WorldWideScience

Sample records for reversal reaction rr

  1. Enzymatic reactions in reversed micelles

    NARCIS (Netherlands)

    Hilhorst, M.H.

    1984-01-01

    It has been recognised that enzymes in reversed micelles have potential for application in chemical synthesis. Before these expectations will be realised many problems must be overcome. This thesis deals with some of them.
    In Chapter 1 the present knowledge about reversed micelles and

  2. Chemical reactions in reverse micelle systems

    Science.gov (United States)

    Matson, Dean W.; Fulton, John L.; Smith, Richard D.; Consani, Keith A.

    1993-08-24

    This invention is directed to conducting chemical reactions in reverse micelle or microemulsion systems comprising a substantially discontinuous phase including a polar fluid, typically an aqueous fluid, and a microemulsion promoter, typically a surfactant, for facilitating the formation of reverse micelles in the system. The system further includes a substantially continuous phase including a non-polar or low-polarity fluid material which is a gas under standard temperature and pressure and has a critical density, and which is generally a water-insoluble fluid in a near critical or supercritical state. Thus, the microemulsion system is maintained at a pressure and temperature such that the density of the non-polar or low-polarity fluid exceeds the critical density thereof. The method of carrying out chemical reactions generally comprises forming a first reverse micelle system including an aqueous fluid including reverse micelles in a water-insoluble fluid in the supercritical state. Then, a first reactant is introduced into the first reverse micelle system, and a chemical reaction is carried out with the first reactant to form a reaction product. In general, the first reactant can be incorporated into, and the product formed in, the reverse micelles. A second reactant can also be incorporated in the first reverse micelle system which is capable of reacting with the first reactant to form a product.

  3. Reversal reaction in borderline leprosy is associated with a polarized shift to type 1-like Mycobacterium leprae T cell reactivity in lesional skin: a follow-up study

    NARCIS (Netherlands)

    Verhagen, C. E.; Wierenga, E. A.; Buffing, A. A.; Chand, M. A.; Faber, W. R.; Das, P. K.

    1997-01-01

    Borderline leprosy patients often undergo acute changes in immune reactivity that manifest as reversal reaction (RR) in the course of the disease. RR is associated with an exacerbated local delayed-type cellular immune response to Mycobacterium leprae and is responsible for severe tissue damage. We

  4. Mass transfer with complex reversible chemical reactions. II: Parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, Geert; van Beckum, F.P.H.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  5. Mass transfer with complex reversible chemical reactions. II: parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, van F.P.H.; van Swaaij, W.P.M.

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  6. Chemical boundary layers in CVD II. Reversible reactions

    NARCIS (Netherlands)

    Croon, de M.H.J.M.; Giling, L.J.

    1990-01-01

    In addition to irreversible reactions, which were treated in part I, reversible reactions in the gas phase have beenstudied using the concept of the chemical boundary layer. The analysis is given for the situations in which either the forwardor the back reaction is dominant. Two conceptual models

  7. Simulation of square wave voltammetry of three electrode reactions coupled by two reversible chemical reactions

    OpenAIRE

    Lovrić, Milivoj

    2017-01-01

    Three fast and reversible electrode reactions that are connected by two reversible chemical reactions that are permanently in the equilibrium are analysed theoretically for square wave voltammetry. The dependence of peak potentials on the dimensionless equilibrium constants of chemical reactions is calculated. The influence of the basic thermodynamic parameters on the square wave voltammetric responses is analysed.

  8. The Forward-Reverse Algorithm for Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

    2015-01-01

    In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem

  9. Time reversal tests in polarized neutron reactions

    International Nuclear Information System (INIS)

    Asahi, Koichiro; Bowman, J.D.; Crawford, B.

    1998-01-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). In recent years the nuclear weak interaction has been studied in the compound nucleus via parity violation. The observed parity-violating effects are strongly enhanced by nuclear structure. The predictions are that the interaction of polarized neutrons with polarized nuclear targets could be also used to perform sensitive tests of time-reversal-violation because of the nuclear enhancements. The author has designed experiments to search for time-reversal violation in neutron-nucleus interactions. He has also developed techniques to polarize neutrons with laser-polarized 3 He gas targets. Using the polarized 3 He neutron spin filter, he has performed two experiments at LANSCE: an absolute neutron beam polarization measurement with an accuracy of 0.2--0.3% and a neutron spin-rotation measurement on a 139 La sample

  10. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  11. Interconversion of η3-H2SiRR' σ-complexes and 16-electron silylene complexes via reversible H-H or C-H elimination.

    Science.gov (United States)

    Lipke, Mark C; Neumeyer, Felix; Tilley, T Don

    2014-04-23

    Solid samples of η(3)-silane complexes [PhBP(Ph)3]RuH(η(3)-H2SiRR') (R,R' = Et2, 1a; PhMe, 1b; Ph2, 1c, MeMes, 1d) decompose when exposed to dynamic vacuum. Gas-phase H2/D2 exchange between isolated, solid samples of 1c-d3 and 1c indicate that a reversible elimination of H2 is the first step in the irreversible decomposition. An efficient solution-phase trap for hydrogen, the 16-electron ruthenium benzyl complex [PhBP(Ph)3]Ru[η(3)-CH2(3,5-Me2C6H3)] (3) reacts quantitatively with H2 in benzene via elimination of mesitylene to form the η(5)-cyclohexadienyl complex [PhBP(Ph)3]Ru(η(5)-C6H7) (4). This H2 trapping reaction was utilized to drive forward and quantify the elimination of H2 from 1b,d in solution, which resulted in the decomposition of 1b,d to form 4 and several organosilicon products that could not be identified. Reaction of {[PhBP(Ph)3]Ru(μ-Cl)}2 (2) with (THF)2Li(SiHMes2) forms a new η(3)-H2Si species [PhBP(Ph)3]Ru[CH2(2-(η(3)-H2SiMes)-3,5-Me2C6H2)] (5) which reacts with H2 to form the η(3)-H2SiMes2 complex [PhBP(Ph)3]RuH(η(3)-H2SiMes2) (1e). Complex 1e was identified by NMR spectroscopy prior to its decomposition by elimination of Mes2SiH2 to form 4. DFT calculations indicate that an isomer of 5, the 16-electron silylene complex [PhBP(Ph)3]Ru(μ-H)(═SiMes2), is only 2 kcal/mol higher in energy than 5. Treatment of 5 with XylNC (Xyl = 2,6-dimethylphenyl) resulted in trapping of [PhBP(Ph)3]Ru(μ-H)(═SiMes2) to form the 18-electron silylene complex [PhBP(Ph)3]Ru(CNXyl)(μ-H)(═SiMes2) (6). A closely related germylene complex [PhBP(Ph)3]Ru[CN(2,6-diphenyl-4-MeC6H2)](H)(═GeH(t)Bu) (8) was prepared from reaction of (t)BuGeH3 with the benzyl complex [PhBP(Ph)3]Ru[CN(2,6-diphenyl-4-MeC6H2)][η(1)-CH2(3,5-Me2C6H3)] (7). Single crystal XRD analysis indicated that unlike for 6, the hydride ligand in 8 is a terminal hydride that does not engage in 3c-2e Ru-H → Ge bonding. Complex 1b is an effective precatalyst for the catalytic Ge-H dehydrocoupling

  12. Analysis of Brownian Dynamics Simulations of Reversible Bimolecular Reactions

    KAUST Repository

    Lipková, Jana

    2011-01-01

    A class of Brownian dynamics algorithms for stochastic reaction-diffusion models which include reversible bimolecular reactions is presented and analyzed. The method is a generalization of the λ-bcȳ model for irreversible bimolecular reactions which was introduced in [R. Erban and S. J. Chapman, Phys. Biol., 6(2009), 046001]. The formulae relating the experimentally measurable quantities (reaction rate constants and diffusion constants) with the algorithm parameters are derived. The probability of geminate recombination is also investigated. © 2011 Society for Industrial and Applied Mathematics.

  13. Mass transfer with complex reversible chemical reactions—I. Single reversible chemical reaction

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1989-01-01

    An improved numerical technique was used in order to develop an absorption model with which it is possible to calculate rapidly absorption rates for the phenomenon of mass transfer accompanied by a complex reversible chemical reaction. This model can be applied for the calculation of the mass

  14. Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  15. Single-molecule stochastic times in a reversible bimolecular reaction

    Science.gov (United States)

    Keller, Peter; Valleriani, Angelo

    2012-08-01

    In this work, we consider the reversible reaction between reactants of species A and B to form the product C. We consider this reaction as a prototype of many pseudobiomolecular reactions in biology, such as for instance molecular motors. We derive the exact probability density for the stochastic waiting time that a molecule of species A needs until the reaction with a molecule of species B takes place. We perform this computation taking fully into account the stochastic fluctuations in the number of molecules of species B. We show that at low numbers of participating molecules, the exact probability density differs from the exponential density derived by assuming the law of mass action. Finally, we discuss the condition of detailed balance in the exact stochastic and in the approximate treatment.

  16. Characterization of reversible reactions of isocyanides with molybdenum dithiolate complexes

    International Nuclear Information System (INIS)

    Miller, D.J.; DuBois, M.R.

    1980-01-01

    Dimeric molybdenum complexes with bridging dithiocarbonimidate ligands of the formula [C 5 H 5 MoS 2 CNR] 2 (where R = CH 3 , CH 2 C 6 H 5 , C 6 H 11 , and n-C 4 H 9 ) have been synthesized and characterized. The syntheses involve the room-temperature reactions of excess isocyanides with solutions of the dimeric complex [C 5 H 5 MoSC 3 H 6 S] 2 . During the course of these reactions, propene is displaced from the sulfur atoms of the bridging dithiolate ligands. Addition of excess alkene reverses the above reactions. Equilibrium constants have been calculated for the following reactions by integration of NMR resonances: [CH 3 C 5 H 4 MoSC 2 H 4 S] 2 + RNC reversible (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + C == C, K 1 = 2.9 +- 0.2; (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + RNC reversible [CH 3 C 5 H 4 MoS 2 CNR] 2 + C == C, K 2 = 0.7 +- 0.1 (R = CH 2 C 6 H 5 ). The dithiocarbonimidate complexes react cleanly with the electrophiles CH 3 OSO 2 F and HOSO 2 CF 3 to form [C 5 H 5 MoS 2 CNRR'] 2 2+ where R' = H or CH 3 . These products have been characterized by spectral and conductivity methods. The reactions of the dithiocarbonimidate complexes with reducing agents and with carbon monoxide are discussed. 1 figure, 2 tables

  17. Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions

    OpenAIRE

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and concentration profiles for a wide range of processes and conditions, for both film and penetration model. With the aid of this mass transfer model it is demonstrated that the absorption rates in syst...

  18. The Forward-Reverse Algorithm for Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian

    2015-01-07

    In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which we solve a set of deterministic optimization problems where the SRNs are replaced by the classical ODE rates; then, during the second phase, the Monte Carlo version of the EM algorithm is applied starting from the output of the previous phase. Starting from a set of over-dispersed seeds, the output of our two-phase method is a cluster of maximum likelihood estimates obtained by using convergence assessment techniques from the theory of Markov chain Monte Carlo.

  19. Properties of the reverse transcription reaction in mRNA quantification

    DEFF Research Database (Denmark)

    Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie

    2004-01-01

    BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...

  20. Reduced Reactivity of Amines against Nucleophilic Substitution via Reversible Reaction with Carbon Dioxide

    Directory of Open Access Journals (Sweden)

    Fiaz S. Mohammed

    2015-12-01

    Full Text Available The reversible reaction of carbon dioxide (CO2 with primary amines to form alkyl-ammonium carbamates is demonstrated in this work to reduce amine reactivity against nucleophilic substitution reactions with benzophenone and phenyl isocyanate. The reversible formation of carbamates has been recently exploited for a number of unique applications including the formation of reversible ionic liquids and surfactants. For these applications, reduced reactivity of the carbamate is imperative, particularly for applications in reactions and separations. In this work, carbamate formation resulted in a 67% reduction in yield for urea synthesis and 55% reduction for imine synthesis. Furthermore, the amine reactivity can be recovered upon reversal of the carbamate reaction, demonstrating reversibility. The strong nucleophilic properties of amines often require protection/de-protection schemes during bi-functional coupling reactions. This typically requires three separate reaction steps to achieve a single transformation, which is the motivation behind Green Chemistry Principle #8: Reduce Derivatives. Based upon the reduced reactivity, there is potential to employ the reversible carbamate reaction as an alternative method for amine protection in the presence of competing reactions. For the context of this work, CO2 is envisioned as a green protecting agent to suppress formation of n-phenyl benzophenoneimine and various n-phenyl–n-alky ureas.

  1. An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

    2016-01-01

    In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem

  2. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  3. Reversal of a Suspected Paradoxical Reaction to Zopiclone with Flumazenil

    DEFF Research Database (Denmark)

    Jordahn, Zarah; Andersen, Cheme; Aaberg, Anne Marie Roust

    2016-01-01

    We describe the care for an elderly woman who was admitted to the intensive care unit (ICU) to receive noninvasive ventilation for acute exacerbation of chronic obstructive pulmonary disease. After administration of the sleeping pill zopiclone, a nonbenzodiazepine receptor agonist (NBRA), the pat......We describe the care for an elderly woman who was admitted to the intensive care unit (ICU) to receive noninvasive ventilation for acute exacerbation of chronic obstructive pulmonary disease. After administration of the sleeping pill zopiclone, a nonbenzodiazepine receptor agonist (NBRA...... indicates that zopiclone induced behavioral changes resembling a paradoxical reaction to benzodiazepines and these symptoms may be treated with flumazenil....

  4. Do high school chemistry examinations inhibit deeper level understanding of dynamic reversible chemical reactions?

    Science.gov (United States)

    Wheeldon, R.; Atkinson, R.; Dawes, A.; Levinson, R.

    2012-07-01

    Background and purpose : Chemistry examinations can favour the deployment of algorithmic procedures like Le Chatelier's Principle (LCP) rather than reasoning using chemical principles. This study investigated the explanatory resources which high school students use to answer equilibrium problems and whether the marks given for examination answers require students to use approaches beyond direct application of LCP. Sample : The questionnaire was administered to 162 students studying their first year of advanced chemistry (age 16/17) in three high achieving London high schools. Design and methods : The students' explanations of reversible chemical systems were inductively coded to identify the explanatory approaches used and interviews with 13 students were used to check for consistency. AS level examination questions on reversible reactions were analysed to identify the types of explanations sought and the students' performance in these examinations was compared to questionnaire answers. Results : 19% of students used a holistic explanatory approach: when the rates of forward and reverse reactions are correctly described, recognising their simultaneous and mutually dependent nature. 36% used a mirrored reactions approach when the connected nature of the forward and reverse reactions is identified, but not their mutual dependency. 42% failed to recognize the interdependence of forward and reverse reactions (reactions not connected approach). Only 4% of marks for AS examination questions on reversible chemical systems asked for responses which went beyond either direct application of LCP or recall of equilibrium knowledge. 37% of students attained an A grade in their AS national examinations. Conclusions : Examinations favour the application of LCP making it possible to obtain the highest grade with little understanding of reversible chemical systems beyond a direct application of this algorithm. Therefore students' understanding may be attenuated so that they are

  5. Reversible aqueous zinc/manganese oxide energy storage from conversion reactions

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Huilin; Shao, Yuyan; Yan, Pengfei; Cheng, Yingwen; Han, Kee Sung; Nie, Zimin; Wang, Chongmin; Yang, Jihui; Li, Xiaolin; Bhattacharya, Priyanka; Mueller, Karl T.; Liu, Jun

    2016-04-18

    Rechargeable aqueous batteries are attracting growing interest for energy storage due to their low cost and high safety. Fundamental understanding of highly reversible aqueous reactions is critical for building high-performance batteries. Herein, we studied the reversibility of Zn/MnO2 battery chemistry in mild aqueous MnSO4 electrolytes. α-MnO2 nanofibers were used as a high performance cathode. Our study provides good evidence for a conversion reaction mechanism through reversible formation of short nanorods and nanoparticle aggregates. This reversible conversion reaction provides an operating voltage of 1.44 V, high capacity of 285 mAh g-1, excellent rate and capacity retention of 92% after 5000 cycles. Zn metal anode also shows high reversibility in the mild aqueous MnSO4 electrolytes. The highly reversible and stable chemistries in aqueous Zn/MnO2 batteries open new opportunity for energy storage technologies with potentially high energy density, high safety, and low cost.

  6. Time-reversal asymmetry: polarization and analyzing power in nuclear reactions

    International Nuclear Information System (INIS)

    Rioux, C.; Roy, R.; Slobodrian, R.J.; Conzett, H.E.

    1984-01-01

    Measurements of the proton polarization in the reactions 7 Li( 3 He, p vector) 9 Be and 9 Be( 3 He, p vector) 11 B and of the analyzing powers in the inverse reactions, initiated by polarized protons at the same center-of-mass energies, show significant differences. This implies the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction 2 H( 3 He, p vector) 4 He and its inverse have also been investigated and show smaller differences. A discussion of instrumental asymmetries is presented

  7. A copper-mediated reverse aromatic Finkelstein reaction in ionic liquid

    Directory of Open Access Journals (Sweden)

    Anh T.H. Nguyen

    2018-03-01

    Full Text Available We have developed a general method for reverse aromatic Finkelstein reactions. Good reaction yields were obtained when aryl iodides or aryl bromides were treated with copper halide salts as promoters in a 1-butyl-3-methylimidazolium bromide ([BMIM]Br ionic liquid (IL solvent at 140 °C for 8 h. Preliminary investigation supported that the copper salts were also the halide sources in halogen exchange reactions. The optimized conditions are applicable to a variety of substrates and have excellent functional group tolerance. Additionally, the [BMIM]Br solvent showed good stability for at least 10 consecutive runs. Results indicated that the [BMIM]Br solvent was recyclable for reverse aromatic Finkelstein reactions.

  8. Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

    National Research Council Canada - National Science Library

    McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

    2005-01-01

    ...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

  9. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  10. On the graph and systems analysis of reversible chemical reaction networks with mass action kinetics

    NARCIS (Netherlands)

    Rao, Shodhan; Jayawardhana, Bayu; Schaft, Arjan van der

    2012-01-01

    Motivated by the recent progresses on the interplay between the graph theory and systems theory, we revisit the analysis of reversible chemical reaction networks described by mass action kinetics by reformulating it using the graph knowledge of the underlying networks. Based on this formulation, we

  11. The role of reversed kinematics and double kinematic solutions in nuclear reactions studies

    International Nuclear Information System (INIS)

    Kaplan, M.; Parker, W.E.; Moses, D.J.; Lacey, R.; Alexander, J.M.

    1993-01-01

    The advantages of reversed kinematics in nuclear reactions studies are discussed, with particular emphasis on the origin of double solutions in the reaction kinematics. This possibility for double solutions does not exist in normal kinematics, and provides the basis for a new method of imposing important experimental constraints on the uniqueness of fitting complex observations. By gating on one or the other of the two solutions, light particle kinematics can be greatly influenced in coincidence measurements. The power of the method is illustrated with data for the reaction 1030 MeV 121 Sb+ 27 Al, where charged particle emissions arise from several different sources. (orig.)

  12. An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian

    2016-01-06

    In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce an efficient two-phase algorithm in which the first phase is deterministic and it is intended to provide a starting point for the second phase which is the Monte Carlo EM Algorithm.

  13. Nanoscale control of reversible chemical reaction between fullerene C60 molecules using scanning tunneling microscope.

    Science.gov (United States)

    Nakaya, Masato; Kuwahara, Yuji; Aono, Masakazu; Nakayama, Tomonobu

    2011-04-01

    The nanoscale control of reversible chemical reactions, the polymerization and depolymerization between C60 molecules, has been investigated. Using a scanning tunneling microscope (STM), the polymerization and depolymerization can be controlled at designated positions in ultrathin films of C60 molecules. One of the two chemical reactions can be selectively induced by controlling the sample bias voltage (V(s)); the application of negative and positive values of V(s) results in polymerization and depolymerization, respectively. The selectivity between the two chemical reactions becomes extremely high when the thickness of the C60 film increases to more than three molecular layers. We conclude that STM-induced negative and positive electrostatic ionization are responsible for the control of the polymerization and depolymerization, respectively.

  14. Modified lignin: Preparation and use in reversible gel via Diels-Alder reaction.

    Science.gov (United States)

    Zhou, Wanpeng; Zhang, Hui; Chen, Fangeng

    2018-02-01

    In this study, popular soda lignin was modified with either furan or maleimide ring, and the modified lignins were subjected to reversible Diels-Alder reaction. A new process was proposed to prepare the functionalized lignin. A long chain was introduced to the hydroxyl groups of lignin, and then either the furan or maleimide ring was added to the other end of the chain. The test results confirmed that either the furan ring or the maleimide ring was bound to lignin. Furan- and maleimide-functionalized lignins were also combined to generate crosslinking via Diels-Alder [4+2] cycloaddition reaction. Under appropriate conditions, the formation of a gel was identified, which reverted to liquid state after retro Diels-Alder reaction upon heating at 120°C. This study reveals the significant versatility and potential of the developed strategy for the utilization of lignin-based recyclable networks. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Asymmetric effect of mechanical stress on the forward and reverse reaction catalyzed by an enzyme.

    Directory of Open Access Journals (Sweden)

    Collin Joseph

    Full Text Available The concept of modulating enzymatic activity by exerting a mechanical stress on the enzyme has been established in previous work. Mechanical perturbation is also a tool for probing conformational motion accompanying the enzymatic cycle. Here we report measurements of the forward and reverse kinetics of the enzyme Guanylate Kinase from yeast (Saccharomyces cerevisiae. The enzyme is held in a state of stress using the DNA spring method. The observation that mechanical stress has different effects on the forward and reverse reaction kinetics suggests that forward and reverse reactions follow different paths, on average, in the enzyme's conformational space. Comparing the kinetics of the stressed and unstressed enzyme we also show that the maximum speed of the enzyme is comparable to the predictions of the relaxation model of enzyme action, where we use the independently determined dissipation coefficient [Formula: see text] for the enzyme's conformational motion. The present experiments provide a mean to explore enzyme kinetics beyond the static energy landscape picture of transition state theory.

  16. Communication: Rate coefficients from quasiclassical trajectory calculations from the reverse reaction: The Mu + H2 reaction re-visited

    Science.gov (United States)

    Homayoon, Zahra; Jambrina, Pablo G.; Aoiz, F. Javier; Bowman, Joel M.

    2012-07-01

    In a previous paper [P. G. Jambrina et al., J. Chem. Phys. 135, 034310 (2011), 10.1063/1.3611400] various calculations of the rate coefficient for the Mu + H2 → MuH + H reaction were presented and compared to experiment. The widely used standard quasiclassical trajectory (QCT) method was shown to overestimate the rate coefficients by several orders of magnitude over the temperature range 200-1000 K. This was attributed to a major failure of that method to describe the correct threshold for the reaction owing to the large difference in zero-point energies (ZPE) of the reactant H2 and product MuH (˜0.32 eV). In this Communication we show that by performing standard QCT calculations for the reverse reaction and then applying detailed balance, the resulting rate coefficient is in very good agreement with the other computational results that respect the ZPE, (as well as with the experiment) but which are more demanding computationally.

  17. An efficient forward-reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Vilanova, Pedro

    2016-01-07

    In this work, we present an extension of the forward-reverse representation introduced in Simulation of forward-reverse stochastic representations for conditional diffusions , a 2014 paper by Bayer and Schoenmakers to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the Expectation-Maximization algorithm to the phase I output. By selecting a set of over-dispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.

  18. Efficient Solar Energy Harvesting and Storage through a Robust Photocatalyst Driving Reversible Redox Reactions.

    Science.gov (United States)

    Zhou, Yangen; Zhang, Shun; Ding, Yu; Zhang, Leyuan; Zhang, Changkun; Zhang, Xiaohong; Zhao, Yu; Yu, Guihua

    2018-06-14

    Simultaneous solar energy conversion and storage is receiving increasing interest for better utilization of the abundant yet intermittently available sunlight. Photoelectrodes driving nonspontaneous reversible redox reactions in solar-powered redox cells (SPRCs), which can deliver energy via the corresponding reverse reactions, present a cost-effective and promising approach for direct solar energy harvesting and storage. However, the lack of photoelectrodes having both high conversion efficiency and high durability becomes a bottleneck that hampers practical applications of SPRCs. Here, it is shown that a WO 3 -decorated BiVO 4 photoanode, without the need of extra electrocatalysts, can enable a single-photocatalyst-driven SPRC with a solar-to-output energy conversion efficiency as high as 1.25%. This SPRC presents stable performance over 20 solar energy storage/delivery cycles. The high efficiency and stability are attributed to the rapid redox reactions, the well-matched energy level, and the efficient light harvesting and charge separation of the prepared BiVO 4 . This demonstrated device system represents a potential alternative toward the development of low-cost, durable, and easy-to-implement solar energy technologies. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. [Are there pseudophototropic reactions in biology? Part 4: On the reversibility of biologic/synthetic polymere systems (author's transl)].

    Science.gov (United States)

    Patschorke, J

    1979-01-01

    In further research on pseudophototropic behaviour in cellular membranes of halobacteria the reversibility of vinylmethylethermaleic anhydride-copolymeres with biological liquids is tested and the basic principles of different colour generating reactions are studied.

  20. Reversible alkyne insertion in the benzannulation reaction of Fischer carbene complexes with alkynes

    Energy Technology Data Exchange (ETDEWEB)

    Waters, M.L.; Bos, M.E.; Wulff, W.D. [Univ. of Chicago, IL (United States)

    1995-12-31

    The benzannulation reaction of Fischer carbene complexes with alkynes to give phenols is highly regioselective with terminal alkynes, and reasonably regioselective with internal alkynes. This has been attributed to steric factors in intermediates, where one form is favored due to close contact between the R substituent and a cis-CO ligand. Whether alkyne insertion is kinetically or thermodynamically controlled has not been determined. The authors now have evidence from regioselectivity studies that alkyne insertion into the metal-carbon bond is reversible. Implications of these results and further mechanistic considerations will be presented.

  1. On null tests of time-reversal invariance in scattering and reactions

    International Nuclear Information System (INIS)

    Conzett, H.E.

    1993-01-01

    There have been suggestions in the literature, both recently and in the more distant past, that, in the lowest-order Born approximation, time-reversal (T)-odd experimental observables in certain reactions are required by T-symmetry to vanish. These observables are the final-state spin-correlation coefficient C xy in the reaction e + e - → τ + τ - and the target analysing power A oy in the inclusive process ep → eX with a polarized proton target. These assertions are in direct conflict with a theorem that states that there can be no null-test of T-symmetry in such processes; that is, T-symmetry does not require any single observable to vanish. This talk addresses the resolution of that conflict

  2. SIMULTANEOUS ABSORPTION AND DESORPTION WITH REVERSIBLE 1ST-ORDER CHEMICAL-REACTION - ANALYTICAL SOLUTION AND NEGATIVE ENHANCEMENT FACTORS

    NARCIS (Netherlands)

    WINKELMAN, JGM; BEENACKERS, AACM

    The problem of ps absorption accompanied by a first-order reversible reaction, producing a volatile reaction product, is considered. A general analytical solution is developed for the film model, resulting in explicit relations for the concentration profiles in the film and for the mass transfer

  3. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  4. An efficient forward–reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Bayer, Christian

    2016-02-20

    © 2016 Taylor & Francis Group, LLC. ABSTRACT: In this work, we present an extension of the forward–reverse representation introduced by Bayer and Schoenmakers (Annals of Applied Probability, 24(5):1994–2032, 2014) to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, that is, SRNs conditional on their values in the extremes of given time intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the expectation-maximization algorithm to the phase I output. By selecting a set of overdispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.

  5. Performance and cost of energy transport and storage systems for dish applications using reversible chemical reactions

    Science.gov (United States)

    Schredder, J. M.; Fujita, T.

    1984-01-01

    The use of reversible chemical reactions for energy transport and storage for parabolic dish networks is considered. Performance and cost characteristics are estimated for systems using three reactions (sulfur-trioxide decomposition, steam reforming of methane, and carbon-dioxide reforming of methane). Systems are considered with and without storage, and in several energy-delivery configurations that give different profiles of energy delivered versus temperature. Cost estimates are derived assuming the use of metal components and of advanced ceramics. (The latter reduces the costs by three- to five-fold). The process that led to the selection of the three reactions is described, and the effects of varying temperatures, pressures, and heat exchanger sizes are addressed. A state-of-the-art survey was performed as part of this study. As a result of this survey, it appears that formidable technical risks exist for any attempt to implement the systems analyzed in this study, especially in the area of reactor design and performance. The behavior of all components and complete systems under thermal energy transients is very poorly understood. This study indicates that thermochemical storage systems that store reactants as liquids have efficiencies below 60%, which is in agreement with the findings of earlier investigators.

  6. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  7. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  8. Neural Network Control of CSTR for Reversible Reaction Using Reverence Model Approach

    Directory of Open Access Journals (Sweden)

    Duncan ALOKO

    2007-01-01

    Full Text Available In this work, non-linear control of CSTR for reversible reaction is carried out using Neural Network as design tool. The Model Reverence approach in used to design ANN controller. The idea is to have a control system that will be able to achieve improvement in the level of conversion and to be able to track set point change and reject load disturbance. We use PID control scheme as benchmark to study the performance of the controller. The comparison shows that ANN controller out perform PID in the extreme range of non-linearity.This paper represents a preliminary effort to design a simplified neutral network control scheme for a class of non-linear process. Future works will involve further investigation of the effectiveness of thin approach for the real industrial chemical process

  9. Controlling Solid–Liquid Conversion Reactions for a Highly Reversible Aqueous Zinc–Iodine Battery

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Huilin; Li, Bin; Mei, Donghai; Nie, Zimin; Shao, Yuyan; Li, Guosheng; Li, Xiaohong S.; Han, Kee Sung; Muller, Karl T.; Sprenkle, Vincent L.; Liu, Jun

    2017-10-30

    Aqueous rechargeable batteries are desirable for many energy storage applications due to their low cost and high safety. However, low capacity and short cycle life are the significant obstacles to their practical applications. Here, we demonstrate a highly reversible aqueous zinc-iodine battery using encapsulated iodine in microporous active carbon fibers (ACFs) as cathode materials through the rational control of solid-liquid conversion reactions. The experiments and density function theory (DFT) calculations were employed to investigate the effects of solvents and properties of carbon hosts, e.g. pore size, surface chemistries, on the adsorption of iodine species. The rational manipulation of the competition between the adsorption in carbon and solvation in electrolytes for iodine species is responsible for the high reversibility and cycling stability. The zinc-iodine batteries deliver a high capacity of 180 mAh g-1 at 1C and a stable cycle life over 3000 cycles with ~90% capacity retention as well as negligible self-discharge. We believe the principles for stabilizing the zinc-iodine system could provide new insight into conversion systems such as Li-S systems.

  10. Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

    Science.gov (United States)

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

    2004-03-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  11. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  12. Mass transfer with complex chemical reactions in gas–liquid systems : two-step reversible reactions with unit stoichiometric and kinetic orders

    NARCIS (Netherlands)

    Vas Bhat, R.D.; Kuipers, J.A.M.; Versteeg, G.F.

    2000-01-01

    An absorption model to study gas–liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although

  13. Mass transfer with complex chemical reactions in gas-liquid systems: two-step reversible reactions with unit stoichiometric and kinetic orders

    NARCIS (Netherlands)

    Vas bhat, R.D.; Kuipers, J.A.M.; Versteeg, Geert

    2000-01-01

    An absorption model to study gas¿liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although

  14. On the feasibility of producing secondary radioactive nuclear beams using reactions in reversed geometries at HI-13 tandem accelerator

    International Nuclear Information System (INIS)

    Bai Xixiang; Liu Weiping

    1993-01-01

    Some of (p,n),(d,p),(d,n) and (d, 3 He) reactions involving heavy-ions in reversed geometries are proposed for producing the kinematically compressed beams of ions such as 6 He, 7 Be, 8 Li, 11 C, 12 B, 13 N, 15 O and 17 F. A simple facility being constructed to produce and utilize these beams is briefly described

  15. Enhanced reversibility and durability of a solid oxide Fe-air redox battery by carbothermic reaction derived energy storage materials.

    Science.gov (United States)

    Zhao, Xuan; Li, Xue; Gong, Yunhui; Huang, Kevin

    2014-01-18

    The recently developed solid oxide metal-air redox battery is a new technology capable of high-rate chemistry. Here we report that the performance, reversibility and stability of a solid oxide iron-air redox battery can be significantly improved by nanostructuring energy storage materials from a carbothermic reaction.

  16. Reversible logic gates based on enzyme-biocatalyzed reactions and realized in flow cells: a modular approach.

    Science.gov (United States)

    Fratto, Brian E; Katz, Evgeny

    2015-05-18

    Reversible logic gates, such as the double Feynman gate, Toffoli gate and Peres gate, with 3-input/3-output channels are realized using reactions biocatalyzed with enzymes and performed in flow systems. The flow devices are constructed using a modular approach, where each flow cell is modified with one enzyme that biocatalyzes one chemical reaction. The multi-step processes mimicking the reversible logic gates are organized by combining the biocatalytic cells in different networks. This work emphasizes logical but not physical reversibility of the constructed systems. Their advantages and disadvantages are discussed and potential use in biosensing systems, rather than in computing devices, is suggested. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  18. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  19. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  20. Spectrophotometry of RR Telescopii

    International Nuclear Information System (INIS)

    Walker, A.R.

    1977-01-01

    The strongest emission lines in the nova-like variable RR Telescopii were measured during late 1974 using a spectrum scanner. The wavelength range 3350 to 7700 A was scanned with a resolution of 50 A. The results are compared with published spectrophotometry covering the period 1961 to 72, with the conclusion that few changes have taken place in the last 6 yr. No evidence was found that suggested the existence of a cool star, nor was there any indication of night-to-night changes in the emission line intensities. The spectrophotometry of the past 15 yr is consistent with an expanding shell, the emission from this shell being caused by high-energy radiation from an underlying star. (author)

  1. Kinetics and thermochemistry of the reversible gas phase reaction HONO+NH3->3N-HONO studied by infrared diode laser spectroscopy

    DEFF Research Database (Denmark)

    Pagsberg, P.; Ratajczak, E.; Sillesen, A.

    1994-01-01

    The kinetics of the reversible reaction HONO+NH3 reversible H3N-HONO (1) was studied by monitoring trans-HONO relaxation kinetics. The rate of approach towards equilibrium was studied as a function of the ammonia concentration to obtain values of the rate constants for the forward and reverse rea...

  2. Effect of lateralized design on muscle and joint reaction forces for reverse shoulder arthroplasty.

    Science.gov (United States)

    Liou, William; Yang, Yang; Petersen-Fitts, Graysen R; Lombardo, Daniel J; Stine, Sasha; Sabesan, Vani J

    2017-04-01

    Manufacturers of reverse shoulder arthroplasty (RSA) implants have recently designed innovative implants to optimize performance in rotator cuff-deficient shoulders. These advancements are not without tradeoffs and can have negative biomechanical effects. The objective of this study was to develop an integrated finite element analysis-kinematic model to compare the muscle forces and joint reaction forces (JRFs) of 3 different RSA designs. A kinematic model of a normal shoulder joint was adapted from the Delft model and integrated with the well-validated OpenSim shoulder model. Static optimizations then allowed for calculation of the individual muscle forces, moment arms, and JRFs relative to net joint moments. Three-dimensional computer models of 3 RSA designs-humeral lateralized design (HLD), glenoid lateralized design, and Grammont design-were integrated, and parametric studies were performed. Overall, there were decreases in deltoid and rotator cuff muscle forces for all 3 RSA designs. These decreases were greatest in the middle deltoid of the HLD model for abduction and flexion and in the rotator cuff muscles under both internal rotation and external rotation. The JRFs in abduction and flexion decreased similarly for all RSA designs compared with the normal shoulder model, with the greatest decrease seen in the HLD model. These findings demonstrate that the design characteristics implicit in these modified RSA prostheses result in mechanical differences most prominently seen in the deltoid muscle and overall JRFs. Further research using this novel integrated model can help guide continued optimization of RSA design and clinical outcomes. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  3. On the ambiguity of the reaction rate constants in multivariate curve resolution for reversible first-order reaction systems.

    Science.gov (United States)

    Schröder, Henning; Sawall, Mathias; Kubis, Christoph; Selent, Detlef; Hess, Dieter; Franke, Robert; Börner, Armin; Neymeyr, Klaus

    2016-07-13

    If for a chemical reaction with a known reaction mechanism the concentration profiles are accessible only for certain species, e.g. only for the main product, then often the reaction rate constants cannot uniquely be determined from the concentration data. This is a well-known fact which includes the so-called slow-fast ambiguity. This work combines the question of unique or non-unique reaction rate constants with factor analytic methods of chemometrics. The idea is to reduce the rotational ambiguity of pure component factorizations by considering only those concentration factors which are possible solutions of the kinetic equations for a properly adapted set of reaction rate constants. The resulting set of reaction rate constants corresponds to those solutions of the rate equations which appear as feasible factors in a pure component factorization. The new analysis of the ambiguity of reaction rate constants extends recent research activities on the Area of Feasible Solutions (AFS). The consistency with a given chemical reaction scheme is shown to be a valuable tool in order to reduce the AFS. The new methods are applied to model and experimental data. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. S-factor measurement of the 13C(p,γ)14N reaction in reverse kinematics

    International Nuclear Information System (INIS)

    Genard, G; Terwagne, G; Descouvemont, P

    2010-01-01

    We measure the S-factor of the 13 C(p,γ) 14 N reaction in reverse kinematics for energies ranging from 561 down to 225 keV with a low background experimental setup. The results are compared with previous measurements and an R-matrix treatment is applied to the data in order to obtain the properties of the 511 keV resonance that dominates the cross section at low energies.

  5. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  6. Safety analysis of switching between reductive and oxidative conditions in a reaction coupling reverse flow reactor.

    NARCIS (Netherlands)

    van Sint Annaland, M.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria

    2001-01-01

    A new reverse flow reactor is developed where endothermic reactants (propane dehydrogenation) and exothermic reactants (fuel combustion) are fed sequentially to a monolithic catalyst, while periodically alternating the inlet and outlet positions. Upon switching from reductive to oxidative conditions

  7. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  8. Scandium(III) catalysis of transimination reactions. Independent and constitutionally coupled reversible processes.

