genomic, enzymatic, and metabolomic analyses of a deeply branching chemolithotrophic Thermosulfidibacter takaii ABI70S6 T revealed a previously unknown reversible TCA cycle whose direction was controlled by the available carbon source(s). Under a chemolithoautotrophic condition, a rTCA cycle occurred with the reverse reaction of citrate synthase (CS) and not with the adenosine 5'-triphosphate-dependent citrate cleavage reactions that had been regarded as essential for the conventional rTCA cycle. Phylometabolic evaluation suggests that the TCA cycle with reversible CS may represent an ancestral mode of the rTCA cycle and raises the possibility of a facultatively chemolithomixotrophic origin of life. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model
International Nuclear Information System (INIS)
Zeller, P.; Clement, M.; Fessard, V.
2011-01-01
Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.
Energy Technology Data Exchange (ETDEWEB)
Jacobs, P A; Uytterhoeven, J B; Beyer, H K
1977-01-01
Degassing above 573/sup 0/K of Ag-Y or Ag-mordenite previously reduced by hydrogen at 623/sup 0/K resulted in hydrogen evolution, the amount of hydrogen increasing to a maximum at about 873/sup 0/K. No hydrogen was evolved when the zeolite was reduced by hydrazine or hydroxylamine, indicating that hydrogen is formed by reaction between silver metal and hydroxyl groups formed in the reduction step (i.e., the reverse of the reduction step). Consumption of hydroxyl groups was proven by IR studies of pyridine chemisorption which occurs entirely as pyridinium ions on Broensted sites or reduced samples but with increasing formation of pyridine on Lewis acid sites as the degassing temperature increases; formation of silver(I) ions was proven by carbon monoxide complexation. Silver metal outside the zeolite pores was not affected by the degassing, and the amount of hydrogen evolved upon degassing decreased with increasing number of reduction-degassing cycles, probably as a result of dehydroxylation or sintering. Spectra, graphs, tables, and 21 references.
LSM-YSZ Reactions in Different Atmospheres
DEFF Research Database (Denmark)
Chen, Ming; Liu, Yi-Lin; Hagen, Anke
2009-01-01
-powder reaction. LSM reacts differently with YSZ in different atmospheres. In air, m-ZrO2 (monoclinic) is formed; while in N2, SrZrO3 and/or La2Zr2O7 are formed depending on the initial LSM/YSZ ratio. The reactions are reversible with varying P(O2) i.e. treating the sample in air after the heat treatment in N2...
Studying protein assembly with reversible Brownian dynamics of patchy particles
International Nuclear Information System (INIS)
Klein, Heinrich C. R.; Schwarz, Ulrich S.
2014-01-01
Assembly of protein complexes like virus shells, the centriole, the nuclear pore complex, or the actin cytoskeleton is strongly determined by their spatial structure. Moreover, it is becoming increasingly clear that the reversible nature of protein assembly is also an essential element for their biological function. Here we introduce a computational approach for the Brownian dynamics of patchy particles with anisotropic assemblies and fully reversible reactions. Different particles stochastically associate and dissociate with microscopic reaction rates depending on their relative spatial positions. The translational and rotational diffusive properties of all protein complexes are evaluated on-the-fly. Because we focus on reversible assembly, we introduce a scheme which ensures detailed balance for patchy particles. We then show how the macroscopic rates follow from the microscopic ones. As an instructive example, we study the assembly of a pentameric ring structure, for which we find excellent agreement between simulation results and a macroscopic kinetic description without any adjustable parameters. This demonstrates that our approach correctly accounts for both the diffusive and reactive processes involved in protein assembly
Studying protein assembly with reversible Brownian dynamics of patchy particles
Energy Technology Data Exchange (ETDEWEB)
Klein, Heinrich C. R. [Institute for Theoretical Physics, Heidelberg University, 69120 Heidelberg (Germany); Schwarz, Ulrich S., E-mail: ulrich.schwarz@bioquant.uni-heidelberg.de [Institute for Theoretical Physics, Heidelberg University, 69120 Heidelberg (Germany); BioQuant, Heidelberg University, 69120 Heidelberg (Germany)
2014-05-14
Assembly of protein complexes like virus shells, the centriole, the nuclear pore complex, or the actin cytoskeleton is strongly determined by their spatial structure. Moreover, it is becoming increasingly clear that the reversible nature of protein assembly is also an essential element for their biological function. Here we introduce a computational approach for the Brownian dynamics of patchy particles with anisotropic assemblies and fully reversible reactions. Different particles stochastically associate and dissociate with microscopic reaction rates depending on their relative spatial positions. The translational and rotational diffusive properties of all protein complexes are evaluated on-the-fly. Because we focus on reversible assembly, we introduce a scheme which ensures detailed balance for patchy particles. We then show how the macroscopic rates follow from the microscopic ones. As an instructive example, we study the assembly of a pentameric ring structure, for which we find excellent agreement between simulation results and a macroscopic kinetic description without any adjustable parameters. This demonstrates that our approach correctly accounts for both the diffusive and reactive processes involved in protein assembly.
DEFF Research Database (Denmark)
Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.
1999-01-01
A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...
Garling, Christopher; Willman, Beth; Sand, David J.; Hargis, Jonathan; Crnojević, Denija; Bechtol, Keith; Carlin, Jeffrey L.; Strader, Jay; Zou, Hu; Zhou, Xu; Nie, Jundan; Zhang, Tianmeng; Zhou, Zhimin; Peng, Xiyan
2018-01-01
We investigate the hypothesized tidal disruption of the Hercules ultra-faint dwarf galaxy (UFD). Previous tidal disruption studies of the Hercules UFD have been hindered by the high degree of foreground contamination in the direction of the dwarf. We bypass this issue by using RR Lyrae stars, which are standard candles with a very low field-volume density at the distance of Hercules. We use wide-field imaging from the Dark Energy Camera on CTIO to identify candidate RR Lyrae stars, supplemented with observations taken in coordination with the Beijing–Arizona Sky Survey on the Bok Telescope. Combining color, magnitude, and light-curve information, we identify three new RR Lyrae stars associated with Hercules. All three of these new RR Lyrae stars lie outside its published tidal radius. When considered with the nine RR Lyrae stars already known within the tidal radius, these results suggest that a substantial fraction of Hercules’ stellar content has been stripped. With this degree of tidal disruption, Hercules is an interesting case between a visibly disrupted dwarf (such as the Sagittarius dwarf spheroidal galaxy) and one in dynamic equilibrium. The degree of disruption also shows that we must be more careful with the ways we determine object membership when estimating dwarf masses in the future. One of the three discovered RR Lyrae stars sits along the minor axis of Hercules, but over two tidal radii away. This type of debris is consistent with recent models that suggest Hercules’ orbit is aligned with its minor axis.
Leprosy reactions in postelimination stage: the Bangladesh experience.
Mowla, M R; Ara, S; Mizanur Rahman, A F M; Tripura, S P; Paul, S
2017-04-01
Leprosy reactions are immunologically mediated conditions and a major cause of disability before, during and after multidrug therapy (MDT). Little data have been published on the epidemiology of leprosy reactions in Bangladesh. To describe the pattern and prevalence of leprosy reactions in the postelimination stage. A descriptive retrospective cross-sectional study was carried out in Chittagong Medical College Hospital using the registered records of patients in the period between 2004 and 2013. Of the 670 patients with leprosy, 488 (73.38%) were males and 182 (27.37%) were females. The prevalence of reaction was in 300 (44.78%) patients with a male:female ratio of 3.55 : 1. The age-specific cumulative reaction cases at >40 years were 115 (38.33%) among all age groups. The prevalence of reaction was found to be in 166 (55.33%) patients for the reversal reaction, 49 (16.57%) for the erythema nodosum leprosum (ENL) and 85 (28.33%) for the neuritis. Borderline tuberculoid was most common (106, 35.33%)in the reversal reaction group, while lepromatous leprosy was most common (37, 12.33%) in ENL group. More than half of the patients (169, 56.33%) had reactions at the time of presentations, while 85 (28.33%) and 46 (15.33%) patients developed reaction during and after MDT, respectively. The reversal reaction group presented with ≥six skin lesions in 96 (57.83%) patients and ≥two nerve function impairments (NFIs) in 107 (64.46%) patients. The ENL was present chiefly as papulo-nodular lesions in 45 (91.84%) patients followed by pustule-necrotic lesions in four (8.16%), neuritis in 33 (67.35%), fever in 24 (48.98%), lymphadenitis in six (12.24%), arthritis in five (10.20%) and iritis in two (4.08%). Bacterial index ≥3 had been demonstrated in 34 (60.71%) patients in ENL group. The incidence of leprosy reaction seemed to be more than three times common in borderline tuberculoid (52.33%) group than in lepromatous leprosy (14%) group. Reactions with NFI and disability
Relationship between thermodynamic driving force and one-way fluxes in reversible processes.
Directory of Open Access Journals (Sweden)
Daniel A Beard
Full Text Available Chemical reaction systems operating in nonequilibrium open-system states arise in a great number of contexts, including the study of living organisms, in which chemical reactions, in general, are far from equilibrium. Here we introduce a theorem that relates forward and reverse fluxes and free energy for any chemical process operating in a steady state. This relationship, which is a generalization of equilibrium conditions to the case of a chemical process occurring in a nonequilibrium steady state in dilute solution, provides a novel equivalent definition for chemical reaction free energy. In addition, it is shown that previously unrelated theories introduced by Ussing and Hodgkin and Huxley for transport of ions across membranes, Hill for catalytic cycle fluxes, and Crooks for entropy production in microscopically reversible systems, are united in a common framework based on this relationship.
Price reactions when consumers are concerned about pro-social reputation
DEFF Research Database (Denmark)
Kahsay, Goytom Abraha; Andersen, Laura Mørch; Hansen, Lars Gårn
In this paper, we propose a reputation-signalling model of demand for consumer goods containing pro-social characteristics such as a ‘fair trade’ or ‘organic’ certification. We show that reputation signalling can reverse price reactions resembling the crowding-out of pre-existing motives for pro-......-social behavior seen in situations of volunteering and charitable giving. Finally, using a unique combination of questionnaire and purchase panel data, we present evidence of such reputation-driven reversal of price reactions in the Danish market for organic milk....
Mozhaev, V V; Bec, N; Balny, C
1994-08-01
Biocatalytic transformations in reversed micelles formed by anionic surfactant Aerosol OT in octane have been studied at high pressures by an example of alpha-chymotrypsin-catalyzed hydrolysis of N-carbobenzoxy-L-tyrosine p-nitrophenyl ester and N-succinyl-L-phenylalanine p-nitroanilide. For the first time it has been found that the enzyme retains high activity in these water-in-oil microemulsions up to a pressure of 2 kbar. The value of the activation volume (delta V*) for the enzyme reactions shows a dependence on the water content in the system. When the size of the micellar aqueous inner cavity (as evaluated at 1 atm) approaches the molecular size of alpha-chymotrypsin, delta V* becomes significantly different from the value in aqueous solution and in the micelles with a larger size. Possibilities of regulating the enzyme activity by pressure in systems with a low content of water are discussed.
Ground-based photometry for 42 Kepler-field RR Lyrae stars
Jeon, Young-Beom; Ngeow, Chow-Choong; Nemec, James M.
2014-02-01
Follow-up (U)BVRI photometric observations have been carried out for 42 RR Lyrae stars in the Kepler field. The new magnitude and color information will complement the available extensive high-precision Kepler photometry and recent spectroscopic results. The photometric observations were made with the following telescopes: 1-m and 41-cm telescopes of Lulin Observatory (Taiwan), 81-cm telescope of Tenagra Observatory (Arizona, USA), 1-m telescope at the Mt. Lemmon Optical Astronomy Observatory (LOAO, Arizona, USA), 1.8-m and 15-cm telescopes at the Bohyunsan Optical Astronomy Observatory (BOAO, Korea) and 61-cm telescope at the Sobaeksan Optical Astronomy Observatory (SOAO, Korea). The observations span from 2010 to 2013, with ~200 to ~600 data points per light curve. Preliminary results of the Korean observations were presented at the 5th KASC workshop in Hungary. In this work, we analyze all observations. These observations permit the construction of full light curves for these RR Lyrae stars and can be used to derive multi-filter Fourier parameters.
An integrated open framework for thermodynamics of reactions that combines accuracy and coverage.
Noor, Elad; Bar-Even, Arren; Flamholz, Avi; Lubling, Yaniv; Davidi, Dan; Milo, Ron
2012-08-01
The laws of thermodynamics describe a direct, quantitative relationship between metabolite concentrations and reaction directionality. Despite great efforts, thermodynamic data suffer from limited coverage, scattered accessibility and non-standard annotations. We present a framework for unifying thermodynamic data from multiple sources and demonstrate two new techniques for extrapolating the Gibbs energies of unmeasured reactions and conditions. Both methods account for changes in cellular conditions (pH, ionic strength, etc.) by using linear regression over the ΔG(○) of pseudoisomers and reactions. The Pseudoisomeric Reactant Contribution method systematically infers compound formation energies using measured K' and pK(a) data. The Pseudoisomeric Group Contribution method extends the group contribution method and achieves a high coverage of unmeasured reactions. We define a continuous index that predicts the reversibility of a reaction under a given physiological concentration range. In the characteristic physiological range 3μM-3mM, we find that roughly half of the reactions in Escherichia coli's metabolism are reversible. These new tools can increase the accuracy of thermodynamic-based models, especially in non-standard pH and ionic strengths. The reversibility index can help modelers decide which reactions are reversible in physiological conditions. Freely available on the web at: http://equilibrator.weizmann.ac.il. Website implemented in Python, MySQL, Apache and Django, with all major browsers supported. The framework is open-source (code.google.com/p/milo-lab), implemented in pure Python and tested mainly on Linux. ron.milo@weizmann.ac.il Supplementary data are available at Bioinformatics online.
An integrated open framework for thermodynamics of reactions that combines accuracy and coverage
Noor, Elad; Bar-Even, Arren; Flamholz, Avi; Lubling, Yaniv; Davidi, Dan; Milo, Ron
2012-01-01
Motivation: The laws of thermodynamics describe a direct, quantitative relationship between metabolite concentrations and reaction directionality. Despite great efforts, thermodynamic data suffer from limited coverage, scattered accessibility and non-standard annotations. We present a framework for unifying thermodynamic data from multiple sources and demonstrate two new techniques for extrapolating the Gibbs energies of unmeasured reactions and conditions. Results: Both methods account for changes in cellular conditions (pH, ionic strength, etc.) by using linear regression over the ΔG○ of pseudoisomers and reactions. The Pseudoisomeric Reactant Contribution method systematically infers compound formation energies using measured K′ and pKa data. The Pseudoisomeric Group Contribution method extends the group contribution method and achieves a high coverage of unmeasured reactions. We define a continuous index that predicts the reversibility of a reaction under a given physiological concentration range. In the characteristic physiological range 3μM–3mM, we find that roughly half of the reactions in Escherichia coli's metabolism are reversible. These new tools can increase the accuracy of thermodynamic-based models, especially in non-standard pH and ionic strengths. The reversibility index can help modelers decide which reactions are reversible in physiological conditions. Availability: Freely available on the web at: http://equilibrator.weizmann.ac.il. Website implemented in Python, MySQL, Apache and Django, with all major browsers supported. The framework is open-source (code.google.com/p/milo-lab), implemented in pure Python and tested mainly on Linux. Contact: ron.milo@weizmann.ac.il Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:22645166
76 FR 65136 - Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines
2011-10-20
... Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines AGENCY: Federal Aviation Administration (FAA... information identified in this AD, contact Rolls-Royce plc, Corporate Communications, P.O. Box 31, Derby... 8, 2011, to perform the inspection. Costs of Compliance Based on the service information, we...
VizieR Online Data Catalog: Type II Cepheid and RR Lyrae variables (Feast+, 2008)
Feast, M. W.; Laney, C. D.; Kinman, T. D.; van Leeuwen, F.; Whitelock, P. A.
2008-10-01
Infrared and optical absolute magnitudes are derived for the type II Cepheids kappa Pav and VY Pyx using revised Hipparcos parallaxes and for kappa Pav, V553 Cen and SW Tau from pulsational parallaxes. Revised Hipparcos and HST parallaxes for RR Lyrae agree satisfactorily and are combined in deriving absolute magnitudes. Phase-corrected J, H and Ks mags are given for 142 Hipparcos RR Lyraes based on Two-Micron All-Sky Survey observations. Pulsation and trigonometrical parallaxes for classical Cepheids are compared to establish the best value for the projection factor (p) used in pulsational analyses. (3 data files).
THE IMPACT OF CONTAMINATED RR LYRAE/GLOBULAR CLUSTER PHOTOMETRY ON THE DISTANCE SCALE
Energy Technology Data Exchange (ETDEWEB)
Majaess, D.; Turner, D.; Lane, D. [Department of Astronomy and Physics, Saint Mary' s University, Halifax, NS B3H 3C3 (Canada); Gieren, W., E-mail: dmajaess@ap.smu.ca [Departamento de Astronomia, Universidad de Concepcion, Casilla 160-C, CL Concepcion (Chile)
2012-06-10
RR Lyrae variables and the stellar constituents of globular clusters are employed to establish the cosmic distance scale and age of the universe. However, photometry for RR Lyrae variables in the globular clusters M3, M15, M54, M92, NGC 2419, and NGC 6441 exhibit a dependence on the clustercentric distance. For example, variables and stars positioned near the crowded high-surface brightness cores of the clusters may suffer from photometric contamination, which invariably affects a suite of inferred parameters (e.g., distance, color excess, absolute magnitude, etc.). The impetus for this study is to mitigate the propagation of systematic uncertainties by increasing awareness of the pernicious impact of contaminated and radial-dependent photometry.
Cao, Can; Zhang, Li; Gao, Jian; Xu, Hong; Xue, Feng; Huang, Weiwei; Li, Yan
2017-06-01
R,R-2,3-butanediol (R,R-2,3-BD) was produced by Paenibacillus polymyxa ZJ-9, which was capable of utilizing inulin without previous hydrolysis. The Jerusalem artichoke pomace (JAP) derived from the conversion of Jerusalem artichoke powder into inulin extract, which was usually used for biorefinery by submerged fermentation (SMF), was utilized in solid state fermentation (SSF) to produce R,R-2,3-BD. In this study, the fermentation parameters of SSF were optimized and determined in flasks. A novel bioreactor was designed and assembled for the laboratory scale-up of SSF, with a maximum yield of R,R-2,3-BD (67.90 g/kg (JAP)). This result is a 36.3% improvement compared with the flasks. Based on the same bath of Jerusalem artichoke powder, the total output of R,R-2,3-BD increased by 38.8% for the SSF of JAP combined with the SMF of inulin extraction. Overall, the utilization of JAP for R,R-2,3-BD production was beneficial to the comprehensive utilization of Jerusalem artichoke tuber.
78 FR 54149 - Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines
2013-09-03
... Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines AGENCY: Federal Aviation Administration (FAA... service information identified in this AD, contact Rolls-Royce plc, Corporate Communications, P.O. Box 31... per hour. Replacement parts are estimated to cost about $2,271 per engine. Based on these figures, we...
International Nuclear Information System (INIS)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang
1994-01-01
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
Energy Technology Data Exchange (ETDEWEB)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)
1994-07-15
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
Oyarzún, Bernardo; Mognetti, Bortolo Matteo
2018-03-01
We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.
Sakurai, Shunya; Shimizu, Toshiyuki; Ohto, Umeharu
2017-10-27
2,3,7,8-Tetrachlorodibenzo- p -dioxin and related compounds are extraordinarily potent environmental toxic pollutants. Most of the 2,3,7,8-tetrachlorodibenzo- p -dioxin toxicities are mediated by aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor belonging to the basic helix-loop-helix (bHLH) Per-ARNT-Sim (PAS) family. Upon ligand binding, AhR forms a heterodimer with AhR nuclear translocator (ARNT) and induces the expression of genes involved in various biological responses. One of the genes induced by AhR encodes AhR repressor (AhRR), which also forms a heterodimer with ARNT and represses the activation of AhR-dependent transcription. The control of AhR activation is critical for managing AhR-mediated diseases, but the mechanisms by which AhRR represses AhR activation remain poorly understood, because of the lack of structural information. Here, we determined the structure of the AhRR-ARNT heterodimer by X-ray crystallography, which revealed an asymmetric intertwined domain organization presenting structural features that are both conserved and distinct among bHLH-PAS family members. The structures of AhRR-ARNT and AhR-ARNT were similar in the bHLH-PAS-A region, whereas the PAS-B of ARNT in the AhRR-ARNT complex exhibited a different domain arrangement in this family reported so far. The structure clearly disclosed that AhRR competitively represses AhR binding to ARNT and target DNA and further suggested the existence of an AhRR-ARNT-specific repression mechanism. This study provides a structural basis for understanding the mechanism by which AhRR represses AhR-mediated gene transcription. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS
Directory of Open Access Journals (Sweden)
Gaodao Liang
2011-01-01
Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.
DEFF Research Database (Denmark)
Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo
2011-01-01
and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without modifications......The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT...
Dehydriding and rehydriding reactions of LiBH4
International Nuclear Information System (INIS)
Orimo, S.; Nakamori, Y.; Kitahara, G.; Miwa, K.; Ohba, N.; Towata, S.; Zuettel, A.
2005-01-01
Structural differences in LiBH 4 before and after the melting reaction at approximately 550-bar K were investigated to clarify the experimental method for the confirmation of reversible dehydriding and rehydriding reactions. Since the long-range order of LiBH 4 begins to disappear after the melting reaction was achieved, investigation of the atomistic vibrations of the [BH 4 ]-anion in LiBH 4 was found to be effective for the confirmation of the reversibility. In the present study, LiBH 4 was successively dehydrided (decomposed) into LiH and B under 1-bar MPa of hydrogen at 873-bar K, and then rehydrided (recombined) into LiBH 4 under 35-bar MPa of hydrogen at the same temperature (873-bar K). The temperatures at the beginning and ending of the dehydriding reaction are lowered, by approximately 30-bar K, for LiBH 4 substituted (or mixed) with Mg (atomic ratio of Li:Mg=9:1) as compared to those for LiBH 4 alone. This is similar to the tendency exhibited by LiNH 2
Direct catalytic asymmetric aldol-Tishchenko reaction.
Gnanadesikan, Vijay; Horiuchi, Yoshihiro; Ohshima, Takashi; Shibasaki, Masakatsu
2004-06-30
A direct catalytic asymmetric aldol reaction of propionate equivalent was achieved via the aldol-Tishchenko reaction. Coupling an irreversible Tishchenko reaction to a reversible aldol reaction overcame the retro-aldol reaction problem and thereby afforded the products in high enantio and diastereoselectivity using 10 mol % of the asymmetric catalyst. A variety of ketones and aldehydes, including propyl and butyl ketones, were coupled efficiently, yielding the corresponding aldol-Tishchenko products in up to 96% yield and 95% ee. Diastereoselectivity was generally below the detection limit of 1H NMR (>98:2). Preliminary studies performed to clarify the mechanism revealed that the aldol products were racemic with no diastereoselectivity. On the other hand, the Tishchenko products were obtained in a highly enantiocontrolled manner.
Crystallization features of ternary reversible reciprocal systems
International Nuclear Information System (INIS)
Tomashik, V.N.; Shcherbak, L.P.; Fejchuk, P.I.; Grytsiv, V.I.
2006-01-01
Some features of the primary crystallization of phases in ternary reversible reciprocal system are considered and discussed. The diagonal join CdTe-GeSe of the CdTe + GeSe = CdSe + GeTe ternary reciprocal system is studied to show that the features in primary and secondary heating and cooling curves in such systems under fully equilibrium conditions are not reproduced upon consecutive heating and cooling sessions, because of the existence of different amounts of the reagents and the reaction products in the mixture; the temperatures of each transformation lie in a range. Those who experimentally investigate other ternary and more complex reversible reciprocal systems should take this fact into account [ru
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
Machine-learned Identification of RR Lyrae Stars from Sparse, Multi-band Data: The PS1 Sample
Sesar, Branimir; Hernitschek, Nina; Mitrović, Sandra; Ivezić, Željko; Rix, Hans-Walter; Cohen, Judith G.; Bernard, Edouard J.; Grebel, Eva K.; Martin, Nicolas F.; Schlafly, Edward F.; Burgett, William S.; Draper, Peter W.; Flewelling, Heather; Kaiser, Nick; Kudritzki, Rolf P.; Magnier, Eugene A.; Metcalfe, Nigel; Tonry, John L.; Waters, Christopher
2017-05-01
RR Lyrae stars may be the best practical tracers of Galactic halo (sub-)structure and kinematics. The PanSTARRS1 (PS1) 3π survey offers multi-band, multi-epoch, precise photometry across much of the sky, but a robust identification of RR Lyrae stars in this data set poses a challenge, given PS1's sparse, asynchronous multi-band light curves (≲ 12 epochs in each of five bands, taken over a 4.5 year period). We present a novel template fitting technique that uses well-defined and physically motivated multi-band light curves of RR Lyrae stars, and demonstrate that we get accurate period estimates, precise to 2 s in > 80 % of cases. We augment these light-curve fits with other features from photometric time-series and provide them to progressively more detailed machine-learned classification models. From these models, we are able to select the widest (three-fourths of the sky) and deepest (reaching 120 kpc) sample of RR Lyrae stars to date. The PS1 sample of ˜45,000 RRab stars is pure (90%) and complete (80% at 80 kpc) at high galactic latitudes. It also provides distances that are precise to 3%, measured with newly derived period-luminosity relations for optical/near-infrared PS1 bands. With the addition of proper motions from Gaia and radial velocity measurements from multi-object spectroscopic surveys, we expect the PS1 sample of RR Lyrae stars to become the premier source for studying the structure, kinematics, and the gravitational potential of the Galactic halo. The techniques presented in this study should translate well to other sparse, multi-band data sets, such as those produced by the Dark Energy Survey and the upcoming Large Synoptic Survey Telescope Galactic plane sub-survey.
Guo, Yajuan; Ren, Ying; Wu, Haishun; Jia, Jianfeng
2013-12-01
Calcium borohydride is a potential candidate for onboard hydrogen storage because it has a high gravimetric capacity (11.5 wt.%) and a high volumetric hydrogen content (∼130 kg m(-3)). Unfortunately, calcium borohydride suffers from the drawback of having very strongly bound hydrogen. In this study, Ca(BH₄)₂ was predicted to form a destabilized system when it was mixed with LiBH₄, NaBH₄, or KBH₄. The release of hydrogen from Ca(BH₄)₂ was predicted to proceed via two competing reaction pathways (leading to CaB₆ and CaH₂ or CaB₁₂H₁₂ and CaH₂) that were found to have almost equal free energies. Using a set of recently developed theoretical methods derived from first principles, we predicted five new hydrogen storage reactions that are among the most attractive of those presently known. These combine high gravimetric densities (>6.0 wt.% H₂) with have low enthalpies [approximately 35 kJ/(mol(-1) H₂)] and are thermodynamically reversible at low pressure within the target window for onboard storage that is actively being considered for hydrogen storage applications. Thus, the first-principles theoretical design of new materials for energy storage in future research appears to be possible.
Thermal performance of Egypt's research reactor core (ET-RR-1)
International Nuclear Information System (INIS)
Khattab, M.; Mariy, A.
1986-01-01
The steady state thermal performance of the ET-RR-1 core system is theoretically investigated by different models describing the heat flux and the coolant mass flow rate. The magnitude of the heat generated by a fuel element depends upon its position in the core. Normal and uniform distributions for heat flux and coolant mass flow rate are considered. The clad and coolant temperatures at different core positions are evaluated and compared with the experimental measurements at different operating conditions. The results indicated large discrepancy between the predicted and the experimental results. Therefore, the previous models and the experimental results are evaluated in order to develop the best model that describes the thermal performance of the ET-RR-1 core. The adapted model gives 99.5% significant confidence limit. The effect of increasing the heat flux or decreasing the mass flow rate by 20% from its maximum recommended operating condition is tested and discussed. Also, the thermal behaviour towards increasing the reactor power more than its maximum operating condition is discussed. The present work could also be used in extending the investigation to other PWR reactor operating conditions
Test of time-reversal invariance at COSY (TRIC)
Energy Technology Data Exchange (ETDEWEB)
Eversheim, D., E-mail: evershei@hiskp.uni-bonn.de; Valdau, Yu. [University Bonn, Helmholtz Institut fuer Strahlen- und Kernphysik (Germany); Lorentz, B. [Forschungszentrum Juelich, Institut fuer Kernphysik (Germany)
2013-03-15
At the Cooler Synchrotron COSY a novel (P-even, T-odd) null test of time-reversal invariance to an accuracy of 10{sup - 6} is planned as an internal target transmission experiment. The parity conserving time-reversal violating observable is the total cross-section asymmetry A{sub y,xz}. This quantity is measured using a polarized proton beam with an energy of 135 MeV and an internal tensor polarized deuteron target from the PAX atomic beam source. The reaction rate will be measured by means of an integrating beam current transformer. Thus, in this experiment the cooler synchroton ring serves as ideal forward spectrometer, as a detector, and an accelerator.