    Science.gov (United States)

    Giuseppone, Nicolas; Schmitt, Jean-Louis; Schwartz, Evan; Lehn, Jean-Marie

    2005-04-20

    Sc(OTf)(3) efficiently catalyzes the self-sufficient transimination reaction between various types of C=N bonds in organic solvents, with turnover frequencies up to 3600 h(-)(1) and rate accelerations up to 6 x 10(5). The mechanism of the crossover reaction in mixtures of amines and imines is studied, comparing parallel individual reactions with coupled equilibria. The intrinsic kinetic parameters for isolated reactions cannot simply be added up when several components are mixed, and the behavior of the system agrees with the presence of a unique mediator that constitutes the core of a network of competing reactions. In mixed systems, every single amine or imine competes for the same central hub, in accordance with their binding affinity for the catalyst metal ion center. More generally, the study extends the basic principles of constitutional dynamic chemistry to interconnected chemical transformations and provides a step toward dynamic systems of increasing complexity.

  9. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  10. In Situ Insight into Reversible O2 Gas-Solid Reactions

    DEFF Research Database (Denmark)

    Wegeberg, Christina

    2016-01-01

    Non-porous crystalline solids containing a series of cationic tetracobalt complexes reversibly, selectively and stoichiometrically chemisorb dioxygen in temperature/O2 partial pressure induced processes involving the oxidation of cobalt with concurrent reduction of two equivalents of sorbed O2 to...

  11. Plant Acyl-CoA:Lysophosphatidylcholine Acyltransferases (LPCATs) Have Different Specificities in Their Forward and Reverse Reactions*

    Science.gov (United States)

    Lager, Ida; Yilmaz, Jenny Lindberg; Zhou, Xue-Rong; Jasieniecka, Katarzyna; Kazachkov, Michael; Wang, Peng; Zou, Jitao; Weselake, Randall; Smith, Mark A.; Bayon, Shen; Dyer, John M.; Shockey, Jay M.; Heinz, Ernst; Green, Allan; Banas, Antoni; Stymne, Sten

    2013-01-01

    Acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT) enzymes have central roles in acyl editing of phosphatidylcholine (PC). Plant LPCAT genes were expressed in yeast and characterized biochemically in microsomal preparations of the cells. Specificities for different acyl-CoAs were similar for seven LPCATs from five different species, including species accumulating hydroxylated acyl groups in their seed oil, with a preference for C18-unsaturated acyl-CoA and low activity with palmitoyl-CoA and ricinoleoyl (12-hydroxyoctadec-9-enoyl)-CoA. We showed that Arabidopsis LPCAT1 and LPCAT2 enzymes catalyzed the acylation and de-acylation of both sn positions of PC, with a preference for the sn-2 position. When acyl specificities of the Arabidopsis LPCATs were measured in the reverse reaction, sn-2-bound oleoyl, linoleoyl, and linolenoyl groups from PC were transferred to acyl-CoA to a similar extent. However, a ricinoleoyl group at the sn-2-position of PC was removed 4–6-fold faster than an oleoyl group in the reverse reaction, despite poor utilization in the forward reaction. The data presented, taken together with earlier published reports on in vivo lipid metabolism, support the hypothesis that plant LPCAT enzymes play an important role in regulating the acyl-CoA composition in plant cells by transferring polyunsaturated and hydroxy fatty acids produced on PC directly to the acyl-CoA pool for further metabolism or catabolism. PMID:24189065

  12. On the Green's function of the partially diffusion-controlled reversible ABCD reaction for radiation chemistry codes

    International Nuclear Information System (INIS)

    Plante, Ianik; Devroye, Luc

    2015-01-01

    Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well

  13. On the Green's function of the partially diffusion-controlled reversible ABCD reaction for radiation chemistry codes

    Energy Technology Data Exchange (ETDEWEB)

    Plante, Ianik, E-mail: ianik.plante-1@nasa.gov [Wyle Science, Technology & Engineering, 1290 Hercules, Houston, TX 77058 (United States); Devroye, Luc, E-mail: lucdevroye@gmail.com [School of Computer Science, McGill University, 3480 University Street, Montreal H3A 0E9 (Canada)

    2015-09-15

    Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well.

  14. The general theory of multistage geminate reactions of isolated pairs of reactants. III. Two-stage reversible dissociation in geminate reaction A + A↔C↔B + B

    Energy Technology Data Exchange (ETDEWEB)

    Kipriyanov, Alexey A.; Kipriyanov, Alexander A.; Doktorov, Alexander B. [Voevodsky Institute of Chemical Kinetics and Combustion, Siberian Branch of the Russian Academy of Sciences, Novosibirsk 630090, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)

    2016-04-14

    Specific two-stage reversible reaction A + A↔C↔B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.

  15. The general theory of multistage geminate reactions of isolated pairs of reactants. III. Two-stage reversible dissociation in geminate reaction A + A ↔ C ↔ B + B.

    Science.gov (United States)

    Kipriyanov, Alexey A; Kipriyanov, Alexander A; Doktorov, Alexander B

    2016-04-14

    Specific two-stage reversible reaction A + A ↔ C ↔ B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.

  16. Features of E-Z-photoisomerization reversible reaction of 4-styrylpyridine crown-containing complexes with different cations

    International Nuclear Information System (INIS)

    Fedorov, Yu.V.; Shepel', N.Eh.; Chernikova, E.Yu.; Fedorova, O.A.; Gulakova, E.N.; Avakyan, V.G.; Jonushauskas, G.

    2008-01-01

    E-Z-Photoisomerization reversible reaction of crown-containing 4-styrylpyridine in the presence of alkali metal perchlorates (Ca 2+ , Mg 2+ , Ba 2+ ) gifted in the formation of complexes with crown-ether fragments, as well as heavy metal perchlorates (Hg 2+ , Cd 2+ ) gifted in the coordination with nitrogen atom of heterocyclic residuum has been studied. Effect of complexing on the photoisomerization is determined by electron spectroscopy and NMR 1 H, structures of the formed Z-isomers are established. The possibility of the E-Z-isomerization control with the use of supramolecular complexing is confirmed by the investigations [ru

  17. Current status and future prospect of space and time reversal symmetry violation on low energy neutron reactions

    International Nuclear Information System (INIS)

    Masuda, Yasuhiro

    1993-01-01

    In this report, the papers on symmetry violation under space reflection and time reversal and neutron spin, neutron spin rotation and P-violation, parity nonconservation in neutron capture reaction, some advantage of the search for CP-violation in neutron scattering, dynamic polarization of 139 La target, alexandrite laser for optical pumping, polarized 3 He system for T- and P-violation neutron experiments, control of neutron spin in T-violation neutron experiment, symmetry regarding time and space and angular distribution and angular correlation of radiation and particle beams, T-violation due to low temperature nuclear polarization and axion exploration using nuclear transition are collected. (K.I.)

  18. Core-shell rhodium sulfide catalyst for hydrogen evolution reaction / hydrogen oxidation reaction in hydrogen-bromine reversible fuel cell

    Science.gov (United States)

    Li, Yuanchao; Nguyen, Trung Van

    2018-04-01

    Synthesis and characterization of high electrochemical active surface area (ECSA) core-shell RhxSy catalysts for hydrogen evolution oxidation (HER)/hydrogen oxidation reaction (HOR) in H2-Br2 fuel cell are discussed. Catalysts with RhxSy as shell and different percentages (5%, 10%, and 20%) of platinum on carbon as core materials are synthesized. Cyclic voltammetry is used to evaluate the Pt-equivalent mass specific ECSA and durability of these catalysts. Transmission electron microscopy (TEM), X-ray Photoelectron spectroscopy (XPS) and Energy-dispersive X-ray spectroscopy (EDX) techniques are utilized to characterize the bulk and surface compositions and to confirm the core-shell structure of the catalysts, respectively. Cycling test and polarization curve measurements in the H2-Br2 fuel cell are used to assess the catalyst stability and performance in a fuel cell. The results show that the catalysts with core-shell structure have higher mass specific ECSA (50 m2 gm-Rh-1) compared to a commercial catalyst (RhxSy/C catalyst from BASF, 6.9 m2 gm-Rh-1). It also shows better HOR/HER performance in the fuel cell. Compared to the platinum catalyst, the core-shell catalysts show more stable performance in the fuel cell cycling test.

  19. A meson-exchange isobar model for the {pi}{sup +}d {r_reversible} pp reaction

    Energy Technology Data Exchange (ETDEWEB)

    Canton, L.; Cattapan, G.; Dortmans, P.J.; Pisent, G. [Istituto Nazionale di Fisica Nucleare, Padua (Italy); Svenne, J.P. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Physics]|[Winnipeg Inst. for Theoretical Physics, Winnipeg, MB (Canada)

    1994-10-10

    A broad set of observables are calculated for the {pi}{sup +} d {r_reversible} pp reaction with a relatively simple meson-exchange isobar model. The comparison between the calculated results and experimental data (including spin observables), shows that the model gives an overall phenomenologically acceptable description of the reaction around the {Delta} resonance. The effects due to the inclusion of Galilei invariant (pseudovector) recoil term in the {pi}NN vertex, of relativistic corrections to the {rho}-exchange component of the {Delta}N transition potential, and of NN final state interaction in the {pi}{sup +}d {yields} p+p process are also discussed. It is estimated that the model is sufficiently simple to be extended to the case of pion absorption on other light nuclei, in particular {sup 3}He (or tritium). 32 refs., 13 figs.

  20. An efficient forward-reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Vilanova, Pedro

    2016-01-01

    reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ

  1. Leprosy reversal reaction as immune reconstitution inflammatory syndrome in patients with AIDS

    OpenAIRE

    Batista, Mariana Dias [UNIFESP; Porro, Adriana Maria [UNIFESP; Maeda, Solange Miki [UNIFESP; Gomes, Elimar Elias [UNIFESP; Yoshioka, Marcia Cristina Naomi [UNIFESP; Enokihara, Mílvia Maria Simões e Silva [UNIFESP; Tomimori, Jane [UNIFESP

    2008-01-01

    We report 2 instances in which reactional borderline leprosy manifested itself as an immune reconstitution phenomenon in patients with acquired immunodeficiency syndrome. We discuss the clinical, laboratory-based, histopathologic, and immunohistochemical characteristics of both patients. Furthermore, we review similar reports from the literature.

  2. Leprosy reversal reaction as immune reconstitution inflammatory syndrome in patients with AIDS.

    Science.gov (United States)

    Batista, Mariana D; Porro, Adriana M; Maeda, Solange M; Gomes, Elimar E; Yoshioka, Márcia C N; Enokihara, Mílvia M S S; Tomimori, Jane

    2008-03-15

    We report 2 instances in which reactional borderline leprosy manifested itself as an immune reconstitution phenomenon in patients with acquired immunodeficiency syndrome. We discuss the clinical, laboratory-based, histopathologic, and immunohistochemical characteristics of both patients. Furthermore, we review similar reports from the literature.

  3. An efficient forward–reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

    2016-01-01

    then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve

  4. The retro Grignard addition reaction revisited: the reversible addition of benzyl reagents to ketones

    DEFF Research Database (Denmark)

    Christensen, Stig Holden; Holm, Torkil; Madsen, Robert

    2014-01-01

    transformation. The retro benzyl reaction was shown by the addition of benzylmagnesium chloride to di-tert-butyl ketone followed by exchange of both the benzyl and the ketone moiety with another substrate. Similar experiments were performed with phenylmagnesium bromide and tert-butylmagnesium chloride...

  5. NONLINEAR ASTEROSEISMOLOGY OF RR LYRAE

    Energy Technology Data Exchange (ETDEWEB)

    Molnar, L.; Kollath, Z.; Szabo, R. [Konkoly Observatory, MTA CSFK, H-1121 Budapest, Konkoly Thege Miklos ut 15-17 (Hungary); Bryson, S.; Mullally, F.; Thompson, S. E. [NASA Ames Research Center, MS 244-30, Moffet Field, CA 94035 (United States); Kolenberg, K., E-mail: molnar.laszlo@csfk.mta.hu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge MA 02138 (United States)

    2012-09-20

    The observations of the Kepler Space Telescope revealed that fundamental-mode RR Lyrae stars may show various radial overtones. The presence of multiple radial modes may allow us to conduct nonlinear asteroseismology: comparison of mode amplitudes and frequency shifts between observations and models. Here we report the detection of three radial modes in the star RR Lyr, the eponym of the class, using the Kepler short cadence data: besides the fundamental mode, both the first and the ninth overtones can be derived from the data set. RR Lyrae shows period doubling, but switches occasionally to a state where a pattern of six pulsation cycles repeats instead of two. We found hydrodynamic models that show the same three modes and the period-six state, allowing for comparison with the observations.

  6. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  7. Pressure effects on enzyme reactions in mainly organic media: alpha-chymotrypsin in reversed micelles of Aerosol OT in octane.

    Science.gov (United States)

    Mozhaev, V V; Bec, N; Balny, C

    1994-08-01

    Biocatalytic transformations in reversed micelles formed by anionic surfactant Aerosol OT in octane have been studied at high pressures by an example of alpha-chymotrypsin-catalyzed hydrolysis of N-carbobenzoxy-L-tyrosine p-nitrophenyl ester and N-succinyl-L-phenylalanine p-nitroanilide. For the first time it has been found that the enzyme retains high activity in these water-in-oil microemulsions up to a pressure of 2 kbar. The value of the activation volume (delta V*) for the enzyme reactions shows a dependence on the water content in the system. When the size of the micellar aqueous inner cavity (as evaluated at 1 atm) approaches the molecular size of alpha-chymotrypsin, delta V* becomes significantly different from the value in aqueous solution and in the micelles with a larger size. Possibilities of regulating the enzyme activity by pressure in systems with a low content of water are discussed.

  8. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  9. Click and chemically triggered declick reactions through reversible amine and thiol coupling via a conjugate acceptor

    Science.gov (United States)

    Diehl, Katharine L.; Kolesnichenko, Igor V.; Robotham, Scott A.; Bachman, J. Logan; Zhong, Ye; Brodbelt, Jennifer S.; Anslyn, Eric V.

    2016-10-01

    The coupling and decoupling of molecular units is a fundamental undertaking of organic chemistry. Herein we report the use of a very simple conjugate acceptor, derived from Meldrum's acid, for the sequential ‘clicking’ together of an amine and a thiol in aqueous conditions at neutral pH. Subsequently, this linkage can be ‘declicked’ by a chemical trigger to release the original amine and thiol undisturbed. The reactivity differs from that of other crosslinking agents because the selectivity for sequential functionalization derives from an altering of the electrophilicity of the conjugate acceptor on the addition of the amine. We describe the use of the procedure to modify proteins, create multicomponent libraries and synthesize oligomers, all of which can be declicked to their starting components in a controlled fashion when desired. Owing to the mild reaction conditions and ease of use in a variety of applications, the method is predicted to have wide utility.

  10. Kinetics and reversibility of radionuclide sorption reactions with rocks. Progress report for fiscal year 1979

    International Nuclear Information System (INIS)

    Barney, G.S.; Brown, G.E.

    1979-01-01

    Sorption-desorption reactions of cesium, strontium, neptunium, americium, and plutonium on basalt, granite, and argillite were observed for 218 days. Equilibrium in batch experiments was not reached for most radionuclides even after this long time. Reactions of the crushed rock with ground waters (dissolution, hydrolysis, precipitation, etc.) also did not reach equilibrium after 150 days. The dissolution of basalt is accompanied by the formation of colloidal particles which contain Si, Fe, Ca, and Al. These colloids sorb Cs, Sr, Am, and Pu during equilibration. Some of the colloids pass through 0.3-μm flters, are not retained even on 0.01-μm filters and, therefore, cause calculated K/sub d/ values to be too low. Samples of crushed basalt, granite, and argillite were artificially weathered by continuous leaching with distilled water for 6 months both in air and in an oxygen-free stream of nitrogen gas. The weathered rock was then characterized for surface area, surface structure, cation exchange capacity, and composition of weathered surface on the rock. Comparisons were made of radionuclide sorption (after 14 days) on fresh rock, rock weathered in air, and rock weathered in N 2 . Sorption on rocks weathered in N 2 generally is less than on rock weathered in air. This is possibly due to the lack of an Fe(OH) 3 coating on the rock weathered in N 2 . The Fe(OH) 3 is known to scavenge cations and silica from solution. Sorption of Cs, Si, Am, and Pu is strongly affected by weathering basalt and argillite. However, the cation exchange capacity is changed very little, suggesting that ion exchange plays a minor role in sorption of these radionuclides

  11. Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

    Science.gov (United States)

    Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

    2011-12-01

    Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

  12. Thermomchromic Reaction-Induced Reversible Upconversion Emission Modulation for Switching Devices and Tunable Upconversion Emission Based on Defect Engineering of WO3:Yb3+,Er3+ Phosphor.

    Science.gov (United States)

    Ruan, Jiufeng; Yang, Zhengwen; Huang, Anjun; Zhang, Hailu; Qiu, Jianbei; Song, Zhiguo

    2018-05-02

    Reversible luminescence modulation of upconversion phosphors has the potential applications as photoswitches and optical memory and data storage devices. Previously, the photochromic reaction was extensively used for the realization of reversible luminescence modulation. It is very necessary to develop other approaches such as thermomchromic reaction to obtain the reversible upconversion luminescence modulation. In this work, the WO 3 :Yb 3+ ,Er 3+ phosphors with various colors were prepared at various temperatures, exhibiting tunable upconversion luminescence attributed to the formation of oxygen vacancies in the host. Upon heat treatment in the reducing atmosphere or air, the WO 3 :Yb 3+ ,Er 3+ phosphors show a reversible thermomchromic property. The reversible upconversion luminescence modulation of WO 3 :Yb 3+ ,Er 3+ phosphors was observed based on thermomchromic reaction. Additionally, the upconversion luminescence modulation is maintained after several cycles, indicating its excellent stability. The WO 3 :Yb 3+ ,Er 3+ phosphors with reversible upconversion luminescence and excellent reproducibility have potential applications as the photoswitches and optical memory and data storage devices.

  13. Fiber-Optic Bio-sniffer (Biochemical Gas Sensor) Using Reverse Reaction of Alcohol Dehydrogenase for Exhaled Acetaldehyde.

    Science.gov (United States)

    Iitani, Kenta; Chien, Po-Jen; Suzuki, Takuma; Toma, Koji; Arakawa, Takahiro; Iwasaki, Yasuhiko; Mitsubayashi, Kohji

    2018-02-23

    Volatile organic compounds (VOCs) exhaled in breath have huge potential as indicators of diseases and metabolisms. Application of breath analysis for disease screening and metabolism assessment is expected since breath samples can be noninvasively collected and measured. In this research, a highly sensitive and selective biochemical gas sensor (bio-sniffer) for gaseous acetaldehyde (AcH) was developed. In the AcH bio-sniffer, a reverse reaction of alcohol dehydrogenase (ADH) was employed for reducing AcH to ethanol and simultaneously consuming a coenzyme, reduced form of nicotinamide adenine dinucleotide (NADH). The concentration of AcH can be quantified by fluorescence detection of NADH that was consumed by reverse reaction of ADH. The AcH bio-sniffer was composed of an ultraviolet light-emitting diode (UV-LED) as an excitation light source, a photomultiplier tube (PMT) as a fluorescence detector, and an optical fiber probe, and these three components were connected with a bifurcated optical fiber. A gas-sensing region of the fiber probe was developed with a flow-cell and an ADH-immobilized membrane. In the experiment, after optimization of the enzyme reaction conditions, the selectivity and dynamic range of the AcH bio-sniffer were investigated. The AcH bio-sniffer showed a short measurement time (within 2 min) and a broad dynamic range for determination of gaseous AcH, 0.02-10 ppm, which encompassed a typical AcH concentration in exhaled breath (1.2-6.0 ppm). Also, the AcH bio-sniffer exhibited a high selectivity to gaseous AcH based on the specificity of ADH. The sensor outputs were observed only from AcH-contained standard gaseous samples. Finally, the AcH bio-sniffer was applied to measure the concentration of AcH in exhaled breath from healthy subjects after ingestion of alcohol. As a result, a significant difference of AcH concentration between subjects with different aldehyde dehydrogenase type 2 (ALDH2) phenotypes was observed. The AcH bio-sniffer can be

  14. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Directory of Open Access Journals (Sweden)

    Laurent Dacheux

    2016-07-01

    Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

  15. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Science.gov (United States)

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  16. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito

    2015-05-01

    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  17. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Chemiluminescence from an oxidation reaction of rhodamine B with cerium(IV) in a reversed micellar medium of cetyltrimethylammonium chloride in 1-hexanol-cyclohexane/water.

    Science.gov (United States)

    Hasanin, Tamer H A; Tsunemine, Yusuke; Tsukahara, Satoshi; Okamoto, Yasuaki; Fujiwara, Terufumi

    2011-01-01

    The chemiluminescence (CL) emission, observed when rhodamine B (RB) in 1-hexanol-cyclohexane was mixed with cerium(IV) sulfate in sulfuric acid dispersed in a reversed micellar medium of cetyltrimethylammonium chloride (CTAC) in 1-hexanol-cyclohexane/water, was investigated using a flow-injection system. The CL emission from the oxidation reaction of RB with Ce(IV) was found to be stronger in the CTAC reversed micellar solution compared with an aqueous solution. Bearing on the enhancement effect of the CTAC reverse micelles on the RB-Ce(IV) CL, several studies including stopped-flow, fluorescence and electron spin resonance (ESR) spectrometries were performed. Rapid spectral changes of an intermediate in the RB-Ce(IV) reaction in the aqueous and reversed micellar solutions were successfully observed using a stopped-flow method. The effect of the experimental variables, i.e., oxidant concentration, sulfuric acid concentration, the mole fraction of 1-hexanol, water-to-surfactant molar concentration ratio, flow rate, upon the CL intensity was evaluated. Under the experimental conditions optimized for a flow-injection determination of RB based on the new reversed micellar-mediated CL reaction with Ce(IV), a detection limit of 0.08 µmol dm(-3) RB was achieved, and a linear calibration graph was obtained with a dynamic range from 0.5 to 20 µmol dm(-3). The relative standard deviation (n = 6) obtained at an RB concentration of 3 µmol dm(-3) was 3%.

  19. Relation between the 16O(α,γ)20Ne capture reaction and its reverse 20Ne(γ,α)16O photodisintegration reaction in stars and in the lab

    International Nuclear Information System (INIS)

    Mohr, P.; Angulo, C.; Descouvemont, P.

    2005-01-01

    The astrophysical reaction rates of the 16 O(α,γ) 20 Ne capture reaction and its reverse 20 Ne(γ,α) 16 O photodisintegration reaction are dominated by a few narrow resonances. Only at very low temperatures direct capture plays a significant role. Usually the reaction rate of photodisintegration reactions is calculated from the reaction rate of the corresponding capture reaction using the detailed balanced theorem. This is only valid for nuclei which are thermalized. The reaction rates of the 16 O(α,γ) 20 Ne capture reaction in the lab and under stellar conditions are identical. However, for the inverse 20 Ne(γ,α) 16 O photodisintegration reaction one finds a significant contribution of the thermally populated first excited state at E x = 1634 keV in 20 Ne. Consequently, the reaction rates of the 20 Ne(γ,α) 16 O photodisintegration reaction are different in the lab and under stellar conditions. It is shown that the detailed balance theorem remains valid for the reaction rates under stellar conditions. Photodisintegration rates in the lab have been measured recently using a quasi-thermal photon spectrum from bremsstrahlung, and a quasi-thermal photon spectrum with superior quality has been suggested using high-energy synchrotron radiation. (author)

  20. The Concentration Dependence of the (Delta)s Term in the Gibbs Free Energy Function: Application to Reversible Reactions in Biochemistry

    Science.gov (United States)

    Gary, Ronald K.

    2004-01-01

    The concentration dependence of (delta)S term in the Gibbs free energy function is described in relation to its application to reversible reactions in biochemistry. An intuitive and non-mathematical argument for the concentration dependence of the (delta)S term in the Gibbs free energy equation is derived and the applicability of the equation to…

  1. Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

    NARCIS (Netherlands)

    Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

    2003-01-01

    An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

  2. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  3. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  4. Redox behavior of transition metal ions in zeolites 6. Reversibility of the reduction reaction in silver zeolites

    Energy Technology Data Exchange (ETDEWEB)

    Jacobs, P A; Uytterhoeven, J B; Beyer, H K

    1977-01-01

    Degassing above 573/sup 0/K of Ag-Y or Ag-mordenite previously reduced by hydrogen at 623/sup 0/K resulted in hydrogen evolution, the amount of hydrogen increasing to a maximum at about 873/sup 0/K. No hydrogen was evolved when the zeolite was reduced by hydrazine or hydroxylamine, indicating that hydrogen is formed by reaction between silver metal and hydroxyl groups formed in the reduction step (i.e., the reverse of the reduction step). Consumption of hydroxyl groups was proven by IR studies of pyridine chemisorption which occurs entirely as pyridinium ions on Broensted sites or reduced samples but with increasing formation of pyridine on Lewis acid sites as the degassing temperature increases; formation of silver(I) ions was proven by carbon monoxide complexation. Silver metal outside the zeolite pores was not affected by the degassing, and the amount of hydrogen evolved upon degassing decreased with increasing number of reduction-degassing cycles, probably as a result of dehydroxylation or sintering. Spectra, graphs, tables, and 21 references.

  5. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    Science.gov (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  6. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    Science.gov (United States)

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    Directory of Open Access Journals (Sweden)

    Ji Yeon Kwon

    2013-09-01

    Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

  8. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription.

    Science.gov (United States)

    Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof

    2012-05-15

    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  9. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam

    2015-01-01

    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  10. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  11. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    Directory of Open Access Journals (Sweden)

    Marcos Lázaro Moreli

    2004-10-01

    Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.

  12. I + (H2O)2 → HI + (H2O)OH Forward and Reverse Reactions. CCSD(T) Studies Including Spin-Orbit Coupling.

    Science.gov (United States)

    Wang, Hui; Li, Guoliang; Li, Qian-Shu; Xie, Yaoming; Schaefer, Henry F

    2016-03-03

    The potential energy profile for the atomic iodine plus water dimer reaction I + (H2O)2 → HI + (H2O)OH has been explored using the "Gold Standard" CCSD(T) method with quadruple-ζ correlation-consistent basis sets. The corresponding information for the reverse reaction HI + (H2O)OH → I + (H2O)2 is also derived. Both zero-point vibrational energies (ZPVEs) and spin-orbit (SO) coupling are considered, and these notably alter the classical energetics. On the basis of the CCSD(T)/cc-pVQZ-PP results, including ZPVE and SO coupling, the forward reaction is found to be endothermic by 47.4 kcal/mol, implying a significant exothermicity for the reverse reaction. The entrance complex I···(H2O)2 is bound by 1.8 kcal/mol, and this dissociation energy is significantly affected by SO coupling. The reaction barrier lies 45.1 kcal/mol higher than the reactants. The exit complex HI···(H2O)OH is bound by 3.0 kcal/mol relative to the asymptotic limit. At every level of theory, the reverse reaction HI + (H2O)OH → I + (H2O)2 proceeds without a barrier. Compared with the analogous water monomer reaction I + H2O → HI + OH, the additional water molecule reduces the relative energies of the entrance stationary point, transition state, and exit complex by 3-5 kcal/mol. The I + (H2O)2 reaction is related to the valence isoelectronic bromine and chlorine reactions but is distinctly different from the F + (H2O)2 system.

  13. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  14. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  15. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  16. Lecithin-cholesterol acyltransferase (LCAT) catalyzes transacylation of intact cholesteryl esters. Evidence for the partial reversal of the forward LCAT reaction

    International Nuclear Information System (INIS)

    Sorci-Thomas, M.; Babiak, J.; Rudel, L.L.

    1990-01-01

    Lecithin-cholesterol acyltransferase (LCAT) catalyzes the intravascular synthesis of lipoprotein cholesteryl esters by converting cholesterol and lecithin to cholesteryl ester and lysolecithin. LCAT is unique in that it catalyzes sequential reactions within a single polypeptide sequence. In this report we find that LCAT mediates a partial reverse reaction, the transacylation of lipoprotein cholesteryl oleate, in whole plasma and in a purified, reconstituted system. As a result of the reverse transacylation reaction, a linear accumulation of [3H]cholesterol occurred during incubations of plasma containing high density lipoprotein labeled with [3H]cholesteryl oleate. When high density lipoprotein labeled with cholesteryl [14C]oleate was also included in the incubation the labeled fatty acyl moiety remained in the cholesteryl [14C]oleate pool showing that the formation of labeled cholesterol did not result from hydrolysis of the doubly labeled cholesteryl esters. The rate of release of [3H]cholesterol was only about 10% of the forward rate of esterification of cholesterol using partially purified human LCAT and was approximately 7% in whole monkey plasma. Therefore, net production of cholesterol via the reverse LCAT reaction would not occur. [3H]Cholesterol production from [3H]cholesteryl oleate was almost completely inhibited by a final concentration of 1.4 mM 5,5'-dithiobis(nitrobenzoic acid) during incubation with either purified LCAT or whole plasma. Addition of excess lysolecithin to the incubation system did not result in the formation of [14C]oleate-labeled lecithin, showing that the reverse reaction found here for LCAT was limited to the last step of the reaction. To explain these results we hypothesize that LCAT forms a [14C]oleate enzyme thioester intermediate after its attack on the cholesteryl oleate molecule

  17. Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

    Science.gov (United States)

    Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

    2015-10-01

    The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

  18. Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

    Directory of Open Access Journals (Sweden)

    Boissière-Michot Florence

    2009-04-01

    Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.

  19. Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

    Science.gov (United States)

    Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

    2012-02-01

    Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

  20. Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Faggioli, F; Pasquini, G; Barba, M

    1998-09-01

    The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

  1. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie

    2013-12-01

    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  2. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  3. Exploring M33 Through RR Lyrae Stars

    OpenAIRE

    Pritzl, Barton J.

    2013-01-01

    Recent surveys have detected RR Lyrae stars in M33, the Triangulum Galaxy. These variable stars are excellent tracers of ancient stellar populations. The RR Lyrae stars have been used to estimate metallicities at various locations within M33, as well as determining the distance to the galaxy. A summary of the M33 RR Lyrae stars is presented here as well as an analysis on what their properties imply for the unique M33 galaxy

  4. Influence of polymerisation on the reversibility of low-energy proton exchange reactions by Para-Aminothiolphenol

    NARCIS (Netherlands)

    Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; Van Den Berg, Albert; Olthuis, Wouter; Pascual-García, César

    2017-01-01

    The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used

  5. TR-ESR Investigation on Reaction of Vitamin C with Excited Triplet of 9,10-phenanthrenequinone in Reversed Micelle Solutions

    Science.gov (United States)

    Xu, Xin-sheng; Shi, Lei; Liu, Yi; Ji, Xue-han; Cui, Zhi-feng

    2011-04-01

    Time-resolved electron spin resonance has been used to study quenching reactions between the antioxidant Vitamin C (VC) and the triplet excited states of 9,10-phenanthrenequinone (PAQ) in ethylene glycol-water (EG-H2O) homogeneous and inhomogeneous reversed micelle solutions. Reversed micelle solutions were used to be the models of physiological environment of biological cell and tissue. In PAQ/EG-H2O homogeneous solution, the excited triplet of PAQ (3PAQ*) abstracts hydrogen atom from solvent EG. In PAQ/VC/EG-H2O solution, 3PAQ* abstracts hydrogen atom not only from solvent EG but also from VC. The quenching rate constant of 3PAQ* by VC is close to the diffusion-controlled value of 1.41 × 108 L/(mol ·s). In hexadecyltrimethylammonium bromide (CTAB)/EG-H2O and aerosol OT (AOT)/EG-H2O reversed micelle solutions, 3PAQ* and VC react around the water-oil interface of the reversed micelle. Exit of 3PAQ* from the lipid phase slows down the quenching reaction. For Triton X-100 (TX-100)/EG-H2O reversed micelle solution, PAQ and VC coexist inside the hydrophilic polyethylene glycol core, and the quenching rate constant of 3PAQ* by VC is larger than those in AOT/EG-H2O and CTAB/EG-H2O reversed micelle solutions, even a little larger than that in EG-H2O homogeneous solution. The strong emissive chemically induced dynamic electron polarization of As.- resulted from the effective TM spin polarization transfer in hydrogen abstraction of 3PAQ* from VC.

  6. Effect of reverse Boudouard reaction catalyst on the performance of solid oxide carbon fuel cells integrated with a dry gasifier

    International Nuclear Information System (INIS)

    Kim, Sun-Kyung; Mehran, Muhammad Taqi; Mushtaq, Usman; Lim, Tak-Hyoung; Lee, Jong-Won; Lee, Seung-Bok; Park, Seok-Joo; Song, Rak-Hyun

    2016-01-01

    Highlights: • The addition of K_2CO_3 catalyst in carbon fuel improves the performance of SO-CFC. • Thermal and electrochemical analyses done to elucidate the catalytic enhancement. • Material characterization of SO-CFC performed after long-term degradation test. - Abstract: A solid oxide carbon fuel cell (SO-CFC) integrated with a dry gasifier was operated on activated carbon fuel and the effect of adding a reverse Boudouard gasification catalyst on the performance and long-term operation characteristics of the SO-CFC was investigated. The reactivity of the carbon fuels for the Boudouard gasification reaction was analyzed by a thermal analysis at various operating conditions. The SO-CFC was then operated on gasified fuel gas consisting of CO_2 and CO obtained from the integrated dry gasifier. The SO-CFC operated on activated carbon fuel with 5 wt.% K_2CO_3 achieved a maximum power density of 202, 262, and 271 mW/cm"2 at 750, 800, and 850 °C, respectively; the SO-CFC fueled with activated carbon fuel without a catalyst meanwhile yielded maximum power density of 168 mW/cm"2 at 850 °C. By using electrochemical impedance spectroscopy, the effect of adding the catalyst on the gasification products and subsequently on the performance of the SO-CFC was studied. A long-term degradation test was conducted by continuously operating the SO-CFC at 50 mA/cm"2 for 518 h at 750 °C. During the long-term degradation test, the average degradation rate of the SO-CFC was found to be 183 mV/kh. The post-mortem SEM and XRD analyses of the SO-CFC after the long-term test revealed the presence of carbon deposits and oxidation of Ni at the anode, causing a relatively higher degree of degradation in the SO-CFC integrated with the dry gasifier during the long-term operation. The addition of the K_2CO_3 based dry gasification catalyst significantly enhances the performance of the SO-CFC integrated with dry gasification, but during long-term operation, the degradation rate is found

  7. Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

    2016-11-22

    Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

  8. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  9. NUMERICAL TECHNIQUES TO SOLVE CONDENSATIONAL AND DISSOLUTIONAL GROWTH EQUATIONS WHEN GROWTH IS COUPLED TO REVERSIBLE REACTIONS (R823186)

    Science.gov (United States)

    Noniterative, unconditionally stable numerical techniques for solving condensational anddissolutional growth equations are given. Growth solutions are compared to Gear-code solutions forthree cases when growth is coupled to reversible equilibrium chemistry. In all cases, ...

  10. REACTIONAL STATES IN MULTIBACILLARY HANSEN DISEASE PATIENTS DURING MULTIDRUG THERAPY

    Directory of Open Access Journals (Sweden)

    José A.C. NERY

    1998-11-01

    Full Text Available It is well known that reactions are commonplace occurrences during the course of leprosy disease. Stigmatization may even be attributable to reactions which are also responsible for the worsening of neural lesions. A cohort of 162 newly-diagnosed baciloscopically positive patients from the Leprosy Care Outpatient Clinic of the Oswaldo Cruz Foundation (FIOCRUZ was selected for this study. While 46% of the multibacillary (MB patients submitted to the 24 fixed-dose multidrug therapy (MDT regimen suffered reactions during treatment, it was found that all MBs were susceptible and that constant attention and care were required at all times. Fourteen per cent were classified as BB, 52% as BL, and 33% as LL. None of the variables under study, such as, sex, age, clinical form, length of illness, length of dermatological lesions, baciloscopic index (BI, or degree of disability proved to be associate with reaction among the patients studied. Reversal Reaction (RR occurred in 45%, and Erythema Nodosum Leprosum (ENL occurred in 55%. Among BB patients who developed reactions (15 patients, 93% presented RR; while among the LL patients who developed reactions (34 patients, 91% presented ENL. Likewise, ENL was very frequent among those with disseminate lesions, while RR was most often observed in patients with segmentary lesions. RR was also most likely to occur during the initial months of treatment. It was demonstrated that the recurrence rate of ENL was significantly higher than that of RR. Neither grade of disability nor BI was shown to be associated with RR and ENL reaction. However, the RR rate was significantly higher among patients showing BI 3.Reações são ocorrências comuns no curso da hanseníase e são responsáveis pelo agravamento das lesões neurais. Uma coorte de 162 pacientes recém-diagnosticados, baciloscopicamente positivos, em acompanhamento no Ambulatório de Hanseníase da Fundação Oswaldo Cruz (FIOCRUZ foi selecionada para estudo

  11. Procedures for Decomposing a Redox Reaction into Half-Reaction

    Science.gov (United States)

    Fishtik, Ilie; Berka, Ladislav H.

    2005-01-01

    A simple algorithm for a complete enumeration of the possible ways a redox reaction (RR) might be uniquely decomposed into half-reactions (HRs) using the response reactions (RERs) formalism is presented. A complete enumeration of the possible ways a RR may be decomposed into HRs is equivalent to a complete enumeration of stoichiometrically…

  12. Influence of polymerisation on the reversibility of low-energy proton exchange reactions by Para-Aminothiolphenol.

    Science.gov (United States)

    Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; van den Berg, Albert; Olthuis, Wouter; Pascual-García, César

    2017-11-13

    The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used electrochemical and photo-polymerisation in neutral buffers and plasma polymerisation in air to induce reversible redox states. The chemical stoichiometry and surface coverage of PATP in the polymerized layers were characterized by X-ray photoelectron spectroscopy (XPS), while cyclic voltammetry (CV) was used to measure the charge transfer, double layer capacitance and electrochemical rate of the layers during successive potential cycles. Our results show that the surface coverage of the redox active species is higher on electro-polymerised samples, however, after consecutive cycles all the methods converge to the same charge transfer, while the plasma polymerised samples achieve higher efficiency per molecule and UV polymerised samples have a higher electron transfer rate.

  13. Exploratory urinary metabolomics of type 1 leprosy reactions.

    Science.gov (United States)

    Mayboroda, Oleg A; van Hooij, Anouk; Derks, Rico; van den Eeden, Susan J F; Dijkman, Karin; Khadge, Saraswoti; Thapa, Pratibha; Kunwar, Chhatra B; Hagge, Deanna A; Geluk, Annemieke

    2016-04-01

    Leprosy is an infectious disease caused by Mycobacterium leprae that affects the skin and nerves. Although curable with multidrug therapy, leprosy is complicated by acute inflammatory episodes called reactions, which are the major causes of irreversible neuropathy in leprosy that occur before, during, and even after treatment. Early diagnosis and prompt treatment of reactions reduces the risk of permanent disability. This exploratory study investigated whether urinary metabolic profiles could be identified that correlate with early signs of reversal reactions (RR). A prospective cohort of leprosy patients with and without reactions and endemic controls was recruited in Nepal. Urine-derived metabolic profiles were measured longitudinally. Thus, a conventional area of biomarker identification for leprosy was extended to non-invasive urine testing. It was found that the urinary metabolome could be used to discriminate endemic controls from untreated patients with mycobacterial disease. Moreover, metabolic signatures in the urine of patients developing RR were clearly different before RR onset compared to those at RR diagnosis. This study indicates that urinary metabolic profiles are promising host biomarkers for the detection of intra-individual changes during acute inflammation in leprosy and could contribute to early treatment and prevention of tissue damage. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  15. The influence of the “cage effect” on the mechanism of reversible bimolecular multistage chemical reactions in solutions

    International Nuclear Information System (INIS)

    Doktorov, Alexander B.

    2015-01-01

    Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants

  16. The influence of the "cage effect" on the mechanism of reversible bimolecular multistage chemical reactions in solutions.

    Science.gov (United States)

    Doktorov, Alexander B

    2015-08-21

    Manifestations of the "cage effect" at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a "cage complex." Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the "cage effect" leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.

  17. The influence of the “cage effect” on the mechanism of reversible bimolecular multistage chemical reactions in solutions

    Energy Technology Data Exchange (ETDEWEB)

    Doktorov, Alexander B., E-mail: doktorov@kinetics.nsc.ru [Voevodsky Institute of Chemical Kinetics & Combustion, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)

    2015-08-21

    Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.

  18. NESDIS Blended Rain Rate (RR) Products

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The blended Rain Rate (RR) product is derived from multiple sensors/satellites. The blended products were merged from polar-orbiting and geostationary satellite...

  19. RR Lyrae Stars in M4

    Science.gov (United States)

    Kuehn, Charles A.; Moskalik, Pawel; Drury, Jason A.

    2017-10-01

    Observations by Kepler/K2 have revolutionized the study of RR Lyrae stars by allowing the detection of new phenomna, such as low amplitude additional modes and period doubling, which had not previously been seen from the ground. During campaign 2, K2 observed the globular cluster M4, providiing the first opportunity to study a sizeable group of RR Lyrae stars that belong to a single population; the other RR Lyrae stars that have been observed from space are field stars in the galactic halo and thus belong to an assortment of populations. In this poster we present the results of our study of the RR Lyrae variables in M4 from K2 photometry. We have identified additional, low amplitude pulsation modes in both observed RRc stars. In 3 RRab stars we have found the Blazhko effect with periods of 16.6d, 22.4d, and 44.5d.

  20. RR Lyrae Stars in M4

    Directory of Open Access Journals (Sweden)

    Kuehn Charles A

    2017-01-01

    Full Text Available Observations by Kepler/K2 have revolutionized the study of RR Lyrae stars by allowing the detection of new phenomna, such as low amplitude additional modes and period doubling, which had not previously been seen from the ground. During campaign 2, K2 observed the globular cluster M4, providiing the first opportunity to study a sizeable group of RR Lyrae stars that belong to a single population; the other RR Lyrae stars that have been observed from space are field stars in the galactic halo and thus belong to an assortment of populations. In this poster we present the results of our study of the RR Lyrae variables in M4 from K2 photometry. We have identified additional, low amplitude pulsation modes in both observed RRc stars. In 3 RRab stars we have found the Blazhko effect with periods of 16.6d, 22.4d, and 44.5d.

  1. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

    2012-01-01

    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

  2. Reaction

    African Journals Online (AJOL)

    abp

    19 oct. 2017 ... Reaction to Mohamed Said Nakhli et al. concerning the article: "When the axillary block remains the only alternative in a 5 year old child". .... Bertini L1, Savoia G, De Nicola A, Ivani G, Gravino E, Albani A et al ... 2010;7(2):101-.

  3. Introduction to time reversal theory

    International Nuclear Information System (INIS)

    Henley, E.M.

    1987-01-01

    Theory and reaction mechanisms relevant to time reversal invariance are reviewed. Consequences of time reversal invariance are presented under the headings of CP tests, electromagnetic moments, weak emissions or absorptions, and scattering reactions. 8 refs., 4 figs

  4. Experimental study of line reversal symmetry in the reactions anti pp→π-π+ and π+p→pπ+ at 6 GeV/c

    International Nuclear Information System (INIS)

    Stein, N.A.

    1977-01-01

    The differential cross sections were measured for several two body and quasi-two body baryon exchange scattering channels at 6 GeV/c in a spark chamber-counter experiment utilizing the Brookhaven National Laboratory Multi-Particle Spectrometer. Among these is a comparison study of anti pp→π - π + and its line reversed partner π + p→pπ + in the range t/sub min/ > t > -1.5 (GeV/c) 2 . For the first time structure analogous to the striking dip in the backward elastic scattering reaction at t approx. -0.15 (GeV/c) 2 is observed in the annihilation reaction. The structure which appears as a break in the t slope at t approx. -0.40 (GeV/c) 2 and perhaps a shallow dip at that point, demonstrates the strong role played by absorption in these channels

  5. Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

    1999-01-01

    A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...

  6. PdZnAl Catalysts for the Reactions of Water-Gas-Shift, Methanol Steam Reforming, and Reverse-Water-Gas-Shift

    Energy Technology Data Exchange (ETDEWEB)

    Dagle, Robert A.; Platon, Alexandru; Datye, Abhaya K.; Vohs, John M.; Wang, Yong; Palo, Daniel R.

    2008-03-07

    Pd/ZnO/Al2O3 catalysts were studied for water-gas-shift (WGS), methanol steam reforming, and reverse-water-gas-shift (RWGS) reactions. WGS activity was found to be dependent on the Pd:Zn ratio with a maximum activity obtained at approximately 0.50, which was comparable to that of a commercial Pt-based catalyst. The catalyst stability was demonstrated for 100 hours time-on-stream at a temperature of 3600C without evidence of metal sintering. WGS reaction rates were approximately 1st order with respect to CO concentration, and kinetic parameters were determined to be Ea = 58.3 kJ mol-1 and k0 = 6.1x107 min-1. During methanol steam reforming, the CO selectivities were observed to be lower than the calculated equilibrium values over a range of temperatures and steam/carbon ratios studied while the reaction rate constants were approximately of the same magnitude for both WGS and methanol steam reforming. These results indicate that although Pd/ZnO/Al2O3 are active WGS catalysts, WGS is not involved in methanol steam reforming. RWGS rate constants are on the order of about 20 times lower than that of methanol steam reforming, suggesting that RWGS reaction could be one of the sources for small amount of CO formation in methanol steam reforming.

  7. Silver Nanowire Embedded Colorless Polyimide Heater for Wearable Chemical Sensors: Improved Reversible Reaction Kinetics of Optically Reduced Graphene Oxide.

    Science.gov (United States)

    Choi, Seon-Jin; Kim, Sang-Joon; Jang, Ji-Soo; Lee, Ji-Hyun; Kim, Il-Doo

    2016-09-14

    Optically reduced graphene oxide (ORGO) sheets are successfully integrated on silver nanowire (Ag NW)-embedded transparent and flexible substrate. As a heating element, Ag NWs are embedded in a colorless polyimide (CPI) film by covering Ag NW networks using polyamic acid and subsequent imidization. Graphene oxide dispersed aqueous solution is drop-coated on the Ag NW-embedded CPI (Ag NW-CPI) film and directly irradiated by intense pulsed light to obtain ORGO sheets. The heat generation property of Ag NW-CPI film is investigated by applying DC voltage, which demonstrates unprecedentedly reliable and stable characteristics even in dynamic bending condition. To demonstrate the potential application in wearable chemical sensors, NO 2 sensing characteristic of ORGO is investigated with respect to the different heating temperature (22.7-71.7 °C) of Ag NW-CPI film. The result reveals that the ORGO sheets exhibit high sensitivity of 2.69% with reversible response/recovery sensing properties and minimal deviation of baseline resistance of around 1% toward NO 2 molecules when the temperature of Ag NW-CPI film is 71.7 °C. This work first demonstrates the improved reversible NO 2 sensing properties of ORGO sheets on flexible and transparent Ag NW-CPI film assisted by Ag NW heating networks. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  9. Reverse line blot probe design and polymerase chain reaction optimization for bloodmeal analysis of ticks from the eastern United States.

    Science.gov (United States)

    Scott, M C; Harmon, J R; Tsao, J I; Jones, C J; Hickling, G J

    2012-05-01

    Determining the host preference of vector ticks is vital to elucidating the eco-epidemiology of the diseases they spread. Detachment of ticks from captured hosts can provide evidence of feeding on those host species, but only for those species that are feasible to capture. Recently developed, highly sensitive molecular assays show great promise in allowing host selection to be determined from minute traces of host DNA that persist in recently molted ticks. Using methods developed in Europe as a starting-point, we designed 12S rDNA mitochondrial gene probes suitable for use in a reverse line blot (RLB) assay of ticks feeding on common host species in the eastern United States. This is the first study to use the 12S mitochondrial gene in a RLB bloodmeal assay in North America. The assay combines conventional PCR with a biotin-labeled primer and reverse line blots that can be stripped and rehybridized up to 20 times, making the method less expensive and more straightforward to interpret than previous methods of tick bloodmeal identification. Probes were designed that target the species, genus, genus group, family, order, or class of eight reptile, 13 birds, and 32 mammal hosts. After optimization, the RLB assay correctly identified the current hostspecies for 99% of ticks [Amblyomma americanum (L.) and eight other ixodid tick species] collected directly from known hosts. The method identified previous-host DNA for approximately half of all questing ticks assayed. Multiple bloodmeal determinations were obtained in some instances from feeding and questing ticks; this pattern is consistent with previous RLB studies but requires further investigation. Development of this probe library, suitable for eastern U.S. ecosystems, opens new avenues for eco-epidemiological investigations of this region's tick-host systems.

  10. Photochemical reactions in dehydrated photosynthetic organisms, leaves, chloroplasts and photosystem II particles: reversible reduction of pheophytin and chlorophyll and oxidation of {beta}-carotene

    Energy Technology Data Exchange (ETDEWEB)

    Shuvalov, Vladimir A.; Heber, Ulrich

    2003-11-01

    Photoreactions of dehydrated leaves, isolated broken chloroplasts and PSII membrane fragments of spinach (Spinacia oleracea) were studied at different air humidities and compared with photoreactions of dry fronds of a fern, Polypodium vulgare, and a dry lichen, Parmelia sulcata, which in contrast to spinach are insensitive to photoinactivation in the dry state. Even in very dry air, P700 in the reaction center of photosystem I of dry leaves was oxidized, and the primary quinone acceptor Q{sub A} in the reaction center of photosystem II was photoreduced by low light. These reactions were only very slowly reversed in the dark and saturated under low light intensity. Light-minus-dark difference absorption spectra of the dry leaves, isolated chloroplasts and PSII membrane fragments measured at higher light intensities revealed absorbance changes of {beta}-carotene at 500 nm (light-dependent bleaching) and 980 nm (light-dependent band formation) and bleaching of chlorophyll at 436 and 680 nm with appearance of bands at 450 and 800 nm. Decrease of chlorophyll fluorescence upon strong illumination indicated photoaccumulation of a quencher. All these changes were kinetically related and readily reversible. They are interpreted to show light-induced oxidation of {beta}-carotene (Car) and reduction of chlorophyll-680 (Chl-680) in the reaction center of photosystem II of the dried leaves, chloroplasts and photosystem II particles. The fluorescence quencher was suggested to be Chl-680{sup -} or Car{sup +} in close proximity to P680, the primary electron donor. Appreciable photoaccumulation of reduced pheophytin was only observed in dry leaves after Q{sub A} reduction had been lost during heat treatment of hydrated leaves prior to dehydration. The observations are interpreted to show light-dependent cyclic electron flow within the reaction center of photosystem II in which Chl-680 (or Pheo) is reduced by P680* and Car is oxidized by P680{sup +} with consequent recombination of

  11. Photochemical reactions in dehydrated photosynthetic organisms, leaves, chloroplasts and photosystem II particles: reversible reduction of pheophytin and chlorophyll and oxidation of β-carotene

    International Nuclear Information System (INIS)

    Shuvalov, Vladimir A.; Heber, Ulrich

    2003-01-01

    Photoreactions of dehydrated leaves, isolated broken chloroplasts and PSII membrane fragments of spinach (Spinacia oleracea) were studied at different air humidities and compared with photoreactions of dry fronds of a fern, Polypodium vulgare, and a dry lichen, Parmelia sulcata, which in contrast to spinach are insensitive to photoinactivation in the dry state. Even in very dry air, P700 in the reaction center of photosystem I of dry leaves was oxidized, and the primary quinone acceptor Q A in the reaction center of photosystem II was photoreduced by low light. These reactions were only very slowly reversed in the dark and saturated under low light intensity. Light-minus-dark difference absorption spectra of the dry leaves, isolated chloroplasts and PSII membrane fragments measured at higher light intensities revealed absorbance changes of β-carotene at 500 nm (light-dependent bleaching) and 980 nm (light-dependent band formation) and bleaching of chlorophyll at 436 and 680 nm with appearance of bands at 450 and 800 nm. Decrease of chlorophyll fluorescence upon strong illumination indicated photoaccumulation of a quencher. All these changes were kinetically related and readily reversible. They are interpreted to show light-induced oxidation of β-carotene (Car) and reduction of chlorophyll-680 (Chl-680) in the reaction center of photosystem II of the dried leaves, chloroplasts and photosystem II particles. The fluorescence quencher was suggested to be Chl-680 - or Car + in close proximity to P680, the primary electron donor. Appreciable photoaccumulation of reduced pheophytin was only observed in dry leaves after Q A reduction had been lost during heat treatment of hydrated leaves prior to dehydration. The observations are interpreted to show light-dependent cyclic electron flow within the reaction center of photosystem II in which Chl-680 (or Pheo) is reduced by P680* and Car is oxidized by P680 + with consequent recombination of Car + and Chl-680 - (or Pheo

  12. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  13. First Kepler Results on RR Lyrae Stars

    DEFF Research Database (Denmark)

    Kolenberg, K.; Szabó, R.; Kurtz, D. W.

    2010-01-01

    We present the first results of our analyses of selected RR Lyrae stars for which data have been obtained by the Kepler Mission. As expected, we find a significant fraction of the RRab stars to show the Blazhko effect, a still unexplained phenomenon that manifests itself as periodic amplitude and...

  14. QT/RR Coupling and Gender Differences

    Czech Academy of Sciences Publication Activity Database

    Halámek, Josef; Jurák, Pavel; Lipoldová, J.; Leinveber, Pavel

    2010-01-01

    Roč. 37, - (2010), s. 365-368 ISSN 0276-6574 R&D Projects: GA ČR GA102/08/1129 Institutional research plan: CEZ:AV0Z20650511 Keywords : THEW * QT/RR model * EXPDC Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering http://cinc.mit.edu/archives/2010/pdf/0365.pdf

  15. Radial velocities of RR Lyrae stars

    International Nuclear Information System (INIS)

    Hawley, S.L.; Barnes, T.G. III

    1985-01-01

    283 spectra of 57 RR Lyrae stars have been obtained using the 2.1-m telescope at McDonald Observatory. Radial velocities were determined using a software cross-correlation technique. New mean radial velocities were determined for 46 of the stars. 11 references

  16. Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

    Directory of Open Access Journals (Sweden)

    C Coelho

    2003-06-01

    Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

  17. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    Science.gov (United States)

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

  18. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    Science.gov (United States)

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  19. Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

    Directory of Open Access Journals (Sweden)

    W. Ali

    2017-06-01

    Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

  20. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  1. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Science.gov (United States)

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  2. Enzymatic Synthesis of Highly Fluorescent 8-Azapurine Ribosides Using a Purine Nucleoside Phosphorylase Reverse Reaction: Variable Ribosylation Sites

    Directory of Open Access Journals (Sweden)

    Goran Mikleušević

    2013-10-01

    Full Text Available Various forms of purine-nucleoside phosphorylase (PNP were used as catalysts of enzymatic ribosylation of selected fluorescent 8-azapurines. It was found that the recombinant calf PNP catalyzes ribosylation of 2,6-diamino-8-azapurine in a phosphate-free medium, with ribose-1-phosphate as ribose donor, but the ribosylation site is predominantly N7 and N8, with the proportion of N8/N7 ribosylated products markedly dependent on the reaction conditions. Both products are fluorescent. Application of the E. coli PNP gave a mixture of N8 and N9-substituted ribosides. Fluorescence of the ribosylated 2,6-diamino-8-azapurine has been briefly characterized. The highest quantum yield, ~0.9, was obtained for N9-β-d-riboside (λmax 365 nm, while for N8-β-d-riboside, emitting at ~430 nm, the fluorescence quantum yield was found to be close to 0.4. Ribosylation of 8-azaguanine with calf PNP as a catalyst goes exclusively to N9. By contrast, the E. coli PNP ribosylates 8-azaGua predominantly at N9, with minor, but highly fluorescent products ribosylated at N8/N7.

  3. Development of a quantitative competitive reverse transcriptase polymerase chain reaction for the quantification of growth hormone gene expression in pigs

    Directory of Open Access Journals (Sweden)

    Maurício Machaim Franco

    2003-01-01

    Full Text Available After the advent of the genome projects, followed by the discovery of DNA polymorphisms, basic understanding of gene expression is the next focus to explain the association between polymorphisms and the level of gene expression, as well as to demonstrate the interaction among genes. Among the various techniques for the investigation of transcriptional profiling involving patterns of gene expression, quantitative PCR is the simplest analytical laboratory technique. The objective of this work was to analyze two strategies of a competitive PCR technique for the quantification of the pig growth hormone (GH gene expression. A pair of primers was designed targeting exons 3 and 5, and two competitive PCR strategies were performed, one utilizing a specific amplicon as a competitor, and the other utilizing a low-stringency PCR amplicon as a competitor. The latter strategy proved to be easier and more efficient, offering an accessible tool that can be used in any kind of competitive reaction, facilitating the study of gene expression patterns for both genetics and diagnostics of infectious diseases.

  4. A Near-Infrared Photothermal Effect-Responsive Drug Delivery System Based on Indocyanine Green and Doxorubicin-Loaded Polymeric Micelles Mediated by Reversible Diels-Alder Reaction.

    Science.gov (United States)

    Li, Hui; Li, Junjie; Ke, Wendong; Ge, Zhishen

    2015-10-01

    Near-infrared light (NIR) possesses great advantages for light-responsive controllable drug release, such as deep tissue penetration and low damage to healthy tissues. Herein, a NIR-responsive drug delivery system is developed based on a NIR dye, indocyanine green (ICG), and anticancer drug, doxorubicin (DOX)-loaded thermoresponsive block copolymer micelles, in which the drug release can be controlled via NIR irradiation. First, block copolymers, poly(oligo(ethylene glycol) methacrylate)-block-poly(furfuryl methacrylate) (POEGMA-b-PFMA), are synthesized by sequential reversible addition-fragmentation chain-transfer (RAFT) polymerization, followed by modification with N-octyl maleimide through Diels-Alder (DA) reaction to produce POEGMA-b-POMFMA. The self-assembly of POEGMA-b-POMFMA by nano-precipitation in aqueous solution affords the polymeric micelles which are used to simultaneously encapsulate ICG and DOX. Upon irradiation by NIR light (805 nm), the loaded DOX is released rapidly from the micelles due to partial retro DA reaction and local temperature increase-induced faster drug diffusion by the photothermal effect. Cytotoxicity evaluation and intracellular distribution observation demonstrate significant synergistic effects of NIR-triggered drug release, photothermal, and chemotherapy toward cancer cells under NIR irradiation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Prediction of thermodynamically reversible hydrogen storage reactions utilizing Ca-M(M = Li, Na, K)-B-H systems: a first-principles study.

    Science.gov (United States)

    Guo, Yajuan; Ren, Ying; Wu, Haishun; Jia, Jianfeng

    2013-12-01

    Calcium borohydride is a potential candidate for onboard hydrogen storage because it has a high gravimetric capacity (11.5 wt.%) and a high volumetric hydrogen content (∼130 kg m(-3)). Unfortunately, calcium borohydride suffers from the drawback of having very strongly bound hydrogen. In this study, Ca(BH₄)₂ was predicted to form a destabilized system when it was mixed with LiBH₄, NaBH₄, or KBH₄. The release of hydrogen from Ca(BH₄)₂ was predicted to proceed via two competing reaction pathways (leading to CaB₆ and CaH₂ or CaB₁₂H₁₂ and CaH₂) that were found to have almost equal free energies. Using a set of recently developed theoretical methods derived from first principles, we predicted five new hydrogen storage reactions that are among the most attractive of those presently known. These combine high gravimetric densities (>6.0 wt.% H₂) with have low enthalpies [approximately 35 kJ/(mol(-1) H₂)] and are thermodynamically reversible at low pressure within the target window for onboard storage that is actively being considered for hydrogen storage applications. Thus, the first-principles theoretical design of new materials for energy storage in future research appears to be possible.

  6. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Science.gov (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  7. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

    Science.gov (United States)

    Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

    2000-12-01

    ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

  8. Degradation of microcystin-RR using boron-doped diamond electrode

    International Nuclear Information System (INIS)

    Zhang Chunyong; Fu Degang; Gu Zhongze

    2009-01-01

    Microcystins (MCs), produced by blue-green algae, are one of the most common naturally occurring toxins found in natural environment. The presence of MCs in drinking water sources poses a great threat to people's health. In this study, the degradation behavior of microcystin-RR on boron-doped diamond (BDD) electrode was investigated under galvanostatic conditions. Such parameters as reaction time, supporting electrolyte and applied current density were varied in order to determine their effects on this oxidation process. The experimental results revealed the suitability of electrochemical processes employing BDD electrode for removing MC-RR from the solution. However, the efficient removal of MC-RR only occurred in the presence of sodium chloride that acted as redox mediators and the reaction was mainly affected by the chloride concentration (c NaCl ) and applied current density (I appl ). Full and quick removal of 0.50 μg/ml MC-RR in solution was achieved when the operating conditions of c NaCl and I appl were 20 mM and 46.3 mA/cm 2 , or 35 mM and 18.2 mA/cm 2 respectively. The kinetics for MC-RR degradation followed a pesudo-first order reaction in most cases, indicating the process was under mass transfer control. As a result of its excellent performance, the BDD technology could be considered as a promising alternative to promote the degradation of MC-RR than chlorination in drinking water supplies.

  9. Reversible bulk-phase change of anthroyl compounds for photopatterning based on photodimerization in the molten state and thermal back reaction.

    Science.gov (United States)

    Kihara, Hideyuki; Yoshida, Masaru

    2013-04-10

    As new organic materials for rewritable photopatterning, 2-anthroyl and 9-anthroyl ester compounds were synthesized. Their bulk-phase changes (we use "bulk-phase change" as complete phase change in a mass of a material neither in a surface nor in a small quantity in this study) triggered by photodimerization under melting conditions (melt-photodimerization) and subsequent thermal back reactions were investigated. All the anthroyl compounds exhibited melting points lower than ca. 160 °C, and they were nearly quantitatively converted to the corresponding photodimers by UV irradiation at temperatures of ∼5 °C higher than their respective melting points. We found that there were two kinds of bulk-phase change behaviors through the photoreaction. Two of the anthroyl compounds remained isotropic and lost fluidity during the melt-photodimerization. The obtained photodimers exhibited robust solid-state amorphous phases at room temperature. In contrast, the other three anthroyl compounds showed crystallization during the melt-photodimerization. The resulting photodimers changed from isotropic to crystalline phases, even at high temperature. Various experiments revealed that the bulk phase of the photodimers was affected not by the existence of regioisomers but by their fluidity at the photoirradiation temperature. The latter three photodimers retained enough fluidity, reflecting their high molecular mobilities at the photoirradiation temperature at which the isothermal crystallization occurred. The other two products were not able to crystallize due to low fluidity, resulting in amorphous phases. We also found that all the photodimers reverted to the corresponding monomers by thermal back reaction and recovered their initial photochemical and thermal properties. Using these reversible bulk-phase changes of the anthroyl compounds, we successfully demonstrated rewritable photopatterning in not only negative images but also positive ones, based on the optical contrast

  10. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

    Science.gov (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

    2007-01-01

    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  11. Simultaneous determination of Cr(iii) and Cr(vi) using reversed-phased ion-pairing liquid chromatography with dynamic reaction cell inductively coupled plasma mass spectrometry

    Science.gov (United States)

    Wolf, R.E.; Morrison, J.M.; Goldhaber, M.B.

    2007-01-01

    A method for the simultaneous determination of Cr(iii) and Cr(vi) species in waters, soil leachates and synthetic bio-fluids is described. The method uses reversed-phase ion-pairing liquid chromatography to separate the chromium species and a dynamic reaction cell (DRC??) equipped ICP-MS for detection of chromium. Separation of the chromium species is carried out in less than 2 min. Cr(iii) is complexed with ethylenediaminetetraacetic acid (EDTA) prior to separation by mixing samples with the mobile phase containing 2.0 mM tetrabutylammonium hydroxide (TBAOH), 0.5 mM EDTA (dipotassium salt), and 5% (vol/vol) methanol, adjusted to pH 7.6. The interfering 40Ar 12C+ background peak at mass 52 was reduced by over four orders of magnitude to less than 200 cps by using 0.65 mL min-1 ammonia as a reaction gas and an RPq setting on the DRC of 0.75. Method detection limits (MDLs) of 0.09 ??g L-1 for Cr(iii) and 0.06 ??g L-1 for Cr(vi) were obtained based on peak areas at mass 52 for 50 ??L injections of low level spikes. Reproducibility at 2 ??g L-1 was 3% RSD for 5 replicate injections. The tolerance of the method to various levels of common cations and anions found in natural waters and to matrix constituents found in soil leachates and simulated gastric and lung fluids was tested by performing spike recovery calculations for a variety of samples. ?? The Royal Society of Chemistry.

  12. Nonlinear Convective Models of RR Lyrae Stars

    Science.gov (United States)

    Feuchtinger, M.; Dorfi, E. A.

    The nonlinear behavior of RR Lyrae pulsations is investigated using a state-of-the-art numerical technique solving the full time-dependent system of radiation hydrodynamics. Grey radiative transfer is included by a variable Eddington-factor method and we use the time-dependent turbulent convection model according to Kuhfuss (1986, A&A 160, 116) in the version of Wuchterl (1995, Comp. Phys. Comm. 89, 19). OPAL opacities extended by the Alexander molecule opacities at temperatures below 6000 K and an equation of state according to Wuchterl (1990, A&A 238, 83) close the system. The resulting nonlinear system is discretized on an adaptive mesh developed by Dorfi & Drury (1987, J. Comp. Phys. 69, 175), which is important to provide the necessary spatial resolution in critical regions like ionization zones and shock waves. Additionally, we employ a second order advection scheme, a time centered temporal discretizaton and an artificial tensor viscosity in order to treat discontinuities. We compute fundamental as well first overtone models of RR Lyrae stars for a grid of stellar parameters both with and without convective energy transport in order to give a detailed picture of the pulsation-convection interaction. In order to investigate the influence of the different features of the convection model calculations with and without overshooting, turbulent pressure and turbulent viscosity are performed and compared with each other. A standard Fourier decomposition is used to confront the resulting light and radial velocity variations with recent observations and we show that the well known RR Lyrae phase discrepancy problem (Simon 1985, ApJ 299, 723) can be resolved with these stellar pulsation computations.

  13. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    Science.gov (United States)

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  14. Analysis of phosphorus herbicides by ion-pairing reversed-phase liquid chromatography coupled to inductively coupled plasma mass spectrometry with octapole reaction cell.

    Science.gov (United States)

    Sadi, Baki B M; Vonderheide, Anne P; Caruso, Joseph A

    2004-09-24

    A reversed phase ion-pairing high performance liquid chromatographic (RPIP-HPLC) method is developed for the separation of two phosphorus herbicides, Glufosinate and Glyphosate as well as Aminomethylphosphonic acid (AMPA), the major metabolite of Glyphosate. Tetrabutylammonium hydroxide is used as the ion-pairing reagent in conjunction with an ammonium acetate/acetic acid buffering system at pH 4.7. An inductively coupled plasma mass spectrometer (ICP-MS) is coupled to the chromatographic system to detect the herbicides at m/z = 31P. Historically, phosphorus has been recognized as one of the elements difficult to analyze in argon plasma. This is due to its relatively high ionization potential (10.5 eV) as well as the inherent presence of the polyatomic interferences 14N16O1H+ and 15N16O+ overlapping its only isotope at m/z = 31. An octapole reaction cell is utilized to minimize the isobaric polyatomic interferences and to obtain the highest signal-to-background ratio. Detection limits were found to be in the low ppt range (25-32 ng/l). The developed method is successfully applied to the analysis of water samples collected from the Ohio River and spiked with a standard compounds at a level of 20 microg/l.

  15. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

    Science.gov (United States)

    Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

    2012-01-01

    A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

  16. Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

    Science.gov (United States)

    Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

    2011-07-01

    Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

  17. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  18. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

    2006-01-01

    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  19. Mechanism of the transition from orthorhombic to tetragonal YBa 2Cu 3O 7- x. Investigation of a reversible topotactic reaction in the electron microscope

    Science.gov (United States)

    Müller, J.-H.; Gruehn, R.

    The phase transition from orthorhombic to tetragonal could be observed (in situ) with High-Resolution Transmission Electron Microscopy (HRTEM). In superconducting samples of YBa 2Cu 3O 7- x ( x=0.09) twinned areas were found which changed from orthorhombic to tetragonal symmetry upon electron irradiation parallel to the long c axis. In opposition to annealing experiments the length of the c-axis remained unchanged. The transition was reversible in the high vacuum of the electron microscope. Therefore we surmise that this reaction has no reductive character (no perceptible loss of oxygen). Within the tetragonal structure one can assume a statistical sharing (“disorder”) of oxygen by the metal atoms. The transition could also be explained by a migration of oxygen to the surface. After finishing the irradiation experiment and waiting for several minutes, the oxygen seems to occupy partially ordered positions resulting again in an orthorhombic symmetry. In some cases we could observed transition states of the structural transformation. A schematic model of the mechanism is depicted.

  20. Evaluating viral interference between Influenza virus and Newcastle disease virus using real-time reverse transcription–polymerase chain reaction in chicken eggs

    Directory of Open Access Journals (Sweden)

    Ge Shengqiang

    2012-07-01

    Full Text Available Abstract Background Simultaneous and sequential allantoic cavity inoculations of Specific-pathogen-free (SPF chicken eggs with Influenza virus (AIV and Newcastle disease virus (NDV demonstrated that the interaction of AIV and NDV during co-infection was variable. Our research revisited the replication interference potential of AIV and NDV using real-time reverse transcription–polymerase chain reaction (real-time RT-PCR for AIV and NDV to specifically detect the viral genomes in mixed infections. Results Data from this survey showed that when different doses of NDV (Lasota or F48E8 and AIV (F98 or H5N1 were simultaneously inoculated into embryonating chicken eggs (ECE, interference with the growth of NDV occurred, while interference with the growth of AIV did not occur. When equal amount of the two viruses were sequentially employed, the degree of interference was dependent upon the time of superinfection and the virulence of virus. Conclusion AIV have a negative impact on NDV growth if they are inoculated simultaneously or sequentially and that the degree of interference depended upon the quantity and relative virulence of the virus strains used; however, interference with AIV was not observed. Only if NDV were inoculated at an earlier time will NDV able to interfere with the growth of AIV.

  1. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    Science.gov (United States)

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  2. Simultaneous detection of viruses and Toxoplasma gondii in cerebrospinal fluid specimens by multiplex polymerase chain reaction-based reverse hybridization assay.

    Science.gov (United States)

    Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe

    2009-04-01

    The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.

  3. Chemical kinetics and reaction mechanism

    International Nuclear Information System (INIS)

    Jung, Ou Sik; Park, Youn Yeol

    1996-12-01

    This book is about chemical kinetics and reaction mechanism. It consists of eleven chapters, which deal with reaction and reaction speed on reaction mechanism, simple reaction by rate expression, reversible reaction and simultaneous reaction, successive reaction, complicated reaction mechanism, assumption for reaction mechanism, transition state theory, successive reaction and oscillating reaction, reaction by solution, research method high except kinetics on reaction mechanism, high reaction of kinetics like pulsed radiolysis.

  4. Renewable synthesis-gas-production. Do hydrocarbons in the reactant flow of the reverse water-gas shift reaction cause coke formation?

    Energy Technology Data Exchange (ETDEWEB)

    Wolf, A.; Kern, C.; Jess, A. [Bayreuth Univ. (Germany). Dept. of Chemical Engineering

    2013-11-01

    In a two-step synthetic fuel production process based on carbon dioxide and renewable hydrogen, the best possible selectivity towards liquid hydrocarbons (Hc) shall be implemented. The process consists of a combination of the Reverse Water-Gas Shift reaction and the Fischer-Tropsch synthesis. To achieve this goal, gaseous short-chained Hc from the FTS reactor are recycled in the RWGS unit. In this paper, challenges coming up with the implementation of a recycle loop are discussed. First of all, it has to be examined whether Hc are converted under conditions present in the RWGS reactor. The coking caused by the recycle of Hc is regarded, including thermal coking in the heating zone of the reactor and catalytic coking in the catalyst bed. Coking of course is unwanted, as it deactivates the catalyst. The scope of this work is to find out to which extent and under which conditions gaseous Hc can be recycled. Therefore, experiments were carried out in both, a quartz glass reactor using a commercial Ni-catalyst at ambient pressure and in a pressurized steel reactor (without catalyst) to examine coking during the thermal decomposition of Hc. The catalytic experiments at atmospheric pressure showed that a recycle of CH{sub 4} did not cause coking up to a ratio of CH{sub 4}/CO{sub 2} below one. For these conditions, long term stability was proved. The reaction rates of the CH{sub 4} conversion were below those of the RWGS reaction. However, replacing CH{sub 4} by C{sub 3}H{sub 8} leads to thermal and catalytic coking. Catalytic coking hits the maximum level at about 700 C and decreases for higher temperatures and, thus is not regarded as a problem for the RWGS reactor. In contrast to that, thermal coking raises with higher temperatures, but it can be supressed efficiently with additional injection of H{sub 2}O, which of course shifts the equilibrium towards the undesired reactant side. (orig.)

  5. Reverse 201Tl myocardial redistribution induced by coronary artery spasm

    International Nuclear Information System (INIS)

    Xiang Dingcheng; Yin Jilin; Gong Zhihua; Xie Zhenhong; Zhang Jinhe; Wen Yanfei; Yi Shaodong

    2010-01-01

    Objective: To investigate the mechanism of reverse redistribution (RR) on dipyridamole 201 Tl myocardial perfusion studies in the patients with coronary artery spasm. Methods: Twenty-six patients with coronary artery spasm and presented as RR on dipyridamole 201 Tl myocardial perfusion studies were enlisted as RR group, while other 16 patients with no coronary artery stenosis nor RR were enlisted as control group. Dipyridamole test was repeated during coronary angiography. Corrected thrombolysis in myocardial infarction (TIMI) frame count (CTFC) and TIMI myocardial perfusion grade (TMPG) were measured at RR related and non-RR related coronary arteries before and after dipyridamole infusion respectively. All of the data were analyzed by Student's t-test or χ 2 -test and correlation analysis. Results: Coronary artery angiography showed slower blood flow and lower myocardial perfusion in RR related vessels when compared with non-RR related vessels in RR group, but there was no significant difference among the main coronary arteries in control group. The perfusion defects of RR area at rest were positively related to slower blood velocity at corresponding coronary arteries (r = 0.79, t =10.18, P 0.05). Conclusion: RR is related to the decreased blood flow and myocardial perfusion induced by coronary artery spasm at rest, which may be improved by stress test such as intravenous dipyridamole infusion. (authors)

  6. QT/RR hysteresis as a function of RR excitation – implications for risk

    Czech Academy of Sciences Publication Activity Database

    Halámek, Josef; Jurák, Pavel; Somers, V. K.; Nykodým, J.; Leinveber, P.; Fráňa, P.; Eisenberger, M.; Kára, T.

    2005-01-01

    Roč. 4, č. 1 (2005), s. 98 [World Congress on Heart Disease - New Trends in Research, Diagnosis and Treatment /12./. 16.07.2005-19.07.2005, Vancouver] Institutional research plan: CEZ:AV0Z20650511 Keywords : ventricular repolarization * RR intervals Subject RIV: FA - Cardiovascular Disease s incl. Cardiotharic Surgery

  7. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    Science.gov (United States)

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  8. Development of real-time reverse transcription polymerase chain reaction assays to quantify insulin-like growth factor receptor and insulin receptor expression in equine tissue

    Directory of Open Access Journals (Sweden)

    Stephen B. Hughes

    2013-08-01

    Full Text Available The insulin-like growth factor system (insulin-like growth factor 1, insulin-like growth factor 2, insulin-like growth factor 1 receptor, insulin-like growth factor 2 receptor and six insulin-like growth factor-binding proteins and insulin are essential to muscle metabolism and most aspects of male and female reproduction. Insulin-like growth factor and insulin play important roles in the regulation of cell growth, differentiation and the maintenance of cell differentiation in mammals. In order to better understand the local factors that regulate equine physiology, such as muscle metabolism and reproduction (e.g., germ cell development and fertilisation, real-time reverse transcription polymerase chain reaction assays for quantification of equine insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were developed. The assays were sensitive: 192 copies/µLand 891 copies/µL for insulin-like growth factor 1 receptor, messenger ribonucleic acid and insulin receptor respectively (95%limit of detection, and efficient: 1.01 for the insulin-like growth factor 1 receptor assay and 0.95 for the insulin receptor assay. The assays had a broad linear range of detection (seven logs for insulin-like growth factor 1 receptor and six logs for insulin receptor. This allowed for analysis of very small amounts of messenger ribonucleic acid. Low concentrations of both insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were detected in endometrium, lung and spleen samples, whilst high concentrations were detected in heart, muscle and kidney samples, this was most likely due to the high level of glucose metabolism and glucose utilisation by these tissues. The assays developed for insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid expression have been shown to work on equine tissue and will contribute to the understanding of insulin and insulin-like growth factor 1

  9. Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

    International Nuclear Information System (INIS)

    Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

    1999-01-01

    We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  10. Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform.

    Science.gov (United States)

    Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K

    2016-10-15

     The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV).  The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus.  The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%.  The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  11. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

    Science.gov (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  12. Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

    Science.gov (United States)

    Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

    2014-07-01

    A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines.