Mimbacas, Adriana; Pérez-Bravo, Francisco; Hidalgo, Pedro C; Javiel, Gerardo; Pisciottano, Carmen; Grignola, Rosario; Jorge, Ana María; Gallino, Juan Pablo; Gasagoite, Jackeline; Cardoso, Horacio
2003-03-31
We studied HLA DQB1 allele frequencies and the relative risk (RR) of various genotypes in 72 type 1 diabetic patients and 40 control individuals in Uruguay. This is a tri-racial (Caucasian, Black and Indo-American) mixed population. The products of the polymerase chain reaction amplifications were hybridized with oligonucleotides by allele-specific oligonucleotide reverse or dot blot methods. Significant differences between these two groups were observed only for allele DQB1*0302 (35%, RR = 7.34, P<0.001). The frequency of the alleles carrying a non-aspartic acid residue at position 57 was significantly higher in the diabetic patients (85 vs 53%, P<0.001). In contrast, the frequency of Asp alleles was negatively associated with type 1 diabetes (RR = 0.20, P<0.001). The genotype DQB1*0302/DQB1*0201 (33%, RR = 5.41, P<0.05) was positively associated with this disease. The genotype frequencies associated with type 1 diabetes in our population were significantly different from what is known for Caucasian and Black populations as well as compared with another admixed population, from Chile.
Directory of Open Access Journals (Sweden)
Mathias Baumert
2014-12-01
Full Text Available Autonomic activity affects beat-to-beat variability of heart rate and QT interval. The aim of this study was to explore whether entropy measures are suitable to detect changes in neural outflow to the heart elicited by two different stress paradigms. We recorded short-term ECG in 11 normal subjects during an experimental protocol that involved head-up tilt and mental arithmetic stress and computed sample entropy, cross-sample entropy and causal interactions based on conditional entropy from RR and QT interval time series. Head-up tilt resulted in a significant reduction in sample entropy of RR intervals and cross-sample entropy, while mental arithmetic stress resulted in a significant reduction in coupling directed from RR to QT. In conclusion, measures of entropy are suitable to detect changes in neural outflow to the heart and decoupling of repolarisation variability from heart rate variability elicited by orthostatic or mental arithmetic stress.
DEFF Research Database (Denmark)
Reimann, M. J.; Moller, J. E.; Haggstrom, J.
2014-01-01
of congestive heart failure due to MMVD. The severity of MR was evaluated in apical four-chamber view using colour Doppler flow mapping (maximum % of the left atrium area) and colour Doppler M-mode (duration in ms). The influence of the ratio between present and preceding R-R interval on MR severity......Mitral regurgitation (MR) due to myxomatous mitral valve disease (MMVD) is a frequent finding in Cavalier King Charles Spaniels (CKCSs). Sinus arrhythmia and atrial premature complexes leading to R-R interval variations occur in dogs. The aim of the study was to evaluate whether the duration...... of the RR interval immediately influences the degree of MR assessed by echocardiography in dogs. Clinical examination including echocardiography was performed in 103 privately-owned dogs: 16 control Beagles, 70 CKCSs with different degree of MR and 17 dogs of different breeds with clinical signs...
Energy Technology Data Exchange (ETDEWEB)
Ngeow, Chow-Choong [Graduate Institute of Astronomy, National Central University, Jhongli 32001, Taiwan (China); Kanbur, Shashi M.; Schrecengost, Zachariah [Department of Physics, SUNY Oswego, Oswego, NY 13126 (United States); Bhardwaj, Anupam; Singh, Harinder P. [Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India)
2017-01-10
Investigation of period–color (PC) and amplitude–color (AC) relations at the maximum and minimum light can be used to probe the interaction of the hydrogen ionization front (HIF) with the photosphere and the radiation hydrodynamics of the outer envelopes of Cepheids and RR Lyraes. For example, theoretical calculations indicated that such interactions would occur at minimum light for RR Lyrae and result in a flatter PC relation. In the past, the PC and AC relations have been investigated by using either the ( V − R ){sub MACHO} or ( V − I ) colors. In this work, we extend previous work to other bands by analyzing the RR Lyraes in the Sloan Digital Sky Survey Stripe 82 Region. Multi-epoch data are available for RR Lyraes located within the footprint of the Stripe 82 Region in five ( ugriz ) bands. We present the PC and AC relations at maximum and minimum light in four colors: ( u − g ){sub 0}, ( g − r ){sub 0}, ( r − i ){sub 0}, and ( i − z ){sub 0}, after they are corrected for extinction. We found that the PC and AC relations for this sample of RR Lyraes show a complex nature in the form of flat, linear or quadratic relations. Furthermore, the PC relations at minimum light for fundamental mode RR Lyrae stars are separated according to the Oosterhoff type, especially in the ( g − r ){sub 0} and ( r − i ){sub 0} colors. If only considering the results from linear regressions, our results are quantitatively consistent with the theory of HIF-photosphere interaction for both fundamental and first overtone RR Lyraes.
EPIC 201585823, a rare triple-mode RR Lyrae star discovered in K2 mission data
DEFF Research Database (Denmark)
Kurtz, Donald W.; Bowman, Dominic M.; Ebo, Simon J.
2016-01-01
We have discovered a new, rare triple-mode RR Lyr star, EPIC 201585823, in the Kepler K2 mission Campaign 1 data. This star pulsates primarily in the fundamental and first-overtone radial modes, and, in addition, a third non-radial mode. The ratio of the period of the non-radial mode...... pixels with significant signal for the star, but without correction for pointing changes, is best for frequency analysis of this star, and, by implication, other RR Lyr stars observed by the K2 mission. We compare several pipeline reductions of the K2 mission data for this star....
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity
House, M.L.; Kim, C.H.; Reno, P.W.
1998-01-01
Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.
Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D
2015-01-01
Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.
Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; van den Berg, Albert; Olthuis, Wouter; Pascual-García, César
2017-11-13
The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used electrochemical and photo-polymerisation in neutral buffers and plasma polymerisation in air to induce reversible redox states. The chemical stoichiometry and surface coverage of PATP in the polymerized layers were characterized by X-ray photoelectron spectroscopy (XPS), while cyclic voltammetry (CV) was used to measure the charge transfer, double layer capacitance and electrochemical rate of the layers during successive potential cycles. Our results show that the surface coverage of the redox active species is higher on electro-polymerised samples, however, after consecutive cycles all the methods converge to the same charge transfer, while the plasma polymerised samples achieve higher efficiency per molecule and UV polymerised samples have a higher electron transfer rate.
Confining Domains Lead to Reaction Bursts: Reaction Kinetics in the Plasma Membrane
Kalay, Ziya; Fujiwara, Takahiro K.; Kusumi, Akihiro
2012-01-01
Confinement of molecules in specific small volumes and areas within a cell is likely to be a general strategy that is developed during evolution for regulating the interactions and functions of biomolecules. The cellular plasma membrane, which is the outermost membrane that surrounds the entire cell, was considered to be a continuous two-dimensional liquid, but it is becoming clear that it consists of numerous nano-meso-scale domains with various lifetimes, such as raft domains and cytoskeleton-induced compartments, and membrane molecules are dynamically trapped in these domains. In this article, we give a theoretical account on the effects of molecular confinement on reversible bimolecular reactions in a partitioned surface such as the plasma membrane. By performing simulations based on a lattice-based model of diffusion and reaction, we found that in the presence of membrane partitioning, bimolecular reactions that occur in each compartment proceed in bursts during which the reaction rate is sharply and briefly increased even though the asymptotic reaction rate remains the same. We characterized the time between reaction bursts and the burst amplitude as a function of the model parameters, and discussed the biological significance of the reaction bursts in the presence of strong inhibitor activity. PMID:22479350
Confining domains lead to reaction bursts: reaction kinetics in the plasma membrane.
Directory of Open Access Journals (Sweden)
Ziya Kalay
Full Text Available Confinement of molecules in specific small volumes and areas within a cell is likely to be a general strategy that is developed during evolution for regulating the interactions and functions of biomolecules. The cellular plasma membrane, which is the outermost membrane that surrounds the entire cell, was considered to be a continuous two-dimensional liquid, but it is becoming clear that it consists of numerous nano-meso-scale domains with various lifetimes, such as raft domains and cytoskeleton-induced compartments, and membrane molecules are dynamically trapped in these domains. In this article, we give a theoretical account on the effects of molecular confinement on reversible bimolecular reactions in a partitioned surface such as the plasma membrane. By performing simulations based on a lattice-based model of diffusion and reaction, we found that in the presence of membrane partitioning, bimolecular reactions that occur in each compartment proceed in bursts during which the reaction rate is sharply and briefly increased even though the asymptotic reaction rate remains the same. We characterized the time between reaction bursts and the burst amplitude as a function of the model parameters, and discussed the biological significance of the reaction bursts in the presence of strong inhibitor activity.
Directory of Open Access Journals (Sweden)
Cui Shang-jin
2010-05-01
Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.
2010-01-01
A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759
Pervaporation applied for dewatering of reaction mixture during esterification
Krasiński Andrzej; Wierzba Patrycja; Grudzień Agata; Hajmowicz Halina; Zawada Krzysztof; Synoradzki Ludwik
2016-01-01
In this work the esterification of diethyl tartrate was studied. The research was focused on the enhancement of reversible reaction yield, which is accomplished by dewatering of the reaction mixture. The removal of water shifts the equilibrium towards the main product. Pervaporation was applied for this purpose, and results were compared to distillation. The advantages and limitations of both processes are discussed. The experimental part consists of dewatering of mixture after the reaction h...
Transfer and breakup reactions at intermediate energies
International Nuclear Information System (INIS)
Stokstad, R.G.
1986-04-01
The origin of the quasi-elastic peak in peripheral heavy-ion reactions is discussed in terms of inelastic scattering and transfer reactions to unbound states of the primary projectile-like fragment. The situation is analogous to the use of reverse kinematics in fusion reactions, a technique in which the object of study is moving with nearly the beam velocity. It appears that several important features of the quasi-elastic peak may be explained by this approach. Projectile-breakup reactions have attractive features for the study of nuclear structure. They may also be used to determine the partition of excitation energy in peripheral reactions. At intermediate energies, neutron-pickup reactions leading to four-body final states become important. Examples of experiments are presented that illustrate these points. 15 refs., 14 figs
The Half RR Rule: A Poor Rule of Thumb and Not a Risk Assessment Tool for QT Interval Prolongation.
Berling, Ingrid; Isbister, Geoffrey K
2015-10-01
Measuring the QT interval on an electrocardiogram (ECG) is integral to risk assessment of Torsade de Pointes (TdP). This study aimed to investigate the accuracy of the 1/2 RR rule as a risk assessment tool for drug-induced TdP, comparing it to the QT nomogram, Bazett's corrected QT (QTcB), and Fridericia's corrected QT (QTcF). The authors calculated sensitivity and specificity of the 1/2 RR rule using a published data set of 129 cases of drug-induced TdP and 316 controls (noncardiotoxic overdoses), compared to the QT nomogram, QTcB > 500 msec and QTcF > 500 msec. To further determine the value of the 1/2 RR rule, its observed positive, and negative agreement were calculated when compared to the QT nomogram for determining an abnormal QT in eight samples of different drugs in overdose. The sensitivity and specificity of the 1/2 RR rule were 88% (95% confidence interval [CI] = 80% to 93%) and 53% (95% CI = 47% to 58%), respectively, compared to the QT nomogram (sensitivity = 97%, 95% CI = 92% to 99%; specificity = 99%, 95% CI = 97% to 100%). It was also less sensitive than QTcB > 500 msec and had a lower specificity than QTcB > 500 msec and QTcF > 500 msec. In drug overdose patients, the 1/2 RR rule had poor observed agreement averaging 41%, which was mainly due to poor positive agreement, except for amisulpride where there was good agreement. The 1/2 RR rule was not as sensitive as the QT nomogram or QTcB > 500 msec for drug-induced TdP. It had poor positive agreement in almost all overdose patients, resulting in over half of patients receiving unnecessary cardiac monitoring and repeat ECGs. © 2015 by the Society for Academic Emergency Medicine.
International Nuclear Information System (INIS)
Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong
2004-01-01
A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes
Bernard, Edouard J.; Gallart, Carme; Monelli, Matteo; Aparicio, Antonio; Cassisi, Santi; Skillman, Evan D.; Stetson, Peter B.; Cole, Andrew A.; Drozdovsky, Igor; Hidalgo, Sebastian L.; Mateo, Mario; Tolstoy, Eline
2008-01-01
We present a study of the radial distribution of RR Lyrae variables, which present a range of photometric and pulsational properties, in the dwarf spheroidal galaxy Tucana. We find that the fainter RR Lyrae stars, having a shorter period, are more centrally concentrated than the more luminous,
Toothpick test: a methodology for the detection of RR soybean plants1
Directory of Open Access Journals (Sweden)
Fabiana Mota da Silva
Full Text Available Due to the large increase in the area cultivated with genetically modified soybean in Brazil, it has become necessary to determine methods that are fast and efficient for detecting these cultivars. The aim of this work was to test the efficiency of the toothpick method in the detection of RR soybean plants, as well as to distinguish between cultivars, for sensitivity caused by herbicide. Ten transgenic soybean cultivars, resistant to the active ingredient glyphosate, and ten conventional soybean cultivars were used. Toothpicks soaked in glyphosate were applied to all the plants at stage V6 and evaluations were made at 2, 4, 6, 8 and 10 days after application (DAA. The effects of the glyphosate on the cultivars, and the symptoms of phytotoxicity caused in the transgenic plants were evaluated by means of grading scales. The toothpick test is effective in identifying RR soybean cultivars and also in separating them into groups by sensitivity to the symptoms caused by the glyphosate.
Directory of Open Access Journals (Sweden)
C Coelho
2003-06-01
Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.
International Nuclear Information System (INIS)
Khattab, M.; Mina, A.R.
1990-01-01
Measurements of pressure drop through a bundle comprising 16 rods and their lower arrangement grid as well as orifices similar to those of ET-RR-1 core have been done. Experiments are carried out under adiabatic turbulent flow conditions at about 35 degree C. Bundle Reynolds number range is 4 x 10 -2 x 10. Orifices of diameters 4.5, 3.25 or 2.5 cm. are mounted underneath the bundle. The bundle and lower grid pressure drop coefficients are 3.75 and 1.8 respectively. Orifices pressure drop coefficients are 2.65, 19.67 and 53.55 respectively. The ratio of bundle pressure drop to that of 4.5 cm. Orifice diameter is 1.415. The pressure drop coefficients are utilizer to calculate flow through bundles. The flow rate per bundle is 39.1, 20.4 or 13.1 m 3 /hr. Depending on orifice diameter
Reddening and blanketing of RR-Lyrae stars, ch. 3
International Nuclear Information System (INIS)
Lub, J.
1977-01-01
The effects of metal line blanketing and interstellar reddening upon the colours of the RR-Lyrae Stars are discussed. Due to the faintness of these stars in the ultraviolet W channel (at lambda 3720 A) the photometry is in most cases reduced to a four-colour VBLU photometry, i.e. there are only three colour indices available for the determination of the four quantities: interstellar reddening, effective temperature, atmospheric pressure (or effective gravity), and metal line strength which determine the energy distribution that was measured
Reference genes for reverse transcription quantitative PCR in canine brain tissue
Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C
2015-01-01
BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and
Effect of lateralized design on muscle and joint reaction forces for reverse shoulder arthroplasty.
Liou, William; Yang, Yang; Petersen-Fitts, Graysen R; Lombardo, Daniel J; Stine, Sasha; Sabesan, Vani J
2017-04-01
Manufacturers of reverse shoulder arthroplasty (RSA) implants have recently designed innovative implants to optimize performance in rotator cuff-deficient shoulders. These advancements are not without tradeoffs and can have negative biomechanical effects. The objective of this study was to develop an integrated finite element analysis-kinematic model to compare the muscle forces and joint reaction forces (JRFs) of 3 different RSA designs. A kinematic model of a normal shoulder joint was adapted from the Delft model and integrated with the well-validated OpenSim shoulder model. Static optimizations then allowed for calculation of the individual muscle forces, moment arms, and JRFs relative to net joint moments. Three-dimensional computer models of 3 RSA designs-humeral lateralized design (HLD), glenoid lateralized design, and Grammont design-were integrated, and parametric studies were performed. Overall, there were decreases in deltoid and rotator cuff muscle forces for all 3 RSA designs. These decreases were greatest in the middle deltoid of the HLD model for abduction and flexion and in the rotator cuff muscles under both internal rotation and external rotation. The JRFs in abduction and flexion decreased similarly for all RSA designs compared with the normal shoulder model, with the greatest decrease seen in the HLD model. These findings demonstrate that the design characteristics implicit in these modified RSA prostheses result in mechanical differences most prominently seen in the deltoid muscle and overall JRFs. Further research using this novel integrated model can help guide continued optimization of RSA design and clinical outcomes. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.
Reversal of liver fibrosis: From fiction to reality.
Zoubek, Miguel Eugenio; Trautwein, Christian; Strnad, Pavel
2017-04-01
In chronic liver diseases, an ongoing hepatocellular injury together with inflammatory reaction results in activation of hepatic stellate cells (HSCs) and increased deposition of extracellular matrix (ECM) termed as liver fibrosis. It can progress to cirrhosis that is characterized by parenchymal and vascular architectural changes together with the presence of regenerative nodules. Even at late stage, liver fibrosis is reversible and the underlying mechanisms include a switch in the inflammatory environment, elimination or regression of activated HSCs and degradation of ECM. While animal models have been indispensable for our understanding of liver fibrosis, they possess several important limitations and need to be further refined. A better insight into the liver fibrogenesis resulted in a large number of clinical trials aiming at reversing liver fibrosis, particularly in patients with non-alcoholic steatohepatitis. Collectively, the current developments demonstrate that reversal of liver fibrosis is turning from fiction to reality. Copyright © 2017. Published by Elsevier Ltd.
Chemical-looping combustion in a reverse-flow fixed bed reactor
International Nuclear Information System (INIS)
Han, Lu; Bollas, George M.
2016-01-01
A reverse-flow fixed bed reactor concept for CLC (chemical-looping combustion) is explored. The limitations of conventional fixed bed reactors, as applied to CLC, are overcome by reversing the gas flow direction periodically to enhance the mixing characteristics of the bed, thus improving oxygen carrier utilization and energy efficiency with respect to power generation. The reverse-flow reactor is simulated by a dusty-gas model and compared with an equivalent fixed bed reactor without flow reversal. Dynamic optimization is used to calculate conditions at which each reactor operates at maximum energy efficiency. Several cases studies illustrate the benefits of reverse-flow operation for the CLC with CuO and NiO oxygen carriers and methane and syngas fuels. The results show that periodic reversal of the flow during reduction improves the contact between the fuel and unconverted oxygen carrier, enabling the system to suppress unwanted catalytic reactions and axial temperature and conversion gradients. The operational scheme presented reduces the fluctuations of temperature during oxidation and increases the high-temperature heat produced by the process. CLC in a reverse-flow reactor has the potential to achieve higher energy efficiency than conventional fixed bed CLC reactors, when integrated with a downstream gas turbine of a combined cycle power plant. - Highlights: • Reverse-flow fixed bed CLC reactors for combined cycle power systems. • Dynamic optimization tunes operation of batch and transient CLC systems. • The reverse-flow CLC system provides stable turbine-ready gas stream. • Reverse-flow CLC fixed bed reactor has superior CO 2 capture and thermal efficiency.
From a Viewpoint of Clinical Settings: Pharmacoepidemiology as Reverse Translational Research (rTR).
Kawakami, Junichi
2017-01-01
Clinical pharmacology and pharmacoepidemiology research may converge in practise. Pharmacoepidemiology is the study of pharmacotherapy and risk management in patient groups. For many drugs, adverse reaction(s) that were not seen and/or clarified during research and development stages have been reported in the real world. Pharmacoepidemiology can detect and verify adverse drug reactions as reverse translational research. Recently, development and effective use of medical information databases (MID) have been conducted in Japan and elsewhere for the purpose of post-marketing safety of drugs. The Ministry of Health, Labour and Welfare, Japan has been promoting the development of 10-million scale database in 10 hospitals and hospital groups as "the infrastructure project of medical information database (MID-NET)". This project enables estimation of the frequency of adverse reactions, the distinction between drug-induced reactions and basal health-condition changes, and usefulness verification of administrative measures of drug safety. However, because the database information is different from detailed medical records, construction of methodologies for the detection and evaluation of adverse reactions is required. We have been performing database research using medical information system in some hospitals to establish and demonstrate useful methods for post-marketing safety. In this symposium, we aim to discuss the possibility of reverse translational research from clinical settings and provide an introduction to our research.
Reversible flowchart languages and the structured reversible program theorem
DEFF Research Database (Denmark)
Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert
2008-01-01
Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...
Electrically Reversible Redox-Switchable Polydopamine Films for Regulating Cell Behavior
International Nuclear Information System (INIS)
Tan, Guoxin; Liu, Yan; Wu, Yuxuan; Ouyang, Kongyou; Zhou, Lei; Yu, Peng; Liao, Jinwen; Ning, Chengyun
2017-01-01
Highlights: • The phenolic/quinone groups on polydopamine can redox-switchable reversible under electrical stimulation. • The quinone groups on PDA (oxidized PDA) enhanced cell spreading and proliferation. • The phenolic groups on PDA (reduced PDA) induced cell differentiation. - Abstract: Switchable surfaces that respond to external stimuli are important for regulating cell behavior. The results herein suggest that the redox process of polydopamine (PDA) is a switching reaction between oxidized polydopamine and reduced polydopamine, involving an interconversion of coupled two-proton (2H + ) and two-electron (2e − ) processes. The redox-switchable reversible surface potential arising from the potential-tunable redox reaction of the phenolic and quinone groups on PDA on titanium induced both cell adhesion and spreading. In vitro experiments demonstrated that the quinone groups on PDA greatly enhanced pre-osteoblasts MC3T3-E1 cell spreading and proliferation. Phenolic groups enhanced the induction of differentiation. The proposed methodology may allow further investigation of switchable surfaces for biological and medical applications.
Solid-phase synthesis of protein-polymers on reversible immobilization supports.
Murata, Hironobu; Carmali, Sheiliza; Baker, Stefanie L; Matyjaszewski, Krzysztof; Russell, Alan J
2018-02-27
Facile automated biomacromolecule synthesis is at the heart of blending synthetic and biologic worlds. Full access to abiotic/biotic synthetic diversity first occurred when chemistry was developed to grow nucleic acids and peptides from reversibly immobilized precursors. Protein-polymer conjugates, however, have always been synthesized in solution in multi-step, multi-day processes that couple innovative chemistry with challenging purification. Here we report the generation of protein-polymer hybrids synthesized by protein-ATRP on reversible immobilization supports (PARIS). We utilized modified agarose beads to covalently and reversibly couple to proteins in amino-specific reactions. We then modified reversibly immobilized proteins with protein-reactive ATRP initiators and, after ATRP, we released and analyzed the protein polymers. The activity and stability of PARIS-synthesized and solution-synthesized conjugates demonstrated that PARIS was an effective, rapid, and simple method to generate protein-polymer conjugates. Automation of PARIS significantly reduced synthesis/purification timelines, thereby opening a path to changing how to generate protein-polymer conjugates.
Rodent Research-1 (RR1) NASA Validation Flight: Mouse eye transcriptomic and epigenomic data
National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...
Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof
2012-05-15
Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.
Hatada, Naoyuki; Shizume, Kunihiko; Uda, Tetsuya
2017-07-01
Thermal energy storage based on chemical reactions is a prospective technology for the reduction of fossil-fuel consumption by storing and using waste heat. For widespread application, a critical challenge is to identify appropriate reversible reactions that occur below 250 °C, where abundant low-grade waste heat and solar energy might be available. Here, it is shown that lanthanum sulfate monohydrate La 2 (SO 4 ) 3 ⋅H 2 O undergoes rapid and reversible dehydration/hydration reactions in the temperature range from 50 to 250 °C upon heating/cooling with remarkably small thermal hysteresis (water is removed from, or inserted in La 2 (SO 4 ) 3 ⋅H 2 O with progressive change in hydration number x without phase change. It is also revealed that only a specific structural modification of La 2 (SO 4 ) 3 exhibits this reversible dehydration/hydration behavior. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Probing the RAFT process using a model reaction between alkoxyamine and dithioester
Zhou, Y.
2012-01-01
A small-molecular model reaction was designed to probe the reversible addition–fragmentation chain transfer (RAFT) process. In this reaction, alkoxyamine releases radicals that react in situ with dithioester through the RAFT process, generating new radicals through the fragmentation of the
Leclercq, Eugénie; Cabaret, Maryline; Guilbert, Alma; Jougleux, Caroline; Vermersch, Patrick; Moroni, Christine
2014-09-01
The aim of this study was to dissociate age and duration of illness effects on cognitive impairment of patients with relapsing-remitting multiple sclerosis. Cognitive impairment among patients with multiple sclerosis (MS) is well known. However, few studies were devoted to assess the respective role of disease duration and age on cognitive functions in MS patients. Therefore, two studies were carried out on relapsing-remitting MS (RR-MS) patients using some tests of the BCcogSEP--a French test battery evaluating cognitive functions in MS. The cognitive deficits of RR-MS patients aged 50 years and over and whose symptoms had been present for more than 20 years were more severe than those of MS patients with a shorter illness duration (less than 10 years) or matched-age control participants. The more impaired cognitive functions were information-processing speed, episodic memory, verbal fluency and attention. On the other hand, cognitive performances of young RR-MS patients were similar to those of older RR-MS patients when all patients had the same illness duration (8 years in this study). Older patients even achieved better performance than younger ones on verbal fluency. This can be partly explained by the theory of cognitive reserve, as reported in previous cognitive aging studies. In RR-MS patients, the influence of illness duration seems to be a predominant factor in the development of cognitive impairment.
Modeling of uncertainties in biochemical reactions.
Mišković, Ljubiša; Hatzimanikatis, Vassily
2011-02-01
Mathematical modeling is an indispensable tool for research and development in biotechnology and bioengineering. The formulation of kinetic models of biochemical networks depends on knowledge of the kinetic properties of the enzymes of the individual reactions. However, kinetic data acquired from experimental observations bring along uncertainties due to various experimental conditions and measurement methods. In this contribution, we propose a novel way to model the uncertainty in the enzyme kinetics and to predict quantitatively the responses of metabolic reactions to the changes in enzyme activities under uncertainty. The proposed methodology accounts explicitly for mechanistic properties of enzymes and physico-chemical and thermodynamic constraints, and is based on formalism from systems theory and metabolic control analysis. We achieve this by observing that kinetic responses of metabolic reactions depend: (i) on the distribution of the enzymes among their free form and all reactive states; (ii) on the equilibrium displacements of the overall reaction and that of the individual enzymatic steps; and (iii) on the net fluxes through the enzyme. Relying on this observation, we develop a novel, efficient Monte Carlo sampling procedure to generate all states within a metabolic reaction that satisfy imposed constrains. Thus, we derive the statistics of the expected responses of the metabolic reactions to changes in enzyme levels and activities, in the levels of metabolites, and in the values of the kinetic parameters. We present aspects of the proposed framework through an example of the fundamental three-step reversible enzymatic reaction mechanism. We demonstrate that the equilibrium displacements of the individual enzymatic steps have an important influence on kinetic responses of the enzyme. Furthermore, we derive the conditions that must be satisfied by a reversible three-step enzymatic reaction operating far away from the equilibrium in order to respond to
Extended Aperture Photometry of K2 RR Lyrae stars
Plachy, Emese; Klagyivik, Péter; Molnár, László; Sódor, Ádám; Szabó, Róbert
2017-10-01
We present the method of the Extended Aperture Photometry (EAP) that we applied on K2 RR Lyrae stars. Our aim is to minimize the instrumental variations of attitude control maneuvers by using apertures that cover the positional changes in the field of view thus contain the stars during the whole observation. We present example light curves that we compared to the light curves from the K2 Systematics Correction (K2SC) pipeline applied on the automated Single Aperture Photometry (SAP) and on the Pre-search Data Conditioning Simple Aperture Photometry (PDCSAP) data.
DEFF Research Database (Denmark)
Szabó, R.; Kollath, Z.; Molnár, L.
2010-01-01
-doubling bifurcation in our non-linear RR Lyrae models computed by the Florida-Budapest hydrocode. This enabled us to trace the origin of this instability in RR Lyrae stars to a resonance, namely a 9:2 resonance between the fundamental mode and a high-order (ninth) radial overtone showing strange-mode characteristics...
RR Lyrae and BL Herculis variables
International Nuclear Information System (INIS)
Cox, A.N.
1980-01-01
The RR Lyrae variables are currently believed to have masses between about 0.5 and 0.8 M/sub solar mass/, effective surface temperatures between 6350 and 7500 0 K, radii from about 4.0 to 6.0 R/sub solar mass/ and luminosities between log L/L/sub solar mass/ of 1.5 and 2.0. Since they are found in population II locations, they generally have Y = 0.3 and Z = 10 -3 , but there are exceptions for both higher Z like the sun and lower Z like 0.0002. In globular clusters the periods range from 0.25 to 0.45 day for the first overtone pulsators and 0.40 to 0.80 day for those in the fundamental mode, depending on their luminosity. At transition lines, discussed in detail, the switch from fundamental to first overtone, or maybe vice versa, involves a period change factor of about 0.74 to 0.75
The 8Li(α,n)11B reaction and primordial nucleosynthesis
International Nuclear Information System (INIS)
Boyd, R.N.
1992-01-01
The cross section for the 8 Li(α,n) 11 B reaction, of importance to synthesis of 11 B and heavier nuclides following the big bang, has been measured using the radioactive beam facility of The Institute of Physical and Chemical Reasearch (RIKEN). The reaction cross section was found to be about five times larger than that estimated from the time reversed reaction cross section. (author)
2011-04-12
... inspections of the MCD. We are issuing this AD to prevent in-flight engine shutdowns caused by step aside... Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 768-60 and Trent 772-60 Turbofan Engines AGENCY... superseding an existing airworthiness directive (AD) for RR RB211-Trent 700 series turbofan engines. That AD...