  13. Comparison of the Diagnostic Value Between Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Histopathologic Examination in Sentinel Lymph Nodes for Patients With Gastric Carcinoma.

    Science.gov (United States)

    Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung

    2016-05-01

    Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

    Directory of Open Access Journals (Sweden)

    Marilia Farignoli Romeiro

    2016-06-01

    Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  15. Detection of feline coronavirus in cheetah (Acinonyx jubatus) feces by reverse transcription-nested polymerase chain reaction in cheetahs with variable frequency of viral shedding.

    Science.gov (United States)

    Gaffney, Patricia M; Kennedy, Melissa; Terio, Karen; Gardner, Ian; Lothamer, Chad; Coleman, Kathleen; Munson, Linda

    2012-12-01

    Cheetahs (Acinonyx jubatus) are a highly threatened species because of habitat loss, human conflict, and high prevalence of disease in captivity. An epidemic of feline infectious peritonitis and concern for spread of infectious disease resulted in decreased movement of cheetahs between U.S. zoological facilities for managed captive breeding. Identifying the true feline coronavirus (FCoV) infection status of cheetahs is challenging because of inconsistent correlation between seropositivity and fecal viral shedding. Because the pattern of fecal shedding of FCoV is unknown in cheetahs, this study aimed to assess the frequency of detectable fecal viral shedding in a 30-day period and to determine the most efficient fecal sampling strategy to identify cheetahs shedding FCoV. Fecal samples were collected from 16 cheetahs housed at seven zoological facilities for 30 to 46 consecutive days; the samples were evaluated for the presence of FCoV by reverse transcription-nested polymerase chain reaction (RT-nPCR). Forty-four percent (7/16) of cheetahs had detectable FCoV in feces, and the proportion of positive samples for individual animals ranged from 13 to 93%. Cheetahs shed virus persistently, intermittently, or rarely over 30-46 days. Fecal RT-nPCR results were used to calculate the probability of correctly identifying a cheetah known to shed virus given multiple hypothetical fecal collection schedules. The most efficient hypothetical fecal sample collection schedule was evaluation of five individual consecutive fecal samples, resulting in a 90% probability of identifying a known shedder. Demographic and management risk factors were not significantly associated (P cheetahs shed virus intermittently to rarely, fecal sampling schedules meant to identify all known shedders would be impractical with current tests and eradication of virus from the population unreasonable. Managing the captive population as endemically infected with FCoV may be a more feasible approach.

  16. Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior

    Science.gov (United States)

    Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

    2011-01-01

    Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

  17. Pressure drop in ET-RR-1

    International Nuclear Information System (INIS)

    Khattab, M.; Mina, A.R.

    1990-01-01

    Measurements of pressure drop through a bundle comprising 16 rods and their lower arrangement grid as well as orifices similar to those of ET-RR-1 core have been done. Experiments are carried out under adiabatic turbulent flow conditions at about 35 degree C. Bundle Reynolds number range is 4 x 10 -2 x 10. Orifices of diameters 4.5, 3.25 or 2.5 cm. are mounted underneath the bundle. The bundle and lower grid pressure drop coefficients are 3.75 and 1.8 respectively. Orifices pressure drop coefficients are 2.65, 19.67 and 53.55 respectively. The ratio of bundle pressure drop to that of 4.5 cm. Orifice diameter is 1.415. The pressure drop coefficients are utilizer to calculate flow through bundles. The flow rate per bundle is 39.1, 20.4 or 13.1 m 3 /hr. Depending on orifice diameter

  18. Reverse redistribution on planar thallium scintigraphy: relationship to resting thallium uptake and long-term outcome

    International Nuclear Information System (INIS)

    Dey, H.M.; Soufer, R.

    1995-01-01

    Reverse redistribution (RR) of thallium-201 has been associated with both acute and healed myocardial infarction, and with recent thrombolysis. The physiologic basis for RR in coronary artery disease (CAD) is unclear but may be related to an admixture of viable and scarred myocardium within the RR segment. We performed thallium reinjection imaging at rest to better characterize RR defects in patients with chronic CAD. We found enhanced uptake of 201 Tl in 52% of RR segments after reinjection, consistent with significant regional viability that was not evident on redistribution images. We then used a logistic multiple regression analysis to determine whether RR alone or in combination with other scintigraphic findings could predict patient outcome. The results showed that severe RR was an independent predictor of patient outcome. We conclude that RR may have prognostic significance in chronic CAD. (orig.)

  19. RR-Interval variance of electrocardiogram for atrial fibrillation detection

    Science.gov (United States)

    Nuryani, N.; Solikhah, M.; Nugoho, A. S.; Afdala, A.; Anzihory, E.

    2016-11-01

    Atrial fibrillation is a serious heart problem originated from the upper chamber of the heart. The common indication of atrial fibrillation is irregularity of R peak-to-R-peak time interval, which is shortly called RR interval. The irregularity could be represented using variance or spread of RR interval. This article presents a system to detect atrial fibrillation using variances. Using clinical data of patients with atrial fibrillation attack, it is shown that the variance of electrocardiographic RR interval are higher during atrial fibrillation, compared to the normal one. Utilizing a simple detection technique and variances of RR intervals, we find a good performance of atrial fibrillation detection.

  20. Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

    DEFF Research Database (Denmark)

    Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo

    2011-01-01

    and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without modifications......The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT...

  1. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

    Science.gov (United States)

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

    2003-01-01

    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

  2. Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

    Science.gov (United States)

    Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

    2008-05-20

    Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

  3. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill.

    Science.gov (United States)

    de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G

    2010-09-20

    Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression

  4. Detection of influenza viruses by coupling multiplex reverse-transcription loop-mediated isothermal amplification with cascade invasive reaction using nanoparticles as a sensor

    Directory of Open Access Journals (Sweden)

    Ge Y

    2017-04-01

    Full Text Available Yiyue Ge,1 Qiang Zhou,2 Kangchen Zhao,1 Ying Chi,1 Bin Liu,3 Xiaoyan Min,4 Zhiyang Shi,1 Bingjie Zou,2 Lunbiao Cui1 1Institute of Pathogenic Microbiology, Key Laboratories of Enteric Pathogenic Microbiology (Ministry of Health, Jiangsu Provincial Center for Disease Control and Prevention, 2Department of Pharmacology, Jinling Hospital, Medical School of Nanjing University, 3Department of Biomedical Engineering, Nanjing Medical University, 4Department of Geriatrics, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu, People’s Republic of China Abstract: Influenza virus infections represent a worldwide public health and economic problem due to the significant morbidity and mortality caused by seasonal epidemics and pandemics. Sensitive and convenient methodologies for detection of influenza viruses are essential for further disease control. Loop-mediated isothermal amplification (LAMP is the most commonly used method of nucleic acid isothermal amplification. However, with regard to multiplex LAMP, differentiating the ladder-like LAMP products derived from multiple targets is still challenging today. The requirement of specialized instruments has further hindered the on-site application of multiplex LAMP. We have developed an integrated assay coupling multiplex reverse transcription LAMP with cascade invasive reaction using nanoparticles (mRT-LAMP-CIRN as a sensor for the detection of three subtypes of influenza viruses: A/H1N1pdm09, A/H3 and influenza B. The analytic sensitivities of the mRT-LAMP-CIRN assay were 101 copies of RNA for both A/H1N1pdm09 and A/H3, and 102 copies of RNA for influenza B. This assay demonstrated highly specific detection of target viruses and could differentiate them from other genetically or clinically related viruses. Clinical specimen analysis showed the mRT-LAMP-CIRN assay had an overall sensitivity and specificity of 98.3% and 100%, respectively. In summary, the mRT-LAMP-CIRN assay is

  5. Utility of a multiplex reverse transcriptasepolymerase chain reaction assay (HemaVision in the evaluation of genetic abnormalities in Korean children with acute leukemia: a single institution study

    Directory of Open Access Journals (Sweden)

    Hye-Jin kim

    2013-06-01

    Full Text Available &lt;b&gt;Purpose:&lt;/b&gt; In children with acute leukemia, bone marrow genetic abnormalities (GA have prognostic significance, and may be the basis for minimal residual disease monitoring. Since April 2007, we have used a multiplex reverse transcriptase-polymerase chain reaction tool (HemaVision to detect of GA. &lt;b&gt;Methods:&lt;/b&gt; In this study, we reviewed the results of HemaVision screening in 270 children with acute leukemia, newly diagnosed at The Catholic University of Korea from April 2007 to December 2011, and compared the results with those of fluorescence in situ hybridization (FISH, and G-band karyotyping. &lt;b&gt;Results:&lt;/b&gt; Among the 270 children (153 males, 117 females, 187 acute lymphoblastic leukemia and 74 acute myeloid leukemia patients were identified. Overall, GA was detected in 230 patients (85.2%. HemaVision, FISH, and G-band karyotyping identified GA in 125 (46.3%, 126 (46.7%, and 215 patients (79.6%, respectively. TEL-AML1 (20.9%, 39/187 and AML1-ETO (27%, 20/74 were the most common GA in ALL and AML, respectively. Overall sensitivity of HemaVision was 98.4%, with false-negative results in 2 instances: 1 each for TEL-AML1 and MLL-AF4 . An aggregate of diseasesspecific FISH showed 100% sensitivity in detection of GA covered by HemaVision for actual probes utilized. G-band karyotype revealed GA other than those covered by HemaVison screening in 133 patients (49.3%. Except for hyperdiplody and hypodiploidy, recurrent GA as defined by the World Health Organizationthat were not screened by HemaVision, were absent in the karyotype. &lt;b&gt;Conclusion:&lt;/b&gt; HemaVision, supported by an aggregate of FISH tests for important translocations, may allow for accurate diagnosis of GA in Korean children with acute leukemia.

  6. Reverse transcription quantitative real-time polymerase chain reaction reference genes in the spared nerve injury model of neuropathic pain: validation and literature search.

    Science.gov (United States)

    Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R

    2013-07-10

    The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process

  7. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    Science.gov (United States)

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Reverse Algols

    Science.gov (United States)

    Leung, K. C.

    1989-01-01

    Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.

  9. RR Lyrae and BL Herculis variables

    International Nuclear Information System (INIS)

    Cox, A.N.

    1980-01-01

    The RR Lyrae variables are currently believed to have masses between about 0.5 and 0.8 M/sub solar mass/, effective surface temperatures between 6350 and 7500 0 K, radii from about 4.0 to 6.0 R/sub solar mass/ and luminosities between log L/L/sub solar mass/ of 1.5 and 2.0. Since they are found in population II locations, they generally have Y = 0.3 and Z = 10 -3 , but there are exceptions for both higher Z like the sun and lower Z like 0.0002. In globular clusters the periods range from 0.25 to 0.45 day for the first overtone pulsators and 0.40 to 0.80 day for those in the fundamental mode, depending on their luminosity. At transition lines, discussed in detail, the switch from fundamental to first overtone, or maybe vice versa, involves a period change factor of about 0.74 to 0.75

  10. Reverse Logistics

    OpenAIRE

    Kulikova, Olga

    2016-01-01

    This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...

  11. The influence of the "cage" effect on the mechanism of reversible bimolecular multistage chemical reactions proceeding from different sites in solutions.

    Science.gov (United States)

    Doktorov, Alexander B

    2016-08-28

    Manifestations of the "cage" effect at the encounters of reactants have been theoretically treated on the example of multistage reactions (including bimolecular exchange reactions as elementary stages) proceeding from different active sites in liquid solutions. It is shown that for reactions occurring near the contact of reactants, consistent consideration of quasi-stationary kinetics of such multistage reactions (possible in the framework of the encounter theory only) can be made on the basis of chemical concepts of the "cage complex," just as in the case of one-site model described in the literature. Exactly as in the one-site model, the presence of the "cage" effect gives rise to new channels of reactant transformation that cannot result from elementary event of chemical conversion for the given reaction mechanism. Besides, the multisite model demonstrates new (as compared to one-site model) features of multistage reaction course.

  12. Reverse Osmosis

    Indian Academy of Sciences (India)

    many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...

  13. Spectral of electrocardiographic RR intervals to indicate atrial fibrillation

    Science.gov (United States)

    Nuryani, Nuryani; Satrio Nugroho, Anto

    2017-11-01

    Atrial fibrillation is a serious heart diseases, which is associated on the risk of death, and thus an early detection of atrial fibrillation is necessary. We have investigated spectral pattern of electrocardiogram in relation to atrial fibrillation. The utilized feature of electrocardiogram is RR interval. RR interval is the time interval between a two-consecutive R peaks. A series of RR intervals in a time segment is converted to a signal with a frequency domain. The frequency components are investigated to find the components which significantly associate to atrial fibrillation. A segment is defined as atrial fibrillation or normal segments by considering a defined number of atrial fibrillation RR in the segment. Using clinical data of 23 patients with atrial fibrillation, we find that the frequency components could be used to indicate atrial fibrillation.

  14. Genetic divergence of roundup ready (RR) soybean cultivars ...

    African Journals Online (AJOL)

    The aim of this study was to estimate the genetic diversity in 74 RR soybean cultivars from different Brazilian breeding programs. ... chosen SSR markers were effective in assessing the genetic diversity among genotypes, besides proving to be ...

  15. Studying RR Lyrae Stars in M4 with K2

    Science.gov (United States)

    Kuehn, Charles A.; Drury, Jason; Moskalik, Pawel

    2017-01-01

    Observations by Kepler/K2 have revolutionized the study of RR Lyrae stars by allowing the detection of new phenomena, such as low amplitude additional modes and period doubling, which had not previously been seen from the ground. During its campaign 2, K2 observed the globular cluster M4, providing the first opportunity to study a sizeable group of RR Lyrae stars that belong to a single population; the other RR Lyrae stars that have been observed from space are field stars in the galactic halo and thus belong to an assortment of populations. We present the results of our study of the RR Lyrae variables in M4 from K2 photometry. We have identified additional, low amplitude pulsation modes in the two observed RRc stars. In three RRab stars we have found the Blazhko effect with periods of 16.6 days, 22.4 days, and 44.5 days.

  16. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    Science.gov (United States)

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  17. Contamination of RR Lyrae stars from Binary Evolution Pulsators

    Science.gov (United States)

    Karczmarek, Paulina; Pietrzyński, Grzegorz; Belczyński, Krzysztof; Stępień, Kazimierz; Wiktorowicz, Grzegorz; Iłkiewicz, Krystian

    2016-06-01

    Binary Evolution Pulsator (BEP) is an extremely low-mass member of a binary system, which pulsates as a result of a former mass transfer to its companion. BEP mimics RR Lyrae-type pulsations but has different internal structure and evolution history. We present possible evolution channels to produce BEPs, and evaluate the contamination value, i.e. how many objects classified as RR Lyrae stars can be undetected BEPs. In this analysis we use population synthesis code StarTrack.

  18. Detection of infectious bursal disease virus in various lymphoid tissues of experimentally infected specific pathogen free chickens by different reverse transcription polymerase chain reaction assays

    DEFF Research Database (Denmark)

    Kabell, Susanne; Handberg, Kurt; Kusk, Mette

    2005-01-01

    Infectious bursal disease (IBD) is a worldwide distributed immunosuppressive viral disease in young chickens, controlled by vaccination. Emergence of several strains of IBD virus (IBDV) has created a demand for strain-specific diagnostic tools. In the present experiment, five different reverse...... included vaccine strain D78, classical strain Faragher 52/70, and the very virulent Danish strain DK01 The presence of the virus infection was confirmed by histopathologic evaluation of bursa lesions. The largest number of positive samples was obtained with a strain-specific two-step multiplex (MPX) RT...

  19. Synthesis of a Self-Healing Polymer Based on Reversible Diels-Alder Reaction: An Advanced Undergraduate Laboratory at the Interface of Organic Chemistry and Materials Science

    Science.gov (United States)

    Weizman, Haim; Nielsen, Christian; Weizman, Or S.; Nemat-Nasser, Sia

    2011-01-01

    This laboratory experiment exposes students to the chemistry of self-healing polymers based on a Diels-Alder reaction. Students accomplish a multistep synthesis of a monomer building block and then polymerize it to form a cross-linked polymer. The healing capability of the polymer is verified by differential scanning calorimetry (DSC) experiments.…

  20. Gauging the Galactic thick disk with RR Lyrae stars

    Directory of Open Access Journals (Sweden)

    Cruz G.

    2012-02-01

    Full Text Available In this contribution we present results from the QUEST RR Lyrae Survey of the thick disk. The survey spans ~480 sq. deg. at low latitude |b| < 30°, with multi-epoch VRI observations, obtained with the QUEST-I camera at the 1m Jürgen Stock Schmidt telescope located at the National Astronomical Observatory of Venezuela. This constitutes the first deep RR Lyrae survey of the Galactic thick disk conducted at low galactic latitudes, covering simultaneously a large range in radial (8RR Lyrae stars having accurate distances (errors <7% and individual reddenings derived from each star’s color curve at minimum light. Moreover, the use of RR Lyrae stars as tracers ensures negligible contamination from the Galactic thin disk. We find a thick disk mean scale height hZ = 0.94 ± 0.11kpc and scale length hR = 3.2 ± 0.4kpc, derived from the vertical and radial mean density profiles of RR Lyrae stars. We also find evidence of thick disk flaring and results that may suggest the thick disk radial density profile shows signs of antitruncation. We discuss our findings in the context of recent thick disk formation models.

  1. Simplified mathematical model for heat supply and removal with allowance for chemical reaction kinetics in the N2O4 reversible 2NO2 reversible 2NO + O2 system

    International Nuclear Information System (INIS)

    Shiryaeva, N.M.

    1977-01-01

    The processes of heat supply and removal with chemical reactions proceeding in the circuit are usually described by a set of nonlinear ordinary differential equations. Considering a non-equilibrium state of a chemically reacting gas relative to equilibrium, to which the nonequilibrium system approaches according to a certain process and applying the Tailor series expansion near this equilibrium point, a set of differential equations can be reduced to one differential and some algebraic equations. The analysis shows that of the differential equation obtained can be quasilinearized, and then the linear differential equation can be solved. On the basis of the analytical solutions obtained the calculations of flow parameters have been performed for the cases of cooling and heating the dissociating coolant in channels of a constant cross-section at various pressures. The calculation results are in a satisfactory agreement with the numerical solution of a set of differential equations performed on the ''Minsk-22'' computer. The solution may be applied to calculate isobaric processes in thermodynamic cycles, where the N 2 O 4 coolant is used

  2. A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity.

    Science.gov (United States)

    Li, An; Ziehr, Jessica L; Johnson, Kenneth A

    2017-04-21

    Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. RR lyrae variable pulsations and the Oosterhoff groups

    International Nuclear Information System (INIS)

    Cox, A.N.

    1981-01-01

    It is concluded that Oosterhoff group I clusters have 0.55 M/sub sun/ stars and group II clusters have 0.65 M/sub sun/ stars. The Y value is always about 0.29. Mean log L/L/sub sun/ values are 1.66 and 1.78 giving M/sub bol/ = 0.60 and 0.30 for the RR Lyrae variables in these two groups of clusters. For field RR Lyrae variables at M = approx. 0.5 M/sub sun/ or less, perhaps M/sub bol/ = 0.90 or even larger as Clube and Jones propose. Apparently all evolution is blueward for RR Lyrae variables, and the color overlap of F and 1H pulsators is not real

  4. The globular cluster ω Centauri and its RR Lyrae variables

    International Nuclear Information System (INIS)

    Dickens, R.J.

    1989-07-01

    The significance of some of the unusual characteristics of the globular cluster ωCentauri in various fundamental problems is explored. Interest is centred on the properties of the cluster RR Lyraes, and what they can contribute to studies of early cluster chemical enrichment, stellar pulsation, the distance scale, stellar evolution, stellar ages and the Oosterhoff period-shift problem. This article, which is intended to highlight problems and progress rather than give a comprehensive review, includes new results based on photometry of the RR Lyraes, red giants, subgiants, horizontal-branch and main sequence stars in the cluster. (author)

  5. Period Changes of 23 Field RR Lyrae Stars

    Directory of Open Access Journals (Sweden)

    Soo-Chang Rey

    1994-12-01

    Full Text Available The secular period behavior of 23 field RR Lyrae stars is studied in order to determine if the observed period changes could be attributed, at least in the mean, to stellar evolution. The sample of stars is subdivided into two Oosterhoff groups based on the metallicity and period-shift. Despite the small sample size, we found a distinct bias toward positive period changes in the group variables. The period changes of the group variables in globular clusters. This provides yet another support for the Lee, Demarque, and Zinn(1990 evolutionary models of RR Lyrae stars and their explanation of the Sandage period-shift effect.

  6. Steam in RR Telescopii and Henize 2-38

    Energy Technology Data Exchange (ETDEWEB)

    Allen, D A [Anglo-Australian Observatory, Epping (Australia); Beattie, D H; Lee, T J; Stewart, J M; Williams, P M

    1978-03-01

    Low-resolution scans in the 1.9-2.6..mu..m atmospheric window reveal steam (H/sub 2/O) and CO adsorption bands in the spectra of the symbiotic stars RR Tel and He 2-38. The steam absorption in RR Tel is particularly intense while the CO is weak, implying the presence in the system of a Mira variable seen near minimum light. In He 2-38 the steam band is weaker while the CO is stronger, as expected for a Mira seen near maximum.

  7. Amplitude analysis of Y*(1385) production in the line-reversed reactions: π+p → K+Y*(1385) and K-p → π-Y*(1385) at 7 and 11.5 GeV/c

    International Nuclear Information System (INIS)

    Ballam, J.; Bouchez, J.; Carroll, J.T.

    1978-08-01

    For the first time in one detector measurements were made of the complete decay angular distribution on Y* → Λπ, Λ → pπ - in the two line-reversed reactions: π + p → K + Y*(1385) and K - p → π - Y*(1385). The experiment was conducted in the SLAC 1 m rapid cycling bubble chamber (15 Hertz) triggered by electronic detectors and an online algorithm. The extended maximum likelihood method was used to obtain the transversity amplitudes of the Y *(1385). Results are in good agreement with both the quark model and Stodolsky-Sakurai model predictions. Finite helicity nonflip contributions at the Y*vertex observed in these data can be associated with double quark scattering in the forward direction. 15 references

  8. Menopause, hormone replacement and RR and QT modulation during sleep

    Czech Academy of Sciences Publication Activity Database

    Lanfranchi, P. A.; Gosselin, N.; Kára, T.; Jurák, Pavel; Somers, V. K.; Denesle, R.; Petit, D.; Carrier, J.; Nadeau, R.; Montplaisir, J.

    2005-01-01

    Roč. 6, č. 6 (2005), s. 561-566 ISSN 1389-9457 R&D Projects: GA ČR(CZ) GA102/05/0402 Keywords : Sleep * Menopause * RR interval * QT interval * Gender * Hormones Subject RIV: FS - Medical Facilities ; Equipment Impact factor: 2.711, year: 2005

  9. THE RR LYRAE VARIABLES AND HORIZONTAL BRANCH OF NGC 6656 (M22) {sup ,}

    Energy Technology Data Exchange (ETDEWEB)

    Kunder, Andrea; Walker, Alistair R.; Paredes Alvarez, Leonardo [Cerro Tololo Inter-American Observatory, Casilla 603, La Serena (Chile); Stetson, Peter B. [Dominion Astrophysical Observatory, NRC-Herzberg, National Research Council, Victoria BC, V9E 2E7 (Canada); Cassisi, Santi [INAF-Osservatorio Astronomico di Collurania, Via M. Maggini, I-64100 Teramo (Italy); Layden, Andrew [Bowling Green State University, Bowling Green, OH 43403 (United States); Bono, Giuseppe [Dipartimento di Fisica, Universita di Roma Tor Vergata, Rome (Italy); Catelan, Márcio [Pontificia Universidad Católica de Chile, Departamento de Astronomía y Astrofísica, Av. Vicuña Mackenna 4860, 782-0436 Macul, Santiago (Chile); Clem, James L. [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, LA 70803-4001 (United States); Matsunaga, Noriyuki [Department of Astronomy, School of Science, The University of Tokyo (Japan); Salaris, Maurizio [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom); Lee, Jae-Woo [Korea Astronomy and Space Science Institute, Daejeon 305-348 (Korea, Republic of); Chaboyer, Brian, E-mail: akunder@ctio.noao.edu, E-mail: mcatelan@astro.puc.cl [Department of Physics and Astronomy, Dartmouth College, Hanover, NH 03755 (United States)

    2013-11-01

    The first calibrated broadband UBVI time-series photometry is presented for the RR Lyrae variable stars in NGC 6656 (M22), with observations spanning a range of 22 years. We have also redetermined the variability types and periods for the RR Lyrae stars identified previously by photographic observations, revising the number of fundamental-mode RR Lyrae variables (RR0) to 10 and the number of first-overtone variables (RR1) to 16. The mean periods of the RR0 and RR1 variables are (P) {sub RR0} = 0.66 ± 0.02 days and (P) {sub RR1} = 0.33 ± 0.01 days, respectively, supporting an Oosterhoff II classification for the cluster. The number ratio of RR1-type to all RR-type variables is N {sub 1}/N{sub RR} = 0.61, also consistent with an Oosterhoff II designation. Both the RR Lyrae stars' minimum light colors and the blue edge of the RR Lyrae instability strip suggest E( B – – V) = 0.36 ± 0.02 mag toward M22. Regarding the HB morphology of M22, we find (B-R)/(B+V+R) = +0.97 ± 0.1 and at least one ''gap'' located in an unusual part of the blue HB, in the middle of the so-called hot HB stars.

  10. Adsorção dos corantes RO16, RR2 e RR141 utilizando lodo residual da indústria têxtil Adsorption of dyes RO16, RR2 and RR141 using residual sludge of textile industry

    Directory of Open Access Journals (Sweden)

    Andressa Regina Vasques

    2011-09-01

    Full Text Available A adsorção é uma das técnicas empregadas com sucesso para remoção efetiva da cor presente em efluentes têxteis. Com o objetivo de avaliar os diferentes parâmetros adsortivos, bem como determinar a eficiência de um adsorvente alternativo desenvolvido a partir de lodo residual têxtil na remoção de corantes, foram determinadas curvas de cinética de adsorção e isotermas. Por meio dos dados cinéticos e de equilíbrio obtidos, verificou-se que a 25ºC a adsorção foi favorável para todos os corantes, sendo esta a melhor condição para os corantes RO16 e RR2 na ausência de sais. Para o corante RR141, a adição de NaCl aumentou a capacidade de adsorção do adsorvente no equilíbrio e a adição de Na2SO4 favoreceu a adsorção para o corante RO16, ao contrário do que se observou para os outros dois corantes. A quantidade máxima de corante adsorvida por unidade de massa de adsorvente (q max nas melhores condições adsortivas para os corantes RO16, RR2 e RR141 foi de 81,30, 53,48 e 78,74 mg.g-1, respectivamente.The adsorption is one of the techniques that have been successfully used for effective removal of the dyes present in textile effluents. With the objective to evaluate the different adsorptive parameters, as well as determining the efficiency of one alternative adsorbent in the removal of dyes, kinetics and equilibrium data of adsorption were determined. By the kinetic data and of equilibrium, it was verified that the adsorption was favorable for all the dyes in 25ºC, being the best condition for the dye RO16 and RR2 in the total absence of salt. For the dye RR141, the addition of NaCl increased the adsorption capacity of adsorbent in the equilibrium and the addition of Na2SO4 favored the adsorption for the dye RO16, in contrast to what was observed for the two other dyes. The maximum quantity of dye adsorbed per unit mass of adsorbent (q max in the best adsorptive conditions for the dyes RO16, RR2 and RR141 was of 81

  11. RR LYRAE ATMOSPHERICS: WRINKLES OLD AND NEW. A PREVIEW

    International Nuclear Information System (INIS)

    Preston, George W.

    2011-01-01

    I report some results of an echelle spectroscopic survey of RR Lyrae stars begun in 2006 that I presented in my Henry Norris Lecture of 2010 January 4. Topics include (1) atmospheric velocity gradients, (2) phase-dependent envelope turbulence as it relates to Peterson's discoveries of axial rotation on the horizontal branch and to Stothers' explanation of the Blazhko effect, (3) the three apparitions of hydrogen emission during a pulsation cycle, (4) the occurrence of He I lines in emission and absorption, (5) detection of He II emission and metallic line doubling in Blazhko stars, and finally (6) speculation about what helium observations of RR Lyrae stars in omega Centauri might tell us about the putative helium populations and the horizontal branch of that strange globular cluster.

  12. Measurement and theory of turbulence in RR Lyrae

    International Nuclear Information System (INIS)

    Benz, W.; Stellingwerf, R.F.

    1985-01-01

    CORAVEL observations of time-dependent turbulence in RR Lyrae are presented. Variation in the width of the mean velocity correlation function implies turbulent velocities that peak at 10 to 15 km/sec for a brief interval of phase near minimum radius. Comparison with a nonlinear pulsation model shows that these amplitudes of the turbulent velocity are expected near the hydrogen ionization zone, again only near minimum radius

  13. Flow distribution in ET-RR-1 core

    International Nuclear Information System (INIS)

    Khattab, M.; Mina, A.R.

    1989-01-01

    In nuclear reactors the flow may be arranged through individual bundles by orifices to achieve better thermal performance. A model based on constant pressure drop across different core regions is developed to determine the flow distribution in reactor core. The friction and grids in the bundles as well as the orifices diameters have an influence on modifying the flow distribution. The application of the proposed model on ET-RR-1 gives reasonable prediction of flow distribution

  14. DISTANCE SCALE ZERO POINTS FROM GALACTIC RR LYRAE STAR PARALLAXES

    Energy Technology Data Exchange (ETDEWEB)

    Benedict, G. Fritz; McArthur, Barbara E.; Barnes, Thomas G. [McDonald Observatory, University of Texas, Austin, TX 78712 (United States); Feast, Michael W. [Centre for Astrophysics, Cosmology and Gravitation, Astronomy Department, University of Cape Town, Rondebosch 7701 (South Africa); Harrison, Thomas E. [Department of Astronomy, New Mexico State University, Las Cruces, NM 88003 (United States); Bean, Jacob L.; Kolenberg, Katrien [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Menzies, John W.; Laney, C. D. [South African Astronomical Observatory, Observatory 7935 (South Africa); Chaboyer, Brian [Department of Physics and Astronomy, Dartmouth College, Hanover, NH 03755 (United States); Fossati, Luca [Department of Physics and Astronomy, Open University, Milton Keynes MK7 6AA (United Kingdom); Nesvacil, Nicole [Institute of Astronomy, University of Vienna, A-1180 Vienna (Austria); Smith, Horace A. [Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824 (United States); Kochukhov, Oleg [Department of Physics and Astronomy, Uppsala University, 75120 Uppsala (Sweden); Nelan, Edmund P.; Taylor, Denise [STScI, Baltimore, MD 21218 (United States); Shulyak, D. V. [Institute of Astrophysics, Georg-August-University, Friedrich-Hund-Platz 1, D-37077 Goettingen (Germany); Freedman, Wendy L. [The Observatories, Carnegie Institution of Washington, Pasadena, CA 91101 (United States)

    2011-12-15

    We present new absolute trigonometric parallaxes and proper motions for seven Population II variable stars-five RR Lyr variables: RZ Cep, XZ Cyg, SU Dra, RR Lyr, and UV Oct; and two type 2 Cepheids: VY Pyx and {kappa} Pav. We obtained these results with astrometric data from Fine Guidance Sensors, white-light interferometers on Hubble Space Telescope. We find absolute parallaxes in milliseconds of arc: RZ Cep, 2.12 {+-} 0.16 mas; XZ Cyg, 1.67 {+-} 0.17 mas; SU Dra, 1.42 {+-} 0.16 mas; RR Lyr, 3.77 {+-} 0.13 mas; UV Oct, 1.71 {+-} 0.10 mas; VY Pyx, 6.44 {+-} 0.23 mas; and {kappa} Pav, 5.57 {+-} 0.28 mas; an average {sigma}{sub {pi}}/{pi} = 5.4%. With these parallaxes, we compute absolute magnitudes in V and K bandpasses corrected for interstellar extinction and Lutz-Kelker-Hanson bias. Using these RR Lyrae variable star absolute magnitudes, we then derive zero points for M{sub V} -[Fe/H] and M{sub K} -[Fe/H]-log P relations. The technique of reduced parallaxes corroborates these results. We employ our new results to determine distances and ages of several Galactic globular clusters and the distance of the Large Magellanic Cloud. The latter is close to that previously derived from Classical Cepheids uncorrected for any metallicity effect, indicating that any such effect is small. We also discuss the somewhat puzzling results obtained for our two type 2 Cepheids.

  15. Unmixing the Galactic halo with RR Lyrae tagging

    Science.gov (United States)

    Belokurov, V.; Deason, A. J.; Koposov, S. E.; Catelan, M.; Erkal, D.; Drake, A. J.; Evans, N. W.

    2018-06-01

    We show that tagging RR Lyrae stars according to their location in the period-amplitude diagram can be used to shed light on the genesis of the Galactic stellar halo. The mixture of RR Lyrae of ab type, separated into classes along the lines suggested by Oosterhoff, displays a strong and coherent evolution with Galactocentric radius. The change in the RR Lyrae composition appears to coincide with the break in the halo's radial density profile at ˜25 kpc. Using simple models of the stellar halo, we establish that at least three different types of accretion events are necessary to explain the observed RRab behaviour. Given that there exists a correlation between the RRab class fraction and the total stellar content of a dwarf satellite, we hypothesize that the field halo RRab composition is controlled by the mass of the progenitor contributing the bulk of the stellar debris at the given radius. This idea is tested against a suite of cosmological zoom-in simulations of Milky Way-like stellar halo formation. Finally, we study some of the most prominent stellar streams in the Milky Way halo and demonstrate that their RRab class fractions follow the trends established previously.

  16. Response of Haloalkaliphilic Archaeon Natronococcus Jeotgali RR17 to Hypergravity

    Science.gov (United States)

    Thombre, Rebecca S.; Bhalerao, Aniruddha R.; Shinde, Vinaya D.; Dhar, Sunil Kumar; Shouche, Yogesh S.

    2017-06-01

    The survival of archaeabacteria in extreme inhabitable environments on earth that challenge organismic survival is ubiquitously known. However, the studies related to the effect of hypergravity on the growth and proliferation of archaea are unprecedented. The survival of organisms in hypergravity and rocks in addition to resistance to cosmic radiations, pressure and other extremities is imperative to study the possibilities of microbial travel between planets and endurance in hyperaccelerative forces faced during ejection of rocks from planets. The current investigation highlights the growth of an extremophilic archaeon isolated from a rocky substrate in hypergravity environment. The haloalkaliphilic archaeon, Natronococcus jeotgali RR17 was isolated from an Indian laterite rock, submerged in the Arabian sea lining Coastal Maharashtra, India. The endolithic haloarchaeon was subjected to hypergravity from 56 - 893 X gusing acceleration generated by centrifugal rotation. The cells of N. jeotgali RR17 proliferated and demonstrated good growth in hypergravity (223 X g). This is the first report on isolation of endolithic haloarchaeon N. jeotgali RR17 from an Indian laterite rock and its ability to proliferate in hypergravity. The present study demonstrates the ability of microbial life to survive and proliferate in hypergravity. Thus the inability of organismic growth in hypergravity may no longer be a limitation for astrobiology studies related to habitability of substellar objects, brown dwarfs and other planetary bodies in the universe besides planet earth.

  17. Identification of atrial fibrillation using electrocardiographic RR-interval difference

    Science.gov (United States)

    Eliana, M.; Nuryani, N.

    2017-11-01

    Automated detection of atrial fibrillation (AF) is an interesting topic. It is an account of very dangerous, not only as a trigger of embolic stroke, but it’s also related to some else chronical disease. In this study, we analyse the presence of AF by determining irregularities of RR-interval. We utilize the interval comparison to measure the degree of irregularities of RR-interval in a defined segment. The series of RR-interval is segmented with the length of 10 of them. In this study, we use interval comparison for the method. We were comparing all of the intervals there each other. Then we put the threshold to define the low difference and high difference (δ). A segment is defined as AF or Normal Sinus by the number of high δ, so we put the tolerance (β) of high δ there. We have used this method to test the 23 patients data from MIT-BIH. Using the approach and the clinical data we find accuracy, sensitivity, and specificity of 84.98%, 91.99%, and 77.85% respectively.

  18. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    Science.gov (United States)

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  19. Significance of detecting circulating hepatocellular carcinoma cells in peripheral blood of hepatocellular carcinoma patients by nested reverse transcription-polymerase chain reaction and its clinical value: a retrospective study.

    Science.gov (United States)

    Liu, Yang; Wang, Yue-ru; Wang, Long; Song, Rui-mei; Zhou, Bo; Song, Zhen-shun

    2014-01-01

    Circulating hepatocellular carcinoma cells may be detected by reverse transcription-polymerase chain reaction. We investigated the relationship between circulating hepatocellular carcinoma cells and hepatoma patient survival after different managements and survival periods. Peripheral vein blood (5 ml) samples were obtained from 113 patients with hepatocellular carcinoma and from 33 control subjects (9 with liver cirrhosis after hepatitis B, 14 with chronic hepatitis B, 10 healthy individuals) between January 1, 2009, and December 31, 2013. To detect circulating hepatocellular carcinoma cells in peripheral blood, alpha-fetoprotein messenger RNA was amplified from total RNA extracted from whole blood by reverse transcription-polymerase chain reaction. Alpha-fetoprotein messenger RNA was detected in 59 blood samples from the hepatocellular carcinoma patients (59/113, 52.2%). In contrast, there were no clinical control subjects whose samples showed detectable alpha-fetoprotein messenger RNA. The presence of alpha-fetoprotein messenger RNA in blood seemed to be correlated with the stage (by TNM classification) of hepatocellular carcinoma, serum alpha-fetoprotein value, and the presence of intrahepatic metastasis, portal vein thrombosis, tumor diameter and/or distant metastasis. In addition, alpha-fetoprotein messenger RNA was detected in the blood of 25 patients showing distant metastasis at extrahepatic organs (100%), in contrast to 32 of 88 cases without metastasis (36.4%). All the patients with hepatocellular carcinoma were followed. Seventeen patients with resection of a T 2 stage hepatocellular carcinoma had a survival of 3.2 years after surgical management, 38 cases with resection of a T3 stage hepatocellular carcinoma had a 1.3-year survival, and only 37 cases with T4 stage disease after different treatments except surgery survived for 0.6 years (P <0.01). The presence of alpha-fetoprotein messenger RNA in peripheral blood may be an indicator of circulating

  20. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  1. Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

    Science.gov (United States)

    Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

    2000-05-01

    We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

  2. Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

    2011-11-01

    Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

  3. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India

    Directory of Open Access Journals (Sweden)

    K. Nithin Prabhu

    2018-02-01

    Full Text Available Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT, as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR, have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat and wild (leopard, wolf and jackal animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  4. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  5. Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

    Science.gov (United States)

    Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

    2016-01-01

    Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

  6. Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Nishiura, T; Abe, K

    1999-01-01

    The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

  7. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

    Science.gov (United States)

    Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

    2018-02-28

    Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  8. 77 FR 27085 - R.R. Donnelley, Inc., Bloomsburg, PA; Notice of Negative Determination on Reconsideration

    Science.gov (United States)

    2012-05-08

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-80,485] R.R. Donnelley, Inc... workers of R.R. Donnelley, Inc., Bloomsburg, Pennsylvania (subject firm). The Department's Notice of... eligibility to apply for worker adjustment assistance for workers and former workers of R.R. Donnelley, Inc...

  9. Chemical abundances and physical parameters of RR Lyrae stars

    International Nuclear Information System (INIS)

    Manduca, A.

    1980-01-01

    A grid of model stellar atmospheres has been calculated with a range of physical parameters which effectively cover RR Lyrae stars over all phases of their pulsation cycle. The models, calculated with the computer program MARCS, are flux-constant and include the effects of convection and line blanketing. Synthetic spectra were calculated for these models from 3000 A to 9600 A at 0.1 A resolution using the computer program SSG. These spectra were used directly in the applications below and were also used to computer theoretical colors on the UBVR, Stromgren uvby, and Walraven systems for the models. The uvby colors were used in determinations of effective temperature and surface gravity from photometry by various observers. The models, synthetic spectra, and colors were then applied to the problems detailed below. The data collected by Freeman and Rodgers (1975) for 25 RR Lyrae stars in ω Cen was reanalyzed with an alternative, synthetic spectrum approach to the calibration of their theoretical relations. The results confirm a wide range in calcium abundance for the stars in the cluster but at much lower values than reported by Freeman and Rodgers: a range of [Ca/H] = -1.0 to -1.9 was found. A theoretical calibration was performed for the ΔS system of determining metal abundances for RR Lyrae stars. The results support the existing empirical calibration of Butler in the range [Fe/H] = -0.6 to -2.2 and indicate how the calibration should be extrapolated to even lower metal abundances. For higher metal abundances, however, our calibration yields [Fe/H] values lower than Butler by as much as 0.4. Possible explanations of this discrepancy are investigated and the implications are discussed

  10. Extended Aperture Photometry of K2 RR Lyrae stars

    Directory of Open Access Journals (Sweden)

    Plachy Emese

    2017-01-01

    Full Text Available We present the method of the Extended Aperture Photometry (EAP that we applied on K2 RR Lyrae stars. Our aim is to minimize the instrumental variations of attitude control maneuvers by using apertures that cover the positional changes in the field of view thus contain the stars during the whole observation. We present example light curves that we compared to the light curves from the K2 Systematics Correction (K2SC pipeline applied on the automated Single Aperture Photometry (SAP and on the Pre-search Data Conditioning Simple Aperture Photometry (PDCSAP data.

  11. Reddening and blanketing of RR-Lyrae stars, ch. 3

    International Nuclear Information System (INIS)

    Lub, J.

    1977-01-01

    The effects of metal line blanketing and interstellar reddening upon the colours of the RR-Lyrae Stars are discussed. Due to the faintness of these stars in the ultraviolet W channel (at lambda 3720 A) the photometry is in most cases reduced to a four-colour VBLU photometry, i.e. there are only three colour indices available for the determination of the four quantities: interstellar reddening, effective temperature, atmospheric pressure (or effective gravity), and metal line strength which determine the energy distribution that was measured

  12. Extended Aperture Photometry of K2 RR Lyrae stars

    Science.gov (United States)

    Plachy, Emese; Klagyivik, Péter; Molnár, László; Sódor, Ádám; Szabó, Róbert

    2017-10-01

    We present the method of the Extended Aperture Photometry (EAP) that we applied on K2 RR Lyrae stars. Our aim is to minimize the instrumental variations of attitude control maneuvers by using apertures that cover the positional changes in the field of view thus contain the stars during the whole observation. We present example light curves that we compared to the light curves from the K2 Systematics Correction (K2SC) pipeline applied on the automated Single Aperture Photometry (SAP) and on the Pre-search Data Conditioning Simple Aperture Photometry (PDCSAP) data.

  13. Reversible Statistics

    DEFF Research Database (Denmark)

    Tryggestad, Kjell

    2004-01-01

    The study aims is to describe how the inclusion and exclusion of materials and calculative devices construct the boundaries and distinctions between statistical facts and artifacts in economics. My methodological approach is inspired by John Graunt's (1667) Political arithmetic and more recent work...... within constructivism and the field of Science and Technology Studies (STS). The result of this approach is here termed reversible statistics, reconstructing the findings of a statistical study within economics in three different ways. It is argued that all three accounts are quite normal, albeit...... in different ways. The presence and absence of diverse materials, both natural and political, is what distinguishes them from each other. Arguments are presented for a more symmetric relation between the scientific statistical text and the reader. I will argue that a more symmetric relation can be achieved...

  14. Reverse Redistribution in Myocardial Perfusion Imaging: Revisited with 64-slice MDCT

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Min Kyung; Kim, Jeong Ho; Hwang, Kyung Hoon; Choi, In Suck; Choi, Soo Jin; Choe, Won Sick [Gachon University Gil Hospital, Incheon (Korea, Republic of); Yoon, Min Ki [Good Samaritan Hospital, Pohang (Korea, Republic of)

    2010-06-15

    The authors report myocardial perfusion imaging of a patient showing reverse redistribution (RR) and a 64-slice multidetector-row computed tomography (MDCT) with corresponding findings. The patient had subendocardial myocardial infarction (MI) with positive electrocardiogram (EMG) findings and elevated levels of cardiac isoenzymes. Experiencing this case emphasizes the importance of complementary correlation of a new diagnostic modality that helps us to understand the nature of RR.

  15. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate

    Directory of Open Access Journals (Sweden)

    Cristiane Fortes Gris

    2013-04-01

    Full Text Available Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha. The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.

  16. A surface brightness analysis of eight RR Lyrae stars

    International Nuclear Information System (INIS)

    Hawley, S.L.; Barnes, T.G. III; Moffett, T.J.

    1987-01-01

    The authors have used a surface brightness, (V-R) relation to analyze new contemporaneous photometry and radial velocity data for 6 RR-ab type stars and to re-analyze previously published data for RR Lyrae and X Arietis. Systematic effects were found in the surface brightness at phases near minimum radius. Excluding these phases, they determine the slope of the surface brightness relation and the mean radius for each star. They also find a zero point which includes both a distance term and the zero point of the surface brightness relation. The sample includes stars with Preston's metallicity indicator ΔS = 0 to 9, with periods ranging from 0.397 days to 0.651 days. Their results indicate a log(R/R solar ) vs. log P relation in the sense that stars with longer periods have larger radii, in agreement with theoretical predictions. Their radii are consistent with bolometric magnitudes in the range 0.2 - 0.8 magnitude but accurate magnitudes must await a reliable T e - color calibration

  17. Evaluation of the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction assay and the INFINITI® Respiratory Viral Panel Plus assay for the detection of human metapneumovirus in Kuwait.

    Science.gov (United States)

    Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad

    2012-04-01

    Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

    2012-04-01

    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  19. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

    Science.gov (United States)

    Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

    2015-03-01

    African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. © 2015 The Author(s).

  20. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

    Science.gov (United States)

    Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

    2017-08-02

    Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

  1. Sensitivity and specificity of real-time reverse transcription polymerase chain reaction, histopathology, and immunohistochemical labeling for the detection of Rift Valley fever virus in naturally infected cattle and sheep.

    Science.gov (United States)

    Odendaal, Lieza; Fosgate, Geoffrey T; Romito, Marco; Coetzer, Jacobus A W; Clift, Sarah J

    2014-01-01

    Real-time reverse transcription polymerase chain reaction (real-time RT-PCR), histopathology, and immunohistochemical labeling (IHC) were performed on liver specimens from 380 naturally infected cattle and sheep necropsied during the 2010 Rift Valley fever (RVF) epidemic in South Africa. Sensitivity (Se) and specificity (Sp) of real-time RT-PCR, histopathology, and IHC were estimated in a latent-class model using a Bayesian framework. The Se and Sp of real-time RT-PCR were estimated as 97.4% (95% confidence interval [CI] = 95.2-98.8%) and 71.7% (95% CI = 65-77.9%) respectively. The Se and Sp of histopathology were estimated as 94.6% (95% CI = 91-97.2%) and 92.3% (95% CI = 87.6-95.8%), respectively. The Se and Sp of IHC were estimated as 97.6% (95% CI = 93.9-99.8%) and 99.4% (95% CI = 96.9-100%), respectively. Decreased Sp of real-time RT-PCR was ascribed to cross-contamination of samples. Stratified analysis of the data suggested variations in test accuracy with fetuses and severely autolyzed specimens. The Sp of histopathology in fetuses (83%) was 9.3% lower than the sample population (92.3%). The Se of IHC decreased from 97.6% to 81.5% in the presence of severe autolysis. The diagnostic Se and Sp of histopathology was higher than expected, confirming the value of routine postmortem examinations and histopathology of liver specimens. Aborted fetuses, however, should be screened using a variety of tests in areas endemic for RVF, and results from severely autolyzed specimens should be interpreted with caution. The most feasible testing option for countries lacking suitably equipped laboratories seems to be routine histology in combination with IHC.

  2. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  3. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  4. How decision reversibility affects motivation.

    Science.gov (United States)

    Bullens, Lottie; van Harreveld, Frenk; Förster, Jens; Higgins, Tory E

    2014-04-01

    The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making, strengthening prevention-related motivation relatively more than promotion-related motivation. If so, then decision reversibility should have effects associated with the relative differences between prevention and promotion motivation. In 5 studies, we manipulated the reversibility of a decision and used different indicators of regulatory focus motivation to test these predictions. Specifically, Study 1 tested for differences in participants' preference for approach versus avoidance strategies toward a desired end state. In Study 2, we used speed and accuracy performance as indicators of participants' regulatory motivation, and in Study 3, we measured global versus local reaction time performance. In Study 4, we approached the research question in a different way, making use of the value-from-fit hypothesis (Higgins, 2000, 2002). We tested whether a fit between chronic regulatory focus and focus induced by the reversibility of the decision increased participants' subjective positive feelings about the decision outcome. Finally, in Study 5, we tested whether regulatory motivation, induced by decision reversibility, also influenced participants' preference in specific product features. The results generally support our hypothesis showing that, compared to irreversible decisions, reversible decisions strengthen a prevention focus more than a promotion focus. Implications for research on decision making are discussed.

  5. Gemcitabine-Based Chemogene Therapy for Pancreatic Cancer Using Ad-dCK::UMK GDEPT and TS/RR siRNA Strategies

    Directory of Open Access Journals (Sweden)

    Soukaina Réjiba

    2009-07-01

    Full Text Available Gemcitabine is a first-line agent for advanced pancreatic cancer therapy. However, its efficacy is often limited by its poor intracellular metabolism and chemoresistance. To exert its antitumor activity, gemcitabine requires to be converted to its active triphosphate form. Thus, our aim was to improve gemcitabine activation using gene-directed enzyme prodrug therapy based on gemcitabine association with the deoxycytidine kinase::uridine monophosphate kinase fusion gene (dCK::UMK and small interference RNA directed against ribonucleotide reductase (RRM2 and thymidylate synthase (TS. In vitro, cytotoxicity was assessed by 3-[4,5-dimethylthiazol-2-yl]-3,5-diphenyl tetrazolium bromide and [3H]thymidine assays. Apoptosis-related gene expression and activity were analyzed by reverse transcription-polymerase chain reaction, Western blot, and ELISA. For in vivo studies, the treatment efficacy was evaluated on subcutaneous and orthotopic pancreatic tumor models. Our data indicated that cell exposure to gemcitabine induced a down-regulation of dCK expression and up-regulation of TS and RR expression in Panc1-resistant cells when compared with BxPc3- and HA-hpc2-sensitive cells. The combination of TS/RRM2 small interference RNA with Ad-dCK::UMK induced a 40-fold decrease of gemcitabine IC50 in Panc1 cells. This strong sensitization was associated to apoptosis induction with a remarkable increase in TRAIL expression and a diminution of gemcitabine-induced nuclear factor-κB activity. In vivo, the gemcitabine-based tritherapy strongly reduced tumor volumes and significantly prolonged mice survival. Moreover, we observed an obvious increase of apoptosis and decrease of cell proliferation in tumors receiving the tritherapy regimens. Together, these findings suggest that simultaneous TS/RRM2-gene silencing and dCK::UMK gene overexpression markedly improved gemcitabine's therapeutic activity. Clearly, this combined strategy warrants further investigation.

  6. Turbulent flow heat transfer in ET-RR-1

    International Nuclear Information System (INIS)

    Khattab, M.; Mina, A.R.

    1990-01-01

    In nuclear reactors the effect of heat transfer coefficient, which depends on the constant C. Is primordial in calculating the clad surface temperatures. To determine the constant C of ET-RR-1 fuel bundles based on in-pile measurements different well known and recommended values of C are verified. A computer program is written to calculate steady thermal core characteristics at different operating conditions. The total flow rate is distributed considering same pressure drop across the core irrespective of bundle location. The total reactor power is readily distributed as Bessel function. The flow and power per bundle are equally distributed among the fuel rods irrespective of their positions inside the bundle. It is found that the constant C equals 0.047 gives acceptable compatibility between measurements and calculations. The maximum clad surface temperature is shifted from the core center

  7. [Heart rate variability study based on a novel RdR RR Intervals Scatter Plot].

    Science.gov (United States)

    Lu, Hongwei; Lu, Xiuyun; Wang, Chunfang; Hua, Youyuan; Tian, Jiajia; Liu, Shihai

    2014-08-01

    On the basis of Poincare scatter plot and first order difference scatter plot, a novel heart rate variability (HRV) analysis method based on scatter plots of RR intervals and first order difference of RR intervals (namely, RdR) was proposed. The abscissa of the RdR scatter plot, the x-axis, is RR intervals and the ordinate, y-axis, is the difference between successive RR intervals. The RdR scatter plot includes the information of RR intervals and the difference between successive RR intervals, which captures more HRV information. By RdR scatter plot analysis of some records of MIT-BIH arrhythmias database, we found that the scatter plot of uncoupled premature ventricular contraction (PVC), coupled ventricular bigeminy and ventricular trigeminy PVC had specific graphic characteristics. The RdR scatter plot method has higher detecting performance than the Poincare scatter plot method, and simpler and more intuitive than the first order difference method.

  8. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate

    OpenAIRE

    Gris,Cristiane Fortes; Pinho,Edila Vilela de Resende Von; Carvalho,Maria Laene de Moreira; Diniz,Rafael Parreira; Andrade,Thaís de

    2013-01-01

    Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the muni...

  9. Ventricular Cycle Length Characteristics Estimative of Prolonged RR Interval during Atrial Fibrillation

    Science.gov (United States)

    CIACCIO, EDWARD J.; BIVIANO, ANGELO B.; GAMBHIR, ALOK; EINSTEIN, ANDREW J.; GARAN, HASAN

    2014-01-01

    Background When atrial fibrillation (AF) is incessant, imaging during a prolonged ventricular RR interval may improve image quality. It was hypothesized that long RR intervals could be predicted from preceding RR values. Methods From the PhysioNet database, electrocardiogram RR intervals were obtained from 74 persistent AF patients. An RR interval lengthened by at least 250 ms beyond the immediately preceding RR interval (termed T0 and T1, respectively) was considered prolonged. A two-parameter scatterplot was used to predict the occurrence of a prolonged interval T0. The scatterplot parameters were: (1) RR variability (RRv) estimated as the average second derivative from 10 previous pairs of RR differences, T13–T2, and (2) Tm–T1, the difference between Tm, the mean from T13 to T2, and T1. For each patient, scatterplots were constructed using preliminary data from the first hour. The ranges of parameters 1 and 2 were adjusted to maximize the proportion of prolonged RR intervals within range. These constraints were used for prediction of prolonged RR in test data collected during the second hour. Results The mean prolonged event was 1.0 seconds in duration. Actual prolonged events were identified with a mean positive predictive value (PPV) of 80% in the test set. PPV was >80% in 36 of 74 patients. An average of 10.8 prolonged RR intervals per 60 minutes was correctly identified. Conclusions A method was developed to predict prolonged RR intervals using two parameters and prior statistical sampling for each patient. This or similar methodology may help improve cardiac imaging in many longstanding persistent AF patients. PMID:23998759

  10. Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

    Science.gov (United States)

    Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

    2010-10-01

    The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT

  11. Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis.

    Science.gov (United States)

    Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin

    2017-04-01

    Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

  12. RR Tel: Getting Under the Flux Limit: An Observation with FUSE

    Science.gov (United States)

    Sonnenborn, George (Technical Monitor); Kenyon, Scott J.

    2004-01-01

    The goal of this program is to acquire a FUSE spectrum of the symbiotic binary RR Tel. With these data, we plan to derive improved constraints on the hot component, the nebula, and perhaps the red giant wind. Based on results from AG Dra, we should also be able to use some line detections to improve atomic parameters for high ionization emission lines. This results would benefit the general FUSE community. As of this writing, the FUSE observation of RR Tel has not been made. Because RR Tel is a very bright UV source, the FUSE team is assessing the likelihood that RR Tel will have an adverse affect on the instrument.

  13. Degradation efficiency and mechanism of azo dye RR2 by a novel ozone aerated internal micro-electrolysis filter.

    Science.gov (United States)

    Zhang, Xian-Bing; Dong, Wen-Yi; Sun, Fei-Yun; Yang, Wei; Dong, Jiao

    2014-07-15

    A newly designed ozone aerated internal micro-electrolysis filter (OIEF) was developed to investigate its degradation efficiencies and correlated reaction mechanisms of RR2 dye. Complete decolorization and 82% TOC removal efficiency were stably achieved in OIEF process. Based on the comprehensive experimental results, an empirical equation was proposed to illustrate the effects of initial dye concentration and ozone dosage rate on color removal. The results indicated that OIEF process could be operated at wide pH range without significant treatment efficiencies change, while the optimum pH for RR2 dye degradation was 9.0. There were 15, 8 and 6 kinds of identified intermediates during ozonation, IE and OIEF treatment processes, respectively. Less identified intermediates and their lower concentrations in OIEF may attribute to its rather excellent mineralization performance. It was found that ozonation, Fe(2+)/Fe(3+) catalyzed ozonation, the redox reactions of electro-reduction and electro-oxidation are the most important mechanisms in OIEF process. The catalytic effect of Fe(2+)/Fe(3+) would induce mutual conversion between dissolved Fe(2+) and Fe(3+), and then decrease the dissolution rate of ZVI. The excellent treatment performance proved that the OIEF process is one promising technology applied for reactive azo dyes and other refractory wastewater treatment. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Reverse transcription and polymerase chain reaction: principles and applications in dentistry Transcrição reversa e reação em cadeia da polimerase: princípios e aplicações em odontologia

    Directory of Open Access Journals (Sweden)

    Carlos Ferreira dos Santos

    2004-03-01

    Full Text Available Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR, which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT reaction in order to produce cDNA from RNA (RT-PCR. RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer. Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.Várias técnicas de biologia molecular têm sido disponibilizadas nos últimos anos. Uma que revolucionou a análise de ácidos nucléicos foi a reação em cadeia da polimerase (PCR, descrita pela primeira vez em 1985. Esta técnica baseia-se na possibilidade de amplificação exponencial de fragmentos específicos de DNA, com a criação de milhões de cópias que servirão como matéria-prima para diferentes tipos de análises. A PCR pode ser precedida por uma reação de transcrição reversa (RT para a obtenção de cDNA a partir de RNA (RT-PCR, representando, por exemplo, uma possibilidade de análise de expressão gênica em células ou tecidos. As técnicas de PCR e RT-PCR têm sido utilizadas em pesquisas odontológicas como

  15. Effect of Sex on Reverse Remodeling in Chronic Systolic Heart Failure.

    Science.gov (United States)

    Aimo, Alberto; Vergaro, Giuseppe; Castiglione, Vincenzo; Barison, Andrea; Pasanisi, Emilio; Petersen, Christina; Chubuchny, Vladyslav; Giannoni, Alberto; Poletti, Roberta; Maffei, Silvia; Januzzi, James L; Passino, Claudio; Emdin, Michele

    2017-10-01

    This study sought to investigate sex-related differences in reverse remodeling (RR). RR, that is, the recovery from left ventricular (LV) dilation and dysfunction in response to treatment for heart failure (HF), is associated with improved prognosis. Data from patients with stable systolic HF (LV ejection fraction [LVEF] of sex. Women showed a higher incidence of RR (41% vs. 27%, respectively; p 35%, according to current indication for device implantation, and LVEF definition of HF with reduced or mid-range EF). In the whole population, female sex was an independent predictor of RR (hazard ratio: 1.54; 95% confidence interval: 1.11 to 2.14; p = 0.011), together with cause of HF, disease duration, and left bundle branch block. Female sex was again an independent predictor of RR in all LVEF categories. Reverse remodeling is more frequent among women, regardless of cause and severity of LV dysfunction. Female sex is an independent predictor of RR in all categories of LV systolic dysfunction. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  16. Thermo-Mechanical Fatigue Crack Growth of RR1000.

    Science.gov (United States)

    Pretty, Christopher John; Whitaker, Mark Thomas; Williams, Steve John

    2017-01-04

    Non-isothermal conditions during flight cycles have long led to the requirement for thermo-mechanical fatigue (TMF) evaluation of aerospace materials. However, the increased temperatures within the gas turbine engine have meant that the requirements for TMF testing now extend to disc alloys along with blade materials. As such, fatigue crack growth rates are required to be evaluated under non-isothermal conditions along with the development of a detailed understanding of related failure mechanisms. In the current work, a TMF crack growth testing method has been developed utilising induction heating and direct current potential drop techniques for polycrystalline nickel-based superalloys, such as RR1000. Results have shown that in-phase (IP) testing produces accelerated crack growth rates compared with out-of-phase (OOP) due to increased temperature at peak stress and therefore increased time dependent crack growth. The ordering of the crack growth rates is supported by detailed fractographic analysis which shows intergranular crack growth in IP test specimens, and transgranular crack growth in 90° OOP and 180° OOP tests. Isothermal tests have also been carried out for comparison of crack growth rates at the point of peak stress in the TMF cycles.

  17. Thermo-Mechanical Fatigue Crack Growth of RR1000

    Directory of Open Access Journals (Sweden)

    Christopher John Pretty

    2017-01-01

    Full Text Available Non-isothermal conditions during flight cycles have long led to the requirement for thermo-mechanical fatigue (TMF evaluation of aerospace materials. However, the increased temperatures within the gas turbine engine have meant that the requirements for TMF testing now extend to disc alloys along with blade materials. As such, fatigue crack growth rates are required to be evaluated under non-isothermal conditions along with the development of a detailed understanding of related failure mechanisms. In the current work, a TMF crack growth testing method has been developed utilising induction heating and direct current potential drop techniques for polycrystalline nickel-based superalloys, such as RR1000. Results have shown that in-phase (IP testing produces accelerated crack growth rates compared with out-of-phase (OOP due to increased temperature at peak stress and therefore increased time dependent crack growth. The ordering of the crack growth rates is supported by detailed fractographic analysis which shows intergranular crack growth in IP test specimens, and transgranular crack growth in 90° OOP and 180° OOP tests. Isothermal tests have also been carried out for comparison of crack growth rates at the point of peak stress in the TMF cycles.

  18. RR Tel: Determination of Dust Properties During Minimum Obscuration

    Directory of Open Access Journals (Sweden)

    Jurkić T.

    2012-06-01

    Full Text Available the ISO infrared spectra and the SAAO long-term JHKL photometry of RR Tel in the epochs during minimum obscuration are studied in order to construct a circumstellar dust model. the spectral energy distribution in the near- and the mid-IR spectral range (1–15 μm was obtained for an epoch without the pronounced dust obscuration. the DUSTY code was used to solve the radiative transfer through the dust and to determine the circumstellar dust properties of the inner dust regions around the Mira component. Dust temperature, maximum grain size, dust density distribution, mass-loss rate, terminal wind velocity and optical depth are determined. the spectral energy distribution and the long-term JHKL photometry during an epoch of minimum obscuration show almost unattenuated stellar source and strong dust emission which cannot be explained by a single dust shell model. We propose a two-component model consisting of an optically thin circmustellar dust shell and optically thick dust outside the line of sight in some kind of a flattened geometry, which is responsible for most of the observed dust thermal emission.

  19. Computer control of ET-RR-1 hot cell manipulators

    International Nuclear Information System (INIS)

    Effat, A.M.; Rahman, F.A.

    1990-01-01

    The hot cell designed for remote handling of radioactive materials are, in effect, integral systems of safety devices for attaining adequate radiological protection for the operating personnel. Their operation involve potential hazards that are sometimes of great magnitude. The effect of an incident or accident could thus be fatal. some of these incident are due to the collision of the manipulator slave side with the radioactive objectives. Therefore in order to minimize the probability of such type of incidents, the movement of the manipulators is suggested (in the present investigation) to be kept under computer control. A model have been developed to control the movement of the hot cell manipulators in the slave side for Egypt first research reactor ET-RR-1, specially in the hidden sectors. The model is based on the use of a microprocessor and some accessories fixed to the manipulators slave side in a special manner such that it prevents the manipulator from colliding with radioactive objects. This is achieved by a signal transmitted to a specially designed brake which controls the movement of the upper arm of the manipulator master side. The hardware design of the model as well as the software are presented in details

  20. La Silla quest RR Lyrae star survey: Region I

    International Nuclear Information System (INIS)

    Zinn, R.; Miller, L.; Horowitz, B.; Baltay, C.; Ellman, N.; Hadjiyska, E.; Rabinowitz, D.; Vivas, A. K.

    2014-01-01

    A search for RR Lyrae stars (RRLSs) in ∼840 deg 2 of the sky in right ascension 150°-210° and declination –10° to + 10° yielded 1013 type ab and 359 type c RRLS. This sample is used to study the density profile of the Galactic halo, halo substructures, and the Oosterhoff type of the halo over distances (d ☉ ) from ∼5 to ∼80 kpc. The halo is flattened toward the Galactic plane, and its density profile steepens in slope at galactocentric distances greater than ∼25 kpc. The RRLS in the stellar stream from the Sagittarius dwarf spheroidal (dSph) galaxy match well the model of Law and Majewski for the stars that were stripped 1.3-3.2 Gyr ago, but not for the ones stripped 3.2-5.0 Gyr ago. Over densities are found at the locations of the Virgo Overdensity and the Virgo Stellar Stream. Within 1° of 1220-1, which Jerjen et al. identify as a halo substructure at d ☉ ∼ 24 kpc, there are four RRLS that are possibly members. Away from substructures, the RRLS are a mixture of Oosterhoff types I and II, but mostly OoI (∼73%). The accretion of galaxies resembling in RRLS content the most massive Milky Way satellites (LMC, SMC, For, Sgr) may explain this preponderance of OoI. Six new RRLS and three new anomalous Cepheids were found in the Sextans dSph galaxy.

  1. AIREKMOD-RR, Reactivity Transients in Nuclear Research Reactors

    International Nuclear Information System (INIS)

    Baggoura, B.; Mazrou, H.

    2001-01-01

    1 - Description of program or function: AIREMOD-RR is a point kinetics code which can simulate fast transients in nuclear research reactor cores. It can also be used for theoretical reactor dynamics studies. It is used for research reactor kinetic analysis and provides a point neutron kinetic capability. The thermal hydraulic behavior is governed by a one-dimensional heat balance equation. The calculations are restricted to a single equivalent unit cell which consists of fuel, clad and coolant. 2 - Method of solution: For transient reactor kinetic calculations a modified Runge Kutta numerical method is used. The external reactivity insertion, specified as a function of time, is converted in dollar ($) unit. The neutron density, energy release and feedback variables are given at each time step. The two types of reactivity feedback considered are: Doppler effect and moderator effect. A new expression for the reactivity dependence on the feedback variables has been introduced in the present version of the code. The feedback reactivities are fitted in power series expression. 3 - Restrictions on the complexity of the problem: The number of delayed neutron groups and the total number of equations are limited only by computer storage capabilities. - Coolant is always in liquid phase. - Void reactivity feedback is not considered

  2. Leprosy reactions: coinfections as a possible risk factor

    Directory of Open Access Journals (Sweden)

    Ana Carolina F. Motta

    2012-10-01

    Full Text Available OBJECTIVE: This study aimed to determine the frequency of coinfections in leprosy patients and whether there is a relationship between the presence of coinfections and the development of leprosy reactional episodes. METHOD: A cross-sectional study based on an analysis of the medical records of the patients who were treated at the Leprosy Clinics of the Ribeirão Preto Medical School, University of São Paulo, was conducted from 2000 to 2010. Information was recorded regarding the age, sex, clinical status, WHO classification, treatment, presence of reactions and coinfections. Focal and systemic infections were diagnosed based on the history, physical examination, and laboratory tests. Multinomial logistic regression was used to evaluate the associations between the leprosy reactions and the patients' gender, age, WHO classification and coinfections. RESULTS: Two hundred twenty-five patients were studied. Most of these patients were males (155/225 = 68.8% of an average age of 49.31±15.92 years, and the most prevalent clinical manifestation was the multibacillary (MB form (n = 146, followed by the paucibacillary (PB form (n = 79. Erythema nodosum leprosum (ENL was more prevalent (78/122 = 63.9% than the reversal reaction (RR (44/122 = 36.1%, especially in the MB patients (OR 5.07; CI 2.86-8.99; p<0.0001 who exhibited coinfections (OR 2.26; CI 1.56-3.27; p,<0.0001. Eighty-eight (88/225 = 39.1% patients exhibited coinfections. Oral coinfections were the most prevalent (40/88 = 45.5%, followed by urinary tract infections (17/88 = 19.3%, sinusopathy (6/88 = 6.8%, hepatitis C (6/88 = 6.8%, and hepatitis B (6/88 = 6.8%. CONCLUSIONS: Coinfections may be involved in the development and maintenance of leprosy reactions.

  3. A NOVEL APPROACH TO ARRHYTHMIA CLASSIFICATION USING RR INTERVAL AND TEAGER ENERGY

    Directory of Open Access Journals (Sweden)

    CHANDRAKAR KAMATH

    2012-12-01

    Full Text Available It is hypothesized that a key characteristic of electrocardiogram (ECG signal is its nonlinear dynamic behaviour and that the nonlinear component changes more significantly between normal and arrhythmia conditions than the linear component. The usual statistical descriptors used in RR (R to R interval analysis do not capture the nonlinear disposition of RR interval variability. In this paper we explore a novel approach to extract the features from nonlinear component of the RR interval signal using Teager energy operator (TEO. The key feature of Teager energy is that it models the energy of the source that generated the signal rather than the energy of the signal itself. Hence any deviations in regular rhythmic activity of the heart get reflected in the Teager energy function. The classification evaluated on MIT-BIH database, with RR interval and mean of Teager energy computed over RR interval as features, exhibits an average accuracy that exceeds 99.79%.

  4. IDAS-RR: an incident data base system for research reactors

    International Nuclear Information System (INIS)

    Matsumoto, Kiyoshi; Kohsaka, Atsuo; Kaminaga, Masanori; Murayama, Youji; Ohnishi, Nobuaki; Maniwa, Masaki.

    1990-03-01

    An Incident Data Base System for Research Reactors, IDAS-RR, has been developed. IDAS-RR has information about abnormal incidents (failures, transients, accidents, etc.) of research reactors in the world. Data reference, input, editing and other functions of IDAS-RR are menu driven. The routine processing and data base management functions are performed by the system software and hardware. PC-9801 equipment was selected as the hardware because of its portability and popularity. IDAS-RR provides effective reference information for the following activities. 1) Analysis of abnormal incident of research reactors, 2) Detail analysis of research reactor behavior in the abnormal incident for building the knowledge base of the reactor emergency diagnostic system for research reactor, 3) Planning counter-measure for emergency situation in the research reactor. This report is a user's manual of IDAS-RR. (author)

  5. La Silla quest RR Lyrae star survey: Region I

    Energy Technology Data Exchange (ETDEWEB)

    Zinn, R.; Miller, L. [Department of Astronomy, Yale University, P.O. Box 208101, New Haven, CT 06520-8101 (United States); Horowitz, B.; Baltay, C.; Ellman, N.; Hadjiyska, E.; Rabinowitz, D. [Department of Physics, Yale University, P.O. Box 208120, New Haven, CT 06511-8499 (United States); Vivas, A. K. [Centro de Investigaciones de Astronomía, Apartado Postal 264, Mérida 5101-A (Venezuela, Bolivarian Republic of)

    2014-01-20

    A search for RR Lyrae stars (RRLSs) in ∼840 deg{sup 2} of the sky in right ascension 150°-210° and declination –10° to + 10° yielded 1013 type ab and 359 type c RRLS. This sample is used to study the density profile of the Galactic halo, halo substructures, and the Oosterhoff type of the halo over distances (d {sub ☉}) from ∼5 to ∼80 kpc. The halo is flattened toward the Galactic plane, and its density profile steepens in slope at galactocentric distances greater than ∼25 kpc. The RRLS in the stellar stream from the Sagittarius dwarf spheroidal (dSph) galaxy match well the model of Law and Majewski for the stars that were stripped 1.3-3.2 Gyr ago, but not for the ones stripped 3.2-5.0 Gyr ago. Over densities are found at the locations of the Virgo Overdensity and the Virgo Stellar Stream. Within 1° of 1220-1, which Jerjen et al. identify as a halo substructure at d {sub ☉} ∼ 24 kpc, there are four RRLS that are possibly members. Away from substructures, the RRLS are a mixture of Oosterhoff types I and II, but mostly OoI (∼73%). The accretion of galaxies resembling in RRLS content the most massive Milky Way satellites (LMC, SMC, For, Sgr) may explain this preponderance of OoI. Six new RRLS and three new anomalous Cepheids were found in the Sextans dSph galaxy.

  6. Managing Reverse Logistics or Reversing Logistics Management?

    OpenAIRE

    Brito, Marisa

    2004-01-01

    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...

  7. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis

    NARCIS (Netherlands)

    Felten, Sandra; Leutenegger, Christian M.; Balzer, Hans Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman|info:eu-repo/dai/nl/089740890; Hartmann, Katrin

    2017-01-01

    Background: Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse

  8. Reaction Formulation: A Bibliography.

    Science.gov (United States)

    Pedrini, D. T.; Pedrini, Bonnie C.

    Reaction formation was studied by Sigmund Freud. This defense mechanism may be related to repression, substitution, reversal, and compensation (or over-compensation). Alfred Adler considered compensation a basic process in his individual psychology. Anna Freud discussed some defense mechanisms, and Bibring, Dwyer, Huntington, and Valenstein…

  9. Managing Reverse Logistics or Reversing Logistics Management?

    NARCIS (Netherlands)

    M.P. de Brito (Marisa)

    2004-01-01

    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse

  10. Reversible Thermoset Adhesives

    Science.gov (United States)

    Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)

    2016-01-01

    Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.

  11. The coefficient of rolling resistance (CoRR) of some pharmaceutical tablets.

    Science.gov (United States)

    Ketterhagen, William R; Bharadwaj, Rahul; Hancock, Bruno C

    2010-06-15

    Experiments have been conducted to measure the coefficient of rolling resistance (CoRR) of some pharmaceutical tablets and several common materials, such as glass beads and steel ball bearings. CoRR values are required as inputs for discrete element method (DEM) models which can be used to model particulate flows and solid dosage form manufacturing processes. Until now there have been no CoRR data reported for pharmaceutical materials, and thus these new data will help to facilitate more accurate modeling of pharmaceutical systems. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Reversible conversion of valence-tautomeric copper metal-organic frameworks dependent single-crystal-to-single-crystal oxidation/reduction: a redox-switchable catalyst for C-H bonds activation reaction.

    Science.gov (United States)

    Huang, Chao; Wu, Jie; Song, Chuanjun; Ding, Ran; Qiao, Yan; Hou, Hongwei; Chang, Junbiao; Fan, Yaoting

    2015-06-28

    Upon single-crystal-to-single-crystal (SCSC) oxidation/reduction, reversible structural transformations take place between the anionic porous zeolite-like Cu(I) framework and a topologically equivalent neutral Cu(I)Cu(II) mixed-valent framework. The unique conversion behavior of the Cu(I) framework endowed it as a redox-switchable catalyst for the direct arylation of heterocycle C-H bonds.

  13. Tubal Ligation Reversal

    Science.gov (United States)

    ... seal off the fallopian tubes, such as the Essure or Adiana systems, generally aren't reversible. Why ... electrocautery). Some types of sterilization, such as the Essure or Adiana systems, aren't considered reversible. Risks ...

  14. Rodent Research-1 (RR1) NASA Validation Flight: Mouse liver transcriptomic proteomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — RR-1 is a validation flight to evaluate the hardware operational and science capabilities of the Rodent Research Project on the ISS. RNA DNA and protein were...

  15. Rodent Research-1 (RR1) NASA Validation Flight: Mouse soleus muscle transcriptomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...

  16. Rodent Research-1 (RR1) NASA Validation Flight: Mouse kidney transcriptomic proteomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...

  17. Rodent Research-1 (RR1) NASA Validation Flight: Mouse quadriceps muscle transcriptomic proteomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...

  18. Rodent Research-1 (RR1) NASA Validation Flight: Mouse gastrocnemius muscle transcriptomic proteomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...

  19. Rodent Research-1 (RR1) NASA Validation Flight: Mouse eye transcriptomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...

  20. Rodent Research-1 (RR1) NASA Validation Flight: Mouse adrenal gland transcriptomic proteomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...

  1. VBLUM photometry of RR Lyrae stars in ω Cen and M4

    International Nuclear Information System (INIS)

    DeBruijn, J.W.; Lub, J.