Leung, K. C.
1989-01-01
Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.
Redox reactions of neptunium in tributyl phosphate-dodecane mixtures
International Nuclear Information System (INIS)
Wehrey, F.
1989-01-01
In relation with the reprocessing of irradiated fuels, disproportionation and oxidation by nitric acid of pentavalent neptunium in tributyl phosphate-dodecane mixtures have been studied. The experimental part of this work is based on spectrophotometric measurements. The disproportionation of pentavalent neptunium in organic perchloric medium is a second order reaction with respect to neptunium V. The reaction rate is strongly influenced by the perchloric acid concentration and has a higher value than in an aqueous medium. The reverse reaction in nitric media is a first order with respect to tetravalent and hexavalent ions. The reaction rate is a function of the reverse of the square of the nitric acid concentration. The energy of activation is the same than in aqueous medium. The oxidation rate of pentavalent neptunium by nitric acid is increased by nitrous acid. When no nitrous acid is added to the mixture, the reaction revealed to be autocatalytic, possesses an induction period. When nitrous and nitric acids are in excess to neptunium the reaction is first order with respect to neptunium. The reaction rate depends on the concentration of nitric acid and is a linear function of the concentration of nitrous acid. In tributyl phosphate dodecane mixtures the reaction occurs spontaneously. It is not the case in aqueous media. The values of thermodynamical and kinetical constants determined in this work could be used in a modelization of the behavior of neptunium in the reprocessing of irradiated fuels, which has to eliminate this element among its tasks [fr
Phosphite radicals and their reactions. Examples of redox, substitution, and addition reactions
International Nuclear Information System (INIS)
Schaefer, K.; Asmus, K.D.
1980-01-01
Phosphite radicals HPO 3 - and PO 3 2 -, which exist in an acid-base equilibrium with pK = 5.75, are shown to take part in various types of reactions. In the absence of scavengers, they disappear mainly by second-order disproportionation and combination; a first-order contribution to the decay is also indicated. HPO 3 - and PO 3 2 - are good reductants toward electron acceptors such as tetranitromethane. In this reaction phosphate and C(NO 2 ) 3 - are formed. Phosphite radicals can, however, also act as good oxidants, e.g., toward thiols and thiolate ions. These reactions lead to the formation of RS. radicals which were identified either directly, as in the case of penicillamine, through the optical absorption of PenS. or more indirectly through equilibration of RS. with RS- to the optically absorbing RSSR-. disulfide radical anion. A homolytic substitution reaction (S/sub H/2) occurs in the reaction of the phosphite radicals with aliphatic disulfides, yielding RS. radicals and phosphate thioester RSPO 3 2 -. Lipoic acid, as an example of a cyclic disulfide, is reduced to the corresponding RSSR-. radical anion and also undergoes the S/sub H/2 reaction with about equal probability. An addition reaction is observed between phosphite radicals and molecular oxygen. The resulting peroxo phosphate radicals establish an acid-base equilibrium HPO 5 - . reversible PO 5 2- . + H+ with a pK = 3.4. Absolute rate constants were determined for all reactions discussed
Gated current integrator for the beam in the RR barrier buckets
Energy Technology Data Exchange (ETDEWEB)
A. Cadorn; C. Bhat; J. Crisp
2003-06-10
At the Fermilab Recycler Ring (RR), the antiproton (pbar) beam will be stored azimuthally in different segments created by barrier buckets. The beam in each segment may have widely varying intensities. They have developed a gated integrator system to measure the beam intensity in each of the barrier bucket. Here they discuss the design of the system and the results of beam measurements using the integrator.
The investigation on electrochemical reaction mechanism of CuF2 thin film with lithium
International Nuclear Information System (INIS)
Cui Yanhua; Xue Mingzhe; Zhou Yongning; Peng Shuming; Wang Xiaolin; Fu Zhengwen
2011-01-01
Crystalline CuF 2 thin films were prepared by pulsed laser deposition under room temperature. The physical and electrochemical properties of the as-deposited thin films have been investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), galvanostatic cycling and cyclic voltammetry (CV). Reversible capacity of 544 mAh g -1 was achieved in the potential range of 1.0-4.0 V. A reversible couple of redox peaks at 3.0 V and 3.7 V was firstly observed. By using ex situ XRD and TEM techniques, an insertion process followed by a fully conversion reaction to Cu and LiF was revealed in the lithium electrochemical reaction of CuF 2 thin film electrode. The reversible insertion reaction above 2.8 V could provide a capacity of about 125 mAh g -1 , which makes CuF 2 a potential cathode material for rechargeable lithium batteries.
Time-reversal symmetry breaking in quantum billiards
Energy Technology Data Exchange (ETDEWEB)
Schaefer, Florian
2009-01-26
The present doctoral thesis describes experimentally measured properties of the resonance spectra of flat microwave billiards with partially broken timereversal invariance induced by an embedded magnetized ferrite. A vector network analyzer determines the complex scattering matrix elements. The data is interpreted in terms of the scattering formalism developed in nuclear physics. At low excitation frequencies the scattering matrix displays isolated resonances. At these the effect of the ferrite on isolated resonances (singlets) and pairs of nearly degenerate resonances (doublets) is investigated. The hallmark of time-reversal symmetry breaking is the violation of reciprocity, i.e. of the symmetry of the scattering matrix. One finds that reciprocity holds in singlets; it is violated in doublets. This is modeled by an effective Hamiltonian of the resonator. A comparison of the model to the data yields time-reversal symmetry breaking matrix elements in the order of the level spacing. Their dependence on the magnetization of the ferrite is understood in terms of its magnetic properties. At higher excitation frequencies the resonances overlap and the scattering matrix elements fluctuate irregularly (Ericson fluctuations). They are analyzed in terms of correlation functions. The data are compared to three models based on random matrix theory. The model by Verbaarschot, Weidenmueller and Zirnbauer describes time-reversal invariant scattering processes. The one by Fyodorov, Savin and Sommers achieves the same for systems with complete time-reversal symmetry breaking. An extended model has been developed that accounts for partial breaking of time-reversal invariance. This extended model is in general agreement with the data, while the applicability of the other two models is limited. The cross-correlation function between forward and backward reactions determines the time-reversal symmetry breaking matrix elements of the Hamiltonian to up to 0.3 mean level spacings. Finally
Time-reversal symmetry breaking in quantum billiards
International Nuclear Information System (INIS)
Schaefer, Florian
2009-01-01
The present doctoral thesis describes experimentally measured properties of the resonance spectra of flat microwave billiards with partially broken timereversal invariance induced by an embedded magnetized ferrite. A vector network analyzer determines the complex scattering matrix elements. The data is interpreted in terms of the scattering formalism developed in nuclear physics. At low excitation frequencies the scattering matrix displays isolated resonances. At these the effect of the ferrite on isolated resonances (singlets) and pairs of nearly degenerate resonances (doublets) is investigated. The hallmark of time-reversal symmetry breaking is the violation of reciprocity, i.e. of the symmetry of the scattering matrix. One finds that reciprocity holds in singlets; it is violated in doublets. This is modeled by an effective Hamiltonian of the resonator. A comparison of the model to the data yields time-reversal symmetry breaking matrix elements in the order of the level spacing. Their dependence on the magnetization of the ferrite is understood in terms of its magnetic properties. At higher excitation frequencies the resonances overlap and the scattering matrix elements fluctuate irregularly (Ericson fluctuations). They are analyzed in terms of correlation functions. The data are compared to three models based on random matrix theory. The model by Verbaarschot, Weidenmueller and Zirnbauer describes time-reversal invariant scattering processes. The one by Fyodorov, Savin and Sommers achieves the same for systems with complete time-reversal symmetry breaking. An extended model has been developed that accounts for partial breaking of time-reversal invariance. This extended model is in general agreement with the data, while the applicability of the other two models is limited. The cross-correlation function between forward and backward reactions determines the time-reversal symmetry breaking matrix elements of the Hamiltonian to up to 0.3 mean level spacings. Finally
International Nuclear Information System (INIS)
Contreras, R.; Catelan, M.; Smith, H. A.; Kuehn, C. A.; Pritzl, B. J.; Borissova, J.
2010-01-01
We present new time-series CCD photometry, in the B and V bands, for the moderately metal-rich ([Fe/H] ≅ -1.3) Galactic globular cluster M62 (NGC 6266). The present data set is the largest obtained so far for this cluster and consists of 168 images per filter, obtained with the Warsaw 1.3 m telescope at the Las Campanas Observatory and the 1.3 m telescope of the Cerro Tololo Inter-American Observatory, in two separate runs over the time span of 3 months. The procedure adopted to detect the variable stars was the optimal image subtraction method (ISIS v2.2), as implemented by Alard. The photometry was performed using both ISIS and Stetson's DAOPHOT/ALLFRAME package. We have identified 245 variable stars in the cluster fields that have been analyzed so far, of which 179 are new discoveries. Of these variables, 133 are fundamental mode RR Lyrae stars (RRab), 76 are first overtone (RRc) pulsators, 4 are type II Cepheids, 25 are long-period variables (LPVs), 1 is an eclipsing binary, and 6 are not yet well classified. Such a large number of RR Lyrae stars places M62 among the top two most RR Lyrae-rich (in the sense of total number of RR Lyrae stars present) globular clusters known in the Galaxy, second only to M3 (NGC 5272) with a total of 230 known RR Lyrae stars. Since this study covers most but not all of the cluster area, it is not unlikely that M62 is in fact the most RR Lyrae-rich globular cluster in the Galaxy. In like vein, thanks to the time coverage of our data sets, we were also able to detect the largest sample of LPVs known so far in a Galactic globular cluster. We analyze a variety of Oosterhoff type indicators for the cluster, including mean periods, period distribution, Bailey diagrams, and Fourier decomposition parameters (as well as the physical parameters derived therefrom). All of these indicators clearly show that M62 is an Oosterhoff type I system. This is in good agreement with the moderately high metallicity of the cluster, in spite of its
Um exemplo de análise contrastiva: o grafema r/rr em português e italiano
Directory of Open Access Journals (Sweden)
Lúcia Fulgêncio
2011-10-01
Full Text Available Neste trabalho é apresentado um exemplo de análise contrastiva entre a língua italiana e o português falado no Brasil, do ponto de vista fonético. Tomam-se os sons grafados
Managing Reverse Logistics or Reversing Logistics Management?
Brito, Marisa
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...
Computational reverse shoulder prosthesis model: Experimental data and verification.
Martins, A; Quental, C; Folgado, J; Ambrósio, J; Monteiro, J; Sarmento, M
2015-09-18
The reverse shoulder prosthesis aims to restore the stability and function of pathological shoulders, but the biomechanical aspects of the geometrical changes induced by the implant are yet to be fully understood. Considering a large-scale musculoskeletal model of the upper limb, the aim of this study is to evaluate how the Delta reverse shoulder prosthesis influences the biomechanical behavior of the shoulder joint. In this study, the kinematic data of an unloaded abduction in the frontal plane and an unloaded forward flexion in the sagittal plane were experimentally acquired through video-imaging for a control group, composed of 10 healthy shoulders, and a reverse shoulder group, composed of 3 reverse shoulders. Synchronously, the EMG data of 7 superficial muscles were also collected. The muscle force sharing problem was solved through the minimization of the metabolic energy consumption. The evaluation of the shoulder kinematics shows an increase in the lateral rotation of the scapula in the reverse shoulder group, and an increase in the contribution of the scapulothoracic joint to the shoulder joint. Regarding the muscle force sharing problem, the musculoskeletal model estimates an increased activity of the deltoid, teres minor, clavicular fibers of the pectoralis major, and coracobrachialis muscles in the reverse shoulder group. The comparison between the muscle forces predicted and the EMG data acquired revealed a good correlation, which provides further confidence in the model. Overall, the shoulder joint reaction force was lower in the reverse shoulder group than in the control group. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Clementini Gisella
2017-01-01
Full Text Available Gaia Data Release 1 contains parallaxes for more than 700 Galactic Cepheids and RR Lyrae stars, computed as part of the Tycho-Gaia Astrometric Solution (TGAS. We have used TGAS parallaxes, along with literature (V, I, J, Ks, W1 photometry and spectroscopy, to calibrate the zero point of the period-luminosity and period-Wesenheit relations of classical and type II Cepheids, and the near-infrared period-luminosity, period-luminosity-metallicity and optical luminosity-metallicity relations of RR Lyrae stars. In this contribution we briefly summarise results obtained by fitting these basic relations adopting different techniques that operate either in parallax or distance (absolute magnitude space.
Extended Aperture Photometry of K2 RR Lyrae stars
Directory of Open Access Journals (Sweden)
Plachy Emese
2017-01-01
Full Text Available We present the method of the Extended Aperture Photometry (EAP that we applied on K2 RR Lyrae stars. Our aim is to minimize the instrumental variations of attitude control maneuvers by using apertures that cover the positional changes in the field of view thus contain the stars during the whole observation. We present example light curves that we compared to the light curves from the K2 Systematics Correction (K2SC pipeline applied on the automated Single Aperture Photometry (SAP and on the Pre-search Data Conditioning Simple Aperture Photometry (PDCSAP data.
International Nuclear Information System (INIS)
Ellouze, E.; Souissi, S.; Ben Amar, R.; Ben Salah, A.; Jrad, A.
2009-01-01
Textile industry process (dyeing, bleaching, printing and finishing) require a high-water consumption generating high amounts of water. Reactive dyeing of 1Kg of cotton requires about 150 Litres of water and 40g reactive dye resulting in a large volume of strongly coloured effluents. This fact in combination with the current water scarcity makes necessary textile waste water reuse. In this paper experimental results obtained from the treatment by different membranes Micro filtration (MF), Nano filtration (NF) and Reverse Osmosis (RO) of Sitex industry waste water pretreated by biological activated sludge are presented and compared. The results obtained from direct Nano filtration performed at different transmembrane pressures (8 - 1 m - 2 for a Volumetric Concentration Factor (VCF) of 4 and that the osmotic pressure π= 4Bars. A high quality of treated effluent in term of colour removal and desalination was obtained for a VCF of 2: salinity retention rate (RR) 57 pour cent and discoloration almost 100 pour cent at pressure of 12 bar. While, the permeate flux obtained using the combination MF/RO at a different pressures 25 - 1 m- 2 for a VCF of 6 indicating an important fouling. In this case, the osmotic pressure varied from 6 to 28 bars. The optimum salinity and colour retention rate (RR) were 86 pour cent and 100 pour cent respectively obtained at a VCF of 2.
Energy Technology Data Exchange (ETDEWEB)
Wolf, A.; Kern, C.; Jess, A. [Bayreuth Univ. (Germany). Dept. of Chemical Engineering
2013-11-01
In a two-step synthetic fuel production process based on carbon dioxide and renewable hydrogen, the best possible selectivity towards liquid hydrocarbons (Hc) shall be implemented. The process consists of a combination of the Reverse Water-Gas Shift reaction and the Fischer-Tropsch synthesis. To achieve this goal, gaseous short-chained Hc from the FTS reactor are recycled in the RWGS unit. In this paper, challenges coming up with the implementation of a recycle loop are discussed. First of all, it has to be examined whether Hc are converted under conditions present in the RWGS reactor. The coking caused by the recycle of Hc is regarded, including thermal coking in the heating zone of the reactor and catalytic coking in the catalyst bed. Coking of course is unwanted, as it deactivates the catalyst. The scope of this work is to find out to which extent and under which conditions gaseous Hc can be recycled. Therefore, experiments were carried out in both, a quartz glass reactor using a commercial Ni-catalyst at ambient pressure and in a pressurized steel reactor (without catalyst) to examine coking during the thermal decomposition of Hc. The catalytic experiments at atmospheric pressure showed that a recycle of CH{sub 4} did not cause coking up to a ratio of CH{sub 4}/CO{sub 2} below one. For these conditions, long term stability was proved. The reaction rates of the CH{sub 4} conversion were below those of the RWGS reaction. However, replacing CH{sub 4} by C{sub 3}H{sub 8} leads to thermal and catalytic coking. Catalytic coking hits the maximum level at about 700 C and decreases for higher temperatures and, thus is not regarded as a problem for the RWGS reactor. In contrast to that, thermal coking raises with higher temperatures, but it can be supressed efficiently with additional injection of H{sub 2}O, which of course shifts the equilibrium towards the undesired reactant side. (orig.)
A study for providing additional storage spaces to ET-RR-1 spent fuel
International Nuclear Information System (INIS)
El-Kady, A.; Ashoub, N.; Saleh, H.G.
1995-01-01
The ET-RR-1 reactor spent fuel storage pool is a trapezoidal aluminum tank concrete shield and of capacity 10 m 3 . It can hold up to 60 fuel assemblies. The long operation history of the ET-RR-1 reactor resulted in a partially filled spent fuel storage with the remaining spaces not enough to host a complete load from the reactor. This work have been initiated to evaluate possible alternative solutions for providing additional storage spaces to host the available EK-10 fuel elements after irradiation and any foreseen fuel in case of reactor upgrading. Several alternate solutions have been reviewed and decision on the most suitable one is under study. These studies include criticality calculation of some suggested alternatives like reracking the present spent fuel storage pool and double tiering by the addition of a second level storage rack above the existing rack. The two levels may have different factor. Criticality calculation of the double tiering possible accident was also studied. (author)
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
The spallation in reverse kinematics: what for a coincidence measurement?
International Nuclear Information System (INIS)
Ducret, J.E.
2006-07-01
The Spaladin installation has been designed to study spallation reactions in reverse kinematics. Furthermore, the heavy and light fragments are detected by coincidence which allows us to get an instantaneous picture of the reaction at a level of accuracy better than that obtained through inclusive measurement. The first part is dedicated to the theoretical description of the different mechanisms involved in the spallation reactions. In the second part we describe the Spaladin installation and report some results on the reaction: Fe 56 + p at an energy of 1 GeV/nucleon. In the third part we expose the performance of the installation through its simulation with the Geant-IV model. We present a study about the sensitivity of the Spaladin installation to theoretical predictions. The fourth part is dedicated to the future experiments that will be performed with the Spaladin installation. (A.C.)
Reversible Redox Chemistry of Azo Compounds for Sodium-Ion Batteries.
Luo, Chao; Xu, Gui-Liang; Ji, Xiao; Hou, Singyuk; Chen, Long; Wang, Fei; Jiang, Jianjun; Chen, Zonghai; Ren, Yang; Amine, Khalil; Wang, Chunsheng
2018-03-05
Sustainable sodium-ion batteries (SSIBs) using renewable organic electrodes are promising alternatives to lithium-ion batteries for the large-scale renewable energy storage. However, the lack of high-performance anode material impedes the development of SSIBs. Herein, we report a new type of organic anode material based on azo group for SSIBs. Azobenzene-4,4'-dicarboxylic acid sodium salt is used as a model to investigate the electrochemical behaviors and reaction mechanism of azo compound. It exhibits a reversible capacity of 170 mAh g -1 at 0.2C. When current density is increased to 20C, the reversible capacities of 98 mAh g -1 can be retained for 2000 cycles, demonstrating excellent cycling stability and high rate capability. The detailed characterizations reveal that azo group acts as an electrochemical active site to reversibly bond with Na + . The reversible redox chemistry between azo compound and Na ions offer opportunities for developing long-cycle-life and high-rate SSIBs. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Marcos Lázaro Moreli
2004-10-01
Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.
National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...
National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...
Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A
2012-08-15
Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.
Reversed rainbow with a nonlocal metamaterial
Energy Technology Data Exchange (ETDEWEB)
Morgado, Tiago A., E-mail: tiago.morgado@co.it.pt; Marcos, João S.; Silveirinha, Mário G., E-mail: mario.silveirinha@co.it.pt [Department of Electrical Engineering, Instituto de Telecomunicações, University of Coimbra, 3030 Coimbra (Portugal); Costa, João T. [CST AG, Bad Nauheimer Strasse 19, 64289 Darmstadt (Germany); Costa, Jorge R. [Instituto de Telecomunicações and Instituto Universitário de Lisboa (ISCTE-IUL), 1649-026 Lisboa (Portugal); Fernandes, Carlos A. [Instituto de Telecomunicações, and Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal)
2014-12-29
One of the intriguing potentials of metamaterials is the possibility to realize a nonlocal electromagnetic reaction, such that the effective medium response at a given point is fundamentally entangled with the macroscopic field distribution at long distances. Here, it is experimentally and numerically verified that a microwave nonlocal metamaterial formed by crossed metallic wires enables a low-loss broadband anomalous material response such that the refractive index decreases with frequency. Notably, it is shown that an electromagnetic beam refracted by our metamaterial prism creates a reversed microwave rainbow.
International Nuclear Information System (INIS)
Ang, Gaik Tin; Ooi, San Nee; Tan, Kok Tat; Lee, Keat Teong; Mohamed, Abdul Rahman
2015-01-01
Highlights: • Sea mango oil as feedstock for biodiesel via non-catalytic supercritical reaction. • Extracted sea mango oil with high FFA could produce high yield of FAME. • Employment of Response Surface Methodology for optimization of FAME. • Kinetic study for reversible transesterification and esterification reactions. - Abstract: Sea mango (Cerbera odollam) oil, which is rich in free fatty acids, was utilized to produce fatty acid methyl esters (FAME) via supercritical transesterification reaction. Sea mango oil was extracted from seeds and was subsequently reacted with methanol in a batch-type supercritical reactor. Response surface methodology (RSM) analysis was used to optimize important parameters, including reaction temperature, reaction time and the molar ratio of methanol to oil. The optimum conditions were found as 380 °C, 40 min and 45:1 mol/mol, respectively, to achieve 78% biodiesel content. The first kinetic modelling of FAME production from sea mango oil incorporating reversible transesterification and reversible esterification was verified simultaneously. The kinetic parameters, including reaction rate constants, k, the pre-exponential constant, A, and the activation energy, Ea, for transesterification and esterification were determined using an ordinary differential equation (ODE45) solver. The highest activation energy of 40 kJ/mol and the lowest reaction rate constant of 2.50 × 10 −5 dm 3 /mol s verified that the first stepwise reaction of TG to produce DG was the rate-limiting step
International Nuclear Information System (INIS)
Sano, Tomonari; Matsutani, Hideyuki; Kondo, Takeshi; Fujimoto, Shinichiro; Sekine, Takako; Arai, Takehiro; Morita, Hitomi; Takase, Shinichi
2011-01-01
The purpose of this study is to elucidate the relationship among RR interval (RR), the optimal reconstruction phase, and adequate temporal resolution (TR) to obtain coronary CT angiography images of acceptable quality using 64-multi detector-row CT (MDCT) (Aquilion 64) of end-systolic reconstruction in 407 patients with high heart rates. Image quality was classified into 3 groups [rank A (excellent): 161, rank B (acceptable): 207, and rank C (unacceptable): 39 patients]. The optimal absolute phase (OAP) significantly correlated with RR [OAP (ms)=119-0.286 RR (ms), r=0.832, p<0.0001], and the optimal relative phase (ORP) also significantly correlated with RR [ORP (%)=62-0.023 RR (ms), r=0.656, p<0.0001], and the correlation coefficient of OAP was significantly (p<0.0001) higher than that of ORP. The OAP range (±2 standard deviation (SD)) in which it is highly possible to get a static image was from [119-0.286 RR (ms)-46] to [119-0.286 RR (ms)+46]. The TR was significantly different among ranks A (97±22 ms), B (111±31 ms) and C (135±34 ms). The TR significantly correlated with RR in ranks A (TR=-16+0.149 RR, r=0.767, p<0.0001), B (TR=-15+0.166 RR, r=0.646, p<0.0001), and C (TR=52+0.117 RR, r=0.425, p=0.0069). Rank C was distinguished from ranks A or B by linear discriminate analysis (TR=-46+0.21 RR), and the discriminate rate was 82.6%. In conclusion, both the OAP and adequate TR depend on RR, and the OAP range (±2 SD) can be calculated using the formula [119-0.286 RR (ms)-46] to [119-0.286 RR (ms) +46], and an adequate TR value would be less than (-46+0.21 RR). (author)
The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers
Oude Essink, B. B.; Berkhout, B.
1999-01-01
Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by
Thermal neutron flux distribution in ET-RR-2 reactor thermal column
Directory of Open Access Journals (Sweden)
Imam Mahmoud M.
2002-01-01
Full Text Available The thermal column in the ET-RR-2 reactor is intended to promote a thermal neutron field of high intensity and purity to be used for following tasks: (a to provide a thermal neutron flux in the neutron transmutation silicon doping, (b to provide a thermal flux in the neutron activation analysis position, and (c to provide a thermal neutron flux of high intensity to the head of one of the beam tubes leading to the room specified for boron thermal neutron capture therapy. It was, therefore, necessary to determine the thermal neutron flux at above mentioned positions. In the present work, the neutron flux in the ET-RR-2 reactor system was calculated by applying the three dimensional diffusion depletion code TRITON. According to these calculations, the reactor system is composed of the core, surrounding external irradiation grid, beryllium block, thermal column and the water reflector in the reactor tank next to the tank wall. As a result of these calculations, the thermal neutron fluxes within the thermal column and at irradiation positions within the thermal column were obtained. Apart from this, the burn up results for the start up core calculated according to the TRITION code were compared with those given by the reactor designer.
Multipurpose RTOF Fourier diffractometer at the ET-RR-1 reactor
International Nuclear Information System (INIS)
Maayouf, R.M.A.; Tiitta, A.T.
1993-09-01
The present work represents a further study of the basic RTOF Fourier multipurpose diffractometer, to start with, at the ET-RR-1 reactor. The functions of the suggested arrangement are thoroughly discussed and the possibilities if its expansion are also assessed. The flexibility of the arrangement allows its further expansion both for stress measurement at 90 deg. scattering angle with two detector banks at opposite sides of the incident beam and for operation in the transmission diffraction mode. (orig.). (19 refs., 10 figs., 1 tab.)
Why has reversal of the actin-myosin cross-bridge cycle not been observed experimentally?
Loiselle, D. S.; Tran, K.; Crampin, E. J.; Curtin, N. A.
2010-01-01
We trace the history of attempts to determine whether the experimentally observed diminution of metabolic energy expenditure when muscles lengthen during active contraction is consistent with reversibility of biochemical reactions and, in particular
Stability of UV exposed RR-P3BT films by spectroscopic ellipsometry
International Nuclear Information System (INIS)
Diware, Mangesh S.; Byun, J. S.; Hwang, S. Y.; Kim, T. J.; Kim, Y. D.
2013-01-01
Stability of regioregular poly(3-butylthiophene) (RR-P3BT) films under irradiation of ultra-violet (UV) light has been studied by spectroscopic ellipsometry at room temperature. Consistent decrease in dielectric function with UV exposure time showed the degree of degradation of polymer. This work suggests that, protective methods are mandatory to use this kind of material in optical devices.
National Aeronautics and Space Administration — RR-1 is a validation flight to evaluate the hardware operational and science capabilities of the Rodent Research Project on the ISS. RNA DNA and protein were...
Factors involved in the paradox of reverse epidemiology.
Martín-Ponce, Esther; Santolaria, Francisco; Alemán-Valls, María-Remedios; González-Reimers, Emilio; Martínez-Riera, Antonio; Rodríguez-Gaspar, Melchor; Rodríguez-Rodríguez, Eva
2010-08-01
The hypothesis of reverse epidemiology holds that some cardiovascular risk factors, such as obesity, hypercholesterolemia and hypertension, in the elderly or in some chronic diseases are not harmful but permit better survival. However, this phenomenon is controversial and the underlying reasons are poorly understood. To search for factors simultaneously linked to reverse epidemiology and to short or long term survival. We included 400 patients, older than 60 years, hospitalized in a general internal medicine unit; 61 died in hospital and 338 were followed up by telephone. Obesity, higher blood pressure and serum cholesterol, besides being related to lower mortality both in hospital and after discharge, were associated with better nutrition and functional capacity, less intense acute phase reaction and organ dysfunction, and lower incidence of high-mortality diseases such as dementia, pneumonia, sepsis or cancer. These associations may explain why obesity and other reverse epidemiology data are inversely related to mortality. Weight loss was related to mortality independently of BMI. Patients with BMI under 30 kg/m(2) who died in hospital showed more weight loss than those who survived; the lower the BMI, the greater the weight loss. In contrast, patients with BMI over 30 kg/m(2) who died in hospital gained more weight than those who survived; the higher the BMI, the greater the weight gain. In patients over 60 years of age admitted to an internal medicine ward, obesity did not show independent survival value, being displaced by other nutritional parameters, functional capacity, acute phase reaction, organ dysfunction and diseases with poor prognosis. Copyright 2009 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Radioimmunoassay method for determination of 3, 3', 5'-triiodothyronine (reverse - T3)
International Nuclear Information System (INIS)
Kosowicz, J.
1979-01-01
To introduce radioimmunoassay, 3, 3', 5'-triiodothyronine (reverse-T 3 ) was coupled to bovine serum albumin by the carbodiimide technique and rabbits were immunized with the conjugates obtained. The immunizations were performed by multiple site intradermal injections at places in which cornynebacterium parvum was previously injected to enhance immunologic reaction. After 3 months the rabbits raised antisera to reverse-T 3 of a high titer and specificity. To obtain labelled 125 I-reverse T 3 , 3,3'-diiodothyronine was used. Iodination was performed by the chloramine T technique and the iodination mixture was subjected to gel filtration on Sephadex G-25 (fine) column. The purified monolabelled 125 I-reverse T 3 had a specific activity of 3,000 milli Curie/mg. The reverse T 3 radioimmunoassay of a high sensitivity (ca 2 pg/tube) was introduced in the clinical studies and facilitated direct determination of reverse T 3 in sera without the need of plasma extractions. The interference of serum proteins (TBG) was avoided by adding 8-anilino-1-naphtalene sulfonic acid to serum samples. Separation of free from antibody bound antigens was achieved by polyethylene glycol precipitation or immunoprecipitation. (author)
Kulikova, Olga
2016-01-01
This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...
Reversible exciplex formation followed charge separation.
Petrova, M V; Burshtein, A I
2008-12-25
The reversible exciplex formation followed by its decomposition into an ion pair is considered, taking into account the subsequent geminate and bulk ion recombination to the triplet and singlet products (in excited and ground states). The integral kinetic equations are derived for all state populations, assuming that the spin conversion is performed by the simplest incoherent (rate) mechanism. When the forward and backward electron transfer is in contact as well as all dissociation/association reactions of heavy particles, the kernels of integral equations are specified and expressed through numerous reaction constants and characteristics of encounter diffusion. The solutions of these equations are used to specify the quantum yields of the excited state and exciplex fluorescence induced by pulse or stationary pumping. In the former case, the yields of the free ions and triplet products are also found, while in the latter case their stationary concentrations are obtained.
Time asymmetry: Polarization and analyzing power in the nuclear reactions
International Nuclear Information System (INIS)
Rioux, C.; Roy, R.; Slobodrian, R.J.; Conzett, H.E.
1983-01-01
Measurements of the proton polarization in the reactions 7 Li( 3 He, p vector) 9 Be and 9 Be( 3 He, p vector) 11 B and of the analyzing powers of the inverse reactions, initiated by polarized protons at the same c.m. energies, show significant differences which imply the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction 2 H( 3 He, p vector) 4 He and its inverse have also been investigated and show some smaller differences. A discussion of the instrumental asymmetries is presented. (orig.)
Cascade enzymatic reactions for efficient carbon sequestration.
Xia, Shunxiang; Zhao, Xueyan; Frigo-Vaz, Benjamin; Zheng, Wenyun; Kim, Jungbae; Wang, Ping
2015-04-01
Thermochemical processes developed for carbon capture and storage (CCS) offer high carbon capture capacities, but are generally hampered by low energy efficiency. Reversible cascade enzyme reactions are examined in this work for energy-efficient carbon sequestration. By integrating the reactions of two key enzymes of RTCA cycle, isocitrate dehydrogenase and aconitase, we demonstrate that intensified carbon capture can be realized through such cascade enzymatic reactions. Experiments show that enhanced thermodynamic driving force for carbon conversion can be attained via pH control under ambient conditions, and that the cascade reactions have the potential to capture 0.5 mol carbon at pH 6 for each mole of substrate applied. Overall it manifests that the carbon capture capacity of biocatalytic reactions, in addition to be energy efficient, can also be ultimately intensified to approach those realized with chemical absorbents such as MEA. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Lebedev, A.V.; Bogdanova, T.G.; Vasil'ev, I.A.; Mel'nikova, I.N.
1980-01-01
Thermo- and radiation-stimulated reversible reaction of oxidation and aggregation of phosphorus in the composition of phosphite molecular centre in the matrix of potassium iodide are studied. It is shown that in the process of isothermal annealing and γ-radiolysis in the matrix of potassium iodide destruction of phosphite molecular centre takes place. It is established that it is accompanied by oxidation of trivalent phosphorus and aggregation of the formed phosphorus-oxygen anions. Reduction of the initial phosphite centre during the sample hardening is explained by the reverse reaction as a result of which electron-exceeding centres of the base are destructed and reduction of phosphorus takes place
Gaia Data Release 1. Testing parallaxes with local Cepheids and RR Lyrae stars
Gaia Collaboration, [Unknown; Clementini, G.; Eyer, L.; Ripepi, V.; Marconi, M.; Muraveva, T.; Garofalo, A.; Sarro, L. M.; Palmer, M.; Luri, X.; Molinaro, R.; Rimoldini, L.; Szabados, L.; Musella, I.; Anderson, R. I.; Prusti, T.; de Bruijne, J. H. J.; Brown, A. G. A.; Vallenari, A.; Babusiaux, C.; Bailer-Jones, C. A. L.; Bastian, U.; Biermann, M.; Evans, D. W.; Jansen, F.; Jordi, C.; Klioner, S. A.; Lammers, U.; Lindegren, L.; Mignard, F.; Panem, C.; Pourbaix, D.; Randich, S.; Sartoretti, P.; Siddiqui, H. I.; Soubiran, C.; Valette, V.; van Leeuwen, F.; Walton, N. A.; Aerts, C.; Arenou, F.; Cropper, M.; Drimmel, R.; Høg, E.; Katz, D.; Lattanzi, M. G.; O'Mullane, W.; Grebel, E. K.; Holland, A. D.; Huc, C.; Passot, X.; Perryman, M.; Bramante, L.; Cacciari, C.; Castañeda, J.; Chaoul, L.; Cheek, N.; De Angeli, F.; Fabricius, C.; Guerra, R.; Hernández, J.; Jean-Antoine-Piccolo, A.; Masana, E.; Messineo, R.; Mowlavi, N.; Nienartowicz, K.; Ordóñez-Blanco, D.; Panuzzo, P.; Portell, J.; Richards, P. J.; Riello, M.; Seabroke, G. M.; Tanga, P.; Thévenin, F.; Torra, J.; Els, S. G.; Gracia-Abril, G.; Comoretto, G.; Garcia-Reinaldos, M.; Lock, T.; Mercier, E.; Altmann, M.; Andrae, R.; Astraatmadja, T. L.; Bellas-Velidis, I.; Benson, K.; Berthier, J.; Blomme, R.; Busso, G.; Carry, B.; Cellino, A.; Cowell, S.; Creevey, O.; Cuypers, J.; Davidson, M.; De Ridder, J.; de Torres, A.; Delchambre, L.; Dell'Oro, A.; Ducourant, C.; Frémat, Y.; García-Torres, M.; Gosset, E.; Halbwachs, J.-L.; Hambly, N. C.; Harrison, D. L.; Hauser, M.; Hestroffer, D.; Hodgkin, S. T.; Huckle, H. E.; Hutton, A.; Jasniewicz, G.; Jordan, S.; Kontizas, M.; Korn, A. J.; Lanzafame, A. C.; Manteiga, M.; Moitinho, A.; Muinonen, K.; Osinde, J.; Pancino, E.; Pauwels, T.; Petit, J.-M.; Recio-Blanco, A.; Robin, A. C.; Siopis, C.; Smith, M.; Smith, K. W.; Sozzetti, A.; Thuillot, W.; van Reeven, W.; Viala, Y.; Abbas, U.; Abreu Aramburu, A.; Accart, S.; Aguado, J. J.; Allan, P. M.; Allasia, W.; Altavilla, G.; Álvarez, M. A.; Alves, J.; Andrei, A. H.; Anglada Varela, E.; Antiche, E.; Antoja, T.; Antón, S.; Arcay, B.; Bach, N.; Baker, S. G.; Balaguer-Núñez, L.; Barache, C.; Barata, C.; Barbier, A.; Barblan, F.; Barrado y Navascués, D.; Barros, M.; Barstow, M. A.; Becciani, U.; Bellazzini, M.; Bello García, A.; Belokurov, V.; Bendjoya, P.; Berihuete, A.; Bianchi, L.; Bienaymé, O.; Billebaud, F.; Blagorodnova, N.; Blanco-Cuaresma, S.; Boch, T.; Bombrun, A.; Borrachero, R.; Bouquillon, S.; Bourda, G.; Bragaglia, A.; Breddels, M. A.; Brouillet, N.; Brüsemeister, T.; Bucciarelli, B.; Burgess, P.; Burgon, R.; Burlacu, A.; Busonero, D.; Buzzi, R.; Caffau, E.; Cambras, J.; Campbell, H.; Cancelliere, R.; Cantat-Gaudin, T.; Carlucci, T.; Carrasco, J. M.; Castellani, M.; Charlot, P.; Charnas, J.; Chiavassa, A.; Clotet, M.; Cocozza, G.; Collins, R. S.; Costigan, G.; Crifo, F.; Cross, N. J. G.; Crosta, M.; Crowley, C.; Dafonte, C.; Damerdji, Y.; Dapergolas, A.; David, P.; David, M.; De Cat, P.; de Felice, F.; de Laverny, P.; De Luise, F.; De March, R.; de Souza, R.; Debosscher, J.; del Pozo, E.; Delbo, M.; Delgado, A.; Delgado, H. E.; Di Matteo, P.; Diakite, S.; Distefano, E.; Dolding, C.; Dos Anjos, S.; Drazinos, P.; Durán, J.; Dzigan, Y.; Edvardsson, B.; Enke, H.; Evans, N. W.; Eynard Bontemps, G.; Fabre, C.; Fabrizio, M.; Falcão, A. J.; Farràs Casas, M.; Federici, L.; Fedorets, G.; Fernández-Hernández, J.; Fernique, P.; Fienga, A.; Figueras, F.; Filippi, F.; Findeisen, K.; Fonti, A.; Fouesneau, M.; Fraile, E.; Fraser, M.; Fuchs, J.; Gai, M.; Galleti, S.; Galluccio, L.; Garabato, D.; García-Sedano, F.; Garralda, N.; Gavras, P.; Gerssen, J.; Geyer, R.; Gilmore, G.; Girona, S.; Giuffrida, G.; Gomes, M.; González-Marcos, A.; González-Núñez, J.; González-Vidal, J. J.; Granvik, M.; Guerrier, A.; Guillout, P.; Guiraud, J.; Gúrpide, A.; Gutiérrez-Sánchez, R.; Guy, L. P.; Haigron, R.; Hatzidimitriou, D.; Haywood, M.; Heiter, U.; Helmi, A.; Hobbs, D.; Hofmann, W.; Holl, B.; Holland, G.; Hunt, J. A. S.; Hypki, A.; Icardi, V.; Irwin, M.; Jevardat de Fombelle, G.; Jofré, P.; Jonker, P. G.; Jorissen, A.; Julbe, F.; Karampelas, A.; Kochoska, A.; Kohley, R.; Kolenberg, K.; Kontizas, E.; Koposov, S. E.; Kordopatis, G.; Koubsky, P.; Krone-Martins, A.; Kudryashova, M.; Bachchan, R. K.; Lacoste-Seris, F.; Lanza, A. F.; Lavigne, J.-B.; Le Poncin-Lafitte, C.; Lebreton, Y.; Lebzelter, T.; Leccia, S.; Leclerc, N.; Lecoeur-Taibi, I.; Lemaitre, V.; Lenhardt, H.; Leroux, F.; Liao, S.; Licata, E.; Lindstrøm, H. E. P.; Lister, T. A.; Livanou, E.; Lobel, A.; Löffler, W.; López, M.; Lorenz, D.; MacDonald, I.; Magalhães Fernandes, T.; Managau, S.; Mann, R. G.; Mantelet, G.; Marchal, O.; Marchant, J. M.; Marinoni, S.; Marrese, P. M.; Marschalkó, G.; Marshall, D. J.; Martín-Fleitas, J. M.; Martino, M.; Mary, N.; Matijevič, G.; McMillan, P. J.; Messina, S.; Michalik, D.; Millar, N. R.; Miranda, B. M. H.; Molina, D.; Molinaro, M.; Molnár, L.; Moniez, M.; Montegriffo, P.; Mor, R.; Mora, A.; Morbidelli, R.; Morel, T.; Morgenthaler, S.; Morris, D.; Mulone, A. F.; Narbonne, J.; Nelemans, G.; Nicastro, L.; Noval, L.; Ordénovic, C.; Ordieres-Meré, J.; Osborne, P.; Pagani, C.; Pagano, I.; Pailler, F.; Palacin, H.; Palaversa, L.; Parsons, P.; Pecoraro, M.; Pedrosa, R.; Pentikäinen, H.; Pichon, B.; Piersimoni, A. M.; Pineau, F.-X.; Plachy, E.; Plum, G.; Poujoulet, E.; Prša, A.; Pulone, L.; Ragaini, S.; Rago, S.; Rambaux, N.; Ramos-Lerate, M.; Ranalli, P.; Rauw, G.; Read, A.; Regibo, S.; Reylé, C.; Ribeiro, R. A.; Riva, A.; Rixon, G.; Roelens, M.; Romero-Gómez, M.; Rowell, N.; Royer, F.; Ruiz-Dern, L.; Sadowski, G.; Sagristà Sellés, T.; Sahlmann, J.; Salgado, J.; Salguero, E.; Sarasso, M.; Savietto, H.; Schultheis, M.; Sciacca, E.; Segol, M.; Segovia, J. C.; Segransan, D.; Shih, I.-C.; Smareglia, R.; Smart, R. L.; Solano, E.; Solitro, F.; Sordo, R.; Soria Nieto, S.; Souchay, J.; Spagna, A.; Spoto, F.; Stampa, U.; Steele, I. A.; Steidelmüller, H.; Stephenson, C. A.; Stoev, H.; Suess, F. F.; Süveges, M.; Surdej, J.; Szegedi-Elek, E.; Tapiador, D.; Taris, F.; Tauran, G.; Taylor, M. B.; Teixeira, R.; Terrett, D.; Tingley, B.; Trager, S. C.; Turon, C.; Ulla, A.; Utrilla, E.; Valentini, G.; van Elteren, A.; Van Hemelryck, E.; van Leeuwen, M.; Varadi, M.; Vecchiato, A.; Veljanoski, J.; Via, T.; Vicente, D.; Vogt, S.; Voss, H.; Votruba, V.; Voutsinas, S.; Walmsley, G.; Weiler, M.; Weingrill, K.; Wevers, T.; Wyrzykowski, Ł.; Yoldas, A.; Žerjal, M.; Zucker, S.; Zurbach, C.; Zwitter, T.; Alecu, A.; Allen, M.; Allende Prieto, C.; Amorim, A.; Anglada-Escudé, G.; Arsenijevic, V.; Azaz, S.; Balm, P.; Beck, M.; Bernstein, H.-H.; Bigot, L.; Bijaoui, A.; Blasco, C.; Bonfigli, M.; Bono, G.; Boudreault, S.; Bressan, A.; Brown, S.; Brunet, P.-M.; Bunclark†, P.; Buonanno, R.; Butkevich, A. G.; Carret, C.; Carrion, C.; Chemin, L.; Chéreau, F.; Corcione, L.; Darmigny, E.; de Boer, K. S.; de Teodoro, P.; de Zeeuw, P. T.; Delle Luche, C.; Domingues, C. D.; Dubath, P.; Fodor, F.; Frézouls, B.; Fries, A.; Fustes, D.; Fyfe, D.; Gallardo, E.; Gallegos, J.; Gardiol, D.; Gebran, M.; Gomboc, A.; Gómez, A.; Grux, E.; Gueguen, A.; Heyrovsky, A.; Hoar, J.; Iannicola, G.; Isasi Parache, Y.; Janotto, A.-M.; Joliet, E.; Jonckheere, A.; Keil, R.; Kim, D.-W.; Klagyivik, P.; Klar, J.; Knude, J.; Kochukhov, O.; Kolka, I.; Kos, J.; Kutka, A.; Lainey, V.; LeBouquin, D.; Liu, C.; Loreggia, D.; Makarov, V. V.; Marseille, M. G.; Martayan, C.; Martinez-Rubi, O.; Massart, B.; Meynadier, F.; Mignot, S.; Munari, U.; Nguyen, A.-T.; Nordlander, T.; O'Flaherty, K. S.; Ocvirk, P.; Olias Sanz, A.; Ortiz, P.; Osorio, J.; Oszkiewicz, D.; Ouzounis, A.; Park, P.; Pasquato, E.; Peltzer, C.; Peralta, J.; Péturaud, F.; Pieniluoma, T.; Pigozzi, E.; Poels†, J.; Prat, G.; Prod'homme, T.; Raison, F.; Rebordao, J. M.; Risquez, D.; Rocca-Volmerange, B.; Rosen, S.; Ruiz-Fuertes, M. I.; Russo, F.; Serraller Vizcaino, I.; Short, A.; Siebert, A.; Silva, H.; Sinachopoulos, D.; Slezak, E.; Soffel, M.; Sosnowska, D.; Straižys, V.; ter Linden, M.; Terrell, D.; Theil, S.; Tiede, C.; Troisi, L.; Tsalmantza, P.; Tur, D.; Vaccari, M.; Vachier, F.; Valles, P.; Van Hamme, W.; Veltz, L.; Virtanen, J.; Wallut, J.-M.; Wichmann, R.; Wilkinson, M. I.; Ziaeepour, H.; Zschocke, S.
2017-01-01
Context. Parallaxes for 331 classical Cepheids, 31 Type II Cepheids, and 364 RR Lyrae stars in common between Gaia and the Hipparcos and Tycho-2 catalogues are published in Gaia Data Release 1 (DR1) as part of the Tycho-Gaia Astrometric Solution (TGAS). Aims: In order to test these first parallax
Ageing problems and renovation programme of ET-RR-1 reactor
International Nuclear Information System (INIS)
Khattab, M.S.; Sultan, M.A.
1995-01-01
Based on Practical Experience gained from interfacing ageing systems in addition to operating new systems, current problems could be deduced whenever in-service inspection are carried out. This paper summarizes the in-service inspection made, and the proposed programme of rehabilitation of mechanical system in the ET-RR-1 research reactor at Inshass. Exchangeable experience in solving common problems in similar reactors play an important role in the effectiveness of such rehabilitation programme. The paper summarizes also the modernization of control, measuring and radiation monitoring system already carried out at the reactor. (orig.)
Hajdu, Gergely; Dékány, István; Catelan, Márcio; Grebel, Eva K.; Jurcsik, Johanna
2018-04-01
RR Lyrae variables are widely used tracers of Galactic halo structure and kinematics, but they can also serve to constrain the distribution of the old stellar population in the Galactic bulge. With the aim of improving their near-infrared photometric characterization, we investigate their near-infrared light curves, as well as the empirical relationships between their light curve and metallicities using machine learning methods. We introduce a new, robust method for the estimation of the light-curve shapes, hence the average magnitudes of RR Lyrae variables in the K S band, by utilizing the first few principal components (PCs) as basis vectors, obtained from the PC analysis of a training set of light curves. Furthermore, we use the amplitudes of these PCs to predict the light-curve shape of each star in the J-band, allowing us to precisely determine their average magnitudes (hence colors), even in cases where only one J measurement is available. Finally, we demonstrate that the K S-band light-curve parameters of RR Lyrae variables, together with the period, allow the estimation of the metallicity of individual stars with an accuracy of ∼0.2–0.25 dex, providing valuable chemical information about old stellar populations bearing RR Lyrae variables. The methods presented here can be straightforwardly adopted for other classes of variable stars, bands, or for the estimation of other physical quantities.
International Nuclear Information System (INIS)
Kurokawa, Kazuyuki; Ohte, Nobuyuki; Miyabe, Hiromichi; Akita, Sachie; Yajima, Kazuhiro; Hayano, Junichiro; Kimura, Genjiro
2003-01-01
The purpose of this study was to investigate the clinical significance of the reverse redistribution (RR) phenomenon on technetium-99m ( 99m Tc)-tetrofosmin myocardial single photon emission computed tomography (SPECT) performed at rest. Twenty-five patients underwent myocardial SPECT 3 weeks after the onset of acute myocardial infarction. Myocardial images were acquired at 40 min (early) and 4 h (delayed) after the injection of 740 MBq of 99m Tc-tetrofosmin. The regional myocardial uptake of the tracer in 26 segments of the left ventricular (LV) wall was visually scored from 0 (no activity) to 3 (normal activity), and then the RR was defined as a decrease of more than 1 point in the activity score on the delayed image compared with that on the early image. Regions with an activity score of 3 on both the early and delayed images were defined as normal, and those with a score of 0 or 1 on the early image were considered to have a fixed defect. The regional myocardial 99m Tc-tetrofosmin uptake and washout rate were also quantitatively assessed in each region. In addition, exercise stress electrocardiograph-gated SPECT with 99m Tc-tetrofosmin was performed within 1 week of the rest study, and the percent count increase (%CI) during myocardial contraction in each corresponding region was studied. RR was observed in 18 of the 25 patients. The regional washout rate of 99m Tc-tetrofosmin was significantly higher in the RR regions (45.0±3.8%) than in either the normal regions (36.4±4.1%, p 99m Tc-tetrofosmin SPECT have severely impaired LV wall contraction after exercise. (author)
Jović, Ozren; Smrečki, Neven; Popović, Zora
2016-04-01
A novel quantitative prediction and variable selection method called interval ridge regression (iRR) is studied in this work. The method is performed on six data sets of FTIR, two data sets of UV-vis and one data set of DSC. The obtained results show that models built with ridge regression on optimal variables selected with iRR significantly outperfom models built with ridge regression on all variables in both calibration (6 out of 9 cases) and validation (2 out of 9 cases). In this study, iRR is also compared with interval partial least squares regression (iPLS). iRR outperfomed iPLS in validation (insignificantly in 6 out of 9 cases and significantly in one out of 9 cases for poil, a well known health beneficial nutrient, is studied in this work by mixing it with cheap and widely used oils such as soybean (So) oil, rapeseed (R) oil and sunflower (Su) oil. Binary mixture sets of hempseed oil with these three oils (HSo, HR and HSu) and a ternary mixture set of H oil, R oil and Su oil (HRSu) were considered. The obtained accuracy indicates that using iRR on FTIR and UV-vis data, each particular oil can be very successfully quantified (in all 8 cases RMSEPoil (R(2)>0.99). Copyright © 2015 Elsevier B.V. All rights reserved.
Li, Hui; Li, Junjie; Ke, Wendong; Ge, Zhishen
2015-10-01
Near-infrared light (NIR) possesses great advantages for light-responsive controllable drug release, such as deep tissue penetration and low damage to healthy tissues. Herein, a NIR-responsive drug delivery system is developed based on a NIR dye, indocyanine green (ICG), and anticancer drug, doxorubicin (DOX)-loaded thermoresponsive block copolymer micelles, in which the drug release can be controlled via NIR irradiation. First, block copolymers, poly(oligo(ethylene glycol) methacrylate)-block-poly(furfuryl methacrylate) (POEGMA-b-PFMA), are synthesized by sequential reversible addition-fragmentation chain-transfer (RAFT) polymerization, followed by modification with N-octyl maleimide through Diels-Alder (DA) reaction to produce POEGMA-b-POMFMA. The self-assembly of POEGMA-b-POMFMA by nano-precipitation in aqueous solution affords the polymeric micelles which are used to simultaneously encapsulate ICG and DOX. Upon irradiation by NIR light (805 nm), the loaded DOX is released rapidly from the micelles due to partial retro DA reaction and local temperature increase-induced faster drug diffusion by the photothermal effect. Cytotoxicity evaluation and intracellular distribution observation demonstrate significant synergistic effects of NIR-triggered drug release, photothermal, and chemotherapy toward cancer cells under NIR irradiation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The first all-sky view of the Milky Way stellar halo with Gaia+2MASS RR Lyrae
Iorio, G.; Belokurov, V.; Erkal, D.; Koposov, S. E.; Nipoti, C.; Fraternali, F.
2018-02-01
We exploit the first Gaia data release to study the properties of the Galactic stellar halo as traced by RR Lyrae. We demonstrate that it is possible to select a pure sample of RR Lyrae using only photometric information available in the Gaia+2MASS catalogue. The final sample contains about 21 600 RR Lyrae covering an unprecedented fraction ( ˜ 60 per cent) of the volume of the Galactic inner halo (R < 28 kpc). We study the morphology of the stellar halo by analysing the RR Lyrae distribution with parametric and non-parametric techniques. Taking advantage of the uniform all-sky coverage, we test halo models more sophisticated than usually considered in the literature, such as those with varying flattening, tilts and/or offset of the halo with respect to the Galactic disc. A consistent picture emerges: the inner halo is well reproduced by a smooth distribution of stars settled on triaxial density ellipsoids. The shortest axis is perpendicular to the Milky Way's disc, while the longest axis forms an angle of ˜70° with the axis connecting the Sun and the Galactic Centre. The elongation along the major axis is mild (p = 1.27), and the vertical flattening is shown to evolve from a squashed state with q ≈ 0.57 in the centre to a more spherical q ≈ 0.75 at the outer edge of our data set. Within the radial range probed, the density profile of the stellar halo is well approximated by a single power law with exponent α = -2.96. We do not find evidence of tilt or offset of the halo with respect to the Galaxy's disc.
Directory of Open Access Journals (Sweden)
Boissière-Michot Florence
2009-04-01
Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.
Hydrogen-deuterium exchange reaction of 2-methylpyridine catalyzed by several fatty acids
International Nuclear Information System (INIS)
Hirata, Hirohumi; Fukuzumi, Kazuo.
1976-01-01
Hydrogen-deuterium exchange reaction of 2-methylpyridine has been studied by using several fatty acids as catalysts. The reaction was carried out in a sealed pyrex tube at 120 0 C, and the contents of the products were determined by mass spectrometry. Reaction of 2-methylpyridine with monodeuteroacetic acid (1 : 1, mol/mol) arrived at a equilibrium (d 0 reversible d 1 reversible d 2 reversible d 3 ) in 2 hr (d 0 41%, d 1 42%, d 2 15%, d 3 2%). No exchange was observed for the reaction of pyridine with monodeuteroacetic acid. The conversion-time curves of typical series reactions (d 0 → d 1 → d 2 → d 3 ) were obtained for the fatty acid catalyzed exchange in deuterium oxide. The effect of the fatty acid RCO 2 H (substrate : fatty acid : D 2 O=1 : 0.86 : 27.6, mol/mol/mol) on the conversion was in the order of R; C 1 --C 3 4 --C 10 , where the reaction mixtures were homogeneous in the case of C 1 --C 3 and were heterogeneous in the case of C 4 --C 10 . The effects of the initial concentration of the substrates and the catalysts (RCO 2 H) on the total conversion were studied by using some fatty acids (R; C 2 , C 4 and C 9 ) in deuterium oxide (for 2 hr). The total conversion of the substrate increases with increasing the concentration of the acids. The total conversion decreases in the case of R=C 9 , but, increases in the case of R=C 2 with increasing the concentration of the substrate. In the case of reactions with low concentrations of the substrate, the reactivity was in the order of C 9 >C 4 >C 2 , while with high concentrations, the reactivity was in the order of C 4 >C 2 >C 9 and C 9 >C 4 >C 2 with high and low concentrations of the acids, respectively. A possible reaction mechanism was proposed and discussed. (auth.)
DISCOVERY OF RR LYRAE STARS IN THE NUCLEAR BULGE OF THE MILKY WAY
Energy Technology Data Exchange (ETDEWEB)
Minniti, Dante; Ramos, Rodrigo Contreras; Zoccali, Manuela; Gran, Felipe [Instituto Milenio de Astrofisica, Santiago (Chile); Rejkuba, Marina; Valenti, Elena [European Southern Observatory, Karl-Schwarszchild-Str. 2, D-85748 Garching bei Muenchen (Germany); Gonzalez, Oscar A., E-mail: dante@astrofisica.cl, E-mail: rcontrer@astro.puc.cl [UK Astronomy Technology Centre, Royal Observatory, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom)
2016-10-10
Galactic nuclei, such as that of the Milky Way, are extreme regions with high stellar densities, and in most cases, the hosts of a supermassive black hole. One of the scenarios proposed for the formation of the Galactic nucleus is merging of primordial globular clusters. An implication of this model is that this region should host stars that are characteristically found in old Milky Way globular clusters. RR Lyrae stars are primary distance indicators, well known representatives of old and metal-poor stellar populations, and therefore are regularly found in globular clusters. Here we report the discovery of a dozen RR Lyrae type ab stars in the vicinity of the Galactic center, i.e., in the so-called nuclear stellar bulge of the Milky Way. This discovery provides the first direct observational evidence that the Galactic nuclear stellar bulge contains ancient stars (>10 Gyr old). Based on this we conclude that merging globular clusters likely contributed to the build-up of the high stellar density in the nuclear stellar bulge of the Milky Way.
Reciprocity theory of homogeneous reactions
Agbormbai, Adolf A.
1990-03-01
The reciprocity formalism is applied to the homogeneous gaseous reactions in which the structure of the participating molecules changes upon collision with one another, resulting in a change in the composition of the gas. The approach is applied to various classes of dissociation, recombination, rearrangement, ionizing, and photochemical reactions. It is shown that for the principle of reciprocity to be satisfied it is necessary that all chemical reactions exist in complementary pairs which consist of the forward and backward reactions. The backward reaction may be described by either the reverse or inverse process. The forward and backward processes must satisfy the same reciprocity equation. Because the number of dynamical variables is usually unbalanced on both sides of a chemical equation, it is necessary that this balance be established by including as many of the dynamical variables as needed before the reciprocity equation can be formulated. Statistical transformation models of the reactions are formulated. The models are classified under the titles free exchange, restricted exchange and simplified restricted exchange. The special equations for the forward and backward processes are obtained. The models are consistent with the H theorem and Le Chatelier's principle. The models are also formulated in the context of the direct simulation Monte Carlo method.
Directory of Open Access Journals (Sweden)
Ana Luiza Chaves Valadão
2015-06-01
Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.