    1987-01-01

    Multicolour VBLUW photometry of RR Lyrae stars in the globular clusters M4 and ω Cen is used to derive information on reddening, blanketing, effective temperatures and gravity of these stars. The methods employed in the literature to determine the reddening of globular clusters from the UBV colours of the RR Lyrae stars are in complete agreement with the results from VBLUW photometry. The most important conclusions of the present work are: the close similarity between the RR Lyrae variables in the field and in globular clusters, and the agreement between the reddenings derived for RR Lyrae in the field and in globular clusters. This means that at least one parameter which normally is taken as a free parameter in studying globular cluster colour magnitude diagrams can be constrained very precisely

  2. Reverse logistics - a framework

    NARCIS (Netherlands)

    M.P. de Brito (Marisa); R. Dekker (Rommert)

    2002-01-01

    textabstractIn this paper we define and compare Reverse Logistics definitions. We start by giving an understanding framework of Reverse Logistics: the why-what-how. By this means, we put in context the driving forces for Reverse Logistics, a typology of return reasons, a classification of

  3. Mechanism of blood pressure and R-R variability: insights from ganglion blockade in humans

    Science.gov (United States)

    Zhang, Rong; Iwasaki, Kenichi; Zuckerman, Julie H.; Behbehani, Khosrow; Crandall, Craig G.; Levine, Benjamin D.; Blomqvist, C. G. (Principal Investigator)

    2002-01-01

    Spontaneous blood pressure (BP) and R-R variability are used frequently as 'windows' into cardiovascular control mechanisms. However, the origin of these rhythmic fluctuations is not completely understood. In this study, with ganglion blockade, we evaluated the role of autonomic neural activity versus other 'non-neural' factors in the origin of BP and R-R variability in humans. Beat-to-beat BP, R-R interval and respiratory excursions were recorded in ten healthy subjects (aged 30 +/- 6 years) before and after ganglion blockade with trimethaphan. The spectral power of these variables was calculated in the very low (0.0078-0.05 Hz), low (0.05-0.15 Hz) and high (0.15-0.35 Hz) frequency ranges. The relationship between systolic BP and R-R variability was examined by cross-spectral analysis. After blockade, R-R variability was virtually abolished at all frequencies; however, respiration and high frequency BP variability remained unchanged. Very low and low frequency BP variability was reduced substantially by 84 and 69 %, respectively, but still persisted. Transfer function gain between systolic BP and R-R interval variability decreased by 92 and 88 % at low and high frequencies, respectively, while the phase changed from negative to positive values at the high frequencies. These data suggest that under supine resting conditions with spontaneous breathing: (1) R-R variability at all measured frequencies is predominantly controlled by autonomic neural activity; (2) BP variability at high frequencies (> 0.15 Hz) is mediated largely, if not exclusively, by mechanical effects of respiration on intrathoracic pressure and/or cardiac filling; (3) BP variability at very low and low frequencies (rhythmicity; and (4) the dynamic relationship between BP and R-R variability as quantified by transfer function analysis is determined predominantly by autonomic neural activity rather than other, non-neural factors.

  4. Carbon and oxygen abundances of field RR Lyrae stars. I. Carbon abundances

    International Nuclear Information System (INIS)

    Butler, D.; Manduca, A.; Deming, D.; Bell, R.A.

    1982-01-01

    From an analysis of KPNO 4-m echelle plates and simultaneous uvbyβ photometry, we have determined carbon abundances and carbon-to-iron ratios for a large number of field RR Lyrae stars having [Fe/H]> or approx. =-1.2. It is found that these field RR Lyrae stars: stars which are known to be in an advanced evolutionary state: have carbon-to-iron ratios which are similar to those of unevolved stars

  5. DNA aptamer selection and aptamer-based fluorometric displacement assay for the hepatotoxin microcystin-RR

    International Nuclear Information System (INIS)

    Wu, Shijia; Li, Qi; Duan, Nuo; Wang, Zhouping; Ma, Haile

    2016-01-01

    Microcystin-RR (MC-RR) is a highly acute hepatotoxin produced by cyanobacteria. It is harmful to both humans and the environment. A novel aptamer was identified by the systemic evolution of ligands by exponential enrichment (SELEX) method as a recognition element for determination of MC-RR in aquatic products. The graphene oxide (GO) SELEX strategy was adopted to generate aptamers with high affinity and specificity. Of the 50 aptamer candidates tested, sequence RR-33 was found to display high affinity and selectivity, with a dissociation constant of 45.7 ± 6.8 nM. Aptamer RR-33 therefore was used as the recognition element in a fluorometric assay that proceeds as follows: (1) Biotinylated aptamer RR-33 is immobilized on the streptavidinylated wells of a microtiterplate, and carboxyfluorescein (FAM) labelled complementary DNA is then allowed to hybridize. (2) After removal of excess (unbound) cDNA, sample containing MC-RR is added and incubated at 37 °C for 2 h. (3) Displaced free cDNA is washed away and fluorescence intensity measured at excitation/emission wavelengths of 490/515 nm. The calibration plot is linear in the 0.20 to 2.5 ng·mL −1 concentration range, and the limit of detection is 80 pg·mL −1 . The results indicate that the GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins. The detection scheme was applied to the determination of MC-RR in (spiked) water, mussel and fish and gave recoveries between 91 and 98 %. The method compares favorably to a known ELISA. Conceivably, this kind of assay is applicable to other toxins for which appropriate aptamers are available. (author)

  6. Critical effects of alkyl chain length on fibril structures in benzene-trans(RR)- or (SS)-N,N'-alkanoyl-1,2-diaminocyclohexane gels.

    Science.gov (United States)

    Sato, Hisako; Nakae, Takahiro; Morimoto, Kazuya; Tamura, Kenji

    2012-02-28

    Vibrational circular dichroism (VCD) spectra were recorded on benzene-d(6) gels formed by chiral low molecular mass gelators (LMGs), trans(RR)- or trans(SS)-N,N'-alkanoyl-1,2-diaminocyclohexane (denoted by RR-C(n) or SS-C(n), respectively; n = the number of carbon atoms in an introduced alkanoyl group). Attention was focused on the effects of alkyl chain length on the structures of the gels. When n was changed from 6 to 12, the signs of the coupled peaks around 1550 cm(-1) in the VCD spectra, which were assigned to the symmetric and asymmetric C=O stretching vibrations from the higher to lower wavenumber, respectively, critically depended on the alkyl chain length. In the case of RR-C(n), for example, the signs of the couplet were plus and minus for n = 8, 9, 10 and 12, while the signs of the same couplet were reversed for n = 6 and 7. The conformations of LMGs in fibrils were determined by comparing the observed IR and VCD spectra with those calculated for a monomeric molecule. The observed reversal of signs in the C=O couplet was rationalized in terms of the different modes of hydrogen bonding. In the case of C(8), C(9), C(10) and C(12), gelator molecules were stacked with their cyclohexyl rings in parallel, forming double anti-parallel chains of intermolecular hydrogen bonds using two pairs of >NH and >C=O groups. In case of C(6) and C(7), gelator molecules were stacked through a single chain of intermolecular hydrogen bonds using a pair of >NH and >C=O groups. The remaining pair of >NH and >C=O groups formed an intramolecular hydrogen bond.

  7. The VMC survey - XXVI. Structure of the Small Magellanic Cloud from RR Lyrae stars

    Science.gov (United States)

    Muraveva, T.; Subramanian, S.; Clementini, G.; Cioni, M.-R. L.; Palmer, M.; van Loon, J. Th.; Moretti, M. I.; de Grijs, R.; Molinaro, R.; Ripepi, V.; Marconi, M.; Emerson, J.; Ivanov, V. D.

    2018-01-01

    We present results from the analysis of 2997 fundamental mode RR Lyrae variables located in the Small Magellanic Cloud (SMC). For these objects, near-infrared time series photometry from the VISTA survey of the Magellanic Clouds system (VMC) and visual light curves from the OGLE IV (Optical Gravitational Lensing Experiment IV) survey are available. In this study, the multi-epoch Ks-band VMC photometry was used for the first time to derive intensity-averaged magnitudes of the SMC RR Lyrae stars. We determined individual distances to the RR Lyrae stars from the near-infrared period-absolute magnitude-metallicity (PM_{K_s}Z) relation, which has some advantages in comparison with the visual absolute magnitude-metallicity (MV-[Fe/H]) relation, such as a smaller dependence of the luminosity on interstellar extinction, evolutionary effects and metallicity. The distances we have obtained were used to study the three-dimensional structure of the SMC. The distribution of the SMC RR Lyrae stars is found to be ellipsoidal. The actual line-of-sight depth of the SMC is in the range 1-10 kpc, with an average depth of 4.3 ± 1.0 kpc. We found that RR Lyrae stars in the eastern part of the SMC are affected by interactions of the Magellanic Clouds. However, we do not see a clear bimodality observed for red clump stars, in the distribution of RR Lyrae stars.

  8. Reversible flowchart languages and the structured reversible program theorem

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2008-01-01

    Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...

  9. Remendable Polymeric Materials Using Reversible Covalent Bonds

    Science.gov (United States)

    2008-12-01

    response in poly(ethylene-co-methacrylic acid ) copolymers. Journal of The Royal Society Interface, 4, 405-411. Kavitha, A. A., and N. K. Singha...2007: A tailor-made polymethacrylate bearing a reactive diene in reversible diels-alder reaction. J. Polym. Sci. A Polym. Chem., 45, 4441-4449

  10. Compound nucleus studies withy reverse kinematics

    International Nuclear Information System (INIS)

    Moretto, L.G.

    1985-06-01

    Reverse kinematics reactions are used to demonstrate the compound nucleus origin of intermediate mass particles at low energies and the extension of the same mechanism at higher energies. No evidence has appeared in our energy range for liquid-vapor equilibrium or cold fragmentation mechanisms. 11 refs., 12 figs

  11. Obtainment the reverse phase spinel [Zn2+0,5Fe3+0,5](Ni2+0,5Fe3+ 1,5)O4 by the method combustion reaction: the form of assessment heating

    International Nuclear Information System (INIS)

    Silva, M.C.; Costa, A.C.F.; Coutinho, J.P.; Silva, A.T.C.; Freitas, N.L.

    2011-01-01

    This paper aims to synthesize the inverse spinel phase of by combustion reaction method and to evaluate how [Zn 2+ 0,5Fe 3+ 0,5](Ni 2+ 0,5Fe 3+ 1,5)O 4 the heat source influences the structural and morphological this phase. The forms of heating were muffle oven and ceramic plate with built-in resistance and aniline as reducing agent. Comparisons were made between temperature, reaction time and physical changes undergone by the material during the combustion carried out in two warm-up. The material was characterized by XRD, SEM, and textural analysis. Based on the results showed that the spinel phase was successfully obtained, were found traces of the phases ZnO and Fe2O3. The Most crystallite size and higher reaction temperature were presented by the material produced in the plate. As for surface area and pore volume, the highest values were achieved by the material synthesized in the oven. The agglomerates were presented in the form of skeins made of pre-sintered particles. (author)

  12. Nuclear reaction studies using inverse kinematics

    International Nuclear Information System (INIS)

    Shapira, D.

    1985-01-01

    Reaction studies with reversed kinematics refer to studies of nuclear reactions induced by a heavy projectile colliding with lighter target nuclei. The technique of using reversed kinematics is costly in terms of the available center-of-mass energy. Most of the projectile's energy goes into forward motion of the reaction products in the laboratory system. Examples are presented where the use of reversed kinematics techniques has provided new information on certain reaction processes. A list of kinematic properties and advantages they may afford is shown. Clearly the possible studies listed can be done without using reversed kinematics but because of the difficulty associated with some of these studies they were never performed until more energetic heavier beams have become available and the reversed kinematics technique was utilized

  13. Introduction to reversible computing

    CERN Document Server

    Perumalla, Kalyan S

    2013-01-01

    Few books comprehensively cover the software and programming aspects of reversible computing. Filling this gap, Introduction to Reversible Computing offers an expanded view of the field that includes the traditional energy-motivated hardware viewpoint as well as the emerging application-motivated software approach. Collecting scattered knowledge into one coherent account, the book provides a compendium of both classical and recently developed results on reversible computing. It explores up-and-coming theories, techniques, and tools for the application of rever

  14. Ridge Regression and Other Kernels for Genomic Selection with R Package rrBLUP

    Directory of Open Access Journals (Sweden)

    Jeffrey B. Endelman

    2011-11-01

    Full Text Available Many important traits in plant breeding are polygenic and therefore recalcitrant to traditional marker-assisted selection. Genomic selection addresses this complexity by including all markers in the prediction model. A key method for the genomic prediction of breeding values is ridge regression (RR, which is equivalent to best linear unbiased prediction (BLUP when the genetic covariance between lines is proportional to their similarity in genotype space. This additive model can be broadened to include epistatic effects by using other kernels, such as the Gaussian, which represent inner products in a complex feature space. To facilitate the use of RR and nonadditive kernels in plant breeding, a new software package for R called rrBLUP has been developed. At its core is a fast maximum-likelihood algorithm for mixed models with a single variance component besides the residual error, which allows for efficient prediction with unreplicated training data. Use of the rrBLUP software is demonstrated through several examples, including the identification of optimal crosses based on superior progeny value. In cross-validation tests, the prediction accuracy with nonadditive kernels was significantly higher than RR for wheat ( L. grain yield but equivalent for several maize ( L. traits.

  15. Mitochondrial electron transport chain is involved in microcystin-RR induced tobacco BY-2 cells apoptosis.

    Science.gov (United States)

    Huang, Wenmin; Li, Dunhai; Liu, Yongding

    2014-09-01

    Microcystin-RR (MC-RR) has been suggested to induce apoptosis in tobacco BY-2 cells through mitochondrial dysfunction including the loss of mitochondrial membrane potential (ΔΨm). To further elucidate the mechanisms involved in MC-RR induced apoptosis in tobacco BY-2 cells, we have investigated the role of mitochondrial electron transport chain (ETC) as a potential source for reactive oxygen species (ROS). Tobacco BY-2 cells after exposure to MC-RR (60mg/L) displayed apoptotic changes in association with an increased production of ROS and loss of ΔΨm. All of these adverse effects were significantly attenuated by ETC inhibitors including Rotenone (2μmol/L, complex I inhibitor) and antimycin A (0.01μmol/L, complex III inhibitor), but not by thenoyltrifluoroacetone (5μmol/L, complex II inhibitor). These results suggest that mitochondrial ETC plays a key role in mediating MC-RR induced apoptosis in tobacco BY-2 cells through an increased mitochondrial production of ROS. Copyright © 2014. Published by Elsevier B.V.

  16. The effect of Livermore OPAL opacities on the evolutionary masses of RR Lyrae stars

    Science.gov (United States)

    Yi, Sukyoung; Lee, Young-Wook; Demarque, Pierre

    1993-01-01

    We have investigated the effect of the new Livermore OPAL opacities on the evolution of horizontal-branch (HB) stars. This work was motivated by the recent stellar pulsation calculations using the new Livermore opacities, which suggest that the masses of double-mode RR Lyrae stars are 0.1-0.2 solar mass larger than those based on earlier opacities. Unlike the pulsation calculations, we find that the effect of opacity change on the evolution of HB stars is not significant. In particular, the effect of the mean masses of RR Lyrae stars is very small, showing a decrease of only 0.01-0.02 solar mass compared to the models based on old Cox-Stewart opacities. Consequently, with the new Livermore OPAL opacities, both the stellar pulsation and evolution models now predict approximately the same masses for the RR Lyrae stars. Our evolutionary models suggest that the mean masses of the RR Lyrae stars are about 0.76 and about 0.71 solar mass for M15 (Oosterhoff group II) and M3 (group I), respectively. If (alpha/Fe) = 0.4, these values are decreased by about 0.03 solar mass. Variations of the mean masses of RR Lyrae stars with HB morphology and metallicity are also presented.

  17. Analysis of a selected sample of RR Lyrae stars in the LMC from OGLE-III

    International Nuclear Information System (INIS)

    Chen Bing-Qiu; Jiang Bi-Wei; Yang Ming

    2013-01-01

    A systematic study of RR Lyrae stars is performed using a selected sample of 655 objects in the Large Magellanic Cloud (LMC) with long-term observations and numerous measurements from the Optical Gravitational Lensing Experiment III project. The phase dispersion method and linear superposition of the harmonic oscillations are used to derive the pulsation frequency and properties of light variation. It is found that a dichotomy exists in Oosterhoff Type I and Oosterhoff Type II for RR Lyrae stars in the LMC. Due to our strict criteria for identifying a frequency, a lower limit for the incidence rate of Blazhko modulation in the LMC is estimated in various subclasses of RR Lyrae stars. For fundamental-mode RR Lyrae stars, the rate of 7.5% is smaller than the previous result. In the case of the first-overtone RR Lyrae variables, the rate of 9.1% is relatively high. In addition to the Blazhko variables, 15 objects are identified to pulsate in the fundamental/first-overtone double mode. Furthermore, four objects show a period ratio around 0.6, which makes them very likely to be rare pulsators in the fundamental/second-overtone double mode. (research papers)

  18. Reversibility of female sterilization.

    Science.gov (United States)

    Siegler, A M; Hulka, J; Peretz, A

    1985-04-01

    The discussion considers the current status of reversibility of sterilization in the US and describes clinical and experimental efforts for developing techniques designed for reversibility. It focuses on regret following sterilization, reversal potential of current sterilization techniques, patient selection, current reversal techniques, results of sterilization procedures, experimental approaches to reversal of current techniques of sterilization, and sterilization procedures devised for reversibility, in humans and in animals. Request is the 1st stage of reversal, but a request for sterilization reversal (SR) does not always mean regret for a decision made at the time. Frequently it is a wish to restore fertility because life circumstances have changed after a sterilization that was ppropriate at the time it was performed. Schwyhart and Kutner reviewed 22 studies published between 1949-69 in which they found that the percentage of patients regretting the procedure ranged from 1.3-15%. Requests for reversal remain low in most countries, but if sterilization becomes a more popular method of contraception, requests will also increase. The ideal operation considered as a reversaible method of sterilization should include an easy, reliable outpatient method of tubal occlusion with miniml risk or patient discomfort that subsequently could be reversed without the need for a major surgical intervention. Endoscopic methods have progressed toward the 1st objective. A recent search of the literature uncovered few series of SR of more than 50 cases. The 767 operations found were analyzed with regard to pregnancy outcome. The precent of live births varied from 74-78.8%, and the occurance of tubal pregnancies ranged from 1.7-6.5%. All of the confounding variables in patient selection and small numbers of reported procedures preclude any conclusion about the different techniques or the number of operations that give a surgeon a level of expertise. Few authors classify their

  19. RR Lyrae star distance scale and kinematics from inner bulge to 50 kpc

    Directory of Open Access Journals (Sweden)

    Dambis Andrei

    2017-01-01

    Full Text Available We use the currently most complete sample of ∼ 3500 type ab RR Lyraes in our Galaxy with available radial-velocity and [Fe/H] measurements to perform a statisticalparallax analysis for a subsample of ∼ 600 type ab RR Lyraes located within 5 kpc from the Sun to refine the parameters of optical and WISE W1-band period-metallicityluminosity relations and adjust our preliminary distances. The new zero point implies the rescaled estimates for the solar Galactocentric distance (RG = 7.99 ± 0.37 kpc and the LMC distance modulus (DMLMC = 18.39 ±0.09. We use the kinematic data for the entire sample to explore the dependence of the halo and thick-disk RR Lyrae velocity ellipsoids on Galactocentric distance from the inner bulge out to R ∼ 50 kpc.

  20. Build-up of actinides in irradiated fuel rods of the ET-RR-1 reactor

    Energy Technology Data Exchange (ETDEWEB)

    Adib, M.; Naguib, K.; Morcos, H.N

    2001-09-01

    The content concentrations of actinides are calculated as a function of operating reactor regime and cooling time at different percentage of fuel burn-up. The build-up transmutation equations of actinides content in an irradiated fuel are solved numerically .A computer code BAC was written to operate on a PC computer to provide the required calculations. The fuel element of 10% {sup 235}U enrichment of ET-RR-1 reactor was taken as an example for calculations using the BAC code. The results are compared with other calculations for the ET-RR-1 fuel rod. An estimation of fissile build-up content of a proposed new fuel of 20% {sup 235}U enrichment for ET-RR-1 reactor is given. The sensitivity coefficients of build-up plutonium concentrations as a function of cross-section data uncertainties are also calculated.

  1. VizieR Online Data Catalog: Mid-infrared study of RR Lyrae stars (Gavrilchenko+, 2014)

    Science.gov (United States)

    Gavrilchenko, T.; Klein, C. R.; Bloom, J. S.; Richards, J. W.

    2015-02-01

    The first goal was to find a large sample of WISE-observed RR Lyrae stars. A data base of previously identified RR Lyrae stars was created, combining information from General Catalogue of Variable Stars (GCVS), All Sky Automated Survey (ASAS), SIMBAD, VizieR, and individual papers. For many of the sources in this data base the only available data were the coordinates and RR Lyrae classification. When provided, information about the period, distance, subclass, and magnitude for several different wavebands was also stored. If a single source appeared in multiple surveys or papers, information from all relevant surveys was included, with markers indicating contradicting measurements between surveys. The resulting data base contains about 17000 sources, of which about 5000 sources have documented V-band periods. (3 data files).

  2. Entropy Analysis of RR and QT Interval Variability during Orthostatic and Mental Stress in Healthy Subjects

    Directory of Open Access Journals (Sweden)

    Mathias Baumert

    2014-12-01

    Full Text Available Autonomic activity affects beat-to-beat variability of heart rate and QT interval. The aim of this study was to explore whether entropy measures are suitable to detect changes in neural outflow to the heart elicited by two different stress paradigms. We recorded short-term ECG in 11 normal subjects during an experimental protocol that involved head-up tilt and mental arithmetic stress and computed sample entropy, cross-sample entropy and causal interactions based on conditional entropy from RR and QT interval time series. Head-up tilt resulted in a significant reduction in sample entropy of RR intervals and cross-sample entropy, while mental arithmetic stress resulted in a significant reduction in coupling directed from RR to QT. In conclusion, measures of entropy are suitable to detect changes in neural outflow to the heart and decoupling of repolarisation variability from heart rate variability elicited by orthostatic or mental arithmetic stress.

  3. Quantum reverse hypercontractivity

    Energy Technology Data Exchange (ETDEWEB)

    Cubitt, Toby [Department of Computer Science, University College London, London, United Kingdom and Centre for Quantum Information and Foundations, DAMTP, University of Cambridge, Cambridge (United Kingdom); Kastoryano, Michael [NBIA, Niels Bohr Institute, University of Copenhagen, 2100 Copenhagen (Denmark); Montanaro, Ashley [School of Mathematics, University of Bristol, Bristol (United Kingdom); Temme, Kristan [Institute for Quantum Information and Matter, California Institute of Technology, Pasadena, California 91125 (United States)

    2015-10-15

    We develop reverse versions of hypercontractive inequalities for quantum channels. By generalizing classical techniques, we prove a reverse hypercontractive inequality for tensor products of qubit depolarizing channels. We apply this to obtain a rapid mixing result for depolarizing noise applied to large subspaces and to prove bounds on a quantum generalization of non-interactive correlation distillation.

  4. Atrioventricular Pacemaker Lead Reversal

    Directory of Open Access Journals (Sweden)

    Mehmet K Aktas, MD

    2007-01-01

    Full Text Available During cardiac surgery temporary epicardial atrial and ventricular leads are placed in case cardiac pacing is required postoperatively. We present the first reported series of patients with reversal of atrioventricular electrodes in the temporary pacemaker without any consequent deleterious hemodynamic effect. We review the electrocardiographic findings and discuss the findings that lead to the discovery of atrioventricular lead reversal.

  5. Adipose tissue (P)RR regulates insulin sensitivity, fat mass and body weight.

    Science.gov (United States)

    Shamansurova, Zulaykho; Tan, Paul; Ahmed, Basma; Pepin, Emilie; Seda, Ondrej; Lavoie, Julie L

    2016-10-01

    We previously demonstrated that the handle-region peptide, a prorenin/renin receptor [(P)RR] blocker, reduces body weight and fat mass and may improve insulin sensitivity in high-fat fed mice. We hypothesized that knocking out the adipose tissue (P)RR gene would prevent weight gain and insulin resistance. An adipose tissue-specific (P)RR knockout (KO) mouse was created by Cre-loxP technology using AP2-Cre recombinase mice. Because the (P)RR gene is located on the X chromosome, hemizygous males were complete KO and had a more pronounced phenotype on a normal diet (ND) diet compared to heterozygous KO females. Therefore, we challenged the female mice with a high-fat diet (HFD) to uncover certain phenotypes. Mice were maintained on either diet for 9 weeks. KO mice had lower body weights compared to wild-types (WT). Only hemizygous male KO mice presented with lower total fat mass, higher total lean mass as well as smaller adipocytes compared to WT mice. Although food intake was similar between genotypes, locomotor activity during the active period was increased in both male and female KO mice. Interestingly, only male KO mice had increased O2 consumption and CO2 production during the entire 24-hour period, suggesting an increased basal metabolic rate. Although glycemia during a glucose tolerance test was similar, KO males as well as HFD-fed females had lower plasma insulin and C-peptide levels compared to WT mice, suggesting improved insulin sensitivity. Remarkably, all KO animals exhibited higher circulating adiponectin levels, suggesting that this phenotype can occur even in the absence of a significant reduction in adipose tissue weight, as observed in females and, thus, may be a specific effect related to the (P)RR. (P)RR may be an important therapeutic target for the treatment of obesity and its associated complications such as type 2 diabetes.

  6. Nahid Sırrı Örik’in Romanlarında Aile

    OpenAIRE

    Sayar, Feyza

    2013-01-01

    In this study, The six novels of Nahid Sırrı Örik Kıskanmak, Yıldız Olmak Kolay mı?, Tersine Giden Yol, Gece Olmadan, Sultan Hamid Düşerken, Kozmopolitler were examined in terms of family approach. In the first section of the study, Nahid Sırrı Örik's life, art and works were mentioned. In the second section, generally novels in Turkish Literature which are on the subject of family were mentioned. In the third section, the plot is studied. In the fourth section family and in the fifth sect...

  7. Probabilistic safety analysis for control rod drive system of ET-RR-1

    International Nuclear Information System (INIS)

    Nasr, M.; Nasser, O.

    1988-01-01

    The International Atomic Energy Agency (IAEA) co-ordinated a Research programme on Probabilistic Safety Analysis (PSA) for research reactors; with the participation of several countries. In the framework of this project (Project Int. 9/063) the Egyptian Atomic Energy Authority decided to perform a PSA study on the ET-RR-1 (Egypt Thermal Research Reactor). The study is conducted in collaboration between the nuclear regulatory and safety centre (NRSC) and the reactor department of the nuclear research centre at Inchass. The present work is a part of the PSA study on ET-RR- it is concerning a probabilistic safety analysis of the control rod drive mechanism

  8. EPIC 201585823, a rare triple-mode RR Lyrae star discovered in K2 mission data

    DEFF Research Database (Denmark)

    Kurtz, Donald W.; Bowman, Dominic M.; Ebo, Simon J.

    2016-01-01

    We have discovered a new, rare triple-mode RR Lyr star, EPIC 201585823, in the Kepler K2 mission Campaign 1 data. This star pulsates primarily in the fundamental and first-overtone radial modes, and, in addition, a third non-radial mode. The ratio of the period of the non-radial mode...... pixels with significant signal for the star, but without correction for pointing changes, is best for frequency analysis of this star, and, by implication, other RR Lyr stars observed by the K2 mission. We compare several pipeline reductions of the K2 mission data for this star....

  9. VizieR Online Data Catalog: Type II Cepheid and RR Lyrae variables (Feast+, 2008)

    Science.gov (United States)

    Feast, M. W.; Laney, C. D.; Kinman, T. D.; van Leeuwen, F.; Whitelock, P. A.

    2008-10-01

    Infrared and optical absolute magnitudes are derived for the type II Cepheids kappa Pav and VY Pyx using revised Hipparcos parallaxes and for kappa Pav, V553 Cen and SW Tau from pulsational parallaxes. Revised Hipparcos and HST parallaxes for RR Lyrae agree satisfactorily and are combined in deriving absolute magnitudes. Phase-corrected J, H and Ks mags are given for 142 Hipparcos RR Lyraes based on Two-Micron All-Sky Survey observations. Pulsation and trigonometrical parallaxes for classical Cepheids are compared to establish the best value for the projection factor (p) used in pulsational analyses. (3 data files).

  10. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate Lignificação da planta e qualidade de sementes de soja RR pulverizadas com herbicida glifosato

    Directory of Open Access Journals (Sweden)

    Cristiane Fortes Gris

    2013-04-01

    Full Text Available Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha. The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.Diferenças nos teores de lignina na planta entre cultivares transgênicos RR e convencionais, tem sido relatadas, por vários autores, no entanto, são escassos os trabalhos avaliando a influência da aplicação do glifosato sobre os teores de lignina na planta e em sementes de soja RR. Neste sentido, objetivou-se, com este trabalho, avaliar a qualidade fisiológica de sementes de soja transgênica RR e os teores de lignina de plantas submetidas à pulverização com o herbicida glifosato. Os ensaios foram conduzidos em casa de vegetação e em campo, no munic

  11. Clinical Significance of Reverse Redistribution Phenomenon on Delayed Tc-99m Tetrofosmin Myocardial Perfusion Imaging in Patients with Acute Myocardial Infarction

    International Nuclear Information System (INIS)

    Park, Soon Ah; Kim, Dae Weung; Kim, Chang Guhn; Jeong, Jin Won; Kim, Nam Ho; Yun, Kyeong Ho

    2009-01-01

    This study was performed to investigate the clinical significance of reverse redistribution (RR) phenomenon detected on delayed Tc-99m tetrofosmin myocardial single photon emission computed tomography (SPECT) in patients with acute myocardial infarction after revascularization. A Tc-99m tetrofrosmin myocardial SPECT was performed in 67 consecutive patients after revascularization for acute myocardial infarction. Myocardial SPECT imaging was performed for early imaging at 40 min and for delayed imaging at 180 min after reinjection at myocardial stress. Regional myocardial uptakes were scored by 4-point scoring in the left ventricular wall divided into 17 segments. Reverse redistribution was defined as an increase of more than 2 point in the activity score on the delayed image. Follow-up myocardial SPECT and coronary angiography (CAG) were performed 9 months later. On myocardial SPECT performed following revascularization, RR was observed in 100 of all 319 segments (31%) and in 43 patients (64%). The abnormalities of perfusion and regional wall motion were more severe in the patients with RR compared to those without RR (p<0.05). On follow-up myocardial SPECT, the myocardial perfusion, regional wall motion, and myocardial thickness were significantly improved in the patients with RR (p<0.05) however, these changes were not significant in those without RR. There was no significant difference between the patients with RR and those without RR in the occurrence of restenosis on CAG. In patients with acute myocardial infarction, the regions showing the RR phenomenon on delayed Tc-99m tetrofosmin SPECT may reflect viable myocardium and indicate recovery of salvaged myocardium

  12. Characterization of ion implanted silicon by the electrolytic reverse current

    International Nuclear Information System (INIS)

    Hueller, J.; Pham, M.T.

    1977-01-01

    The current voltage behaviour of ion implanted silicon electrodes in HF electrolyte is investigated. The electrolytic reverse current, i.e. the reaction rate of the minority carrier limited reactions is found to increase. The current increase depends on the implanted dose and layer stripping. Reason for the increased reverse current can be referred to radiation damage acting as generation centres for minority carriers. Measurement of the electrolytic reverse current can be used for determining damage profiles. Layer stripping is carried out by anodic dissolution in the same electrolyte. The sensitivity of this new method for characterizing ion implanted silicon layers lies at 10 11 to 10 12 atoms/cm 2 . (author)

  13. An algebra of reversible computation.

    Science.gov (United States)

    Wang, Yong

    2016-01-01

    We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.

  14. Stability of UV exposed RR-P3BT films by spectroscopic ellipsometry

    International Nuclear Information System (INIS)

    Diware, Mangesh S.; Byun, J. S.; Hwang, S. Y.; Kim, T. J.; Kim, Y. D.

    2013-01-01

    Stability of regioregular poly(3-butylthiophene) (RR-P3BT) films under irradiation of ultra-violet (UV) light has been studied by spectroscopic ellipsometry at room temperature. Consistent decrease in dielectric function with UV exposure time showed the degree of degradation of polymer. This work suggests that, protective methods are mandatory to use this kind of material in optical devices.

  15. 78 FR 54149 - Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines

    Science.gov (United States)

    2013-09-03

    ... Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines AGENCY: Federal Aviation Administration (FAA... service information identified in this AD, contact Rolls-Royce plc, Corporate Communications, P.O. Box 31... per hour. Replacement parts are estimated to cost about $2,271 per engine. Based on these figures, we...

  16. 76 FR 65136 - Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines

    Science.gov (United States)

    2011-10-20

    ... Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines AGENCY: Federal Aviation Administration (FAA... information identified in this AD, contact Rolls-Royce plc, Corporate Communications, P.O. Box 31, Derby... 8, 2011, to perform the inspection. Costs of Compliance Based on the service information, we...

  17. 76 FR 52288 - Airworthiness Directives; Rolls-Royce plc (RR) Trent 800 Series Turbofan Engines

    Science.gov (United States)

    2011-08-22

    ...-0836; Directorate Identifier 2010-NE-38-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom: telephone 44 (0) 1332 242424; fax 44 (0) 1332... based on those comments. We will post all comments we receive, without change, to http://www.regulations...

  18. A HIGH-VELOCITY BULGE RR LYRAE VARIABLE ON A HALO-LIKE ORBIT

    International Nuclear Information System (INIS)

    Kunder, Andrea; Storm, J.; Rich, R. M.; Hawkins, K.; Poleski, R.; Johnson, C. I.; Shen, J.; Li, Z.-Y.; Cordero, M. J.; Nataf, D. M.; Bono, G.; Walker, A. R.; Koch, A.; De Propris, R.; Udalski, A.; Szymanski, M. K.; Soszynski, I.; Pietrzynski, G.; Ulaczyk, K.; Wyrzykowski, Ł.

    2015-01-01

    We report on the RR Lyrae variable star, MACHO 176.18833.411, located toward the Galactic bulge and observed within the data from the ongoing Bulge RR Lyrae Radial Velocity Assay, which has the unusual radial velocity of −372 ± 8 km s −1 and true space velocity of −482 ± 22 km s −1 relative to the Galactic rest frame. Located less than 1 kpc from the Galactic center and toward a field at (l, b) = (3, −2.5), this pulsating star has properties suggesting it belongs to the bulge RR Lyrae star population, yet a velocity indicating it is abnormal, at least with respect to bulge giants and red clump stars. We show that this star is most likely a halo interloper and therefore suggest that halo contamination is not insignificant when studying metal-poor stars found within the bulge area, even for stars within 1 kpc of the Galactic center. We discuss the possibility that MACHO 176.18833.411 is on the extreme edge of the bulge RR Lyrae radial velocity distribution, and also consider a more exotic scenario in which it is a runaway star moving through the Galaxy

  19. Analysis of R-R intervals in patients with atrial fibrillation at rest and during exercise

    NARCIS (Netherlands)

    Bootsma, B.K.; Hoelen, A.J.; Strackee, J.; Meijler, F.L.

    Serial autocorrelation functions and histograms of R-R intervals in patients with atrial fibrillation, with and without digitalis, at rest and during exercise, were produced by a computer. At rest with and without digitalis the first and higher order coefficients did not differ from zero. During

  20. Characterization of the VVV Survey RR Lyrae Population across the Southern Galactic Plane

    International Nuclear Information System (INIS)

    Minniti, Dante; Palma, Tali; Pullen, Joyce; Tissera, Patricia; Dékány, Istvan; Majaess, Daniel; Rejkuba, Marina; Valenti, Elena; Alonso-García, Javier; Catelan, Marcio; Contreras Ramos, Rodrigo; Zoccali, Manuela; Gonzalez, Oscar A.; Hempel, Maren; Irwin, Mike; Lucas, Philip W.; Saito, Roberto K.

    2017-01-01

    Deep near-IR images from the VISTA Variables in the Vía Láctea (VVV) Survey were used to search for RR Lyrae stars in the Southern Galactic plane. A sizable sample of 404 RR Lyrae of type ab stars was identified across a thin slice of the fourth Galactic quadrant (295° < ℓ < 350°, −2.°24 < b < −1.°05). The sample’s distance distribution exhibits a maximum density that occurs at the bulge tangent point, which implies that this primarily Oosterhoff type I population of RRab stars does not trace the bar delineated by their red clump counterparts. The bulge RR Lyrae population does not extend beyond ℓ  ∼ 340°, and the sample’s spatial distribution presents evidence of density enhancements and substructure that warrants further investigation. Indeed, the sample may be employed to evaluate Galactic evolution models, and is particularly lucrative since half of the discovered RR Lyrae are within reach of Gaia astrometric observations.

  1. Characterization of the VVV Survey RR Lyrae Population across the Southern Galactic Plane

    Energy Technology Data Exchange (ETDEWEB)

    Minniti, Dante; Palma, Tali; Pullen, Joyce; Tissera, Patricia [Departamento de Ciencias Físicas, Facultad de Ciencias Exactas, Universidad Andrés Bello, Av. Fernández Concha 700, Las Condes, Santiago (Chile); Dékány, Istvan [Astronomisches Rechen-Institut, Zentrum fuer Astronomie der Universitaet Heidelberg, Moenchhofstr. 12-14, D-69120 Heidelberg (Germany); Majaess, Daniel [Mount Saint Vincent University, Halifax, Nova Scotia (Canada); Rejkuba, Marina; Valenti, Elena [European Southern Observatory, Karl-Schwarszchild-Str. 2, D-85748 Garching bei Muenchen (Germany); Alonso-García, Javier; Catelan, Marcio; Contreras Ramos, Rodrigo; Zoccali, Manuela [Instituto Milenio de Astrofísica, Santiago (Chile); Gonzalez, Oscar A. [Institute for Astronomy, University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom); Hempel, Maren [Pontificia Universidad Católica de Chile, Instituto de Astrofisica, Av. Vicuna Mackenna 4860, Santiago (Chile); Irwin, Mike [Institute of Astronomy, Cambridge University, Cambridge, CB3 0HA (United Kingdom); Lucas, Philip W. [Department of Astronomy, University of Hertfordshire, Hertfordshire (United Kingdom); Saito, Roberto K. [Departamento de Física, Universidade Federal de Santa Catarina, Trindade 88040-900, Florianópolis, SC (Brazil)

    2017-04-01

    Deep near-IR images from the VISTA Variables in the Vía Láctea (VVV) Survey were used to search for RR Lyrae stars in the Southern Galactic plane. A sizable sample of 404 RR Lyrae of type ab stars was identified across a thin slice of the fourth Galactic quadrant (295° < ℓ < 350°, −2.°24 < b < −1.°05). The sample’s distance distribution exhibits a maximum density that occurs at the bulge tangent point, which implies that this primarily Oosterhoff type I population of RRab stars does not trace the bar delineated by their red clump counterparts. The bulge RR Lyrae population does not extend beyond ℓ  ∼ 340°, and the sample’s spatial distribution presents evidence of density enhancements and substructure that warrants further investigation. Indeed, the sample may be employed to evaluate Galactic evolution models, and is particularly lucrative since half of the discovered RR Lyrae are within reach of Gaia astrometric observations.