Directory of Open Access Journals (Sweden)
E.S. Leguizamón
2012-12-01
Full Text Available Concerns about the sustainability of large-scale, direct-drilled RR-soybeans (Glycine max, and RR-maize (Zea mays under monoculture in central Argentina are growing steadily. An experiment was conducted during three consecutive years to determine the effects of crops and systems (monocultures and strips and herbicide strategy on weed density, population rate of change (l, b community diversity (H´, crop yields and Land Equivalent Ratio (LER. Not only crops but also crop systems differentially influenced weed densities along their growth and development. For crop harvests, weed densities increased in both maize crop systems as compared to in the one for soybeans, but the lowest increase occurred in soybean strips. Differences were leveled by both herbicide strategies, which achieved 73% efficacy during the critical periods in both crops. l of annual monocotyledonous increased, thus shifting the weed community composition. Species richness and H´ were not affected by crop systems, but both herbicide strategies, particularly POST, either in soybeans in monoculture or in maize strips, significantly enhanced H´. Crop yields significantly increased in the maize-strip system with POST (Year 1 or PRE (Years 2 and 3 strategies, thus increasing LER above 1. Herbicide Environmental Load treatments fall within very low or low field use rating.A preocupação com a sustentabilidade do plantio direto da monocultura e do consórcio de soja e milho RR plantados em grande escala na região central da Argentina cresce continuamente. Durante três anos consecutivos, foram determinados os efeitos das culturas de soja e de milho RR, dos sistemas de plantio (monoculturas e consorciado, e a ação de herbicidas sobre a densidade de plantas daninhas, a taxa de mudança da população, a diversidade da comunidade, as safras e a razão de área equivalente. Não apenas as culturas, mas também os sistemas de plantio, influenciaram as densidades de plantas daninhas ao
Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L
2009-10-01
Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.
Rapid purification of radioiodinated peptides with Sep-Pak reversed phase cartridges and HPLC
International Nuclear Information System (INIS)
Miller, J.J.; Schultz, G.S.; Levy, R.S.
1984-01-01
A simple, rapid method is described for the purification of radioiodinated peptides for use in radioimmuno- and in radioreceptor assays. Iodinated reaction mixtures are applied directly onto Sep-Pak disposable, reversed phase cartridges equilibrated with phosphate buffer. Unreacted 125-iodide and other non-peptide reaction components are eluted with buffer. The peptide fraction is then eluted with 70% buffer:30% acetonitrile. The peptide fraction is further purified by reversed phase high pressure liquid chromatography to separate the native peptide and the mono- and diiodo-derivatives. In this study the method is used to prepare 125-iodide-labeled monoiodo-leucine enkephalin and monoiodo-angiotensin II, which are free of the parent peptides and diiodo-derivatives and are of maximum obtainable specific radioactivity. The usefulness of these labeled peptides in radioimmuno- and radioreceptor assays is demonstrated by their binding to specific antibodies and receptors, respectively. (author)
Modular rate laws for enzymatic reactions: thermodynamics, elasticities and implementation.
Liebermeister, Wolfram; Uhlendorf, Jannis; Klipp, Edda
2010-06-15
Standard rate laws are a key requisite for systematically turning metabolic networks into kinetic models. They should provide simple, general and biochemically plausible formulae for reaction velocities and reaction elasticities. At the same time, they need to respect thermodynamic relations between the kinetic constants and the metabolic fluxes and concentrations. We present a family of reversible rate laws for reactions with arbitrary stoichiometries and various types of regulation, including mass-action, Michaelis-Menten and uni-uni reversible Hill kinetics as special cases. With a thermodynamically safe parameterization of these rate laws, parameter sets obtained by model fitting, sampling or optimization are guaranteed to lead to consistent chemical equilibrium states. A reformulation using saturation values yields simple formulae for rates and elasticities, which can be easily adjusted to the given stationary flux distributions. Furthermore, this formulation highlights the role of chemical potential differences as thermodynamic driving forces. We compare the modular rate laws to the thermodynamic-kinetic modelling formalism and discuss a simplified rate law in which the reaction rate directly depends on the reaction affinity. For automatic handling of modular rate laws, we propose a standard syntax and semantic annotations for the Systems Biology Markup Language. An online tool for inserting the rate laws into SBML models is freely available at www.semanticsbml.org. Supplementary data are available at Bioinformatics online.
Symmetry Relations in Chemical Kinetics Arising from Microscopic Reversibility
Adib, Artur B.
2006-01-01
It is shown that the kinetics of time-reversible chemical reactions having the same equilibrium constant but different initial conditions are closely related to one another by a directly measurable symmetry relation analogous to chemical detailed balance. In contrast to detailed balance, however, this relation does not require knowledge of the elementary steps that underlie the reaction, and remains valid in regimes where the concept of rate constants is ill defined, such as at very short times and in the presence of low activation barriers. Numerical simulations of a model of isomerization in solution are provided to illustrate the symmetry under such conditions, and potential applications in protein folding or unfolding are pointed out.
National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...
National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...
National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...
Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M
2015-10-01
The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.
Proton-Fueled, Reversible DNA Hybridization Chain Assembly for pH Sensing and Imaging.
Liu, Lan; Liu, Jin-Wen; Huang, Zhi-Mei; Wu, Han; Li, Na; Tang, Li-Juan; Jiang, Jian-Hui
2017-07-05
Design of DNA self-assembly with reversible responsiveness to external stimuli is of great interest for diverse applications. We for the first time develop a pH-responsive, fully reversible hybridization chain reaction (HCR) assembly that allows sensitive sensing and imaging of pH in living cells. Our design relies on the triplex forming sequences that form DNA triplex with toehold regions under acidic conditions and then induce a cascade of strand displacement and DNA assembly. The HCR assembly has shown dynamic responses in physiological pH ranges with excellent reversibility and demonstrated the potential for in vitro detection and live-cell imaging of pH. Moreover, this method affords HCR assemblies with highly localized fluorescence responses, offering advantages of improving sensitivity and better selectivity. The proton-fueled, reversible HCR assembly may provide a useful approach for pH-related cell biology study and disease diagnostics.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
From cutting-edge pointwise cross-section to groupwise reaction rate: A primer
Sublet, Jean-Christophe; Fleming, Michael; Gilbert, Mark R.
2017-09-01
The nuclear research and development community has a history of using both integral and differential experiments to support accurate lattice-reactor, nuclear reactor criticality and shielding simulations, as well as verification and validation efforts of cross sections and emitted particle spectra. An important aspect to this type of analysis is the proper consideration of the contribution of the neutron spectrum in its entirety, with correct propagation of uncertainties and standard deviations derived from Monte Carlo simulations, to the local and total uncertainty in the simulated reactions rates (RRs), which usually only apply to one application at a time. This paper identifies deficiencies in the traditional treatment, and discusses correct handling of the RR uncertainty quantification and propagation, including details of the cross section components in the RR uncertainty estimates, which are verified for relevant applications. The methodology that rigorously captures the spectral shift and cross section contributions to the uncertainty in the RR are discussed with quantified examples that demonstrate the importance of the proper treatment of the spectrum profile and cross section contributions to the uncertainty in the RR and subsequent response functions. The recently developed inventory code FISPACT-II, when connected to the processed nuclear data libraries TENDL-2015, ENDF/B-VII.1, JENDL-4.0u or JEFF-3.2, forms an enhanced multi-physics platform providing a wide variety of advanced simulation methods for modelling activation, transmutation, burnup protocols and simulating radiation damage sources terms. The system has extended cutting-edge nuclear data forms, uncertainty quantification and propagation methods, which have been the subject of recent integral and differential, fission, fusion and accelerators validation efforts. The simulation system is used to accurately and predictively probe, understand and underpin a modern and sustainable understanding
From cutting-edge pointwise cross-section to groupwise reaction rate: A primer
Directory of Open Access Journals (Sweden)
Sublet Jean-Christophe
2017-01-01
Full Text Available The nuclear research and development community has a history of using both integral and differential experiments to support accurate lattice-reactor, nuclear reactor criticality and shielding simulations, as well as verification and validation efforts of cross sections and emitted particle spectra. An important aspect to this type of analysis is the proper consideration of the contribution of the neutron spectrum in its entirety, with correct propagation of uncertainties and standard deviations derived from Monte Carlo simulations, to the local and total uncertainty in the simulated reactions rates (RRs, which usually only apply to one application at a time. This paper identifies deficiencies in the traditional treatment, and discusses correct handling of the RR uncertainty quantification and propagation, including details of the cross section components in the RR uncertainty estimates, which are verified for relevant applications. The methodology that rigorously captures the spectral shift and cross section contributions to the uncertainty in the RR are discussed with quantified examples that demonstrate the importance of the proper treatment of the spectrum profile and cross section contributions to the uncertainty in the RR and subsequent response functions. The recently developed inventory code FISPACT-II, when connected to the processed nuclear data libraries TENDL-2015, ENDF/B-VII.1, JENDL-4.0u or JEFF-3.2, forms an enhanced multi-physics platform providing a wide variety of advanced simulation methods for modelling activation, transmutation, burnup protocols and simulating radiation damage sources terms. The system has extended cutting-edge nuclear data forms, uncertainty quantification and propagation methods, which have been the subject of recent integral and differential, fission, fusion and accelerators validation efforts. The simulation system is used to accurately and predictively probe, understand and underpin a modern and
Time asymmetry: Polarization and analyzing power in the nuclear reactions
Energy Technology Data Exchange (ETDEWEB)
Rioux, C.; Roy, R.; Slobodrian, R.J. (Laval Univ., Quebec City (Canada). Lab. de Physique Nucleaire); Conzett, H.E. (California Univ., Berkeley (USA). Lawrence Berkeley Lab.)
1983-02-28
Measurements of the proton polarization in the reactions /sup 7/Li(/sup 3/He, p vector)/sup 9/Be and /sup 9/Be(/sup 3/He, p vector)/sup 11/B and of the analyzing powers of the inverse reactions, initiated by polarized protons at the same c.m. energies, show significant differences which imply the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction /sup 2/H(/sup 3/He, p vector)/sup 4/ He and its inverse have also been investigated and show some smaller differences. A discussion of the instrumental asymmetries is presented.
Exploring the Milky Way halo with SDSS-II SN survey RR Lyrae stars
De Lee, Nathan
This thesis details the creation of a large catalog of RR Lyrae stars, their lightcurves, and their associated photometric and kinematic parameters. This catalog contains 421 RR Lyrae stars with 305 RRab and 116 RRc. Of these, 241 stars have stellar spectra taken with either the Blanco 4m RC spectrograph or the SDSS/SEGUE survey, and in some cases taken by both. From these spectra and photometric methods derived from them, an analysis is conducted of the RR lyrae's distribution, metallicity, kinematics, and photometric properties within the halo. All of these RR Lyrae originate from the SDSS-II Supernova Survey. The SDSS-II SN Survey covers a 2.5 degree equatorial stripe ranging from -60 to +60 degrees in RA. This corresponds to relatively high southern galactic latitudes in the anti-center direction. The full catalog ranges from g 0 magnitude 13 to 20 which covers a distance of 3 to 95 kpc from the sun. Using this sample, we explore the Oosterhoff dichotomy through the D log P method as a function of | Z | distance from the plane. This results in a clear division of the RRab stars into OoI and OoII groups at lower | Z |, but the population becomes dominated by OoI stars at higher | Z |. The idea of a dual halo is explored primarily in the context of radial velocity distributions as a function of | Z |. In particular, V gsr , the radial velocity in the galactic standard of rest, is used as a proxy for V [straight phi] , the cylindrical rotational velocity. This is then compared against a single halo model galaxy, which results in very similar V gsr histograms for both at low to medium | Z |. However, at high | Z | there is a clear separation into two distinct velocity groups for the data without a corresponding separation in the model, suggesting that at least a two-component model for the halo is necessary. The final part of the analysis involves [Fe/H] measurements from both spectra and photometric relations cut in both | Z | and radial velocity. In this case
Transesterification of oil mixtures catalyzed by microencapsulated cutinase in reversed micelles.
Badenes, Sara M; Lemos, Francisco; Cabral, Joaquim M S
2010-03-01
Recombinant cutinase from Fusarium solani pisi was used to catalyze the transesterification reaction between a mixture of triglycerides (oils) and methanol in reversed micelles of bis(2-ethylhexyl) sodium sulfosuccinate (AOT) in isooctane for the purposes of producing biodiesel. The use of a bi-phase lipase-catalyzed system brings advantages in terms of catalyst re-use and the control of water activity in the medium and around the enzyme micro-environment. Small-scale batch studies were performed to study the influence of the initial enzyme and alcohol concentrations, and the substrates molar ratio. Conversions in excess of 75 were obtained with reaction times under 24 h, which makes this enzymatic process highly competitive when compared to similar lipase catalyzed reactions for biodiesel production using methanol.
Pous, Jonathan; Courant, Thibaut; Bernadat, Guillaume; Iorga, Bogdan I; Blanchard, Florent; Masson, Géraldine
2015-09-23
Chiral phosphoric acid-catalyzed asymmetric nitroso-Diels-Alder reaction of nitrosoarenes with carbamate-dienes afforded cis-3,6-disubstituted dihydro-1,2-oxazines in high yields with excellent regio-, diastereo-, and enantioselectivities. Interestingly, we observed that the catalyst is able not only to control the enantioselectivity but also to reverse the regioselectivity of the noncatalyzed nitroso-Diels-Alder reaction. The regiochemistry reversal and asynchronous concerted mechanism were confirmed by DFT calculations.
Moruno-Dávila, M A; Garrido-del Solo, C; García-Moreno, M; Havsteen, B H; Garcia-Sevilla, F; Garcia-Cánovas, F; Varón, R
2001-02-01
The use of suicide substrates remains a very important and useful method in enzymology for studying enzyme mechanisms and designing potential drugs. Suicide substrates act as modified substrates for the target enzymes and bind to the active site. Therefore the presence of a competitive reversible inhibitor decreases the rate of substrate-induced inactivation and protects the enzyme from this inactivation. This lowering on the inactivation rate has evident physiological advantages, since it allows the easy acquisition of experimental data and facilitates kinetic data analysis by providing another variable (inhibitor concentration). However despite the importance of the simultaneous action of a suicide substrate and a competitive reversible inhibition, to date no corresponding kinetic analysis has been carried out. Therefore we present a general kinetic analysis of a Michaelis-Menten reaction mechanism with double inhibition caused by both, a suicide substrate and a competitive reversible inhibitor. We assume rapid equilibrium of the reversible reaction steps involved, while the time course equations for the reaction product have been derived with the assumption of a limiting enzyme. The goodness of the analytical solutions has been tested by comparison with the simulated curves obtained by numerical integration. A kinetic data analysis to determine the corresponding kinetic parameters from the time progress curve of the product is suggested. In conclusion, we present a complete kinetic analysis of an enzyme reaction mechanism as described above in an attempt to fill a gap in the theoretical treatment of this type of system.
Reversible and Irreversible Binding of Nanoparticles to Polymeric Surfaces
Directory of Open Access Journals (Sweden)
Wolfgang H. Binder
2009-01-01
Full Text Available Reversible and irreversible binding of CdSe-nanoparticles and nanorods to polymeric surfaces via a strong, multiple hydrogen bond (= Hamilton-receptor/barbituric acid is described. Based on ROMP-copolymers, the supramolecular interaction on a thin polymer film is controlled by living polymerization methods, attaching the Hamilton-receptor in various architectures, and concentrations. Strong binding is observed with CdSe-nanoparticles and CdSe-nanorods, whose surfaces are equipped with matching barbituric acid-moieties. Addition of polar solvents, able to break the hydrogen bonds leads to the detachment of the nanoparticles from the polymeric film. Irreversible binding is observed if an azide/alkine-“click”-reaction is conducted after supramolecular recognition of the nanoparticles on the polymeric surface. Thus reversible or irreversible attachment of the nanosized objects can be achieved.
Unified path integral approach to theories of diffusion-influenced reactions
Prüstel, Thorsten; Meier-Schellersheim, Martin
2017-08-01
Building on mathematical similarities between quantum mechanics and theories of diffusion-influenced reactions, we develop a general approach for computational modeling of diffusion-influenced reactions that is capable of capturing not only the classical Smoluchowski picture but also alternative theories, as is here exemplified by a volume reactivity model. In particular, we prove the path decomposition expansion of various Green's functions describing the irreversible and reversible reaction of an isolated pair of molecules. To this end, we exploit a connection between boundary value and interaction potential problems with δ - and δ'-function perturbation. We employ a known path-integral-based summation of a perturbation series to derive a number of exact identities relating propagators and survival probabilities satisfying different boundary conditions in a unified and systematic manner. Furthermore, we show how the path decomposition expansion represents the propagator as a product of three factors in the Laplace domain that correspond to quantities figuring prominently in stochastic spatially resolved simulation algorithms. This analysis will thus be useful for the interpretation of current and the design of future algorithms. Finally, we discuss the relation between the general approach and the theory of Brownian functionals and calculate the mean residence time for the case of irreversible and reversible reactions.
Barriers to Receiving Long-acting Reversible Contraception in the Postpartum Period.
Zerden, Matthew L; Tang, Jennifer H; Stuart, Gretchen S; Norton, Deborah R; Verbiest, Sarah B; Brody, Seth
2015-01-01
To assess why postpartum women who desired long-acting reversible contraception (LARC) did not receive it in the postpartum period and to assess which contraceptive methods they were using instead. This was a subgroup analysis of 324 women enrolled in a randomized, controlled trial to receive or not receive an educational LARC script during their postpartum hospitalization. Participants in this subgroup analysis stated that they were either using LARC (n = 114) or interested in using LARC (n = 210) during a follow-up survey completed after their scheduled 6-week postpartum visit. Modified Poisson regression analysis was used to assess for characteristics associated with using LARC by the time of the follow-up survey. Women who were interested in LARC but not using it were more likely to be multiparous (relative risk [RR], 1.59; 95% CI, 1.19-2.11) and to have missed their postpartum visit (RR, 25.88; 95% CI, 3.75-178.44) compared with those using LARC. Among the interested 210 who were not using LARC, the most common reasons provided for non-use were that they were told to come back for another insertion visit (45%), missed the postpartum visit (26%), and could not afford LARC (11%). The most common contraceptive methods used instead of LARC were barrier methods (42%) and abstinence (19%); 18% used no contraceptive method. Two-thirds (65%) of postpartum women who desired to use LARC did not receive it in the postpartum period and used less effective contraceptive methods. Increasing access to immediate postpartum LARC and eliminating two-visit protocols for LARC insertion may increase postpartum LARC use. As the Affordable Care Act moves toward full implementation, it is necessary to understand the barriers that prevent interested patients from receiving LARC. Copyright © 2015 Jacobs Institute of Women's Health. Published by Elsevier Inc. All rights reserved.
Kihara, Hideyuki; Yoshida, Masaru
2013-04-10
As new organic materials for rewritable photopatterning, 2-anthroyl and 9-anthroyl ester compounds were synthesized. Their bulk-phase changes (we use "bulk-phase change" as complete phase change in a mass of a material neither in a surface nor in a small quantity in this study) triggered by photodimerization under melting conditions (melt-photodimerization) and subsequent thermal back reactions were investigated. All the anthroyl compounds exhibited melting points lower than ca. 160 °C, and they were nearly quantitatively converted to the corresponding photodimers by UV irradiation at temperatures of ∼5 °C higher than their respective melting points. We found that there were two kinds of bulk-phase change behaviors through the photoreaction. Two of the anthroyl compounds remained isotropic and lost fluidity during the melt-photodimerization. The obtained photodimers exhibited robust solid-state amorphous phases at room temperature. In contrast, the other three anthroyl compounds showed crystallization during the melt-photodimerization. The resulting photodimers changed from isotropic to crystalline phases, even at high temperature. Various experiments revealed that the bulk phase of the photodimers was affected not by the existence of regioisomers but by their fluidity at the photoirradiation temperature. The latter three photodimers retained enough fluidity, reflecting their high molecular mobilities at the photoirradiation temperature at which the isothermal crystallization occurred. The other two products were not able to crystallize due to low fluidity, resulting in amorphous phases. We also found that all the photodimers reverted to the corresponding monomers by thermal back reaction and recovered their initial photochemical and thermal properties. Using these reversible bulk-phase changes of the anthroyl compounds, we successfully demonstrated rewritable photopatterning in not only negative images but also positive ones, based on the optical contrast
Turbulent flow heat transfer in ET-RR-1
International Nuclear Information System (INIS)
Khattab, M.; Mina, A.R.
1990-01-01
In nuclear reactors the effect of heat transfer coefficient, which depends on the constant C. Is primordial in calculating the clad surface temperatures. To determine the constant C of ET-RR-1 fuel bundles based on in-pile measurements different well known and recommended values of C are verified. A computer program is written to calculate steady thermal core characteristics at different operating conditions. The total flow rate is distributed considering same pressure drop across the core irrespective of bundle location. The total reactor power is readily distributed as Bessel function. The flow and power per bundle are equally distributed among the fuel rods irrespective of their positions inside the bundle. It is found that the constant C equals 0.047 gives acceptable compatibility between measurements and calculations. The maximum clad surface temperature is shifted from the core center
Measure of the QT-RR Dynamic Coupling in Patients with the Long QT Syndrome
Czech Academy of Sciences Publication Activity Database
Halámek, Josef; Couderc, J. P.; Jurák, Pavel; Vondra, Vlastimil; Zareba, W.; Viščor, Ivo; Leinveber, P.
2012-01-01
Roč. 17, č. 4 (2012), s. 323-330 ISSN 1082-720X R&D Projects: GA MŠk ME09050 Institutional support: RVO:68081731 Keywords : Long QT syndrome * Dynamic QT-RR coupling * Holter recording * QT adaptation * QT parameters Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 1.084, year: 2012
Zhang, Li; Cao, Can; Jiang, Ruifan; Xu, Hong; Xue, Feng; Huang, Weiwei; Ni, Hao; Gao, Jian
2018-08-01
The present study describes the use of metabolic engineering to achieve the production of R,R-2,3-butanediol (R,R-2,3-BD) of ultra-high optical purity (>99.99%). To this end, the diacetyl reductase (DAR) gene (dud A) of Paenibacillus polymyxa ZJ-9 was knocked out via homologous recombination between the genome and the previously constructed targeting vector pRN5101-L'C in a process based on homologous single-crossover. PCR verification confirmed the successful isolation of the dud A gene disruption mutant P. polymyxa ZJ-9-△dud A. Moreover, fermentation results indicated that the optical purity of R,R-2,3-BD increased from about 98% to over 99.99%, with a titer of 21.62 g/L in Erlenmeyer flasks. The latter was further increased to 25.88 g/L by fed-batch fermentation in a 5-L bioreactor. Copyright © 2018 Elsevier Ltd. All rights reserved.
Diversity-Oriented Syntheses by Combining CuAAC and Stereoselective INCIC Reactions with Peptides
DEFF Research Database (Denmark)
Wang, Yuanyuan; Madsen, Anders; Diness, Frederik
2017-01-01
Cascade reactions proceeding through peptide-derived N-carbamoyl iminium ions are reported. Two new reactions of N-carbamoyl iminium ions are described, including a stereoselective double cyclization generating N,N′-aminals and an acid-promoted auto-oxidation. Mechanistic investigations revealed...... that the N,N′-aminal formation is reversible under strongly acidic conditions. Both of these new reactions proved to be completely orthogonal to subsequent CuAAC chemistry. The reactions were performed in solution and on solid support. The robustness and high stereoselectivity of the methodology holds great...
Leprosy reversal reaction as immune reconstitution inflammatory syndrome in patients with AIDS
Batista, Mariana Dias [UNIFESP; Porro, Adriana Maria [UNIFESP; Maeda, Solange Miki [UNIFESP; Gomes, Elimar Elias [UNIFESP; Yoshioka, Marcia Cristina Naomi [UNIFESP; Enokihara, Mílvia Maria Simões e Silva [UNIFESP; Tomimori, Jane [UNIFESP
2008-01-01
We report 2 instances in which reactional borderline leprosy manifested itself as an immune reconstitution phenomenon in patients with acquired immunodeficiency syndrome. We discuss the clinical, laboratory-based, histopathologic, and immunohistochemical characteristics of both patients. Furthermore, we review similar reports from the literature.
Leprosy reversal reaction as immune reconstitution inflammatory syndrome in patients with AIDS.
Batista, Mariana D; Porro, Adriana M; Maeda, Solange M; Gomes, Elimar E; Yoshioka, Márcia C N; Enokihara, Mílvia M S S; Tomimori, Jane
2008-03-15
We report 2 instances in which reactional borderline leprosy manifested itself as an immune reconstitution phenomenon in patients with acquired immunodeficiency syndrome. We discuss the clinical, laboratory-based, histopathologic, and immunohistochemical characteristics of both patients. Furthermore, we review similar reports from the literature.
Reversible Thermoset Adhesives
Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)
2016-01-01
Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.
Thermally reversible cross-linked poly(ether-urethanes
Directory of Open Access Journals (Sweden)
V. Gaina
2013-07-01
Full Text Available Cross-linked poly(ether-urethanes were prepared by Diels-Alder (DA reaction of the furan-containing poly(ether-urethane to bismaleimides and showed thermal reversibility evidenced by differential scanning calorimetry and attenuated total reflectance in conjunction with Fourier transform infrared spectroscopy (ATR-FTIR. The furan-containing poly(ether-urethanes were synthesized by the polyaddition reaction of 1,6-hexamethylene diisocyanate (HMDI or 4,4'- dibenzyl diisocyanate (DBDI to poly(tetramethylene ether glycol (PTMEG having Mn = 250, 650, 1000, 1500 and 2000 and 2-[N,N-bis(2-methyl-2-hydroxyethylamino]furfuryl as chain extender by the solution prepolymer method. The molar ratio of isocyanate: PTMEG:chain extender varied from 2:1:1 to 4:1:3, which produces a molar concentration of furyl group ranging between 3.65•10–4 and 1.25•10–3 mol/g.
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Dysregulated Homeostasis of Acetylcholine Levels in Immune Cells of RR-Multiple Sclerosis Patients
Directory of Open Access Journals (Sweden)
Maria Di Bari
2016-11-01
Full Text Available Multiple sclerosis (MS is characterized by pro-inflammatory cytokine production. Acetylcholine (ACh contributes to the modulation of central and peripheral inflammation. We studied the homeostasis of the cholinergic system in relation to cytokine levels in immune cells and sera of relapsing remitting-MS (RR-MS patients. We demonstrated that lower ACh levels in serum of RR-MS patients were inversely correlated with the increased activity of the hydrolyzing enzymes acetylcholinesterase (AChE and butyrylcholinesterase (BuChE. Interestingly, the expression of the ACh biosynthetic enzyme and the protein carriers involved in non-vesicular ACh release were found overexpressed in peripheral blood mononuclear cells of MS patients. The inflammatory state of the MS patients was confirmed by increased levels of TNFα, IL-12/IL-23p40, IL-18. The lower circulating ACh levels in sera of MS patients are dependent on the higher activity of cholinergic hydrolyzing enzymes. The smaller ratio of ACh to TNFα, IL-12/IL-23p40 and IL-18 in MS patients, with respect to healthy donors (HD, is indicative of an inflammatory environment probably related to the alteration of cholinergic system homeostasis.
Properties of Asymmetric Detrended Fluctuation Analysis in the time series of RR intervals
Piskorski, J.; Kosmider, M.; Mieszkowski, D.; Krauze, T.; Wykretowicz, A.; Guzik, P.
2018-02-01
Heart rate asymmetry is a phenomenon by which the accelerations and decelerations of heart rate behave differently, and this difference is consistent and unidirectional, i.e. in most of the analyzed recordings the inequalities have the same directions. So far, it has been established for variance and runs based types of descriptors of RR intervals time series. In this paper we apply the newly developed method of Asymmetric Detrended Fluctuation Analysis, which so far has mainly been used with economic time series, to the set of 420 stationary 30 min time series of RR intervals from young, healthy individuals aged between 20 and 40. This asymmetric approach introduces separate scaling exponents for rising and falling trends. We systematically study the presence of asymmetry in both global and local versions of this method. In this study global means "applying to the whole time series" and local means "applying to windows jumping along the recording". It is found that the correlation structure of the fluctuations left over after detrending in physiological time series shows strong asymmetric features in both magnitude, with α+ physiological data after shuffling or with a group of symmetric synthetic time series.
Zero field reversal probability in thermally assisted magnetization reversal
Prasetya, E. B.; Utari; Purnama, B.
2017-11-01
This paper discussed about zero field reversal probability in thermally assisted magnetization reversal (TAMR). Appearance of reversal probability in zero field investigated through micromagnetic simulation by solving stochastic Landau-Lifshitz-Gibert (LLG). The perpendicularly anisotropy magnetic dot of 50×50×20 nm3 is considered as single cell magnetic storage of magnetic random acces memory (MRAM). Thermally assisted magnetization reversal was performed by cooling writing process from near/almost Curie point to room temperature on 20 times runs for different randomly magnetized state. The results show that the probability reversal under zero magnetic field decreased with the increase of the energy barrier. The zero-field probability switching of 55% attained for energy barrier of 60 k B T and the reversal probability become zero noted at energy barrier of 2348 k B T. The higest zero-field switching probability of 55% attained for energy barrier of 60 k B T which corespond to magnetif field of 150 Oe for switching.