  2. Measure of the QT-RR Dynamic Coupling in Patients with the Long QT Syndrome

    Czech Academy of Sciences Publication Activity Database

    Halámek, Josef; Couderc, J. P.; Jurák, Pavel; Vondra, Vlastimil; Zareba, W.; Viščor, Ivo; Leinveber, P.

    2012-01-01

    Roč. 17, č. 4 (2012), s. 323-330 ISSN 1082-720X R&D Projects: GA MŠk ME09050 Institutional support: RVO:68081731 Keywords : Long QT syndrome * Dynamic QT-RR coupling * Holter recording * QT adaptation * QT parameters Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 1.084, year: 2012

  3. A HIGH-VELOCITY BULGE RR LYRAE VARIABLE ON A HALO-LIKE ORBIT

    Energy Technology Data Exchange (ETDEWEB)

    Kunder, Andrea; Storm, J. [Leibniz-Institut für Astrophysik Potsdam (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Rich, R. M. [Department of Physics and Astronomy, University of California at Los Angeles, Los Angeles, CA 90095-1562 (United States); Hawkins, K. [Institute of Astronomy, Madingley Road, Cambridge CB3 0HA (United Kingdom); Poleski, R. [Department of Astronomy, Ohio State University, 140 W. 18th Avenue, Columbus, OH 43210 (United States); Johnson, C. I. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Shen, J.; Li, Z.-Y. [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China); Cordero, M. J. [Astronomisches Rechen-Institut: Zentrum für Astronomie, Mönchhofstr. 12-14, D-69120 Heidelberg (Germany); Nataf, D. M. [Research School of Astronomy and Astrophysics, The Australian National University, Canberra, ACT 2611 (Australia); Bono, G. [Dipartimento di Fisica, Universita di Roma Tor Vergata, Via della Ricerca Scientifica 1, I-00133 Roma (Italy); Walker, A. R. [Cerro Tololo Inter-American Observatory, National Optical Astronomy Observatory, Casilla 603, La Serena (Chile); Koch, A. [Landessternwarte, Zentrum für Astronomie der Universität Heidelberg, Königstuhl 12, D-69117 Heidelberg (Germany); De Propris, R. [Finnish Centre for Astronomy with ESO (FINCA), University of Turku, Turku (Finland); Udalski, A.; Szymanski, M. K.; Soszynski, I.; Pietrzynski, G.; Ulaczyk, K.; Wyrzykowski, Ł. [Warsaw University Observatory, Al. Ujazdowskie 4, 00-478 Warszawa (Poland); and others

    2015-07-20

    We report on the RR Lyrae variable star, MACHO 176.18833.411, located toward the Galactic bulge and observed within the data from the ongoing Bulge RR Lyrae Radial Velocity Assay, which has the unusual radial velocity of −372 ± 8 km s{sup −1} and true space velocity of −482 ± 22 km s{sup −1} relative to the Galactic rest frame. Located less than 1 kpc from the Galactic center and toward a field at (l, b) = (3, −2.5), this pulsating star has properties suggesting it belongs to the bulge RR Lyrae star population, yet a velocity indicating it is abnormal, at least with respect to bulge giants and red clump stars. We show that this star is most likely a halo interloper and therefore suggest that halo contamination is not insignificant when studying metal-poor stars found within the bulge area, even for stars within 1 kpc of the Galactic center. We discuss the possibility that MACHO 176.18833.411 is on the extreme edge of the bulge RR Lyrae radial velocity distribution, and also consider a more exotic scenario in which it is a runaway star moving through the Galaxy.

  4. Gaia Data Release 1. Testing parallaxes with local Cepheids and RR Lyrae stars

    NARCIS (Netherlands)

    Gaia Collaboration, [Unknown; Clementini, G.; Eyer, L.; Ripepi, V.; Marconi, M.; Muraveva, T.; Garofalo, A.; Sarro, L. M.; Palmer, M.; Luri, X.; Molinaro, R.; Rimoldini, L.; Szabados, L.; Musella, I.; Anderson, R. I.; Prusti, T.; de Bruijne, J. H. J.; Brown, A. G. A.; Vallenari, A.; Babusiaux, C.; Bailer-Jones, C. A. L.; Bastian, U.; Biermann, M.; Evans, D. W.; Jansen, F.; Jordi, C.; Klioner, S. A.; Lammers, U.; Lindegren, L.; Mignard, F.; Panem, C.; Pourbaix, D.; Randich, S.; Sartoretti, P.; Siddiqui, H. I.; Soubiran, C.; Valette, V.; van Leeuwen, F.; Walton, N. A.; Aerts, C.; Arenou, F.; Cropper, M.; Drimmel, R.; Høg, E.; Katz, D.; Lattanzi, M. G.; O'Mullane, W.; Grebel, E. K.; Holland, A. D.; Huc, C.; Passot, X.; Perryman, M.; Bramante, L.; Cacciari, C.; Castañeda, J.; Chaoul, L.; Cheek, N.; De Angeli, F.; Fabricius, C.; Guerra, R.; Hernández, J.; Jean-Antoine-Piccolo, A.; Masana, E.; Messineo, R.; Mowlavi, N.; Nienartowicz, K.; Ordóñez-Blanco, D.; Panuzzo, P.; Portell, J.; Richards, P. J.; Riello, M.; Seabroke, G. M.; Tanga, P.; Thévenin, F.; Torra, J.; Els, S. G.; Gracia-Abril, G.; Comoretto, G.; Garcia-Reinaldos, M.; Lock, T.; Mercier, E.; Altmann, M.; Andrae, R.; Astraatmadja, T. L.; Bellas-Velidis, I.; Benson, K.; Berthier, J.; Blomme, R.; Busso, G.; Carry, B.; Cellino, A.; Cowell, S.; Creevey, O.; Cuypers, J.; Davidson, M.; De Ridder, J.; de Torres, A.; Delchambre, L.; Dell'Oro, A.; Ducourant, C.; Frémat, Y.; García-Torres, M.; Gosset, E.; Halbwachs, J.-L.; Hambly, N. C.; Harrison, D. L.; Hauser, M.; Hestroffer, D.; Hodgkin, S. T.; Huckle, H. E.; Hutton, A.; Jasniewicz, G.; Jordan, S.; Kontizas, M.; Korn, A. J.; Lanzafame, A. C.; Manteiga, M.; Moitinho, A.; Muinonen, K.; Osinde, J.; Pancino, E.; Pauwels, T.; Petit, J.-M.; Recio-Blanco, A.; Robin, A. C.; Siopis, C.; Smith, M.; Smith, K. W.; Sozzetti, A.; Thuillot, W.; van Reeven, W.; Viala, Y.; Abbas, U.; Abreu Aramburu, A.; Accart, S.; Aguado, J. J.; Allan, P. M.; Allasia, W.; Altavilla, G.; Álvarez, M. A.; Alves, J.; Andrei, A. H.; Anglada Varela, E.; Antiche, E.; Antoja, T.; Antón, S.; Arcay, B.; Bach, N.; Baker, S. G.; Balaguer-Núñez, L.; Barache, C.; Barata, C.; Barbier, A.; Barblan, F.; Barrado y Navascués, D.; Barros, M.; Barstow, M. A.; Becciani, U.; Bellazzini, M.; Bello García, A.; Belokurov, V.; Bendjoya, P.; Berihuete, A.; Bianchi, L.; Bienaymé, O.; Billebaud, F.; Blagorodnova, N.; Blanco-Cuaresma, S.; Boch, T.; Bombrun, A.; Borrachero, R.; Bouquillon, S.; Bourda, G.; Bragaglia, A.; Breddels, M. A.; Brouillet, N.; Brüsemeister, T.; Bucciarelli, B.; Burgess, P.; Burgon, R.; Burlacu, A.; Busonero, D.; Buzzi, R.; Caffau, E.; Cambras, J.; Campbell, H.; Cancelliere, R.; Cantat-Gaudin, T.; Carlucci, T.; Carrasco, J. M.; Castellani, M.; Charlot, P.; Charnas, J.; Chiavassa, A.; Clotet, M.; Cocozza, G.; Collins, R. S.; Costigan, G.; Crifo, F.; Cross, N. J. G.; Crosta, M.; Crowley, C.; Dafonte, C.; Damerdji, Y.; Dapergolas, A.; David, P.; David, M.; De Cat, P.; de Felice, F.; de Laverny, P.; De Luise, F.; De March, R.; de Souza, R.; Debosscher, J.; del Pozo, E.; Delbo, M.; Delgado, A.; Delgado, H. E.; Di Matteo, P.; Diakite, S.; Distefano, E.; Dolding, C.; Dos Anjos, S.; Drazinos, P.; Durán, J.; Dzigan, Y.; Edvardsson, B.; Enke, H.; Evans, N. W.; Eynard Bontemps, G.; Fabre, C.; Fabrizio, M.; Falcão, A. J.; Farràs Casas, M.; Federici, L.; Fedorets, G.; Fernández-Hernández, J.; Fernique, P.; Fienga, A.; Figueras, F.; Filippi, F.; Findeisen, K.; Fonti, A.; Fouesneau, M.; Fraile, E.; Fraser, M.; Fuchs, J.; Gai, M.; Galleti, S.; Galluccio, L.; Garabato, D.; García-Sedano, F.; Garralda, N.; Gavras, P.; Gerssen, J.; Geyer, R.; Gilmore, G.; Girona, S.; Giuffrida, G.; Gomes, M.; González-Marcos, A.; González-Núñez, J.; González-Vidal, J. J.; Granvik, M.; Guerrier, A.; Guillout, P.; Guiraud, J.; Gúrpide, A.; Gutiérrez-Sánchez, R.; Guy, L. P.; Haigron, R.; Hatzidimitriou, D.; Haywood, M.; Heiter, U.; Helmi, A.; Hobbs, D.; Hofmann, W.; Holl, B.; Holland, G.; Hunt, J. A. S.; Hypki, A.; Icardi, V.; Irwin, M.; Jevardat de Fombelle, G.; Jofré, P.; Jonker, P. G.; Jorissen, A.; Julbe, F.; Karampelas, A.; Kochoska, A.; Kohley, R.; Kolenberg, K.; Kontizas, E.; Koposov, S. E.; Kordopatis, G.; Koubsky, P.; Krone-Martins, A.; Kudryashova, M.; Bachchan, R. K.; Lacoste-Seris, F.; Lanza, A. F.; Lavigne, J.-B.; Le Poncin-Lafitte, C.; Lebreton, Y.; Lebzelter, T.; Leccia, S.; Leclerc, N.; Lecoeur-Taibi, I.; Lemaitre, V.; Lenhardt, H.; Leroux, F.; Liao, S.; Licata, E.; Lindstrøm, H. E. P.; Lister, T. A.; Livanou, E.; Lobel, A.; Löffler, W.; López, M.; Lorenz, D.; MacDonald, I.; Magalhães Fernandes, T.; Managau, S.; Mann, R. G.; Mantelet, G.; Marchal, O.; Marchant, J. M.; Marinoni, S.; Marrese, P. M.; Marschalkó, G.; Marshall, D. J.; Martín-Fleitas, J. M.; Martino, M.; Mary, N.; Matijevič, G.; McMillan, P. J.; Messina, S.; Michalik, D.; Millar, N. R.; Miranda, B. M. H.; Molina, D.; Molinaro, M.; Molnár, L.; Moniez, M.; Montegriffo, P.; Mor, R.; Mora, A.; Morbidelli, R.; Morel, T.; Morgenthaler, S.; Morris, D.; Mulone, A. F.; Narbonne, J.; Nelemans, G.; Nicastro, L.; Noval, L.; Ordénovic, C.; Ordieres-Meré, J.; Osborne, P.; Pagani, C.; Pagano, I.; Pailler, F.; Palacin, H.; Palaversa, L.; Parsons, P.; Pecoraro, M.; Pedrosa, R.; Pentikäinen, H.; Pichon, B.; Piersimoni, A. M.; Pineau, F.-X.; Plachy, E.; Plum, G.; Poujoulet, E.; Prša, A.; Pulone, L.; Ragaini, S.; Rago, S.; Rambaux, N.; Ramos-Lerate, M.; Ranalli, P.; Rauw, G.; Read, A.; Regibo, S.; Reylé, C.; Ribeiro, R. A.; Riva, A.; Rixon, G.; Roelens, M.; Romero-Gómez, M.; Rowell, N.; Royer, F.; Ruiz-Dern, L.; Sadowski, G.; Sagristà Sellés, T.; Sahlmann, J.; Salgado, J.; Salguero, E.; Sarasso, M.; Savietto, H.; Schultheis, M.; Sciacca, E.; Segol, M.; Segovia, J. C.; Segransan, D.; Shih, I.-C.; Smareglia, R.; Smart, R. L.; Solano, E.; Solitro, F.; Sordo, R.; Soria Nieto, S.; Souchay, J.; Spagna, A.; Spoto, F.; Stampa, U.; Steele, I. A.; Steidelmüller, H.; Stephenson, C. A.; Stoev, H.; Suess, F. F.; Süveges, M.; Surdej, J.; Szegedi-Elek, E.; Tapiador, D.; Taris, F.; Tauran, G.; Taylor, M. B.; Teixeira, R.; Terrett, D.; Tingley, B.; Trager, S. C.; Turon, C.; Ulla, A.; Utrilla, E.; Valentini, G.; van Elteren, A.; Van Hemelryck, E.; van Leeuwen, M.; Varadi, M.; Vecchiato, A.; Veljanoski, J.; Via, T.; Vicente, D.; Vogt, S.; Voss, H.; Votruba, V.; Voutsinas, S.; Walmsley, G.; Weiler, M.; Weingrill, K.; Wevers, T.; Wyrzykowski, Ł.; Yoldas, A.; Žerjal, M.; Zucker, S.; Zurbach, C.; Zwitter, T.; Alecu, A.; Allen, M.; Allende Prieto, C.; Amorim, A.; Anglada-Escudé, G.; Arsenijevic, V.; Azaz, S.; Balm, P.; Beck, M.; Bernstein, H.-H.; Bigot, L.; Bijaoui, A.; Blasco, C.; Bonfigli, M.; Bono, G.; Boudreault, S.; Bressan, A.; Brown, S.; Brunet, P.-M.; Bunclark†, P.; Buonanno, R.; Butkevich, A. G.; Carret, C.; Carrion, C.; Chemin, L.; Chéreau, F.; Corcione, L.; Darmigny, E.; de Boer, K. S.; de Teodoro, P.; de Zeeuw, P. T.; Delle Luche, C.; Domingues, C. D.; Dubath, P.; Fodor, F.; Frézouls, B.; Fries, A.; Fustes, D.; Fyfe, D.; Gallardo, E.; Gallegos, J.; Gardiol, D.; Gebran, M.; Gomboc, A.; Gómez, A.; Grux, E.; Gueguen, A.; Heyrovsky, A.; Hoar, J.; Iannicola, G.; Isasi Parache, Y.; Janotto, A.-M.; Joliet, E.; Jonckheere, A.; Keil, R.; Kim, D.-W.; Klagyivik, P.; Klar, J.; Knude, J.; Kochukhov, O.; Kolka, I.; Kos, J.; Kutka, A.; Lainey, V.; LeBouquin, D.; Liu, C.; Loreggia, D.; Makarov, V. V.; Marseille, M. G.; Martayan, C.; Martinez-Rubi, O.; Massart, B.; Meynadier, F.; Mignot, S.; Munari, U.; Nguyen, A.-T.; Nordlander, T.; O'Flaherty, K. S.; Ocvirk, P.; Olias Sanz, A.; Ortiz, P.; Osorio, J.; Oszkiewicz, D.; Ouzounis, A.; Park, P.; Pasquato, E.; Peltzer, C.; Peralta, J.; Péturaud, F.; Pieniluoma, T.; Pigozzi, E.; Poels†, J.; Prat, G.; Prod'homme, T.; Raison, F.; Rebordao, J. M.; Risquez, D.; Rocca-Volmerange, B.; Rosen, S.; Ruiz-Fuertes, M. I.; Russo, F.; Serraller Vizcaino, I.; Short, A.; Siebert, A.; Silva, H.; Sinachopoulos, D.; Slezak, E.; Soffel, M.; Sosnowska, D.; Straižys, V.; ter Linden, M.; Terrell, D.; Theil, S.; Tiede, C.; Troisi, L.; Tsalmantza, P.; Tur, D.; Vaccari, M.; Vachier, F.; Valles, P.; Van Hamme, W.; Veltz, L.; Virtanen, J.; Wallut, J.-M.; Wichmann, R.; Wilkinson, M. I.; Ziaeepour, H.; Zschocke, S.

    2017-01-01

    Context. Parallaxes for 331 classical Cepheids, 31 Type II Cepheids, and 364 RR Lyrae stars in common between Gaia and the Hipparcos and Tycho-2 catalogues are published in Gaia Data Release 1 (DR1) as part of the Tycho-Gaia Astrometric Solution (TGAS). Aims: In order to test these first parallax

  5. Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

    Science.gov (United States)

    Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

    2018-06-01

    The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  6. Influence of Age and Aerobic Fitness on the Multifractal Characteristics of Electrocardiographic RR Time-Series

    Directory of Open Access Journals (Sweden)

    Michael James Lewis

    2013-05-01

    Full Text Available Multifractal properties of electrocardiographic inter-beat (RR time-series offer insight into its long-term correlation structure, independently of RR variability. Here we quantify multifractal characteristics of RR data during 24-hour diurnal-nocturnal activity in healthy participants. We tested the hypotheses that (1 age, gender and aerobic fitness influence RR multifractal properties, and that (2 these are influenced by circadian variation.Seventy adults (39 males aged 19-58 years and of various fitness levels were monitored using 24-hour ECG. Participants were dichotomised by median age and fitness for sub-group analysis. Gender and fitness were independent of age (p=0.1, p>0.5. Younger/older group ages were substantially different (p<0.0005 and were independent of gender and fitness. Multifractality was quantified using the probability spectrum of Hölder exponents (h, from which modal h (h* and the full-width and half-widths at half-maximum measures (FWHM, HWHM+ and HWHM- were derived. FWHM decreased (p=0.004 and h* increased (p=0.011 in older people, indicating diminished long-range RR correlations and weaker anti-persistent behavior. Anti-persistent correlation (h* was strongest in the youngest/fittest individuals and weakest in the oldest/least fit individuals (p=0.015. Long-range correlation (HWHM+/FWHM was strongest in the fittest males and weakest in the least fit females (p=0.007-0.033.Multifractal RR characteristics in our healthy participants showed strong age-dependence with diminished long-range anti-persistent correlation in older people. Circadian variation of these characteristics was influenced by fitness and gender: fitter males and females of all ages had the greatest degree of multifractality or long-range order. Multifractal characterisation appears to be a useful method for exploring the physiological basis of long-term correlation structure in RR time-series as well as the benefits thereon of physical fitness training.

  7. Sex reversal in vertebrates

    OpenAIRE

    2016-01-01

    This special topic issue of Sexual Development gives an overview of sex reversal in vertebrates, from fishes naturally changing their sex, to rodents escaping the mammalian SRY-determining system. It offers eight up-to-date reviews on specific subjects in sex reversal, considering fishes, amphibians, reptiles, birds, marsupials, and placental mammals, including humans. The broad scope of represented animals makes this ideal for students and researchers, especially those interested in the...

  8. QT-RR relationships and suitable QT correction formulas for halothane-anesthetized dogs.

    Science.gov (United States)

    Tabo, Mitsuyasu; Nakamura, Mikiko; Kimura, Kazuya; Ito, Shigeo

    2006-10-01

    Several QT correction (QTc) formulas have been used for assessing the QT liability of drugs. However, they are known to under- and over-correct the QT interval and tend to be specific to species and experimental conditions. The purpose of this study was to determine a suitable formula for halothane-anesthetized dogs highly sensitive to drug-induced QT interval prolongation. Twenty dogs were anesthetized with 1.5% halothane and the relationship between the QT and RR intervals were obtained by changing the heart rate under atrial pacing conditions. The QT interval was corrected for the RR interval by applying 4 published formulas (Bazett, Fridericia, Van de Water, and Matsunaga); Fridericia's formula (QTcF = QT/RR(0.33)) showed the least slope and lowest R(2) value for the linear regression of QTc intervals against RR intervals, indicating that it dissociated changes in heart rate most effectively. An optimized formula (QTcX = QT/RR(0.3879)) is defined by analysis of covariance and represents a correction algorithm superior to Fridericia's formula. For both Fridericia's and the optimized formula, QT-prolonging drugs (d,l-sotalol, astemizole) showed QTc interval prolongation. A non-QT-prolonging drug (d,l-propranolol) failed to prolong the QTc interval. In addition, drug-induced changes in QTcF and QTcX intervals were highly correlated with those of the QT interval paced at a cycle length of 500 msec. These findings suggest that Fridericia's and the optimized formula, although the optimized is a little bit better, are suitable for correcting the QT interval in halothane-anesthetized dogs and help to evaluate the potential QT prolongation of drugs with high accuracy.

  9. On thermodynamic and microscopic reversibility

    International Nuclear Information System (INIS)

    Crooks, Gavin E

    2011-01-01

    The word 'reversible' has two (apparently) distinct applications in statistical thermodynamics. A thermodynamically reversible process indicates an experimental protocol for which the entropy change is zero, whereas the principle of microscopic reversibility asserts that the probability of any trajectory of a system through phase space equals that of the time reversed trajectory. However, these two terms are actually synonymous: a thermodynamically reversible process is microscopically reversible, and vice versa

  10. The ACS LCID project : RR Lyrae stars as tracers of old population gradients in the isolated dwarf spheroidal galaxy tucana

    NARCIS (Netherlands)

    Bernard, Edouard J.; Gallart, Carme; Monelli, Matteo; Aparicio, Antonio; Cassisi, Santi; Skillman, Evan D.; Stetson, Peter B.; Cole, Andrew A.; Drozdovsky, Igor; Hidalgo, Sebastian L.; Mateo, Mario; Tolstoy, Eline

    2008-01-01

    We present a study of the radial distribution of RR Lyrae variables, which present a range of photometric and pulsational properties, in the dwarf spheroidal galaxy Tucana. We find that the fainter RR Lyrae stars, having a shorter period, are more centrally concentrated than the more luminous,

  11. [The characteristics of RR-Lorenz plot in persistent atrial fibrillation patients complicating with escape beats and rhythm].

    Science.gov (United States)

    Pan, Yunping; Zhang, Fangfang; Liu, Ru; Jing, Yan; Shen, Jihong; Li, Zhongjian; Zhu, Huaijie

    2014-06-01

    To explore the characteristics of RR-Lorenz plot in persistent atrial fibrillation (AF) patients complicating with escape beats and rhythm though ambulatory electrocardiogram. The 24-hour ambulatory electrocardiogram of 291 persistent AF patients in second affiliated hospital of Zhengzhou university from July 2005 to April 2013 were retrospectively analyzed and the RR interval and the QRS wave were measured. Patients were divided into two groups according to the distribution of the RR-Lorenz point [AF without escape beats and rhythm group (Group A, n = 259) and AF with escape beats and rhythm group (Group B, n = 32)]. The characteristics of RR-Lorenz plot between the two groups were compared. (1) Fan-shaped RR-Lorenz plots were evidenced in Group A. (2)In Group B, 30 cases showed fan-shaped with L-shaped and a short dense rods along 45° line. The proportion of escape beats and rhythm was 0.28% (275/98 369) -14.06% (11 263/80 112) . The other 2 cases in group B showed no typical RR-Lorenz plots features. RR-Lorenz plot could help to quickly diagnose persistent AF complicating with escape beats and rhythm according to the typical RR-Lorenz plot characteristics in 24-hour ambulatory electrocardiogram.

  12. 76 FR 78805 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines

    Science.gov (United States)

    2011-12-20

    ... Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation... all Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines. This AD results from mandatory... inspection of the FOHE mounts. We did not change the AD based on this comment. Request To Add Requirement To...

  13. Biofuel and Biochemical Analysis of Amphora coffeaeformis RR03, a Novel Marine Diatom, Cultivated in an Open Raceway Pond

    Directory of Open Access Journals (Sweden)

    Muthu Ganesan Rajaram

    2018-05-01

    Full Text Available (1 Background: To increase the biochemical productivity and to reduce the production cost of microalgal biodiesel, this study aimed to investigate the effects of CO2 on biomass, fatty acids, carbon-hydrogen, and biochemical accumulation of the marine diatom, Amphora coffeaeformis RR03 (A. coffeaeformis RR03. (2 Methods: Fatty acid composition of the dry biomass of A. coffeaeformis RR03 was analysed using Gas chromatography-mass spectrometry (GC-MS. (3 Results: The results showed that A. coffeaeformis RR03 contained high biomass productivity and biochemical composition in different cultivation conditions. A. coffeaeformis RR03 showed maximum growth of 5.2 × 106/mL on 21st day cultivation under CO2 supply. The bio-crude oil production from A. coffeaeformis RR03 was 36.19 megajoule (MJ. GC-MS analysis found that the dry biomass of A. coffeaeformis RR03 contained maximum of 47.72% fatty acids of 16-octadecanoic acid methyl ester (10:12 and 19.58% pentadecanoic acid, 13-methyl-, and methyl ester (9.24. (4 Conclusion: The results of this study may suggest that a novel diatom of A. coffeaeformis RR03 could be a suitable candidate for biocrude production in order to meet the future demand of energy.

  14. Does Kepler unveil the mystery of the Blazhko effect? First detection of period doubling in Kepler Blazhko RR Lyrae stars

    DEFF Research Database (Denmark)

    Szabó, R.; Kollath, Z.; Molnár, L.

    2010-01-01

    -doubling bifurcation in our non-linear RR Lyrae models computed by the Florida-Budapest hydrocode. This enabled us to trace the origin of this instability in RR Lyrae stars to a resonance, namely a 9:2 resonance between the fundamental mode and a high-order (ninth) radial overtone showing strange-mode characteristics...

  15. Nuclear reactions

    International Nuclear Information System (INIS)

    Lane, A.M.

    1980-01-01

    In reviewing work at Harwell over the past 25 years on nuclear reactions it is stated that a balance has to be struck in both experiment and theory between work on cross-sections of direct practical relevance to reactors and on those relevant to an overall understanding of reaction processes. The compound nucleus and direct process reactions are described. Having listed the contributions from AERE, Harwell to developments in nuclear reaction research in the period, work on the optical model, neutron capture theory, reactions at doorway states with fine structure, and sum-rules for spectroscopic factors are considered in more detail. (UK)

  16. Kepler photometry of the prototypical Blazhko star RR Lyr: an old friend seen in a new light

    DEFF Research Database (Denmark)

    Kolenberg, Katrien; Bryson, S.; Szabó, R.

    2011-01-01

    We present our analysis of the long-cadence Kepler data for the well-studied Blazhko star RR Lyr, gathered during the first two quarters of the satellite's observations and covering a total of 127 d. Besides being of great importance for our understanding of RR Lyrae stars in general, these RR Lyr...... data can be regarded as a case study for observations of bright stars with Kepler. Kepler can perform high-precision photometry on targets like RR Lyr, as the saturated flux is conserved to a very high degree. The Kepler data on RR Lyr are revolutionary in several respects. Even with long......-cadence sampling (one measurement per 29.4 min), the unprecedented precision (star's extreme light-curve variations in detail. The multiplet structures at the main frequency and its harmonics, typical for Blazhko stars, are clearly detected up...

  17. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    International Nuclear Information System (INIS)

    Zeller, P.; Clement, M.; Fessard, V.

    2011-01-01

    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  18. Reversible Communicating Processes

    Directory of Open Access Journals (Sweden)

    Geoffrey Brown

    2016-02-01

    Full Text Available Reversible distributed programs have the ability to abort unproductive computation paths and backtrack, while unwinding communication that occurred in the aborted paths. While it is natural to assume that reversibility implies full state recovery (as with traditional roll-back recovery protocols, an interesting alternative is to separate backtracking from local state recovery. For example, such a model could be used to create complex transactions out of nested compensable transactions where a programmer-supplied compensation defines the work required to "unwind" a transaction. Reversible distributed computing has received considerable theoretical attention, but little reduction to practice; the few published implementations of languages supporting reversibility depend upon a high degree of central control. The objective of this paper is to demonstrate that a practical reversible distributed language can be efficiently implemented in a fully distributed manner. We discuss such a language, supporting CSP-style synchronous communication, embedded in Scala. While this language provided the motivation for the work described in this paper, our focus is upon the distributed implementation. In particular, we demonstrate that a "high-level" semantic model can be implemented using a simple point-to-point protocol.

  19. Requirements for DNA strand transfer during reverse transcription in mutant HIV-1 virions

    NARCIS (Netherlands)

    Berkhout, B.; van Wamel, J.; Klaver, B.

    1995-01-01

    Retroviruses convert their RNA genome into a DNA form by means of reverse transcription. According to the current model of reverse transcription, two strand transfer reactions are needed to synthesize a full-length DNA genome. Because reverse transcription is initiated close to the 5' end of the RNA

  20. Annotation and analysis of a large cuticular protein family with the R&R Consensus in Anopheles gambiae

    Directory of Open Access Journals (Sweden)

    He Ningjia

    2008-01-01

    Full Text Available Abstract Background The most abundant family of insect cuticular proteins, the CPR family, is recognized by the R&R Consensus, a domain of about 64 amino acids that binds to chitin and is present throughout arthropods. Several species have now been shown to have more than 100 CPR genes, inviting speculation as to the functional importance of this large number and diversity. Results We have identified 156 genes in Anopheles gambiae that code for putative cuticular proteins in this CPR family, over 1% of the total number of predicted genes in this species. Annotation was verified using several criteria including identification of TATA boxes, INRs, and DPEs plus support from proteomic and gene expression analyses. Two previously recognized CPR classes, RR-1 and RR-2, form separate, well-supported clades with the exception of a small set of genes with long branches whose relationships are poorly resolved. Several of these outliers have clear orthologs in other species. Although both clades are under purifying selection, the RR-1 variant of the R&R Consensus is evolving at twice the rate of the RR-2 variant and is structurally more labile. In contrast, the regions flanking the R&R Consensus have diversified in amino-acid composition to a much greater extent in RR-2 genes compared with RR-1 genes. Many genes are found in compact tandem arrays that may include similar or dissimilar genes but always include just one of the two classes. Tandem arrays of RR-2 genes frequently contain subsets of genes coding for highly similar proteins (sequence clusters. Properties of the proteins indicated that each cluster may serve a distinct function in the cuticle. Conclusion The complete annotation of this large gene family provides insight on the mechanisms of gene family evolution and clues about the need for so many CPR genes. These data also should assist annotation of other Anopheles genes.

  1. Economic impact of reversion

    International Nuclear Information System (INIS)

    2005-01-01

    Estimations of the Norwegian hydropower production and various reversion models' market value have been made. The value of the Norwegian hydropower production until 01.01.2007 is estimated to about Nok 289 billion after taxes, or about 2,42 Nok/kWh medium production, given an expected future electricity price of around 0,25 Nok/kWh and a discount rate at 6,5 percent in nominal terms after taxes. The estimate is slightly above the level of prices for Norwegian hydropower plants in the last 8-10 years. The value of reversion in private plants which today have a limited licence time is estimated to Nok 5,5 billion. The value of reversion in public-owned Norwegian hydropower plants are about Nok 21 billion with a 60 year licence period from 01.01.2007, and about 12 billion for 75 years (ml)

  2. THE IMPACT OF CONTAMINATED RR LYRAE/GLOBULAR CLUSTER PHOTOMETRY ON THE DISTANCE SCALE

    Energy Technology Data Exchange (ETDEWEB)

    Majaess, D.; Turner, D.; Lane, D. [Department of Astronomy and Physics, Saint Mary' s University, Halifax, NS B3H 3C3 (Canada); Gieren, W., E-mail: dmajaess@ap.smu.ca [Departamento de Astronomia, Universidad de Concepcion, Casilla 160-C, CL Concepcion (Chile)

    2012-06-10

    RR Lyrae variables and the stellar constituents of globular clusters are employed to establish the cosmic distance scale and age of the universe. However, photometry for RR Lyrae variables in the globular clusters M3, M15, M54, M92, NGC 2419, and NGC 6441 exhibit a dependence on the clustercentric distance. For example, variables and stars positioned near the crowded high-surface brightness cores of the clusters may suffer from photometric contamination, which invariably affects a suite of inferred parameters (e.g., distance, color excess, absolute magnitude, etc.). The impetus for this study is to mitigate the propagation of systematic uncertainties by increasing awareness of the pernicious impact of contaminated and radial-dependent photometry.

  3. Reversible deep disposal

    International Nuclear Information System (INIS)

    2009-10-01

    This presentation, given by the national agency of radioactive waste management (ANDRA) at the meeting of October 8, 2009 of the high committee for the nuclear safety transparency and information (HCTISN), describes the concept of deep reversible disposal for high level/long living radioactive wastes, as considered by the ANDRA in the framework of the program law of June 28, 2006 about the sustainable management of radioactive materials and wastes. The document presents the social and political reasons of reversibility, the technical means considered (containers, disposal cavities, monitoring system, test facilities and industrial prototypes), the decisional process (progressive development and blocked off of the facility, public information and debate). (J.S.)

  4. R-matrix and RR-matrix calculations for cross sections for photoionization of outermost subshell in nobile gas atoms

    International Nuclear Information System (INIS)

    Tiwary, S.N.

    2000-02-01

    Photon impact integral ionization cross section (σ) as well as photoelectron asymmetry parameter (β) for the reactions hν+Ne(1s 2 2s 2 2p 6 ) → Ne + (1s 2 2s 2 2p 5 ) + e - , hν+Ar(1s 2 2s 2 2p 6 3s 2 3p 6 ) → Ar + (1s 2 2s 2 2p 6 3s 2 3p 5 ) + e - , hν+Kr(1s 2 2s 2 2p 6 3s 2 3p 6 3d 10 4s 2 4p 6 ) → Kr + (1s 2 2s 2 2p 6 3s 2 3p 6 3d 10 4s 2 4p 5 ) + e - and hν+Xe(1s 2 2s 2 2p 6 3s 2 3p 6 3d 10 4s 2 4p 6 4d 10 5s 2 5p 6 ) → Xe + (1s 2 2s 2 2p 6 3s 2 3p 6 3d 10 4s 2 4p 6 4d 10 5s 2 5p 5 ) + e - have been calculated in the L-S and j-j coupling schemes using Hartree-Fock (HF) wavefunctions within the reliable non-relativistic R-matrix as well as relativistic R-matrix (RR-matrix) methods in both the length and velocity gauges in the energy range of experimental data available. Comparison is made with all available experimental data as well as other theoretical results. Our present theoretical investigation clearly demonstrates that there is a good agreement between our present R-matrix results and RR-matrix results as well as with other results in the case of neon which reflects that the correlation and relativity are not important in this case, in the energy range of present consideration. Whereas in the case of xenon (Z=54), the independent-particle approximation completely breaks down, i.e., HF cross sections are both qualitatively as well as quantitatively incorrect in the entire energy range which exhibit that the multielectron correlation as well as relativity are both important but interchannel interactions are more important than the intrachannel interaction and relativity for obtaining high precision results. (author)

  5. Research performed at the ET-RR-1 reactor using the neutron scattering equipment

    International Nuclear Information System (INIS)

    Adib, M.; Maayouf, R.M.A.; Abdel-Kawy, A.

    1990-02-01

    This report represents the results of studies and measurements, performed at the ET-RR-1 reactor, using the neutron scattering equipment supplied by the IAEA according to the technical assistance project EGY/1/11/10. The results of these studies, starting in 1980 and continuing to date, are discussed; the use of the equipment, both as a neutron monochromator and fixed scattering angle spectrometer, is also assessed. (author). 19 refs, 17 figs

  6. Gaia Data Release 1. Testing the parallaxes with local Cepheids and RR Lyrae stars

    OpenAIRE

    Gaia Collaboration; Clementini, G.; Eyer, L.; Ripepi, V.; Marconi, M.; Muraveva, T.; Garofalo, A.; Sarro, L. M.; Palmer, M.; Luri, X.; Molinaro, R.; Rimoldini, L.; Szabados, L.; Musella, I.; Anderson, R. I.

    2017-01-01

    Context. Parallaxes for 331 classical Cepheids, 31 Type II Cepheids, and 364 RR Lyrae stars in common between Gaia and the HIPPARCOS and Tycho-2 catalogues are published in Gaia Data Release 1 (DR1) as part of the Tycho-Gaia Astrometric Solution (TGAS). Aims. In order to test these first parallax measurements of the primary standard candles of the cosmological distance ladder, which involve astrometry collected by Gaia during the initial 14 months of science operation, we compared them with l...

  7. Gated current integrator for the beam in the RR barrier buckets

    Energy Technology Data Exchange (ETDEWEB)

    A. Cadorn; C. Bhat; J. Crisp

    2003-06-10

    At the Fermilab Recycler Ring (RR), the antiproton (pbar) beam will be stored azimuthally in different segments created by barrier buckets. The beam in each segment may have widely varying intensities. They have developed a gated integrator system to measure the beam intensity in each of the barrier bucket. Here they discuss the design of the system and the results of beam measurements using the integrator.

  8. GAUGE R&R FOR AN OPTICAL MICROMETER INDUSTRIAL TYPE MACHINE

    Directory of Open Access Journals (Sweden)

    Georgia A. Louka

    2010-12-01

    Full Text Available The measurement of the uncertainty of a metric system, as 'Gauge R&R' and the collation of results between the Xbar & R and the ANOVA method, are extended in this essay. In an academic school laboratory we accomplished a sequence of measurements with the use of an Optical Micrometer Industrial Type Machine (MUL 300. This paper analyzes the measurement system that used in the laboratory and checks the reasons of the variability's provocation that observed in the machine, between the theoretical calculations and measurements. In order to find out this problem, we will use the 'Gage Repeatability and Reproducibility' technique of Measurement System Analysis (M.S.A.. This technique uses analysis of variance. In addition, will use Minitab program in order to find out the factors that we have in the whole experiment as enlarge the problem of measurements. In this paper, a statistical method using the correlation between Gage R&R and process capability indices is proposed for evaluating the adequacy of the acceptance criteria of P/T ratio. Finally, a comparative analysis has also been performed for evaluating the accuracy of Gage R&R between two methods (ANOVA and R- Xbar method. Hopefully, the results of this research can provide a useful reference for quality practitioners in various industries.

  9. Calcium abundance of RR Lyrae variables in ω Centaurri and M22

    International Nuclear Information System (INIS)

    Manduca, A.; Bell, R.A.