Test of parity and time reversal invariance with low energy polarized neutrons
International Nuclear Information System (INIS)
Masaike, Akira
1996-01-01
Measurements of helicity asymmetries in slow neutron reactions on nuclei have been performed by transmission and capture γ-ray detection. Large enhancements of parity-violation effects have been observed on p-wave resonances of various medium and heavy nuclei. The weak matrix elements in hadron reactions have been deduced from these experimental results. Neutron spin precession near the p-wave resonance has been measured. In recent years violation of time reversal invariance is being searched for in the neutron reactions in which large enhancements of the parity violation effects have been observed. The measurement of the term σ n ·(k n x I) in a neutron reaction using polarized neutrons and a polarized target is an example of the test of T-violation. Polarizations of the neutron and lanthanum nucleus for these experiments are also presented. (author)
76 FR 52288 - Airworthiness Directives; Rolls-Royce plc (RR) Trent 800 Series Turbofan Engines
2011-08-22
...-0836; Directorate Identifier 2010-NE-38-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom: telephone 44 (0) 1332 242424; fax 44 (0) 1332... based on those comments. We will post all comments we receive, without change, to http://www.regulations...
Reversal of a Suspected Paradoxical Reaction to Zopiclone with Flumazenil
DEFF Research Database (Denmark)
Jordahn, Zarah; Andersen, Cheme; Aaberg, Anne Marie Roust
2016-01-01
We describe the care for an elderly woman who was admitted to the intensive care unit (ICU) to receive noninvasive ventilation for acute exacerbation of chronic obstructive pulmonary disease. After administration of the sleeping pill zopiclone, a nonbenzodiazepine receptor agonist (NBRA), the pat......We describe the care for an elderly woman who was admitted to the intensive care unit (ICU) to receive noninvasive ventilation for acute exacerbation of chronic obstructive pulmonary disease. After administration of the sleeping pill zopiclone, a nonbenzodiazepine receptor agonist (NBRA...... indicates that zopiclone induced behavioral changes resembling a paradoxical reaction to benzodiazepines and these symptoms may be treated with flumazenil....
Indian Academy of Sciences (India)
many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...
Reverse microemulsion synthesis of layered gadolinium hydroxide nanoparticles
Xu, Yadong; Suthar, Jugal; Egbu, Raphael; Weston, Andrew J.; Fogg, Andrew M.; Williams, Gareth R.
2018-02-01
A reverse microemulsion approach has been explored for the synthesis of layered gadolinium hydroxide (LGdH) nanoparticles in this work. This method uses oleylamine as a multifunctional agent, acting as surfactant, oil phase and base. 1-butanol is additionally used as a co-surfactant. A systematic study of the key reaction parameters was undertaken, including the volume ratio of surfactant (oleylamine) to water, the reaction time, synthesis temperature, and the amount of co-surfactant (1-butanol) added. It proved possible to obtain pristine LGdH materials at temperatures of 120 °C or below with an oleylamine: water ratio of 1:4. Using larger amounts of surfactant or higher temperatures caused the formation of Gd(OH)3, either as the sole product or as a major impurity phase. The LGdH particles produced have sizes of ca. 200 nm, with this size being largely independent of temperature or reaction time. Adjusting the amount of 1-butanol co-surfactant added permits the size to be varied between 200 and 300 nm.
Gargano, Andrea F G; Leek, Tomas; Lindner, Wolfgang; Lämmerhofer, Michael
2013-01-01
In the present contribution a novel Ugi multicomponent reaction (MCR) was used to generate zwitterionic chromatographic selectors with capability for application in mixed-mode chromatography featuring complementary selectivities in reversed-phase (RP) and hydrophilic interaction liquid
DEFF Research Database (Denmark)
Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin
2006-01-01
oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....
Versatile Dual Photoresponsive System for Precise Control of Chemical Reactions.
Xu, Can; Bing, Wei; Wang, Faming; Ren, Jinsong; Qu, Xiaogang
2017-08-22
A versatile method for photoregulation of chemical reactions was developed through a combination of near-infrared (NIR) and ultraviolet (UV) light sensitive materials. This regulatory effect was achieved through photoresponsive modulation of reaction temperature and pH values, two prominent factors influencing reaction kinetics. Photothermal nanomaterial graphene oxide (GO) and photobase reagent malachite green carbinol base (MGCB) were selected for temperature and pH regulation, respectively. Using nanocatalyst- and enzyme-mediated chemical reactions as model systems, we demonstrated the feasibility and high efficiency of this method. In addition, a photoresponsive, multifunctional "Band-aid"-like hydrogel platform was presented for programmable wound healing. Overall, this simple, efficient, and reversible system was found to be effective for controlling a wide variety of chemical reactions. Our work may provide a method for remote and sustainable control over chemical reactions for industrial and biomedical applications.
Directory of Open Access Journals (Sweden)
W. Ali
2017-06-01
Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.
Analysis of R-R intervals in patients with atrial fibrillation at rest and during exercise
Bootsma, B.K.; Hoelen, A.J.; Strackee, J.; Meijler, F.L.
Serial autocorrelation functions and histograms of R-R intervals in patients with atrial fibrillation, with and without digitalis, at rest and during exercise, were produced by a computer. At rest with and without digitalis the first and higher order coefficients did not differ from zero. During
National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...
National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...
International Nuclear Information System (INIS)
Doktorov, Alexander B; Kipriyanov, Alexey A
2007-01-01
In considering the irreversible chemical reaction A+B→ C+B in liquid solutions two many-particle approaches to the derivation of binary non-Markovian kinetic equations are compared: simple superposition decoupling and a method of extracting 'pair' channels from three-particle correlation evolution. It is shown that both methods provide an almost identical description of this reaction. However, in studies of reversible reactions in liquid solutions only the channel extraction method gives a correct physically clear description of the reaction though it consists of a sequence of steps: the development of integral encounter theory (IET), effective pairs approximation (EPA), modified encounter theory (MET), and the final regular form (RF) of kinetic equations. It is shown that the rate equations often encountered in the literature correspond to the independence of transient channels of 'scattering' in the bimolecular reversible reaction (A+B -B), while the independent transient channel of 'decay' in the reversible reactionA+B -C is defined solely by time integral convolution. In the general case transient channels in non-Markovian theory are not independent, and their interference manifests itself as a non-Markovian inhomogeneous source in binary non-Markovian kinetic equations in regular form. Based on the derived equations new universal kinetics (independent of models) of chemical equilibrium attainment have been obtained. It is shown that these kinetics can differ essentially from the kinetics corresponding to the kinetic law of mass action of formal chemical kinetics
Reversible insertion of carbon dioxide into Pt(II)-hydroxo bonds.
Lohr, Tracy L; Piers, Warren E; Parvez, Masood
2013-10-01
The reactivity of three monomeric diimine Pt(II) hydroxo complexes, (NN)Pt(OH)R (NN = bulky diimine ligand; R = OH, ; R = C6H5, ; R = CH3, ) towards carbon dioxide has been investigated. Insertion into the Pt-OH bonds was found to be facile and reversible at low temperature for all compounds; the reaction with bis-hydroxide gives an isolable κ(2)-carbonato compound , with elimination of water.
The Outer Halo of the Milky Way as Probed by RR Lyr Variables from the Palomar Transient Facility
Cohen, Judith G.; Sesar, Branimir; Bahnolzer, Sophianna; He, Kevin; Kulkarni, Shrinivas R.; Prince, Thomas A.; Bellm, Eric; Laher, Russ R.
2017-11-01
RR Lyrae stars are ideal massless tracers that can be used to study the total mass and dark matter content of the outer halo of the Milky Way (MW). This is because they are easy to find in the light-curve databases of large stellar surveys and their distances can be determined with only knowledge of the light curve. We present here a sample of 112 RR Lyr stars beyond 50 kpc in the outer halo of the MW, excluding the Sgr streams, for which we have obtained moderate-resolution spectra with Deimos on the Keck II Telescope. Four of these have distances exceeding 100 kpc. These were selected from a much larger set of 447 candidate RR Lyr stars that were data-mined using machine-learning techniques applied to the light curves of variable stars in the Palomar Transient Facility database. The observed radial velocities taken at the phase of the variable corresponding to the time of observation were converted to systemic radial velocities in the Galactic standard of rest. From our sample of 112 RR Lyr stars we determine the radial velocity dispersion in the outer halo of the MW to be ˜90 km s-1 at 50 kpc, falling to about 65 km s-1 near 100 kpc once a small number of major outliers are removed. With reasonable estimates of the completeness of our sample of 447 candidates and assuming a spherical halo, we find that the stellar density in the outer halo declines as {r}-4. Based in part on observations obtained at the W. M. Keck Observatory, which is operated jointly by the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration.
Redox-induced reversible luminescence switching of cerium-doped upconversion nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Huang, Yanan [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Xiao, Qingbo, E-mail: qbxiao2011@sinano.ac.cn [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Wang, Jian [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Xi, Yonglan [Laboratory for Agricultural Wastes Treatment and Recycling Institute of Agricultural Resources and Environment, Jiangsu Academy of Agricultural Science, Nanjing 210014 (China); Li, Fujin [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Feng, Yamin [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Shi, Liyi [College of Sciences, Shanghai University, Shanghai 200444 (China); Lin, Hongzhen, E-mail: hzlin2010@sinano.ac.cn [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China)
2016-05-15
Smart upconversion nanophosphors (UCNPs) that can be reversibly switched between two or more luminescent states by certain external stimuli have attracted considerable attention due to their great potential in biological applications. Here we report for the first time a type of redox-switchable UCNPs by codoping NaGdF{sub 4}:Yb/Er nanorods with the redox-active Ce{sup 3+}/Ce{sup 4+} ion pairs. A reversible switching of their UC luminescence intensity was observed upon the variation of the surrounding redox environments. We show solid proof that the luminescence switching is caused by the tailoring of the NaGdF{sub 4} host crystal structure in response to changing redox state of the codoped cerium ions. A proof-of-concept example is further demonstrated by using these UCNPs for probing the dynamical variation of redox environments in biological tissues. - Highlights: • Synthesis of upconversion nanoparticles doped with Ce{sup 3+}/Ce{sup 4+} ions. • The precise and reversible modification of crystal structure by redox reactions. • Tuning the upconversion luminescence by tailoring the crystal structure.
Solar energy powered microbial fuel cell with a reversible bioelectrode.
Strik, David P B T B; Hamelers, Hubertus V M; Buisman, Cees J N
2010-01-01
The solar energy powered microbial fuel cell is an emerging technology for electricity generation via electrochemically active microorganisms fueled by solar energy via in situ photosynthesized metabolites from algae, cyanobacteria, or living higher plants. A general problem with microbial fuel cells is the pH membrane gradient which reduces cell voltage and power output. This problem is caused by acid production at the anode, alkaline production at the cathode, and the nonspecific proton exchange through the membrane. Here we report a solution for a new kind of solar energy powered microbial fuel cell via development of a reversible bioelectrode responsible for both biocatalyzed anodic and cathodic electron transfer. Anodic produced protons were used for the cathodic reduction reaction which held the formation of a pH membrane gradient. The microbial fuel cell continuously generated electricity and repeatedly reversed polarity dependent on aeration or solar energy exposure. Identified organisms within biocatalyzing biofilm of the reversible bioelectrode were algae, (cyano)bacteria and protozoa. These results encourage application of solar energy powered microbial fuel cells.
International Nuclear Information System (INIS)
Hester, L.S.; Raushel, F.M.
1987-01-01
A method has been developed for obtaining qualitative information about enzyme-catalyzed reactions by measuring the inhibitory effects of added substrates on positional isotope exchange rates. It has been demonstrated for ordered kinetic mechanisms that an increase in the concentration of the second substrate to add to the enzyme will result in a linear increase in the ratio of the chemical and positional isotope exchange rates. The slopes and intercepts from these plots can be used to determine the partitioning ratios of binary and ternary enzyme complexes. The method has been applied to the reaction catalyzed by UDP-glucose pyrophosphorylase. A positional isotope exchange reaction was measured within oxygen-18-labeled UTP as a function of variable glucose 1-phosphate concentration in the forward reaction. In the reverse reaction, a positional isotope exchange reaction was measured within oxygen-18-labeled UDP-glucose as a function of increasing pyrophosphate concentration. The results have been interpreted to indicate that the interconversion of the ternary central complexes is fast relative to product dissociation in either direction. In the forward direction, the release of UDP-glucose is slower than the release of pyrophosphate. The release of glucose 1-phosphate is slower than the release of UTP in the reverse reaction
Beauchemin, André M
2013-11-07
Cope-type hydroaminations are versatile for the direct amination of alkenes, alkynes and allenes using hydroxylamines and hydrazine derivatives. These reactions occur via a concerted, 5-membered cyclic transition state that is the microscopic reverse of the Cope elimination. This article focuses on recent developments, including intermolecular variants, directed reactions, and asymmetric variants using aldehydes as tethering catalysts, and their applications in target-oriented synthesis.
Directory of Open Access Journals (Sweden)
Hamed Rezaeejam
2015-01-01
Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.
Random attractors for stochastic lattice reversible Gray-Scott systems with additive noise
Directory of Open Access Journals (Sweden)
Hongyan Li
2015-10-01
Full Text Available In this article, we prove the existence of a random attractor of the stochastic three-component reversible Gray-Scott system on infinite lattice with additive noise. We use a transformation of addition involved with Ornstein-Uhlenbeck process, for proving the pullback absorbing property and the pullback asymptotic compactness of the reaction diffusion system with cubic nonlinearity.
Spackman, Erica; Suarez, David L
2005-01-01
Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.
International Nuclear Information System (INIS)
Mohebbi, Maryam; Ghassemian, Hassan
2011-01-01
Atrial fibrillation (AF) is the most common cardiac arrhythmia and increases the risk of stroke. Predicting the onset of paroxysmal AF (PAF), based on noninvasive techniques, is clinically important and can be invaluable in order to avoid useless therapeutic intervention and to minimize risks for the patients. In this paper, we propose an effective PAF predictor which is based on the analysis of the RR-interval signal. This method consists of three steps: preprocessing, feature extraction and classification. In the first step, the QRS complexes are detected from the electrocardiogram (ECG) signal and then the RR-interval signal is extracted. In the next step, the recurrence plot (RP) of the RR-interval signal is obtained and five statistically significant features are extracted to characterize the basic patterns of the RP. These features consist of the recurrence rate, length of longest diagonal segments (L max ), average length of the diagonal lines (L mean ), entropy, and trapping time. Recurrence quantification analysis can reveal subtle aspects of dynamics not easily appreciated by other methods and exhibits characteristic patterns which are caused by the typical dynamical behavior. In the final step, a support vector machine (SVM)-based classifier is used for PAF prediction. The performance of the proposed method in prediction of PAF episodes was evaluated using the Atrial Fibrillation Prediction Database (AFPDB) which consists of both 30 min ECG recordings that end just prior to the onset of PAF and segments at least 45 min distant from any PAF events. The obtained sensitivity, specificity, positive predictivity and negative predictivity were 97%, 100%, 100%, and 96%, respectively. The proposed methodology presents better results than other existing approaches
Bloomfield, D M; Magnano, A; Bigger, J T; Rivadeneira, H; Parides, M; Steinman, R C
2001-03-01
R-R interval variability (RR variability) is increasingly being used as an index of autonomic activity. High-frequency (HF) power reflects vagal modulation of the sinus node. Since vagal modulation occurs at the respiratory frequency, some investigators have suggested that HF power cannot be interpreted unless the breathing rate is controlled. We hypothesized that HF power during spontaneous breathing would not differ significantly from HF power during metronome-guided breathing. We measured HF power during spontaneous breathing in 20 healthy subjects and 19 patients with heart disease. Each subject's spontaneous breathing rate was determined, and the calculation of HF power was repeated with a metronome set to his or her average spontaneous breathing rate. There was no significant difference between the logarithm of HF power measured during spontaneous and metronome-guided breathing [4.88 +/- 0.29 vs. 5.29 +/- 0.30 ln(ms(2)), P = 0.32] in the group as a whole and when patients and healthy subjects were examined separately. We did observe a small (9.9%) decrease in HF power with increasing metronome-guided breathing rates (from 9 to 20 breaths/min). These data indicate that HF power during spontaneous and metronome-guided breathing differs at most by very small amounts. This variability is several logarithmic units less than the wide discrepancies observed between healthy subjects and cardiac patients with a heterogeneous group of cardiovascular disorders. In addition, HF power is relatively constant across the range of typical breathing rates. These data indicate that there is no need to control breathing rate to interpret HF power when RR variability (and specifically HF power) is used to identify high-risk cardiac patients.
Doktorov, Alexander B
2015-08-21
Manifestations of the "cage effect" at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a "cage complex." Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the "cage effect" leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.
Ozcan, Gulnihal; Aykac, Emel; Kasap, Yelda; Nemutlu, Nergiz T; Sen, Ebru; Aydinkarahaliloglu, N Demet
2016-03-01
In Turkey, pharmacovigilance began in 1985. A fully structured adverse drug reaction (ADR)-reporting system was established with the publication of the first pharmacovigilance regulation in 2005. Subsequent regulation published in 2014 brought further improvements to the system. In this study, we aimed to analyse the ADR-reporting pattern in the context of the first pharmacovigilance legislation in Turkey. We analysed ADR reports submitted to the Turkish Pharmacovigilance Center (TUFAM) from 2005 to 2014 with respect to reporting rate (RR), patient characteristics, type of the ADRs, suspected drugs, source of the report and the profession of the reporter. The annual RR increased gradually over the study period. RRs for females were greater than those for males. RRs were highly correlated with age. Most commonly reported ADRs were skin and subcutaneous tissue disorders. Most commonly suspected drugs were antineoplastic and immunomodulating agents. There was no remarkable change in reporting pattern of ADRs, patient characteristics or classes of suspected drugs over the years. The most common source of reports was spontaneous reporting. Contribution of the reports from studies increased gradually. Most of the reports were reported by physicians. RRs by pharmacists increased substantially over the years. This study showed that the annual RR increased gradually over the 9-year study period. This increase was neither due to an increased reporting of a specific group of ADRs or drugs, nor to an increased reporting in a specific group of patients. There was a general increase in RR in parallel to pharmacovigilance activities.
Characterizing multistationarity regimes in biochemical reaction networks.
Directory of Open Access Journals (Sweden)
Irene Otero-Muras
Full Text Available Switch like responses appear as common strategies in the regulation of cellular systems. Here we present a method to characterize bistable regimes in biochemical reaction networks that can be of use to both direct and reverse engineering of biological switches. In the design of a synthetic biological switch, it is important to study the capability for bistability of the underlying biochemical network structure. Chemical Reaction Network Theory (CRNT may help at this level to decide whether a given network has the capacity for multiple positive equilibria, based on their structural properties. However, in order to build a working switch, we also need to ensure that the bistability property is robust, by studying the conditions leading to the existence of two different steady states. In the reverse engineering of biological switches, knowledge collected about the bistable regimes of the underlying potential model structures can contribute at the model identification stage to a drastic reduction of the feasible region in the parameter space of search. In this work, we make use and extend previous results of the CRNT, aiming not only to discriminate whether a biochemical reaction network can exhibit multiple steady states, but also to determine the regions within the whole space of parameters capable of producing multistationarity. To that purpose we present and justify a condition on the parameters of biochemical networks for the appearance of multistationarity, and propose an efficient and reliable computational method to check its satisfaction through the parameter space.
Giacoia-Gripp, Carmem Beatriz Wagner; Sales, Anna Maria; Nery, José Augusto da Costa; Santos-Oliveira, Joanna Reis; de Oliveira, Ariane Leite; Sarno, Euzenir Nunes; Morgado, Mariza Gonçalves
2011-01-01
Background It is now evident that HAART-associated immunological improvement often leads to a variety of new clinical manifestations, collectively termed immune reconstitution inflammatory syndrome, or IRIS. This phenomenon has already been described in cases of HIV coinfection with Mycobacterium leprae, most of them belonging to the tuberculoid spectrum of leprosy disease, as observed in leprosy reversal reaction (RR). However, the events related to the pathogenesis of this association need to be clarified. This study investigated the immunological profile of HIV/leprosy patients, with special attention to the cellular activation status, to better understand the mechanisms related to IRIS/RR immunopathogenesis, identifying any potential biomarkers for IRIS/RR intercurrence. Methods/Principal Findings Eighty-five individuals were assessed in this study: HIV/leprosy and HIV-monoinfected patients, grouped according to HIV-viral load levels, leprosy patients without HIV coinfection, and healthy controls. Phenotypes were evaluated by flow cytometry for T cell subsets and immune differentiation/activation markers. As expected, absolute counts of the CD4+ and CD8+ T cells from the HIV-infected individuals changed in relation to those of the leprosy patients and controls. However, there were no significant differences among the groups, whether in the expression of cellular differentiation phenotypes or cellular activation, as reflected by the expression of CD38 and HLA-DR. Six HIV/leprosy patients identified as IRIS/RR were analyzed during IRIS/RR episodes and after prednisone treatment. These patients presented high cellular activation levels regarding the expression of CD38 in CD8+ cells T during IRIS/RR (median: 77,15%), dropping significantly (pleprosy individuals at risk for IRIS/RR. So, a comparative investigation to leprosy patients at RR should be conducted. PMID:22205964
Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi
2014-01-01
Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.
Amendola, R
1994-11-01
The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.
Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe
2009-04-01
The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.
Managing Reverse Logistics or Reversing Logistics Management?
M.P. de Brito (Marisa)
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse
van Sint Annaland, M.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria
2001-01-01
A new reverse flow reactor is developed where endothermic reactants (propane dehydrogenation) and exothermic reactants (fuel combustion) are fed sequentially to a monolithic catalyst, while periodically alternating the inlet and outlet positions. Upon switching from reductive to oxidative conditions
Visual but not motor processes predict simple visuomotor reaction time of badminton players.
Hülsdünker, Thorben; Strüder, Heiko K; Mierau, Andreas
2018-03-01
The athlete's brain exhibits significant functional adaptations that facilitate visuomotor reaction performance. However, it is currently unclear if the same neurophysiological processes that differentiate athletes from non-athletes also determine performance within a homogeneous group of athletes. This information can provide valuable help for athletes and coaches aiming to optimize existing training regimes. Therefore, this study aimed to identify the neurophysiological correlates of visuomotor reaction performance in a group of skilled athletes. In 36 skilled badminton athletes, electroencephalography (EEG) was used to investigate pattern reversal and motion onset visual-evoked potentials (VEPs) as well as visuomotor reaction time (VMRT) during a simple reaction task. Stimulus-locked and response-locked event-related potentials (ERPs) in visual and motor regions as well as the onset of muscle activation (EMG onset) were determined. Correlation and multiple regression analyses identified the neurophysiological parameters predicting EMG onset and VMRT. For pattern reversal stimuli, the P100 latency and age best predicted EMG onset (r = 0.43; p = .003) and VMRT (r = 0.62; p = .001). In the motion onset experiment, EMG onset (r = 0.80; p badminton players while motor-related processes, although differentiating athletes from non-athletes, are not associated simple with visuomotor reaction performance.
Directory of Open Access Journals (Sweden)
Everson Reis Carvalho
2014-09-01
Full Text Available Sementes de soja com alta qualidade fisiológica são essenciais à obtenção de produtividade elevada e um dos fatores que afetam a produção de sementes é a nutrição mineral. O objetivo neste trabalho foi avaliar o efeito da aplicação foliar de manganês, em diferentes doses e estádios de aplicação, na qualidade fisiológica de sementes de soja, em cultivares convencionais e em suas derivadas transgênicas RR, com distintos teores de lignina do tegumento. O ensaio foi conduzido em blocos casualizados, com três repetições e esquema fatorial 4 x 4 x 2, sendo quatro cultivares de soja, duas convencionais e suas derivadas transgênicas RR (BRS Celeste e BRS Baliza RR; BRSGO Jataí e BRS Silvânia RR, quatro doses de Mn via foliar (0; 200; 400 e 600 g Mn ha-1 e dois estádios de aplicação (R1 e R3. A qualidade fisiológica das sementes foi estimada, antes e após seis meses de armazenamento, por meio dos testes: Germinação, Envelhecimento acelerado, Emergência de plântulas, Condutividade elétrica e Tetrazólio (Viabilidade, vigor e danos mecânicos. Realizou-se também a quantificação de lignina no tegumento das sementes. A aplicação foliar de Mn proporciona incrementos na qualidade fisiológica nas sementes de soja produzidas. Sementes das cultivares de soja Celeste e Baliza RR apresentam melhor qualidade fisiológica quando comparadas às de Jataí e Silvânia RR. Sementes de cultivares de soja com maior teor de lignina no tegumento não apresentam necessariamente melhor qualidade fisiológica, sendo a qualidade das sementes relacionada a outros fatores intrínsecos ao genótipo.
Reversible structural modulation of Fe-Pt bimetallic surfaces and its effect on reactivity.
Ma, Teng; Fu, Qiang; Su, Hai-Yan; Liu, Hong-Yang; Cui, Yi; Wang, Zhen; Mu, Ren-Tao; Li, Wei-Xue; Bao, Xin-He
2009-05-11
Tunable surface: The surface structure of the Fe-Pt bimetallic catalyst can be reversibly modulated between the iron-oxide-rich Pt surface and the Pt-skin structure with subsurface Fe via alternating reduction and oxidation treatments (see figure). The regenerated active Pt-skin structure is active in reactions involving CO and/or O.
Quantum theory of exchange reactions: Use of nonorthogonal bases and coordinates
International Nuclear Information System (INIS)
Stechel, E.B.; Schmalz, T.G.; Light, J.C.
1979-01-01
A general approach to quantum scattering theory of exchange reactions utilizing nonorthogonal (''over-complete'') basis sets and nonorthogonal coordinates is presented. The method is shown to resolve many of the formal and practical difficulties attending earlier theories. Although the inspiration came from the early and accurate work on the collinear H+H 2 reaction by Diestler possible applications include electron transfer processes as well as chemical exchange reactions. The mathematics is formulated in detail and the solution is presented in terms of the R-matrix propagation method preserving all the symmetries of the physical process, i.e., conservation of flux and microscopic reversibility
Tsoulou, A; Ferrari, A; CERN. Geneva. AB Department
2005-01-01
The Collimation project is one of the most crucial for the LHC performance. 54 movable, two-sided collimators will be placed in two insertions, i.e. IR3 and IR7, which will be among the most radioactive in the LHC. For a normal machine operation, it is essential that the electronics do not degrade or fail â" at least very often â" due to irradiation. The radiation levels initially estimated in IR7 (RR73/77 and UJ76) were too high for the electronics to tolerate. A shielding study was necessary to be done, in parallel with the study for the absorber positions. This article summarizes the shielding proposed and the radiation levels calculated for the final collimator and absorber positions as indicated by the FLUKA team.
Tsoulou, A; Ferrari, A
2005-01-01
The Collimation project is one of the most crucial for the LHC performance. 54 movable, two-sided collimators will be placed in two insertions, i.e. IR3 and IR7, which will be among the most radioactive in the LHC. For a normal machine operation, it is essential that the electronics do not degrade or fail â" at least very often â" due to irradiation. The radiation levels initially estimated in IR7 (RR73/77 and UJ76) were too high for the electronics to tolerate. A shielding study was necessary to be done, in parallel with the study for the absorber positions. This article summarizes the shielding proposed and the radiation levels calculated for the final collimator and absorber positions as indicated by the FLUKA team.
Inelastic Branch of the Stellar Reaction $^{14}$O$(\\alpha,p)^{17}$F
Hass, M; Van duppen, P L E
2002-01-01
We propose to use the upgraded REX-ISOLDE beam energy to study the astrophysically important $^{14}$O($\\alpha$, p)$^{17}$F reaction in time reverse kinematics. In particular, we will use the highly efficient miniball + CD detection system to measure the previously undetermined inelastic proton branch of the 1$^-$ state at 6.15 MeV in $^{18}$Ne. This state dominates the reaction rate under X-ray burster conditions.
77 FR 1009 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines
2012-01-09
... Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines AGENCY: Federal Aviation... 5, 2005). ADDRESSES: For service information identified in this AD, contact Rolls-Royce plc, P.O...,000. Based on these figures, we estimate the total cost of the AD to U.S. operators to be $4,206,960...
Research performed at the ET-RR-1 reactor using the neutron scattering equipment
International Nuclear Information System (INIS)
Adib, M.; Maayouf, R.M.A.; Abdel-Kawy, A.
1990-02-01
This report represents the results of studies and measurements, performed at the ET-RR-1 reactor, using the neutron scattering equipment supplied by the IAEA according to the technical assistance project EGY/1/11/10. The results of these studies, starting in 1980 and continuing to date, are discussed; the use of the equipment, both as a neutron monochromator and fixed scattering angle spectrometer, is also assessed. (author). 19 refs, 17 figs
Niobium(V) chloride as catalyst in Diels-Alder reaction of furan ring
International Nuclear Information System (INIS)
Santos, Deborah A. dos; Rodrigues, Ludmila R.; Arpini, Bruno H.; Lacerda Junior, Valdemar; Greco, Sandro J.; Santos, Reginaldo B. dos; Neto, Alvaro C.; Castro, Eustaquio V.R. de
2014-01-01
According to the relevant literature, the Diels-Alder reaction of furan without a catalyst can last several weeks and shows a low yield due to the diene’s low reactivity. The use of Lewis acid catalysts or high pressures is described as an effective method for improving the reaction yields. This paper describes our recent study on the use of niobium pentachloride as the catalyst in Diels-Alder reactions between furan and several reactive dienophiles, among which methyl acrylate showed good yields, especially at lower temperatures. Other dienophiles have shown lower yields because of problems such as byproduct formation and the high reversibility of the reaction. (author)
Niobium(V) chloride as catalyst in Diels-Alder reaction of furan ring
Energy Technology Data Exchange (ETDEWEB)
Santos, Deborah A. dos; Rodrigues, Ludmila R.; Arpini, Bruno H.; Lacerda Junior, Valdemar; Greco, Sandro J.; Santos, Reginaldo B. dos; Neto, Alvaro C.; Castro, Eustaquio V.R. de, E-mail: vljuniorqui@gmail.com [Universidade Federal do Espirito Santo (UFES), Vitoria, ES (Brazil). Dept. de Quimica; Romao, Wanderson [Instituto Federal de Educacao, Ciencia e Tecnologia (IFES), Vila Velha, ES (Brazil)
2014-05-15
According to the relevant literature, the Diels-Alder reaction of furan without a catalyst can last several weeks and shows a low yield due to the diene’s low reactivity. The use of Lewis acid catalysts or high pressures is described as an effective method for improving the reaction yields. This paper describes our recent study on the use of niobium pentachloride as the catalyst in Diels-Alder reactions between furan and several reactive dienophiles, among which methyl acrylate showed good yields, especially at lower temperatures. Other dienophiles have shown lower yields because of problems such as byproduct formation and the high reversibility of the reaction. (author)
Giacoia-Gripp, Carmem Beatriz Wagner; Sales, Anna Maria; Nery, José Augusto da Costa; Santos-Oliveira, Joanna Reis; de Oliveira, Ariane Leite; Sarno, Euzenir Nunes; Morgado, Mariza Gonçalves
2011-01-01
It is now evident that HAART-associated immunological improvement often leads to a variety of new clinical manifestations, collectively termed immune reconstitution inflammatory syndrome, or IRIS. This phenomenon has already been described in cases of HIV coinfection with Mycobacterium leprae, most of them belonging to the tuberculoid spectrum of leprosy disease, as observed in leprosy reversal reaction (RR). However, the events related to the pathogenesis of this association need to be clarified. This study investigated the immunological profile of HIV/leprosy patients, with special attention to the cellular activation status, to better understand the mechanisms related to IRIS/RR immunopathogenesis, identifying any potential biomarkers for IRIS/RR intercurrence. Eighty-five individuals were assessed in this study: HIV/leprosy and HIV-monoinfected patients, grouped according to HIV-viral load levels, leprosy patients without HIV coinfection, and healthy controls. Phenotypes were evaluated by flow cytometry for T cell subsets and immune differentiation/activation markers. As expected, absolute counts of the CD4+ and CD8+ T cells from the HIV-infected individuals changed in relation to those of the leprosy patients and controls. However, there were no significant differences among the groups, whether in the expression of cellular differentiation phenotypes or cellular activation, as reflected by the expression of CD38 and HLA-DR. Six HIV/leprosy patients identified as IRIS/RR were analyzed during IRIS/RR episodes and after prednisone treatment. These patients presented high cellular activation levels regarding the expression of CD38 in CD8+ cells T during IRIS/RR (median: 77,15%), dropping significantly (p<0,05) during post-IRIS/RR moments (median: 29,7%). Furthermore, an increase of cellular activation seems to occur prior to IRIS/RR. These data suggest CD38 expression in CD8+ T cells interesting tool identifying HIV/leprosy individuals at risk for IRIS/RR. So, a
Directory of Open Access Journals (Sweden)
Carmem Beatriz Wagner Giacoia-Gripp
Full Text Available BACKGROUND: It is now evident that HAART-associated immunological improvement often leads to a variety of new clinical manifestations, collectively termed immune reconstitution inflammatory syndrome, or IRIS. This phenomenon has already been described in cases of HIV coinfection with Mycobacterium leprae, most of them belonging to the tuberculoid spectrum of leprosy disease, as observed in leprosy reversal reaction (RR. However, the events related to the pathogenesis of this association need to be clarified. This study investigated the immunological profile of HIV/leprosy patients, with special attention to the cellular activation status, to better understand the mechanisms related to IRIS/RR immunopathogenesis, identifying any potential biomarkers for IRIS/RR intercurrence. METHODS/PRINCIPAL FINDINGS: Eighty-five individuals were assessed in this study: HIV/leprosy and HIV-monoinfected patients, grouped according to HIV-viral load levels, leprosy patients without HIV coinfection, and healthy controls. Phenotypes were evaluated by flow cytometry for T cell subsets and immune differentiation/activation markers. As expected, absolute counts of the CD4+ and CD8+ T cells from the HIV-infected individuals changed in relation to those of the leprosy patients and controls. However, there were no significant differences among the groups, whether in the expression of cellular differentiation phenotypes or cellular activation, as reflected by the expression of CD38 and HLA-DR. Six HIV/leprosy patients identified as IRIS/RR were analyzed during IRIS/RR episodes and after prednisone treatment. These patients presented high cellular activation levels regarding the expression of CD38 in CD8+ cells T during IRIS/RR (median: 77,15%, dropping significantly (p<0,05 during post-IRIS/RR moments (median: 29,7%. Furthermore, an increase of cellular activation seems to occur prior to IRIS/RR. CONCLUSION/SIGNIFICANCE: These data suggest CD38 expression in CD8+ T cells
Characterization of Pulse Reverses Electroforming on Hard Gold Coating.
Byoun, Young-Min; Noh, Young-Tai; Kim, Young-Geun; Ma, Seung-Hwan; Kim, Gwan-Hoon
2018-03-01
Effect of pulse reverse current (PRC) method on brass coatings electroplated from gold solution was investigated by various plating parameters such as plating duration, the anodic duty cycle, the anodic current density and the cathodic current density. The reversed current results in a significant change in the morphology of electrodeposits, improvement of the overall current efficiency and reduction of deposit porosity. With longer pulses, hemispherical surface features are generated, while larger grains result from shorter pulse widths. The porosity of the plated samples is found to decrease compared with results at the same time-average plating rate obtained from DC or Pulse plating. A major impediment to reducing gold later thickness is the corrosion of the underlying substrate, which is affected by the porosity of the gold layer. Both the morphology and the hydrogen evolution reaction have significant impact on porosity. PRC plating affect hydrogen gold and may oxidize hydrogen produced during the cathodic portion of the waveform. Whether the dissolution of gold and oxidation of hydrogen occur depends on the type of plating bath and the plating conditions adapted. In reversed pulse plating, the amount of excess near-surface cyanide is changed after the cathodic current is applied, and the oxidation of gold under these conditions has not been fully addressed. The effects of the current density, pulse-reverse ratio and brightener concentration of the electroplating process were investigated and optimized for suitable performance.
An evaluation of the adverse reaction potential of three measles-mumps-rubella combination vaccines
Directory of Open Access Journals (Sweden)
Santos Boaventura Antônio dos
2002-01-01
Full Text Available Objective. To compare the incidence of adverse events following the administration of three commercially available measles-mumps-rubella (MMR combination vaccines. Methods. A randomized double-blind clinical trial was performed in 1996 that involved a total of 10 142 students 6-12 years of age in the state of Rio Grande do Sul, in Brazil. An MMR vaccine containing the Edmonston-Zagreb, Leningrad-Zagreb, and RA 27/3 strains ("vaccine A" was administered to 2 226 students (21.9% of the total; an MMR vaccine with the Moraten, Jeryl Lynn, and Wistar 27/3 strains ("vaccine B" was administered to 2 216 children (21.8%; and an MMR vaccine containing the Schwartz, Urabe AM-9, and Wistar 27/3 strains ("vaccine C" was given to 2 179 students (21.5%. A control group of 3 521 students (34.7% was not vaccinated. Both the vaccinated subjects and the control subjects were followed daily for 30 days to detect any clinical manifestations. Results. Adverse events were more frequent in the vaccinated children than in the control group (P < 0.01. In terms of causing parotitis, vaccine A had a relative risk (RR of 5.72 (95% confidence interval (CI = 3.11-10.54 when compared with vaccine B, and an RR of 2.33 (95% CI = 1.52-3.58 when compared with vaccine C. Vaccine A was also associated with an increased risk of lymphadenopathy when compared with vaccine B (RR = 3.11; 95% CI = 1.78-5.45 and with vaccine C (RR = 2.22; 95% CI = 1.35-3.66. Vaccine C was associated with an increased risk of parotitis when compared with vaccine B (RR = 2.46; 95% CI = 1.26-4.80. Three cases of aseptic meningitis were detected among the children in the study group, but only one case of vaccine-related aseptic meningitis was identified, among the children receiving vaccine A. Conclusions. The three MMR vaccines that we studied are associated with different risks of adverse events. We found vaccine A to cause more reactions than the two other vaccines, especially vaccine B. In addition
75 FR 61361 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engines
2010-10-05
...-0994; Directorate Identifier 2009-NE-39-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR...-Royce plc., P.O. Box 31, Derby, DE24 8BJ, United Kingdom; Telephone: 011 44 1332 242424, Fax: 011 44... based on those comments. We will post all comments we receive, without change, to http://www.regulations...
76 FR 65997 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engines
2011-10-25
...-0994; Directorate Identifier 2009-NE-39-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... Friday, except Federal holidays. For service information identified in this AD, contact Rolls-Royce plc.... Based on these figures, we estimate the cost of this proposed AD on U.S. operators to be $1,499,400. FAA...
A Reverse Stroop Task with Mouse Tracking
Yamamoto, Naohide; Incera, Sara; McLennan, Conor T.
2016-01-01
In a reverse Stroop task, observers respond to the meaning of a color word irrespective of the color in which the word is printed—for example, the word red may be printed in the congruent color (red), an incongruent color (e.g., blue), or a neutral color (e.g., white). Although reading of color words in this task is often thought to be neither facilitated by congruent print colors nor interfered with incongruent print colors, this interference has been detected by using a response method that does not give any bias in favor of processing of word meanings or processing of print colors. On the other hand, evidence for the presence of facilitation in this task has been scarce, even though this facilitation is theoretically possible. By modifying the task such that participants respond to a stimulus color word by pointing to a corresponding response word on a computer screen with a mouse, the present study investigated the possibility that not only interference but also facilitation would take place in a reverse Stroop task. Importantly, in this study, participants’ responses were dynamically tracked by recording the entire trajectories of the mouse. Arguably, this method provided richer information about participants’ performance than traditional measures such as reaction time and accuracy, allowing for more detailed (and thus potentially more sensitive) investigation of facilitation and interference in the reverse Stroop task. These trajectories showed that the mouse’s approach toward correct response words was significantly delayed by incongruent print colors but not affected by congruent print colors, demonstrating that only interference, not facilitation, was present in the current task. Implications of these findings are discussed within a theoretical framework in which the strength of association between a task and its response method plays a critical role in determining how word meanings and print colors interact in reverse Stroop tasks. PMID:27199881
Satoh, Tetsuya; Kouroki, Seiya; Ogawa, Keita; Tanaka, Yorika; Matsumura, Kazutoshi; Iwase, Susumu
2018-04-25
Identifying body fluids from forensic samples can provide valuable evidence for criminal investigations. Messenger RNA (mRNA)-based body fluid identification was recently developed, and highly sensitive parallel identification using reverse transcription polymerase chain reaction (RT-PCR) has been described. In this study, we developed reverse transcription loop-mediated isothermal amplification (RT-LAMP) as a simple, rapid assay for identifying three common forensic body fluids, namely blood, semen, and saliva, and evaluated its specificity and sensitivity. Hemoglobin beta (HBB), transglutaminase 4 (TGM4), and statherin (STATH) were selected as marker genes for blood, semen, and saliva, respectively. RT-LAMP could be performed in a single step including both reverse transcription and DNA amplification under an isothermal condition within 60 min, and detection could be conveniently performed via visual fluorescence. Marker-specific amplification was performed in each assay, and no cross-reaction was observed among five representative forensically relevant body fluids. The detection limits of the assays were 0.3 nL, 30 nL, and 0.3 μL for blood, semen, and saliva, respectively, and their sensitivities were comparable with those of RT-PCR. Furthermore, RT-LAMP assays were applicable to forensic casework samples. It is considered that RT-LAMP is useful for body fluid identification.
Berkhout, B.; Vastenhouw, N. L.; Klasens, B. I.; Huthoff, H.
2001-01-01
Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer is facilitated by terminal repeat (R) elements in the viral genome. This strand-transfer reaction depends on base pairing between the cDNA of the 5'R and the 3'R. There
Arellano Ferro, A.; Giridhar, Sunetra; Bramich, D. M.
2010-02-01
We report the results of CCD V, r and I time-series photometry of the globular cluster NGC 5053. New times of maximum light are given for the eight known RR Lyrae stars in the field of our images, and their periods are revised. Their V light curves were Fourier decomposed to estimate their physical parameters. A discussion on the accuracy of the Fourier-based iron abundances, temperatures, masses and radii is given. New periods are found for the five known SX Phe stars, and a critical discussion of their secular period changes is offered. The mean iron abundance for the RR Lyrae stars is found to be [Fe/H] ~ -1.97 +/- 0.16 and lower values are not supported by the present analysis. The absolute magnitude calibrations of the RR Lyrae stars yield an average true distance modulus of 16.12 +/- 0.04 or a distance of 16.7 +/- 0.3 kpc. Comparison of the observational colour magnitude diagram (CMD) with theoretical isochrones indicates an age of 12.5 +/- 2.0 Gyr for the cluster. A careful identification of all reported blue stragglers (BS) and their V, I magnitudes leads to the conclusion that BS12, BS22, BS23 and BS24 are not BS. On the other hand, three new BS are reported. Variability was found in seven BS, very likely of the SX Phe type in five of them, and in one red giant star. The new SX Phe stars follow established Period-Luminosity relationships and indicate a distance in agreement with the distance from the RR Lyrae stars. Based on observations collected at the Indian Astrophysical Observatory, Hanle, India. E-mail: armando@astroscu.unam.mx (AAF); giridhar@iiap.res.in (SG); dan.bramich@hotmail.co.uk (DMB)
VizieR Online Data Catalog: Abundances of 8 RR Lyrae subclass C variable stars (Govea+, 2014)
Govea, J.; Gomez, T.; Preston, G. W.; Sneden, C.
2016-02-01
We chose 10 candidate RR Lyrae variable stars of subclass c (RRc) stars for spectroscopic observation. Many of these stars were first identified as RRc variables by the All Sky Automated Survey (ASAS) of Pojmanski 2003 (cat. II/264). The target star list included ASAS 144154-0324.7 and ASAS 204440-2402.7. But our spectroscopic study suggest that these two stars are probably W UMa binaries instead of RR Lyrae stars Our spectra were obtained with the echelle spectrograph of the du Pont 2.5m telescope at the Las Campanas Observatory. Four observing runs during 2009-2010 were partly devoted to this project. The spectrograph was used with the 1.5*4'' entrance slit, which translates to a resolving power of R=λ/Δλ~27000 at the MgI b lines near 5180Å. The total continuous wavelength coverage of the spectra was 3500-9000Å. (6 data files).
Directory of Open Access Journals (Sweden)
Feng Li-Guo
2015-01-01
Full Text Available A prickle is an acuminate protuberance formed by the deformation of plant trichomes together with a few cortical cells. It is a type of multicellular eglandular trichome with special morphology, which originates from the phloem but is not connected to the xylem. Rosa rugosa is an important ornamental/commercial plant and an important raw material in the food and perfume industries. However, the firm prickles on its stems are inconvenient to field management, the harvesting of flowers and garden management. The TTG1 transcription factor related to the development of prickle was isolated from R. rugosa in the present study. Its expression patterns in different tissues and varieties were analyzed. Results showed the expression level of the RrTTG1 gene was highest in the leaves, followed by the stems, but was lower in the pericarps and petals. Moreover, the higher expression level of the RrTTG1 gene in all tissues of the ‘Ciguo rose’, as compared with that of the ‘Weihai wild rose’, follows the results of field morphological observation. Therefore, the RrTTG1 transcription factor is likely to regulate the development of rose prickles. This study allows for further discussion on the molecular mechanisms of prickle formation and development in R. rugosa and provides a molecular basis for the cultivation of roses with fewer or no prickles via genetic engineering.
Banks, Simon T; Clary, David C
2009-01-14
We consider the general problem of vibrational analysis at nonglobally optimized points on a reduced dimensional reaction surface. We discuss the importance of the use of curvilinear internal coordinates to describe molecular motion and derive a curvilinear projection operator to remove the contribution of nonzero gradients from the Hessian matrix. Our projection scheme is tested in the context of a two-dimensional quantum scattering calculation for the reaction H + CH(4) --> H(2) + CH(3) and its reverse H(2) + CH(3) --> H + CH(4). Using zero-point energies calculated via rectilinear and curvilinear projections we construct two two-dimensional, adiabatically corrected, ab initio reaction surfaces for this system. It is shown that the use of curvilinear coordinates removes unphysical imaginary frequencies observed with rectilinear projection and leads to significantly improved thermal rate constants for both the forward and reverse reactions.
77 FR 4648 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engine
2012-01-31
... Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engine AGENCY: Federal Aviation... identified in this AD, contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; phone: 011 44... parts are required. Based on these figures, we estimate the cost of this AD on U.S. operators to be $1...
75 FR 63727 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines
2010-10-18
...-0162; Directorate Identifier 2004-NE-19-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR...-2251. Contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; telephone: 011-44-1332... would cost $0. Based on these figures, we estimate the total cost of the AD to U.S. operators would be...
Reverse genetics with animal viruses. NSV reverse genetics
International Nuclear Information System (INIS)
Mebatsion, T.
2005-01-01
New strategies to genetically manipulate the genomes of several important animal pathogens have been established in recent years. This article focuses on the reverse genetics techniques, which enables genetic manipulation of the genomes of non-segmented negative-sense RNA viruses. Recovery of a negative-sense RNA virus entirely from cDNA was first achieved for rabies virus in 1994. Since then, reverse genetic systems have been established for several pathogens of medical and veterinary importance. Based on the reverse genetics technique, it is now possible to design safe and more effective live attenuated vaccines against important viral agents. In addition, genetically tagged recombinant viruses can be designed to facilitate serological differentiation of vaccinated animals from infected animals. The approach of delivering protective immunogens of different pathogens using a single vector was made possible with the introduction of the reverse genetics system, and these novel broad-spectrum vaccine vectors have potential applications in improving animal health in developing countries. (author)
Detailed evaluation of ET-RR-2 neutronic design: approach to criticality
International Nuclear Information System (INIS)
Ashoub, N.; Amin, E.
2000-01-01
The ET-RR-2 safety analysis evaluation effort included the assessment of the reactor core nuclear design parameters. The present work complements the previous effort of neutronic calculations using NCNSRC computer code packages. This paper is the first in comprehensive neutronic calculation assessment up to the equilibrium core. It deals with evaluation of neutronic calculation submitted during the early phase of the licensing process; namely the proposal to assemble the first critical core, calculation of power peaking factor and determination of detailed energy group flux distribution in the core particularly in the cobalt irradiation position. The neutronic design criteria are examined qualitatively and quantitatively in the present paper
Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep
2012-02-01
Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
Liu, Yang; Wang, Yue-ru; Wang, Long; Song, Rui-mei; Zhou, Bo; Song, Zhen-shun
2014-01-01
Circulating hepatocellular carcinoma cells may be detected by reverse transcription-polymerase chain reaction. We investigated the relationship between circulating hepatocellular carcinoma cells and hepatoma patient survival after different managements and survival periods. Peripheral vein blood (5 ml) samples were obtained from 113 patients with hepatocellular carcinoma and from 33 control subjects (9 with liver cirrhosis after hepatitis B, 14 with chronic hepatitis B, 10 healthy individuals) between January 1, 2009, and December 31, 2013. To detect circulating hepatocellular carcinoma cells in peripheral blood, alpha-fetoprotein messenger RNA was amplified from total RNA extracted from whole blood by reverse transcription-polymerase chain reaction. Alpha-fetoprotein messenger RNA was detected in 59 blood samples from the hepatocellular carcinoma patients (59/113, 52.2%). In contrast, there were no clinical control subjects whose samples showed detectable alpha-fetoprotein messenger RNA. The presence of alpha-fetoprotein messenger RNA in blood seemed to be correlated with the stage (by TNM classification) of hepatocellular carcinoma, serum alpha-fetoprotein value, and the presence of intrahepatic metastasis, portal vein thrombosis, tumor diameter and/or distant metastasis. In addition, alpha-fetoprotein messenger RNA was detected in the blood of 25 patients showing distant metastasis at extrahepatic organs (100%), in contrast to 32 of 88 cases without metastasis (36.4%). All the patients with hepatocellular carcinoma were followed. Seventeen patients with resection of a T 2 stage hepatocellular carcinoma had a survival of 3.2 years after surgical management, 38 cases with resection of a T3 stage hepatocellular carcinoma had a 1.3-year survival, and only 37 cases with T4 stage disease after different treatments except surgery survived for 0.6 years (P <0.01). The presence of alpha-fetoprotein messenger RNA in peripheral blood may be an indicator of circulating
Directory of Open Access Journals (Sweden)
Ge Shengqiang
2012-07-01
Full Text Available Abstract Background Simultaneous and sequential allantoic cavity inoculations of Specific-pathogen-free (SPF chicken eggs with Influenza virus (AIV and Newcastle disease virus (NDV demonstrated that the interaction of AIV and NDV during co-infection was variable. Our research revisited the replication interference potential of AIV and NDV using real-time reverse transcription–polymerase chain reaction (real-time RT-PCR for AIV and NDV to specifically detect the viral genomes in mixed infections. Results Data from this survey showed that when different doses of NDV (Lasota or F48E8 and AIV (F98 or H5N1 were simultaneously inoculated into embryonating chicken eggs (ECE, interference with the growth of NDV occurred, while interference with the growth of AIV did not occur. When equal amount of the two viruses were sequentially employed, the degree of interference was dependent upon the time of superinfection and the virulence of virus. Conclusion AIV have a negative impact on NDV growth if they are inoculated simultaneously or sequentially and that the degree of interference depended upon the quantity and relative virulence of the virus strains used; however, interference with AIV was not observed. Only if NDV were inoculated at an earlier time will NDV able to interfere with the growth of AIV.
77 FR 10355 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines
2012-02-22
... Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation... service of certain critical engine parts based on reduced life limits. This new AD reduces the life limits... effective March 28, 2012. ADDRESSES: For service information identified in this AD, contact Rolls-Royce plc...
Pires, Carla Andréa Avelar; Miranda, Mario Fernando Ribeiro de; Bittencourt, Maraya de Jesus Semblano; Brito, Arival Cardoso de; Xavier, Marília Brasil
2015-01-01
Leprosy and HIV are diseases that have a major impact on public health in Brazil. Patients coinfected with both diseases, appear to be at higher risk to develop leprosy reactions. The aim of this study is to describe the histopathological aspects of cutaneous lesions during reactional states in a group of patients with HIV-leprosy coinfection, compared to patients with leprosy, without coinfection. Two groups were established: group 1 comprised of 40 patients coinfected with HIV-leprosy; group 2, comprised of 107 patients with leprosy only. Patients presenting reactional states of leprosy had their lesions biopsied and comparatively evaluated. Reversal reaction was the most frequent feature in both groups, with dermis edema as the most common histopathological finding. Giant cells were seen in all group 1 histopathological examinations. Dermis edema was the most common finding in patients with erythema nodosum leprosum. Few histopathological differences were found in both groups, with reversal reaction as the most significant one, although this fact should be analyzed considering the predominant BT clinical form in the coinfected group and BB form in the group without HIV. Larger prospective studies in patients with HIV-leprosy coinfection are needed to confirm and broaden these results.
International Nuclear Information System (INIS)
Doktorov, Alexander B.
2015-01-01
Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants
Energy Technology Data Exchange (ETDEWEB)
Doktorov, Alexander B., E-mail: doktorov@kinetics.nsc.ru [Voevodsky Institute of Chemical Kinetics & Combustion, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)
2015-08-21
Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.
International Nuclear Information System (INIS)
Nakase, Yoshiaki; Yanagi, Tadashi; Uemura, Tadahiro.
1994-01-01
In order to develop a membrane suitable for reverse osmotic condensation of radioactive liquid wastes, a new cross-linked aromatic polyamide composite reverse osmosis membrane (ROM) was irradiated in water or in wet system, and its mechanical and some thermal properties, and the separation performance for inorganic salt were investigated. A membrane was degraded by irradiation more severely in wet system than in dry system, probably due to the reaction with OH-radicals. In the separation performance for NaCl, the salt rejection of the membrane was kept over 88% until irradiation reached 2MGy, maintaining about 90% of its original water flux. (author)
Wolf, R.E.; Morrison, J.M.; Goldhaber, M.B.
2007-01-01
A method for the simultaneous determination of Cr(iii) and Cr(vi) species in waters, soil leachates and synthetic bio-fluids is described. The method uses reversed-phase ion-pairing liquid chromatography to separate the chromium species and a dynamic reaction cell (DRC??) equipped ICP-MS for detection of chromium. Separation of the chromium species is carried out in less than 2 min. Cr(iii) is complexed with ethylenediaminetetraacetic acid (EDTA) prior to separation by mixing samples with the mobile phase containing 2.0 mM tetrabutylammonium hydroxide (TBAOH), 0.5 mM EDTA (dipotassium salt), and 5% (vol/vol) methanol, adjusted to pH 7.6. The interfering 40Ar 12C+ background peak at mass 52 was reduced by over four orders of magnitude to less than 200 cps by using 0.65 mL min-1 ammonia as a reaction gas and an RPq setting on the DRC of 0.75. Method detection limits (MDLs) of 0.09 ??g L-1 for Cr(iii) and 0.06 ??g L-1 for Cr(vi) were obtained based on peak areas at mass 52 for 50 ??L injections of low level spikes. Reproducibility at 2 ??g L-1 was 3% RSD for 5 replicate injections. The tolerance of the method to various levels of common cations and anions found in natural waters and to matrix constituents found in soil leachates and simulated gastric and lung fluids was tested by performing spike recovery calculations for a variety of samples. ?? The Royal Society of Chemistry.
76 FR 68663 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines
2011-11-07
...-0755; Directorate Identifier 2010-NE-12-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... Rolls-Royce plc, Corporate Communications, P.O. Box 31, Derby, England, DE248BJ; phone: 011-44-1332... date and may amend this proposed AD based on those comments. We will post all comments we receive...
Trapping of superoxido cobalt and peroxido dicobalt species formed reversibly from CoII and O2.
Corona, Teresa; Padamati, Sandeep K; Acuña-Parés, Ferran; Duboc, Carole; Browne, Wesley R; Company, Anna
2017-08-22
The formation and spectroscopic characterization of a superoxido cobalt(iii) and a peroxido dicobalt(iii) species formed in the temperature dependent reversible reaction of a cobalt(ii) precursor with O 2 is described. The electronic nature of each species is explored in their reactivity with organic substrates.
Zhao, Zhiqiang; Zhang, Zhaojun; Liu, Shu; Zhang, Dong H.
2017-02-01
Reactions occurring at a carbon atom through the Walden inversion mechanism are one of the most important and useful classes of reactions in chemistry. Here we report an accurate theoretical study of the simplest reaction of that type: the H+CH4 substitution reaction and its isotope analogues. It is found that the reaction threshold versus collision energy is considerably higher than the barrier height. The reaction exhibits a strong normal secondary isotope effect on the cross-sections measured above the reaction threshold, and a small but reverse secondary kinetic isotope effect at room temperature. Detailed analysis reveals that the reaction proceeds along a path with a higher barrier height instead of the minimum-energy path because the umbrella angle of the non-reacting methyl group cannot change synchronously with the other reaction coordinates during the reaction due to insufficient energy transfer from the translational motion to the umbrella mode.
Yanagihara, Nobuyuki; Seki, Meikan; Nakano, Masahiro; Hachisuga, Toru; Goto, Yukio
2014-06-01
Disturbance of autonomic nervous activity has been thought to play a role in the climacteric symptoms of postmenopausal women. This study was therefore designed to investigate the relationship between autonomic nervous activity and climacteric symptoms in postmenopausal Japanese women. The autonomic nervous activity of 40 Japanese women with climacteric symptoms and 40 Japanese women without climacteric symptoms was measured by power spectral analysis of heart rate variability using a standard hexagonal radar chart. The scores for climacteric symptoms were determined using the simplified menopausal index. Sympathetic excitability and irritability, as well as the standard deviation of mean R-R intervals in supine position, were significantly (P standard deviation of mean R-R intervals in supine position and the simplified menopausal index score. The lack of control for potential confounding variables was a limitation of this study. In climacteric women, the standard deviation of mean R-R intervals in supine position is negatively correlated with the simplified menopausal index score.
Outbreak of viral gastroenteritis due to drinking water contaminated by Norwalk-like viruses.
Kukkula, M; Maunula, L; Silvennoinen, E; von Bonsdorff, C H
1999-12-01
Heinävesi, a Finnish municipality with a population of 4860 inhabitants, had an outbreak of gastroenteritis in March 1998. On the basis of an epidemiologic survey, an estimated 1700-3000 cases of acute gastroenteritis occurred during the outbreak. Municipal water consumption was found to be associated with illness (risk ratio [RR]=3.5, 95% confidence interval, 3.11>RR>3.96). Norwalk-like virus (NLV) genogroup II (GGII) was identified in untreated water, treated water, and 4 tap water samples by use of reverse transcription-polymerase chain reaction. This was the first time NLVs had been detected in municipal tap water. Fifteen of 27 patient stool samples had NLV GGII, with an identical amplification product to that found in the water samples, indicating that the outbreak was caused by this virus. In some patients, NLV genogroup I was also encountered. This virus, however, could not be detected in the water samples. Inadequate chlorination contributed to the survival of the virus in the water.
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
International Nuclear Information System (INIS)
Ashoub, N.; Saleh, H.
1995-01-01
The first Egyptian research reactor, ET-RR-1 is tank type with light water as a moderator, coolant and reflector. Its nominal power is 2MWt and the average thermal neutron flux is 10 13 n/cm 2 sec -1 . Its criticality was on the fall of 1961. The reactor went through several modifications and updating and is still utilized for experimental research. A plan for decommissioning of ET-RR-1 reactor should include estimation of radioactivity in structural materials. The inventory will help in assessing the radiological consequences of decommissioning. This paper presents a conservative calculation to estimate the activity of the long lived isotopes which can be produced by neutron activation. The materials which are presented in significant quantities in the reactor structural materials are aluminum, cast iron, graphite, ordinary and iron shot concrete. The radioactivity of each component is dependent not only upon the major elements, but also on the concentration of the trace elements. The main radioactive inventory are expected to be from 60 Co and 55 Fe which are presented in aluminium as trace elements and in large quantities in other construction materials. (author)
Chuang, Shin-Shin; Wu, Kung-Tai; Lin, Chen-Yang; Lee, Steven; Chen, Gau-Yang; Kuo, Cheng-Deng
2014-08-01
The Poincaré plot of RR intervals (RRI) is obtained by plotting RRIn+1 against RRIn. The Pearson correlation coefficient (ρRRI), slope (SRRI), Y-intercept (YRRI), standard deviation of instantaneous beat-to-beat RRI variability (SD1RR), and standard deviation of continuous long-term RRI variability (SD2RR) can be defined to characterize the plot. Similarly, the Poincaré plot of autocorrelation function (ACF) of RRI can be obtained by plotting ACFk+1 against ACFk. The corresponding Pearson correlation coefficient (ρACF), slope (SACF), Y-intercept (YACF), SD1ACF, and SD2ACF can be defined similarly to characterize the plot. By comparing the indices of Poincaré plots of RRI and ACF between patients with acute myocardial infarction (AMI) and patients with patent coronary artery (PCA), we found that the ρACF and SACF were significantly larger, whereas the RMSSDACF/SDACF and SD1ACF/SD2ACF were significantly smaller in AMI patients. The ρACF and SACF correlated significantly and negatively with normalized high-frequency power (nHFP), and significantly and positively with normalized very low-frequency power (nVLFP) of heart rate variability in both groups of patients. On the contrary, the RMSSDACF/SDACF and SD1ACF/SD2ACF correlated significantly and positively with nHFP, and significantly and negatively with nVLFP and low-/high-frequency power ratio (LHR) in both groups of patients. We concluded that the ρACF, SACF, RMSSDACF/SDACF, and SD1ACF/SD2ACF, among many other indices of ACF Poincaré plot, can be used to differentiate between patients with AMI and patients with PCA, and that the increase in ρACF and SACF and the decrease in RMSSDACF/SDACF and SD1ACF/SD2ACF suggest an increased sympathetic and decreased vagal modulations in both groups of patients.
VizieR Online Data Catalog: Standard Galactic field RR Lyrae. I. Photometry (Monson+, 2017)
Monson, A. J.; Beaton, R. L.; Scowcroft, V.; Freedman, W. L.; Madore, B. F.; Rich, J. A.; Seibert, M.; Kollmeier, J. A.; Clementini, G.
2017-06-01
The Three-hundred MilliMeter Telescope (TMMT) is a fully robotic, 300mm telescope at Las Campanas Observatory (LCO), for which the nightly operation and data processing have been completely automated. Over the course of two years data were collected on 179 individual nights for our sample of the 55 RR Lyrae in the B, V, and IC broadband filters. Of these nights, 76 were under photometric conditions and calibrated directly. The 103 nonphotometric nights were roughly calibrated by using the default transformation equations, but only provide differential photometry relative to the calibrated frames. This resulted in 59698 final individual observations. Individual data points have a typical photometric precision of 0.02mag. The statistical error falls rapidly with hundreds of observations, with the zero-point uncertainties being the largest source of uncertainty in the final reported mean magnitude. To compare the results of our TMMT campaign to previous studies of these RR Lyrae (RRL) and to fill gaps in our TMMT phase coverage, we have compiled available broadband data from literature published over the past 30 years and spanning our full wavelength coverage (0.4 to 4.5μm) from the optical to mid-infrared. We have homogenized these diverse data sets to the following filter systems: Johnson UBV, Kron-Cousins RI, 2MASS J,H,Ks, and Spitzer [3.6], [4.5]. The All Sky Automated Survey (ASAS; http://www.astrouw.edu.pl/asas/) is a long-term project monitoring all stars brighter than V~14mag. The program covers both hemispheres, with telescopes at Las Campanas Observatory in Chile and Haleakala on Maui, both of which provide simultaneous I and V photometry. The GEOS RR Lyr Survey (http://www.ast.obs-mip.fr/users/leborgne/dbRR/grrs.html) is a long-term program utilizing TAROT (http://tarot.obs-hp.fr/) at Calern Observatory (Nice University, France). Annual data releases from this project add times for maximum light for program stars over the last year of observations. In
Directory of Open Access Journals (Sweden)
Joojin Jeong
2015-09-01
Full Text Available The primary step for efficient control of viral diseases is the development of simple, rapid, and sensitive virus detection. Reverse transcription loop-mediated isothermal amplification (RT-LAMP has been used to detect viral RNA molecules because of its simplicity and high sensitivity for a number of viruses. RT-LAMP for the detection of Potato virus X (PVX was developed and compared with conventional reverse transcription polymerase chain reaction (RT-PCR to demonstrate its advantages over RT-PCR. RT-LAMP reactions were conducted with or without a set of loop primers since one out of six primers showed PVX specificity. Based on real-time monitoring, RT-LAMP detected PVX around 30 min, compared to 120 min for RT-PCR. By adding a fluorescent reagent during the reaction, the extra step of visualization by gel electrophoresis was not necessary. RT-LAMP was conducted using simple inexpensive instruments and a regular incubator to evaluate whether RNA could be amplified at a constant temperature instead of using an expensive thermal cycler. This study shows the potential of RT-LAMP for the diagnosis of viral diseases and PVX epidemiology because of its simplicity and rapidness compared to RT-PCR.
Directory of Open Access Journals (Sweden)
Vanessa Leonardo Ignácio
2015-10-01
Full Text Available ABSTRACTThis study aimed to evaluate the influence of foliar fertilizer doses containing Mn of phenological stages of suggested application in RR soybeans, to recover management damages with glyphosate at postemergence application on seed vigor in post-harvest and post six months storage. The seeds originated from a field experiment conducted , which included two applications of glyphosate, concomitant with foliar fertilizer in growth stages V4 and V6, with 0.00, 113.50 and 227.00 mg ha-1doses of Mn2+. Germination, GSI (Germination Speed Index, electrical conductivity tests and the first count of seeds were conducted. The application of Mn did not affect the physiological quality of RR soy in postharvest. However, in post-storage, higher doses of Mn had a negative effect on tests of abnormal seedlings, GSI and electrical conductivity. The applications of Mn, regardless of the developmental stage, did not interfere in the germination and first count tests, with and without storage. The electrical conductivity test showed a higher correlation with the seed germination test in the post-harvest treatment.
Faggioli, F; Pasquini, G; Barba, M
1998-09-01
The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.
Energy Technology Data Exchange (ETDEWEB)
Marteau, Chantal; Gaillard-Cusin, Francoise; James, Henri [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures
1978-05-01
Investigation of experimental data related to evolution period exhibited by H/sub 2/-D/sub 2/ exchange process requires to take into account the variation against time of every atomic species -adsorbed or not- implied in the reaction mechanism. The formation of first chain carriers involves: - chemisorption of either gaseous reactant on the surface active centres (..sigma..), e.g.: ..sigma.. + 1/2 H/sub 2/ reversible ..sigma..H; - consecutive generation of atomic species through hetero-homogeneous transfer between chemisorbed species (..sigma..H) and gaseous molecules: ..sigma..H+H/sub 2/..--> sigma..+H/sub 2/+H/sup 0/, ..sigma..H+D/sub 2/..--> sigma..+HD+D/sup 0/. Therefore, it can be shown that the heterogeneous initiation process of a gas phase reaction identifies to a chain linear mechanism. Such an heterogeneous sequence conditions the further proceeding of the homogeneous chain reaction; both evolutions being kinematically connected. Rate constant of hydrogen adsorption on silica glass: ksub(a1) approximately 10/sup 14/ exp(-47/RT)Isup(0,5).molesup(-0,5).S/sup -1/ has been evaluated.
Technical advances in neutron polarimetry and studies of the (p,n) reaction in /sup 13/C
Energy Technology Data Exchange (ETDEWEB)
Videla, N G
1985-01-01
The asymmetry in the /sup 4/He(p,n vector)/sup 4/He reaction has been measured at three different incident neutron energies: 19.40; 22.85 and 27.31 MeV, and 120/sup 0/ from forward direction. Values of the asymmetry have been used to calculate the polarization of fast neutrons produced in the /sup 13/C(p,n vector)/sup 13/N. The /sup 13/C(p,n vector)/sup 13/N reaction was studied as part of a program being undertaken at the University of Manitoba Cyclotron Laboratory to study (p,n) reactions linking isobaric analog states of mirror nuclei in the energy range of 22 to 50 MeV. The study involves a comparison of the proton analyzing power A(theta), in the reaction /sup 13/C(vector p,n)/sup 13/N to the neutron polarization in the inverse reaction /sup 13/C(p,n vector)/sup 13/N. The importance of the comparison between these two observables is based in Conzett's theorem for time reversed reactions, the theorem states that the proton analyzing power in the reaction /sup 13/C(vector p,n)/sup 13/N is equal to the neutron polarization in the reaction /sup 13/C(p,n vector)/sup 13/N provided the reaction proceeds between members of an isospin doublet and when charge symmetry and time reversal invariance hold exactly. However, isospin symmetry is broken by the Coulomb interaction. So comparison of these two observables should yield information of the breaking of isospin by the Coulomb force.
Direct single-molecule dynamic detection of chemical reactions.
Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng
2018-02-01
Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.
An algebra of reversible computation.
Wang, Yong
2016-01-01
We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.
75 FR 45560 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines
2010-08-03
...-0755; Directorate Identifier 2010-NE-12-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... based on engine thrust rating but now based on operating shaft speeds) introduced by Rolls- Royce. The...-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom: Telephone 44 (0) 1332 242424; fax 44 (0) 1332...
76 FR 72650 - Airworthiness Directives; Rolls-Royce plc (RR) RB211 Trent 800 Series Turbofan Engines
2011-11-25
...-0959; Directorate Identifier 2011-NE-25-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... holidays. Fax: (202) 493-2251. Contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; phone... AD. We will consider all comments received by the closing date and may amend this proposed AD based...
On thermodynamic and microscopic reversibility
International Nuclear Information System (INIS)
Crooks, Gavin E
2011-01-01
The word 'reversible' has two (apparently) distinct applications in statistical thermodynamics. A thermodynamically reversible process indicates an experimental protocol for which the entropy change is zero, whereas the principle of microscopic reversibility asserts that the probability of any trajectory of a system through phase space equals that of the time reversed trajectory. However, these two terms are actually synonymous: a thermodynamically reversible process is microscopically reversible, and vice versa
International Nuclear Information System (INIS)
Grueso, E.; Prado-Gotor, R.; Lopez, M.; Gomez-Herrera, C.; Sanchez, F.
2005-01-01
The kinetics of the reaction between ruthenium pentaammine pyrazine and acetonitrile pentacyanoferrate (II) to obtain the binuclear anionic complex [Fe(CN) 5 pzRu(NH 3 ) 5 ] - , and the reverse (dissociation) process, have been studied in solutions containing DNA. The results corresponding to this reaction and those corresponding to the reverse (dissociation) process show a clear influence of DNA on their kinetics. The results can be interpreted using a modified Pseudophase Model. From the results obtained for the dissociation reaction one can conclude that the binuclear anionic complex [Fe(CN) 5 pzRu(NH 3 ) 5 ] - interacts with DNA
Energy Technology Data Exchange (ETDEWEB)
Lu, Dongping; Tao, Jinhui; Yan, Pengfei; Henderson, Wesley A.; Li, Qiuyan; Shao, Yuyan; Helm, Monte L.; Borodin, Oleg; Graff, Gordon L.; Polzin, Bryant; Wang, Chong-Min; Engelhard, Mark; Zhang, Ji-Guang; De Yoreo, James J.; Liu, Jun; Xiao, Jie
2017-02-10
Interfacial phenomena have always been key determinants for the performance of energy storage technologies. The solid electrolyte interfacial (SEI) layer, pervasive on the surfaces of battery electrodes for numerous chemical couples, directly affects the ion transport, charge transfer and lifespan of the entire energy system. Almost all SEI layers, however, are unstable resulting in the continuous consumption of the electrolyte. Typically, this leads to the accumulation of degradation products on/restructuring of the electrode surface and thus increased cell impedance, which largely limits the long-term operation of the electrochemical reactions. Herein, a completely new SEI formation mechanism has been discovered, in which the electrolyte components reversibly self-assemble into a protective surface coating on a graphite electrode upon changing the potential. In contrast to the established wisdom regarding the necessity of employing the solvent ethylene carbonate (EC) to form a protective SEI layer on graphite, a wide range of EC-free electrolytes are demonstrated for the reversible intercalation/deintercalation of Li+ cations within a graphite lattice, thereby providing tremendous flexibility in electrolyte tailoring for battery couples. This novel finding is broadly applicable and provides guidance for how to control interfacial reactions through the relationship between ion aggregation and solvent decomposition at polarized interfaces.
Core--strategy leading to high reversible hydrogen storage capacity for NaBH4.
Christian, Meganne L; Aguey-Zinsou, Kondo-François
2012-09-25
Owing to its high storage capacity (10.8 mass %), sodium borohydride (NaBH(4)) is a promising hydrogen storage material. However, the temperature for hydrogen release is high (>500 °C), and reversibility of the release is unachievable under reasonable conditions. Herein, we demonstrate the potential of a novel strategy leading to high and stable hydrogen absorption/desorption cycling for NaBH(4) under mild pressure conditions (4 MPa). By an antisolvent precipitation method, the size of NaBH(4) particles was restricted to a few nanometers (hydrogen at 400 °C. Further encapsulation of these nanoparticles upon reaction of nickel chloride at their surface allowed the synthesis of a core--shell nanostructure, NaBH(4)@Ni, and this provided a route for (a) the effective nanoconfinement of the melted NaBH(4) core and its dehydrogenation products, and (b) reversibility and fast kinetics owing to short diffusion lengths, the unstable nature of nickel borohydride, and possible modification of reaction paths. Hence at 350 °C, a reversible and steady hydrogen capacity of 5 mass % was achieved for NaBH(4)@Ni; 80% of the hydrogen could be desorbed or absorbed in less than 60 min, and full capacity was reached within 5 h. To the best of our knowledge, this is the first time that such performances have been achieved with NaBH(4). This demonstrates the potential of the strategy in leading to major advancements in the design of effective hydrogen storage materials from pristine borohydrides.
Reversibility of female sterilization.
Siegler, A M; Hulka, J; Peretz, A
1985-04-01
The discussion considers the current status of reversibility of sterilization in the US and describes clinical and experimental efforts for developing techniques designed for reversibility. It focuses on regret following sterilization, reversal potential of current sterilization techniques, patient selection, current reversal techniques, results of sterilization procedures, experimental approaches to reversal of current techniques of sterilization, and sterilization procedures devised for reversibility, in humans and in animals. Request is the 1st stage of reversal, but a request for sterilization reversal (SR) does not always mean regret for a decision made at the time. Frequently it is a wish to restore fertility because life circumstances have changed after a sterilization that was ppropriate at the time it was performed. Schwyhart and Kutner reviewed 22 studies published between 1949-69 in which they found that the percentage of patients regretting the procedure ranged from 1.3-15%. Requests for reversal remain low in most countries, but if sterilization becomes a more popular method of contraception, requests will also increase. The ideal operation considered as a reversaible method of sterilization should include an easy, reliable outpatient method of tubal occlusion with miniml risk or patient discomfort that subsequently could be reversed without the need for a major surgical intervention. Endoscopic methods have progressed toward the 1st objective. A recent search of the literature uncovered few series of SR of more than 50 cases. The 767 operations found were analyzed with regard to pregnancy outcome. The precent of live births varied from 74-78.8%, and the occurance of tubal pregnancies ranged from 1.7-6.5%. All of the confounding variables in patient selection and small numbers of reported procedures preclude any conclusion about the different techniques or the number of operations that give a surgeon a level of expertise. Few authors classify their
Systematics of complex fragment emission from La induced reactions at E/A = 47 MeV
International Nuclear Information System (INIS)
Kehoe, W.L.; Mignerey, A.C.; Bradley, S.
1989-03-01
Complex fragment (Z > 2) emission was studied in the reverse kinematics reactions of 139 La on 27 Al and /sup nat./Cu at a bombarding energy of E/A = 47 MeV. Experimental results from inclusive and coincidence measurements for two- and three-fold complex fragments events are presented. Measured cross sections and Z 1 -Z 2 correlations show a predominately binary-decay process for the La + Al reaction, while the La + Cu reaction is dominated by multi-body decay. 18 refs., 9 figs., 1 tab
Reactions of modulated molecular beams with pyrolytic graphite IV. Water vapor
International Nuclear Information System (INIS)
Olander, D.R.; Acharya, T.R.; Ullman, A.Z.
1977-01-01
The reaction of water vapor with the prism plane face of anneal pyrolytic graphite was investigated by modulated molecular beam--mass spectrometry methods. The equivalent water vapor pressure of the beam was approx.2 x 10 -5 Torr and the graphite temperature was varied from 300 to 2500 0 K. The mechanism was deduced from three types of experiments: isotope exchange utilizing modulated H 2 O and steady D 2 O beams; measurements of the phase difference between H 2 O and neon reflected from the surface from a mixed primary beam of these species; and reaction of a modulated H 2 O beam to produce CO and H 2 . Based upon the isotope exchange experiments chemisorption of water on graphite was found to be dissociative and reversible. Incident water molecules chemisorbed with a sticking probability of 0.15 +- 0.02 to form the complexes C--OH and C--H. Recombination of the surface complexes reverses the adsorption step and is responsible for the isotope exchange properties of the graphite surface. This process is unactivated. Reaction to produce CO and H 2 also results from collisions of the primary surface complexes, but this step has an activation energy of 170 kJ/mole. This reaction yields bound complexes tentatively identified as C--O and H--C--H, which then decompose to produce the stable reaction products. All of the above steps exhibit characteristic times on the order of milliseconds, and are therefore detectable by the modulated beam method. All surface intermediates are strongly affected by solution and diffusion in the bulk of the solid
Sadi, Baki B M; Vonderheide, Anne P; Caruso, Joseph A
2004-09-24
A reversed phase ion-pairing high performance liquid chromatographic (RPIP-HPLC) method is developed for the separation of two phosphorus herbicides, Glufosinate and Glyphosate as well as Aminomethylphosphonic acid (AMPA), the major metabolite of Glyphosate. Tetrabutylammonium hydroxide is used as the ion-pairing reagent in conjunction with an ammonium acetate/acetic acid buffering system at pH 4.7. An inductively coupled plasma mass spectrometer (ICP-MS) is coupled to the chromatographic system to detect the herbicides at m/z = 31P. Historically, phosphorus has been recognized as one of the elements difficult to analyze in argon plasma. This is due to its relatively high ionization potential (10.5 eV) as well as the inherent presence of the polyatomic interferences 14N16O1H+ and 15N16O+ overlapping its only isotope at m/z = 31. An octapole reaction cell is utilized to minimize the isobaric polyatomic interferences and to obtain the highest signal-to-background ratio. Detection limits were found to be in the low ppt range (25-32 ng/l). The developed method is successfully applied to the analysis of water samples collected from the Ohio River and spiked with a standard compounds at a level of 20 microg/l.
Noniterative, unconditionally stable numerical techniques for solving condensational anddissolutional growth equations are given. Growth solutions are compared to Gear-code solutions forthree cases when growth is coupled to reversible equilibrium chemistry. In all cases, ...
Dual method use among long-acting reversible contraceptive users.
Bernard, Caitlin; Zhao, Qiuhong; Peipert, Jeffrey F
2018-03-27
To compare rates of dual method use (concurrent use of condoms and an effective method of contraception) in long-acting reversible contraceptive (LARC) and non-LARC hormonal contraceptive users, and to determine factors associated with dual method use. We conducted a secondary analysis of the Contraceptive CHOICE Project, an observational, prospective cohort study of 9256 women in St. Louis, MO, USA. Our sample included 6744 women who initiated a contraceptive method within 3 months of enrollment, continued use at 6 months post-enrollment, and responded regarding dual method use. Our primary outcome was the rate of dual method use at 6 months post-enrollment. Dual method use was reported by 32% of LARC and 45% of non-LARC hormonal contraceptive users (p dual method use (RR adj 0.76, 95% CI 0.70-0.83). Factors associated with dual method use in our multivariable analysis were age dual method use, baseline diagnosis of sexually transmitted infection (STI), greater partner willingness to use a condom, and higher condom self-efficacy score. LARC users are less likely to report dual method use compared to non-LARC hormonal contraceptive users, but other factors also impact dual method use. Further studies should be performed to determine whether this lower dual method use increases the risk of STI. Clinicaltrials.gov Identifier NCT01986439.
Gallet, Y.; Pavlov, V.; Shatsillo, A.; Hulot, G.
2015-12-01
Constraining the evolution in the geomagnetic reversal frequency over hundreds of million years is not a trivial matter. Beyond the fact that there are long periods without reversals, known as superchrons, and periods with many reversals, the way the reversal frequency changes through time during reversing periods is still debated. A smooth evolution or a succession of stationary segments have both been suggested to account for the geomagnetic polarity time scale since the Middle-Late Jurassic. Sudden changes from a reversing mode to a non-reversing mode of the geodynamo may also well have happened, the switch between the two modes having then possibly been controlled by the thermal conditions at the core-mantle boundary. There is, nevertheless, a growing set of magnetostratigraphic data, which could help decipher a proper interpretation of the reversal history, in particular in the early Paleozoic and even during the Precambrian. Although yielding a fragmentary record, these data reveal the occurrence of both additional superchrons and periods characterized by extremely high, not to say extraordinary, magnetic reversal frequencies. In this talk, we will present a synthesis of these data, mainly obtained from Siberia, and discuss their implication for the magnetic reversal behavior over the past billion years.
Pires, Carla Andréa Avelar; de Miranda, Mario Fernando Ribeiro; Bittencourt, Maraya de Jesus Semblano; de Brito, Arival Cardoso; Xavier, Marília Brasil
2015-01-01
BACKGROUND Leprosy and HIV are diseases that have a major impact on public health in Brazil. Patients coinfected with both diseases, appear to be at higher risk to develop leprosy reactions. OBJECTIVE The aim of this study is to describe the histopathological aspects of cutaneous lesions during reactional states in a group of patients with HIV-leprosy coinfection, compared to patients with leprosy, without coinfection. METHODS Two groups were established: group 1 comprised of 40 patients coinfected with HIV-leprosy; group 2, comprised of 107 patients with leprosy only. Patients presenting reactional states of leprosy had their lesions biopsied and comparatively evaluated. RESULTS Reversal reaction was the most frequent feature in both groups, with dermis edema as the most common histopathological finding. Giant cells were seen in all group 1 histopathological examinations. Dermis edema was the most common finding in patients with erythema nodosum leprosum. CONCLUSION Few histopathological differences were found in both groups, with reversal reaction as the most significant one, although this fact should be analyzed considering the predominant BT clinical form in the coinfected group and BB form in the group without HIV. Larger prospective studies in patients with HIV-leprosy coinfection are needed to confirm and broaden these results. PMID:25672296
Hattori, Shunji; Fujisaki, Hitomi; Kiriyama, Tomomi; Yokoyama, Tsukao; Irie, Shinkichi
2002-02-01
Zymography and reverse zymography are widely used techniques for identifying the proteolytic activity of enzymes and the presence of protease inhibitors in polyacrylamide gels. In the current studies, we utilized a fluorescein-isothiocyanate-labeled substrate to develop novel zymographic and reverse zymographic methods for detecting matrix metalloproteinases and tissue inhibitors of the metalloproteinases, respectively. Using a transilluminator, the results can be observed visually without stopping the enzymatic reaction. For this reason, we have named these methods real-time zymography and real-time reverse zymography. These methods have the following advantages compared with conventional protocols: (1) because the reaction can be repeatedly monitored on the polyacrylamide gels, optimization of the incubation time can be achieved without preliminary analyses; (2) higher sensitivity is achieved with a lower amount of substrate than with conventional methods; (3) a semi-quantitative analysis of matrix metalloproteinases is possible. An additional advantage of the real-time reverse zymography is that, because the fluorescence detection is specific for substrate digestion, the inhibitor bands can be easily distinguished from contaminating proteins.
Reverse microemulsion prepared Ni–Pt catalysts for methane cracking to produce COx-free hydrogen
Zhou, Lu
2017-09-08
A monodispersed 15 nm Ni9Pt1 catalyst synthesized via a reverse microemulsion method, shows a lower activation energy than both Ni and Pt catalysts during the methane cracking reaction. Thanks to the synergic effect of Ni–Pt alloy, this catalyst presents a stable H2 formation rate at 700 °C, and forms carbon nanotubes, anchoring the catalyst particles on top.
Reverse microemulsion prepared Ni–Pt catalysts for methane cracking to produce COx-free hydrogen
Zhou, Lu; Harb, Moussab; Enakonda, Linga Reddy; Al Mana, Noor; Hedhili, Mohamed N.; Basset, Jean-Marie
2017-01-01
A monodispersed 15 nm Ni9Pt1 catalyst synthesized via a reverse microemulsion method, shows a lower activation energy than both Ni and Pt catalysts during the methane cracking reaction. Thanks to the synergic effect of Ni–Pt alloy, this catalyst presents a stable H2 formation rate at 700 °C, and forms carbon nanotubes, anchoring the catalyst particles on top.
Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M
2011-07-01
Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.
Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro
2016-01-01
then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve
Vilanova, Pedro
2016-01-01
reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ
International Nuclear Information System (INIS)
Izawa, Hirozumi; Isomura, Shohei; Nakane, Ryohei.
1979-01-01
The deuterium exchange reaction between hydrogen and water in the gas phase where the fed hydrogen gas is saturated with water vapor is studied experimentally by use of the proper hydrophobic catalysts supporting platinum. It is found that the activities of those catalysts for this reaction system are very high compared with the other known ones for the systems in which gas and liquid should coexist on catalyst surfaces, and that the apparent catalytic activity becomes larger as the amount of platinum supported on a catalyst particle increases. By analyses of the data the following informations are obtained. The exchange reaction can be expressed by a first order reversible reaction kinetics. The pore diffusion in the catalyst particles has significant effect on the overall reaction mechanisms. (author)
International Nuclear Information System (INIS)
Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.
1986-01-01
The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)
Wang, Meng; Jiang, Chunlei; Zhang, Songquan; Song, Xiaohe; Tang, Yongbing; Cheng, Hui-Ming
2018-06-01
Calcium-ion batteries (CIBs) are attractive candidates for energy storage because Ca2+ has low polarization and a reduction potential (-2.87 V versus standard hydrogen electrode, SHE) close to that of Li+ (-3.04 V versus SHE), promising a wide voltage window for a full battery. However, their development is limited by difficulties such as the lack of proper cathode/anode materials for reversible Ca2+ intercalation/de-intercalation, low working voltages (performance. Here, we report a CIB that can work stably at room temperature in a new cell configuration using graphite as the cathode and tin foils as the anode as well as the current collector. This CIB operates on a highly reversible electrochemical reaction that combines hexafluorophosphate intercalation/de-intercalation at the cathode and a Ca-involved alloying/de-alloying reaction at the anode. An optimized CIB exhibits a working voltage of up to 4.45 V with capacity retention of 95% after 350 cycles.
Directory of Open Access Journals (Sweden)
David Warrilow
Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.
International Nuclear Information System (INIS)
Zheng, Jianming; Yan, Pengfei; Gu, Meng; Wagner, Michael J.; Hays, Kevin A.; Chen, Junzheng; Li, Xiaohong; Wang, Chongmin; Zhang, Ji-Guang; Liu, Jun; Xiao, Jie
2015-01-01
Lithium-sulfur (Li-S) battery is a promising energy storage system due to its high energy density, cost effectiveness, and environmental friendliness of sulfur. However, there are still a number of technical challenges, such as low Coulombic efficiency and poor long-term cycle life, impeding the commercialization of Li-S battery. The electrochemical performance of Li-S battery is closely related with the interfacial reactions occurring between hosting substrate and active sulfur species, which are poorly conducting at fully oxidized and reduced states. Here, we correlate the relationship between the performance and interfacial reactions in the Li-S battery system, using a hollow carbon nanosphere (HCNS) with highly graphitic character as hosting substrate for sulfur. With an appropriate amount of sulfur loading, HCNS/S composite exhibits excellent electrochemical performance because of the fast interfacial reactions between HCNS and the polysulfides. However, further increase of sulfur loading leads to increased formation of highly resistive insoluble reaction products (Li 2 S 2 /Li 2 S), which limits the reversibility of the interfacial reactions and results in poor electrochemical performances. These findings demonstrate the importance of the interfacial reaction reversibility in the whole electrode system on achieving high capacity and long cycle life of sulfur cathode for Li-S batteries.