    1978-01-01

    Freeman and Rodgers observed 25 RR Lyrae variables in ω Cen and reported a range in calcium abundance from [Ca/H] = -0.4 to -1.6. This result, however, has been difficult to reconcile with other recent studies of the giant branch of ω Cen. with a model-atmosphere grid covering the physical parameters expected for RR Lyrae variables, Freeman and Rodgers's data were reanalyzed, by use of their basic method of theoretical relations among the equivalent widths of the K, H4b, and H delta lines and [Ca/H] but with an alternative, synthetic-spectrum approach to the calibration of these relations. When interpreted with the present calibration, the data yield a range in calcium abundance from [Ca/H] = -1.0 to -1.9 for the ω Cen RR Lyrae variables. This calibration applied to the M22 data of Butler et al gives [Ca/H] = -1.25 for M22. 2 figures, 1 table

  10. Studies for the radiation levels and shielding in RR73, RR77 and UJ76 in IR7 for collimation phase 1 - 035

    CERN Document Server

    Tsoulou, A; Ferrari, A; CERN. Geneva. AB Department

    2005-01-01

    The Collimation project is one of the most crucial for the LHC performance. 54 movable, two-sided collimators will be placed in two insertions, i.e. IR3 and IR7, which will be among the most radioactive in the LHC. For a normal machine operation, it is essential that the electronics do not degrade or fail â€" at least very often â€" due to irradiation. The radiation levels initially estimated in IR7 (RR73/77 and UJ76) were too high for the electronics to tolerate. A shielding study was necessary to be done, in parallel with the study for the absorber positions. This article summarizes the shielding proposed and the radiation levels calculated for the final collimator and absorber positions as indicated by the FLUKA team.

  11. Studies for the radiation levels and shielding in RR73, RR77 and UJ76 in IR7 for collimation phase 1 - 372

    CERN Document Server

    Tsoulou, A; Ferrari, A

    2005-01-01

    The Collimation project is one of the most crucial for the LHC performance. 54 movable, two-sided collimators will be placed in two insertions, i.e. IR3 and IR7, which will be among the most radioactive in the LHC. For a normal machine operation, it is essential that the electronics do not degrade or fail â€" at least very often â€" due to irradiation. The radiation levels initially estimated in IR7 (RR73/77 and UJ76) were too high for the electronics to tolerate. A shielding study was necessary to be done, in parallel with the study for the absorber positions. This article summarizes the shielding proposed and the radiation levels calculated for the final collimator and absorber positions as indicated by the FLUKA team.

  12. Thermosensory reversal effect quantified

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2008-01-01

    At room temperature, some materials feel colder than others due to differences in thermal conductivity, heat capacity and geometry. When the ambient temperature is well above skin temperature, the roles of 'cold' and 'warm' materials are reversed. In this paper, this effect is quantified by

  13. Thermosensory reversal effect quantified

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2008-01-01

    At room temperature, some materials feel colder than others due to differences in thermal conductivity, heat capacity and geometry. When the ambient temperature is well above skin temperature, the roles of ‘cold’ and ‘warm’ materials are reversed. In this paper, this effect is quantified by

  14. Time reversal communication system

    Science.gov (United States)

    Candy, James V.; Meyer, Alan W.

    2008-12-02

    A system of transmitting a signal through a channel medium comprises digitizing the signal, time-reversing the digitized signal, and transmitting the signal through the channel medium. The channel medium may be air, earth, water, tissue, metal, and/or non-metal.

  15. Engineering Encounters: Reverse Engineering

    Science.gov (United States)

    McGowan, Veronica Cassone; Ventura, Marcia; Bell, Philip

    2017-01-01

    This column presents ideas and techniques to enhance your science teaching. This month's issue shares information on how students' everyday experiences can support science learning through engineering design. In this article, the authors outline a reverse-engineering model of instruction and describe one example of how it looked in our fifth-grade…

  16. Sex Reversal in Birds.

    Science.gov (United States)

    Major, Andrew T; Smith, Craig A

    2016-01-01

    Sexual differentiation in birds is controlled genetically as in mammals, although the sex chromosomes are different. Males have a ZZ sex chromosome constitution, while females are ZW. Gene(s) on the sex chromosomes must initiate gonadal sex differentiation during embryonic life, inducing paired testes in ZZ individuals and unilateral ovaries in ZW individuals. The traditional view of avian sexual differentiation aligns with that expounded for other vertebrates; upon sexual differentiation, the gonads secrete sex steroid hormones that masculinise or feminise the rest of the body. However, recent studies on naturally occurring or experimentally induced avian sex reversal suggest a significant role for direct genetic factors, in addition to sex hormones, in regulating sexual differentiation of the soma in birds. This review will provide an overview of sex determination in birds and both naturally and experimentally induced sex reversal, with emphasis on the key role of oestrogen. We then consider how recent studies on sex reversal and gynandromorphic birds (half male:half female) are shaping our understanding of sexual differentiation in avians and in vertebrates more broadly. Current evidence shows that sexual differentiation in birds is a mix of direct genetic and hormonal mechanisms. Perturbation of either of these components may lead to sex reversal. © 2016 S. Karger AG, Basel.

  17. Elastomers with Reversible Nanoporosity

    DEFF Research Database (Denmark)

    Szewczykowski, Piotr Przemyslaw; Andersen, K.; Schulte, Lars

    2009-01-01

    nanostructure and displays liquid-filled cavities. Upon several cycles of swelling and drying the cavities open and close in a reversible fashion. When exposed to a nonsolvent, the material remains collapsed. This discriminating behavior of liquid-material interaction holds potential for the use...

  18. Dual kinetic curves in reversible electrochemical systems.

    Directory of Open Access Journals (Sweden)

    Michael J Hankins

    Full Text Available We introduce dual kinetic chronoamperometry, in which reciprocal relations are established between the kinetic curves of electrochemical reactions that start from symmetrical initial conditions. We have performed numerical and experimental studies in which the kinetic curves of the electron-transfer processes are analyzed for a reversible first order reaction. Experimental tests were done with the ferrocyanide/ferricyanide system in which the concentrations of each component could be measured separately using the platinum disk/gold ring electrode. It is shown that the proper ratio of the transient kinetic curves obtained from cathodic and anodic mass transfer limited regions give thermodynamic time invariances related to the reaction quotient of the bulk concentrations. Therefore, thermodynamic time invariances can be observed at any time using the dual kinetic curves for reversible reactions. The technique provides a unique possibility to extract the non-steady state trajectory starting from one initial condition based only on the equilibrium constant and the trajectory which starts from the symmetrical initial condition. The results could impact battery technology by predicting the concentrations and currents of the underlying non-steady state processes in a wide domain from thermodynamic principles and limited kinetic information.

  19. Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

    Directory of Open Access Journals (Sweden)

    Gilberto Simeone Henriques

    2005-12-01

    , primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of testis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1 initial cDNA concentration of 2 µg, (2 primer concentration of 200nM, (3 hybridization temperature between 57.5ºC and 60.1ºC and (4 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

  20. Model of 1/f noise in ion implanted resistors as a function of the resistance, determined by a reverse bias voltage

    International Nuclear Information System (INIS)

    Beck, H.G.E.

    1979-01-01

    A model is presented for the 1/f noise in ion-implanted resistors. The resistance was changed by a reverse bias voltage. The model explains the experimentally found square dependence between the relative 1/f noise intensity C/C 0 and the relative change in resistance R/R 0 . (author)

  1. Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A.

    Science.gov (United States)

    Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong

    2007-06-30

    Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

  2. Artificial Self-Sufficient P450 in Reversed Micelles

    Directory of Open Access Journals (Sweden)

    Teruyuki Nagamune

    2010-04-01

    Full Text Available Cytochrome P450s are heme-containing monooxygenases that require electron transfer proteins for their catalytic activities. They prefer hydrophobic compounds as substrates and it is, therefore, desirable to perform their reactions in non-aqueous media. Reversed micelles can stably encapsulate proteins in nano-scaled water pools in organic solvents. However, in the reversed micellar system, when multiple proteins are involved in a reaction they can be separated into different micelles and it is then difficult to transfer electrons between proteins. We show here that an artificial self-sufficient cytochrome P450, which is an enzymatically crosslinked fusion protein composed of P450 and electron transfer proteins, showed micelle-size dependent catalytic activity in a reversed micellar system. Furthermore, the presence of thermostable alcohol dehydrogenase promoted the P450-catalyzed reaction due to cofactor regeneration.

  3. Reversed field pinch diagnostics

    International Nuclear Information System (INIS)

    Weber, P.G.

    1986-01-01

    The Reversed Field Pinch (RFP) is a toroidal, axisymmetric magnetic confinement configuration characterized by a magnetic field configuration in which the toroidal magnetic field is of similar strength to the poloidal field, and is reversed at the edge compared to the center. The RFP routinely operates at high beta, and is a strong candidate for a compact fusion device. Relevant attributes of the configuration will be presented, together with an overview of present and planned experiments and their diagnostics. RFP diagnostics are in many ways similar to those of other magnetic confinement devices (such as tokamaks); these lectures will point out pertinent differences, and will present some diagnostics which provide special insights into unique attributes of the RFP

  4. Posterior Reversible Encephalopathy (PRES)

    International Nuclear Information System (INIS)

    Moron E, Fanny E; Diaz Marchan, Pedro

    2005-01-01

    The Posterior Reversible Encephalopathy Syndrome (PRES) is a clinical Syndrome composed of cephalea, alteration in vision and convulsions, usually observed in patients with sudden elevation of arterial pressure. The imagenologic evidence shows reversible vasogenic brain edema without stroke. Its location is predominantly posterior; it affects the cortex and the subcortical white matter of the occipital, parietal and temporal lobes. The treatment with antihypertensive drugs and the removing of immunosupressor medication are generally associated with complete neurological recovery; this is reflected also in the images which return to their basal condition. The untreated hypertension, on the other side, can result in a progressive defect of the autoregulation system of the central nervous system with cerebral hemorrhage, irreversible brain stroke, coma and death

  5. Quasielastic reactions

    International Nuclear Information System (INIS)

    Henning, W.

    1979-01-01

    Quasielastic reaction studies, because of their capability to microscopically probe nuclear structure, are still of considerable interest in heavy-ion reactions. The recent progress in understanding various aspects of the reaction mechanism make this aim appear closer. The relation between microscopic and macroscopic behavior, as suggested, for example, by the single proton transfer data to individual final states or averaged excitation energy intervals, needs to be explored. It seems particularly useful to extend measurements to higher incident energies, to explore and understand nuclear structure aspects up to the limit of the energy range where they are important

  6. Reversible infantile mitochondrial diseases.

    Science.gov (United States)

    Boczonadi, Veronika; Bansagi, Boglarka; Horvath, Rita

    2015-05-01

    Mitochondrial diseases are usually severe and progressive conditions; however, there are rare forms that show remarkable spontaneous recoveries. Two homoplasmic mitochondrial tRNA mutations (m.14674T>C/G in mt-tRNA(Glu)) have been reported to cause severe infantile mitochondrial myopathy in the first months of life. If these patients survive the first year of life by extensive life-sustaining measures they usually recover and develop normally. Another mitochondrial disease due to deficiency of the 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU) causes severe liver failure in infancy, but similar to the reversible mitochondrial myopathy, within the first year of life these infants may also recover completely. Partial recovery has been noted in some other rare forms of mitochondrial disease due to deficiency of mitochondrial tRNA synthetases and mitochondrial tRNA modifying enzymes. Here we summarize the clinical presentation of these unique reversible mitochondrial diseases and discuss potential molecular mechanisms behind the reversibility. Understanding these mechanisms may provide the key to treatments of potential broader relevance in mitochondrial disease, where for the majority of the patients no effective treatment is currently available.

  7. Positioning paper on reversibility

    International Nuclear Information System (INIS)

    2016-01-01

    After having recalled the legal framework adopted in 2006 for the deep geological storage of radioactive wastes, and briefly introduced the concept of reversibility, this publication presents the principle of geological storage, presents high and medium level and long life wastes, highlights the ethical necessity to deal with these radioactive wastes, outlines that geological storage is the generally admitted and adopted solution at the international level, and presents additional means implemented for radioactive waste management. It presents the Cigeo project as the technical answer to the issue of radioactive waste storage, describes the Cigeo development process, its current status and its development planning, and justifies the choice of this technical solution, notably from an ethical point of view. It addresses the issue of reversibility and proposes an overview of the various tools and means which aim at guaranteeing this reversibility. Appendices propose figures illustrating the Cigeo project and its development process, and a rather detailed Power Point presentation of the project by the ANDRA (history, object, planning, installations, and so on)

  8. Rodent Research-1 (RR1) NASA Validation Flight: Mouse extensor digitorum longus muscle transcriptomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...

  9. Rodent Research-1 (RR1) NASA Validation Flight: Mouse tibialis anterior muscle transcriptomic proteomic and epigenomic data

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA s Rodent Research (RR) project is playing a critical role in advancing biomedical research on the physiological effects of space environments. Due to the...

  10. cycloaddition reactions

    Indian Academy of Sciences (India)

    Unknown

    Molecular Modeling Group, Organic Chemical Sciences, Indian Institute of Chemical Technology,. Hyderabad ... thus obtained are helpful to model the regioselectivity ... compromise to model Diels–Alder reactions involving ...... acceptance.

  11. Comparison of spontaneous vs. metronome-guided breathing on assessment of vagal modulation using RR variability.

    Science.gov (United States)

    Bloomfield, D M; Magnano, A; Bigger, J T; Rivadeneira, H; Parides, M; Steinman, R C

    2001-03-01

    R-R interval variability (RR variability) is increasingly being used as an index of autonomic activity. High-frequency (HF) power reflects vagal modulation of the sinus node. Since vagal modulation occurs at the respiratory frequency, some investigators have suggested that HF power cannot be interpreted unless the breathing rate is controlled. We hypothesized that HF power during spontaneous breathing would not differ significantly from HF power during metronome-guided breathing. We measured HF power during spontaneous breathing in 20 healthy subjects and 19 patients with heart disease. Each subject's spontaneous breathing rate was determined, and the calculation of HF power was repeated with a metronome set to his or her average spontaneous breathing rate. There was no significant difference between the logarithm of HF power measured during spontaneous and metronome-guided breathing [4.88 +/- 0.29 vs. 5.29 +/- 0.30 ln(ms(2)), P = 0.32] in the group as a whole and when patients and healthy subjects were examined separately. We did observe a small (9.9%) decrease in HF power with increasing metronome-guided breathing rates (from 9 to 20 breaths/min). These data indicate that HF power during spontaneous and metronome-guided breathing differs at most by very small amounts. This variability is several logarithmic units less than the wide discrepancies observed between healthy subjects and cardiac patients with a heterogeneous group of cardiovascular disorders. In addition, HF power is relatively constant across the range of typical breathing rates. These data indicate that there is no need to control breathing rate to interpret HF power when RR variability (and specifically HF power) is used to identify high-risk cardiac patients.

  12. Status of time reversal invariance

    International Nuclear Information System (INIS)

    Henley, E.M.

    1989-01-01

    Time Reversal Invariance is introduced, and theories for its violation are reviewed. The present experimental and theoretical status of Time Reversal Invariance and tests thereof will be presented. Possible future tests will be discussed. 30 refs., 2 figs., 1 tab

  13. Multipurpose RTOF Fourier diffractometer at the ET-RR-1 reactor

    International Nuclear Information System (INIS)

    Maayouf, R.M.A.; Tiitta, A.T.

    1993-09-01

    The present work represents a further study of the basic RTOF Fourier multipurpose diffractometer, to start with, at the ET-RR-1 reactor. The functions of the suggested arrangement are thoroughly discussed and the possibilities if its expansion are also assessed. The flexibility of the arrangement allows its further expansion both for stress measurement at 90 deg. scattering angle with two detector banks at opposite sides of the incident beam and for operation in the transmission diffraction mode. (orig.). (19 refs., 10 figs., 1 tab.)

  14. A low background pulsed neutron polyenergetic beam at the ET-RR-1 reactor

    International Nuclear Information System (INIS)

    Adib, M.; Abdel-Kawy, A.; Habib, N.; Abu-El-Ela, M.; Wahba, M.; Kilany, M.

    1991-12-01

    A low background pulsed neutron polyenergetic thermal beam at ET-RR-1 is produced by a rotor and rotating collimator suspended in magnetic fields. Each of them is mounted on its mobile platform and whose centres are 66 cm apart, rotating synchronously at speeds up to 16000 rpm. It was found that the neutron burst produced by the rotor with almost 100% transmission passes through the collimator, when the rotation phase between them is 28.8 deg. Moreover the background level achieved at the detector position is low, constant and free from peaks due to gamma rays and fast neutrons accompanying the reactor thermal beam. (author). 12 refs, 3 figs

  15. Detailed evaluation of ET-RR-2 neutronic design: approach to criticality

    International Nuclear Information System (INIS)

    Ashoub, N.; Amin, E.

    2000-01-01

    The ET-RR-2 safety analysis evaluation effort included the assessment of the reactor core nuclear design parameters. The present work complements the previous effort of neutronic calculations using NCNSRC computer code packages. This paper is the first in comprehensive neutronic calculation assessment up to the equilibrium core. It deals with evaluation of neutronic calculation submitted during the early phase of the licensing process; namely the proposal to assemble the first critical core, calculation of power peaking factor and determination of detailed energy group flux distribution in the core particularly in the cobalt irradiation position. The neutronic design criteria are examined qualitatively and quantitatively in the present paper

  16. Exploring the Milky Way halo with SDSS-II SN survey RR Lyrae stars

    Science.gov (United States)

    De Lee, Nathan

    This thesis details the creation of a large catalog of RR Lyrae stars, their lightcurves, and their associated photometric and kinematic parameters. This catalog contains 421 RR Lyrae stars with 305 RRab and 116 RRc. Of these, 241 stars have stellar spectra taken with either the Blanco 4m RC spectrograph or the SDSS/SEGUE survey, and in some cases taken by both. From these spectra and photometric methods derived from them, an analysis is conducted of the RR lyrae's distribution, metallicity, kinematics, and photometric properties within the halo. All of these RR Lyrae originate from the SDSS-II Supernova Survey. The SDSS-II SN Survey covers a 2.5 degree equatorial stripe ranging from -60 to +60 degrees in RA. This corresponds to relatively high southern galactic latitudes in the anti-center direction. The full catalog ranges from g 0 magnitude 13 to 20 which covers a distance of 3 to 95 kpc from the sun. Using this sample, we explore the Oosterhoff dichotomy through the D log P method as a function of | Z | distance from the plane. This results in a clear division of the RRab stars into OoI and OoII groups at lower | Z |, but the population becomes dominated by OoI stars at higher | Z |. The idea of a dual halo is explored primarily in the context of radial velocity distributions as a function of | Z |. In particular, V gsr , the radial velocity in the galactic standard of rest, is used as a proxy for V [straight phi] , the cylindrical rotational velocity. This is then compared against a single halo model galaxy, which results in very similar V gsr histograms for both at low to medium | Z |. However, at high | Z | there is a clear separation into two distinct velocity groups for the data without a corresponding separation in the model, suggesting that at least a two-component model for the halo is necessary. The final part of the analysis involves [Fe/H] measurements from both spectra and photometric relations cut in both | Z | and radial velocity. In this case

  17. Ageing problems and renovation programme of ET-RR-1 reactor

    International Nuclear Information System (INIS)

    Khattab, M.S.; Sultan, M.A.

    1995-01-01

    Based on Practical Experience gained from interfacing ageing systems in addition to operating new systems, current problems could be deduced whenever in-service inspection are carried out. This paper summarizes the in-service inspection made, and the proposed programme of rehabilitation of mechanical system in the ET-RR-1 research reactor at Inshass. Exchangeable experience in solving common problems in similar reactors play an important role in the effectiveness of such rehabilitation programme. The paper summarizes also the modernization of control, measuring and radiation monitoring system already carried out at the reactor. (orig.)

  18. Mapping the Tidal Destruction of the Hercules Dwarf: A Wide-field DECam Imaging Search for RR Lyrae Stars

    Science.gov (United States)

    Garling, Christopher; Willman, Beth; Sand, David J.; Hargis, Jonathan; Crnojević, Denija; Bechtol, Keith; Carlin, Jeffrey L.; Strader, Jay; Zou, Hu; Zhou, Xu; Nie, Jundan; Zhang, Tianmeng; Zhou, Zhimin; Peng, Xiyan

    2018-01-01

    We investigate the hypothesized tidal disruption of the Hercules ultra-faint dwarf galaxy (UFD). Previous tidal disruption studies of the Hercules UFD have been hindered by the high degree of foreground contamination in the direction of the dwarf. We bypass this issue by using RR Lyrae stars, which are standard candles with a very low field-volume density at the distance of Hercules. We use wide-field imaging from the Dark Energy Camera on CTIO to identify candidate RR Lyrae stars, supplemented with observations taken in coordination with the Beijing–Arizona Sky Survey on the Bok Telescope. Combining color, magnitude, and light-curve information, we identify three new RR Lyrae stars associated with Hercules. All three of these new RR Lyrae stars lie outside its published tidal radius. When considered with the nine RR Lyrae stars already known within the tidal radius, these results suggest that a substantial fraction of Hercules’ stellar content has been stripped. With this degree of tidal disruption, Hercules is an interesting case between a visibly disrupted dwarf (such as the Sagittarius dwarf spheroidal galaxy) and one in dynamic equilibrium. The degree of disruption also shows that we must be more careful with the ways we determine object membership when estimating dwarf masses in the future. One of the three discovered RR Lyrae stars sits along the minor axis of Hercules, but over two tidal radii away. This type of debris is consistent with recent models that suggest Hercules’ orbit is aligned with its minor axis.

  19. The Causes of Preference Reversal.

    OpenAIRE

    Tversky, Amos; Slovic, Paul; Kahneman, Daniel

    1990-01-01

    Observed preference reversal cannot be adequately explained by violations of independence, the reduction axiom, or transitivity. The primary cause of preference reversal is the failure of procedure invariance, especially the overpricing of low-probability, high-payoff bets. This result violates regret theory and generalized (nonindependent) utility models. Preference reversal and a new reversal involving time preferences are explained by scale compatibility, which implies that payoffs are wei...

  20. Geomagnetic Field During a Reversal

    Science.gov (United States)

    Heirtzler, J. R.

    2003-01-01

    It has frequently been suggested that only the geomagnetic dipole, rather than higher order poles, reverse during a geomagnetic field reversal. Under this assumption the geomagnetic field strength has been calculated for the surface of the Earth for various steps of the reversal process. Even without an eminent a reversal of the field, extrapolation of the present secular change (although problematic) shows that the field strength may become zero in some geographic areas within a few hundred years.

  1. A Study on Reverse Logistics

    OpenAIRE

    Reddy, Dhananjaya

    2011-01-01

    In the competitive world of manufacturing, companies are often searching for new ways to improve their process, customer satisfaction and stay ahead in the game with their competitors. Reverse logistics has been considered a strategy to bring these things to life for the past decade or so. This thesis work tries to shed some light on the basics of reverse logistics and how reverse logistics can be used as a management strategy. This paper points out the fundamentals of reverse logistics and l...

  2. Geomagnetic Reversals during the Phanerozoic.

    Science.gov (United States)

    McElhinny, M W

    1971-04-09

    An antalysis of worldwide paleomagnetic measurements suggests a periodicity of 350 x 10(6) years in the polarity of the geomagnetic field. During the Mesozoic it is predominantly normal, whereas during the Upper Paleozoic it is predominantly reversed. Although geomagnetic reversals occur at different rates throughout the Phanerozoic, there appeaars to be no clear correlation between biological evolutionary rates and reversal frequency.

  3. Nonequilibrium thermodynamics and a fluctuation theorem for individual reaction steps in a chemical reaction network

    International Nuclear Information System (INIS)

    Pal, Krishnendu; Das, Biswajit; Banerjee, Kinshuk; Gangopadhyay, Gautam

    2015-01-01

    We have introduced an approach to nonequilibrium thermodynamics of an open chemical reaction network in terms of the propensities of the individual elementary reactions and the corresponding reverse reactions. The method is a microscopic formulation of the dissipation function in terms of the relative entropy or Kullback-Leibler distance which is based on the analogy of phase space trajectory with the path of elementary reactions in a network of chemical process. We have introduced here a fluctuation theorem valid for each opposite pair of elementary reactions which is useful in determining the contribution of each sub-reaction on the nonequilibrium thermodynamics of overall reaction. The methodology is applied to an oligomeric enzyme kinetics at a chemiostatic condition that leads the reaction to a nonequilibrium steady state for which we have estimated how each step of the reaction is energy driven or entropy driven to contribute to the overall reaction. (paper)

  4. Crystallization features of ternary reversible reciprocal systems

    International Nuclear Information System (INIS)

    Tomashik, V.N.; Shcherbak, L.P.; Fejchuk, P.I.; Grytsiv, V.I.

    2006-01-01

    Some features of the primary crystallization of phases in ternary reversible reciprocal system are considered and discussed. The diagonal join CdTe-GeSe of the CdTe + GeSe = CdSe + GeTe ternary reciprocal system is studied to show that the features in primary and secondary heating and cooling curves in such systems under fully equilibrium conditions are not reproduced upon consecutive heating and cooling sessions, because of the existence of different amounts of the reagents and the reaction products in the mixture; the temperatures of each transformation lie in a range. Those who experimentally investigate other ternary and more complex reversible reciprocal systems should take this fact into account [ru

  5. Reversal Strategies for NOACs

    DEFF Research Database (Denmark)

    Husted, Steen; Verheugt, Freek; Comuth, Willemijn

    2015-01-01

    , coagulation factor concentrates or NOAC-specific antidotes could be used. Coagulation factor concentrates can be used in patients with haemophilia and to reverse the effect of VKAs but, in NOAC-treated patients, results are inconsistent and these agents could potentially have pro-thrombotic effects. Specific...... antidotes for NOACs are expected to be on the market soon. Phase III clinical trials with a humanized antibody fragment directed against dabigatran (idarucizumab) and recombinant, modified factor Xa (andexanet alfa) are ongoing. A molecule (aripazine) with broad activity against various anticoagulants...

  6. Reversible brazing process

    Science.gov (United States)

    Pierce, Jim D.; Stephens, John J.; Walker, Charles A.

    1999-01-01

    A method of reversibly brazing surfaces together. An interface is affixed to each surface. The interfaces can be affixed by processes such as mechanical joining, welding, or brazing. The two interfaces are then brazed together using a brazing process that does not defeat the surface to interface joint. Interfaces of materials such as Ni-200 can be affixed to metallic surfaces by welding or by brazing with a first braze alloy. The Ni-200 interfaces can then be brazed together using a second braze alloy. The second braze alloy can be chosen so that it minimally alters the properties of the interfaces to allow multiple braze, heat and disassemble, rebraze cycles.

  7. Direct Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Austern, N. [University of Pittsburgh, Pittsburgh, PA (United States)

    1963-01-15

    In order to give a unified presentation of one point of view, these lectures are devoted only to a detailed development of the standard theories of direct reactions, starting from basic principles. Discussion is given of the present status of the theories, of the techniques used for practical calculation, and of possible future developments. The direct interaction (DI) aspects of a reaction are those which involve only a few of the many degrees of freedom of a nucleus. In fact the minimum number of degrees of freedom which must be involved in a reaction are those required to describe the initial and final channels, and DI studies typically consider these degrees of freedom and no others. Because of this simplicity DI theories may be worked out in painstaking detail. DI processes concern only part of the wave function for a problem. The other part involves complicated excitations of many degrees of freedom, and gives the compound nucleus (CN) effects. While it is extremely interesting to learn how to separate DI and CN effects in an orderly manner, if they are both present in a reaction, no suitable method has yet been found. Instead, current work stresses the kinds of reactions and the kinds of final states in which DI effects dominate and in which CN effects may almost be forgotten. The DI cross-sections which are studied are often extremely large, comparable to elastic scattering cross-sections. (author)

  8. Influence of foliar fertilization with manganese on germination, vigor and storage time of RR soybean seeds

    Directory of Open Access Journals (Sweden)

    Vanessa Leonardo Ignácio

    2015-10-01

    Full Text Available ABSTRACTThis study aimed to evaluate the influence of foliar fertilizer doses containing Mn of phenological stages of suggested application in RR soybeans, to recover management damages with glyphosate at postemergence application on seed vigor in post-harvest and post six months storage. The seeds originated from a field experiment conducted , which included two applications of glyphosate, concomitant with foliar fertilizer in growth stages V4 and V6, with 0.00, 113.50 and 227.00 mg ha-1doses of Mn2+. Germination, GSI (Germination Speed Index, electrical conductivity tests and the first count of seeds were conducted. The application of Mn did not affect the physiological quality of RR soy in postharvest. However, in post-storage, higher doses of Mn had a negative effect on tests of abnormal seedlings, GSI and electrical conductivity. The applications of Mn, regardless of the developmental stage, did not interfere in the germination and first count tests, with and without storage. The electrical conductivity test showed a higher correlation with the seed germination test in the post-harvest treatment.

  9. Toothpick test: a methodology for the detection of RR soybean plants1

    Directory of Open Access Journals (Sweden)

    Fabiana Mota da Silva

    Full Text Available Due to the large increase in the area cultivated with genetically modified soybean in Brazil, it has become necessary to determine methods that are fast and efficient for detecting these cultivars. The aim of this work was to test the efficiency of the toothpick method in the detection of RR soybean plants, as well as to distinguish between cultivars, for sensitivity caused by herbicide. Ten transgenic soybean cultivars, resistant to the active ingredient glyphosate, and ten conventional soybean cultivars were used. Toothpicks soaked in glyphosate were applied to all the plants at stage V6 and evaluations were made at 2, 4, 6, 8 and 10 days after application (DAA. The effects of the glyphosate on the cultivars, and the symptoms of phytotoxicity caused in the transgenic plants were evaluated by means of grading scales. The toothpick test is effective in identifying RR soybean cultivars and also in separating them into groups by sensitivity to the symptoms caused by the glyphosate.

  10. Dysregulated Homeostasis of Acetylcholine Levels in Immune Cells of RR-Multiple Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Maria Di Bari

    2016-11-01

    Full Text Available Multiple sclerosis (MS is characterized by pro-inflammatory cytokine production. Acetylcholine (ACh contributes to the modulation of central and peripheral inflammation. We studied the homeostasis of the cholinergic system in relation to cytokine levels in immune cells and sera of relapsing remitting-MS (RR-MS patients. We demonstrated that lower ACh levels in serum of RR-MS patients were inversely correlated with the increased activity of the hydrolyzing enzymes acetylcholinesterase (AChE and butyrylcholinesterase (BuChE. Interestingly, the expression of the ACh biosynthetic enzyme and the protein carriers involved in non-vesicular ACh release were found overexpressed in peripheral blood mononuclear cells of MS patients. The inflammatory state of the MS patients was confirmed by increased levels of TNFα, IL-12/IL-23p40, IL-18. The lower circulating ACh levels in sera of MS patients are dependent on the higher activity of cholinergic hydrolyzing enzymes. The smaller ratio of ACh to TNFα, IL-12/IL-23p40 and IL-18 in MS patients, with respect to healthy donors (HD, is indicative of an inflammatory environment probably related to the alteration of cholinergic system homeostasis.

  11. Thermal neutron flux distribution in ET-RR-2 reactor thermal column

    Directory of Open Access Journals (Sweden)

    Imam Mahmoud M.

    2002-01-01

    Full Text Available The thermal column in the ET-RR-2 reactor is intended to promote a thermal neutron field of high intensity and purity to be used for following tasks: (a to provide a thermal neutron flux in the neutron transmutation silicon doping, (b to provide a thermal flux in the neutron activation analysis position, and (c to provide a thermal neutron flux of high intensity to the head of one of the beam tubes leading to the room specified for boron thermal neutron capture therapy. It was, therefore, necessary to determine the thermal neutron flux at above mentioned positions. In the present work, the neutron flux in the ET-RR-2 reactor system was calculated by applying the three dimensional diffusion depletion code TRITON. According to these calculations, the reactor system is composed of the core, surrounding external irradiation grid, beryllium block, thermal column and the water reflector in the reactor tank next to the tank wall. As a result of these calculations, the thermal neutron fluxes within the thermal column and at irradiation positions within the thermal column were obtained. Apart from this, the burn up results for the start up core calculated according to the TRITION code were compared with those given by the reactor designer.

  12. Properties of Asymmetric Detrended Fluctuation Analysis in the time series of RR intervals

    Science.gov (United States)

    Piskorski, J.; Kosmider, M.; Mieszkowski, D.; Krauze, T.; Wykretowicz, A.; Guzik, P.

    2018-02-01

    Heart rate asymmetry is a phenomenon by which the accelerations and decelerations of heart rate behave differently, and this difference is consistent and unidirectional, i.e. in most of the analyzed recordings the inequalities have the same directions. So far, it has been established for variance and runs based types of descriptors of RR intervals time series. In this paper we apply the newly developed method of Asymmetric Detrended Fluctuation Analysis, which so far has mainly been used with economic time series, to the set of 420 stationary 30 min time series of RR intervals from young, healthy individuals aged between 20 and 40. This asymmetric approach introduces separate scaling exponents for rising and falling trends. We systematically study the presence of asymmetry in both global and local versions of this method. In this study global means "applying to the whole time series" and local means "applying to windows jumping along the recording". It is found that the correlation structure of the fluctuations left over after detrending in physiological time series shows strong asymmetric features in both magnitude, with α+ physiological data after shuffling or with a group of symmetric synthetic time series.

  13. DISCOVERY OF RR LYRAE STARS IN THE NUCLEAR BULGE OF THE MILKY WAY

    Energy Technology Data Exchange (ETDEWEB)

    Minniti, Dante; Ramos, Rodrigo Contreras; Zoccali, Manuela; Gran, Felipe [Instituto Milenio de Astrofisica, Santiago (Chile); Rejkuba, Marina; Valenti, Elena [European Southern Observatory, Karl-Schwarszchild-Str. 2, D-85748 Garching bei Muenchen (Germany); Gonzalez, Oscar A., E-mail: dante@astrofisica.cl, E-mail: rcontrer@astro.puc.cl [UK Astronomy Technology Centre, Royal Observatory, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom)

    2016-10-10

    Galactic nuclei, such as that of the Milky Way, are extreme regions with high stellar densities, and in most cases, the hosts of a supermassive black hole. One of the scenarios proposed for the formation of the Galactic nucleus is merging of primordial globular clusters. An implication of this model is that this region should host stars that are characteristically found in old Milky Way globular clusters. RR Lyrae stars are primary distance indicators, well known representatives of old and metal-poor stellar populations, and therefore are regularly found in globular clusters. Here we report the discovery of a dozen RR Lyrae type ab stars in the vicinity of the Galactic center, i.e., in the so-called nuclear stellar bulge of the Milky Way. This discovery provides the first direct observational evidence that the Galactic nuclear stellar bulge contains ancient stars (>10 Gyr old). Based on this we conclude that merging globular clusters likely contributed to the build-up of the high stellar density in the nuclear stellar bulge of the Milky Way.

  14. A study for providing additional storage spaces to ET-RR-1 spent fuel

    International Nuclear Information System (INIS)

    El-Kady, A.; Ashoub, N.; Saleh, H.G.

    1995-01-01

    The ET-RR-1 reactor spent fuel storage pool is a trapezoidal aluminum tank concrete shield and of capacity 10 m 3 . It can hold up to 60 fuel assemblies. The long operation history of the ET-RR-1 reactor resulted in a partially filled spent fuel storage with the remaining spaces not enough to host a complete load from the reactor. This work have been initiated to evaluate possible alternative solutions for providing additional storage spaces to host the available EK-10 fuel elements after irradiation and any foreseen fuel in case of reactor upgrading. Several alternate solutions have been reviewed and decision on the most suitable one is under study. These studies include criticality calculation of some suggested alternatives like reracking the present spent fuel storage pool and double tiering by the addition of a second level storage rack above the existing rack. The two levels may have different factor. Criticality calculation of the double tiering possible accident was also studied. (author)

  15. Thermal performance of Egypt's research reactor core (ET-RR-1)

    International Nuclear Information System (INIS)

    Khattab, M.; Mariy, A.

    1986-01-01

    The steady state thermal performance of the ET-RR-1 core system is theoretically investigated by different models describing the heat flux and the coolant mass flow rate. The magnitude of the heat generated by a fuel element depends upon its position in the core. Normal and uniform distributions for heat flux and coolant mass flow rate are considered. The clad and coolant temperatures at different core positions are evaluated and compared with the experimental measurements at different operating conditions. The results indicated large discrepancy between the predicted and the experimental results. Therefore, the previous models and the experimental results are evaluated in order to develop the best model that describes the thermal performance of the ET-RR-1 core. The adapted model gives 99.5% significant confidence limit. The effect of increasing the heat flux or decreasing the mass flow rate by 20% from its maximum recommended operating condition is tested and discussed. Also, the thermal behaviour towards increasing the reactor power more than its maximum operating condition is discussed. The present work could also be used in extending the investigation to other PWR reactor operating conditions

  16. Optimization of Exopolysaccharide Production by Lactobacillus delbrueckii subsp. bulgaricus RR Grown in a Semidefined Medium

    Science.gov (United States)

    Kimmel, Stacy A.; Roberts, Robert F.; Ziegler, Gregory R.

    1998-01-01

    The optimal fermentation temperature, pH, and Bacto-casitone (Difco Laboratories, Detroit, Mich.) concentration for production of exopolysaccharide by Lactobacillus delbrueckii subsp. bulgaricus RR in a semidefined medium were determined by using response surface methods. The design consisted of 20 experiments, 15 unique combinations, and five replications. All fermentations were conducted in a fermentor with a 2.5-liter working volume and were terminated when 90% of the glucose in the medium had been consumed. The population of L. delbrueckii subsp. bulgaricus RR and exopolysaccharide content were measured at the end of each fermentation. The optimum temperature, pH, and Bacto-casitone concentration for exopolysaccharide production were 38°C, 5, and 30 g/liter, respectively, with a predicted yield of 295 mg of exopolysaccharide/liter. The actual yield under these conditions was 354 mg of exopolysaccharide/liter, which was within the 95% confidence interval (217 to 374 mg of exopolysaccharide/liter). An additional experiment conducted under optimum conditions showed that exopolysaccharide production was growth associated, with a specific production at the endpoint of 101.4 mg/g of dry cells. Finally, to obtain material for further characterization, a 100-liter fermentation was conducted under optimum conditions. Twenty-nine grams of exopolysaccharide was isolated from centrifuged, ultrafiltered fermentation broth by ethanol precipitation. PMID:9464404

  17. Ground-based photometry for 42 Kepler-field RR Lyrae stars

    Science.gov (United States)

    Jeon, Young-Beom; Ngeow, Chow-Choong; Nemec, James M.

    2014-02-01

    Follow-up (U)BVRI photometric observations have been carried out for 42 RR Lyrae stars in the Kepler field. The new magnitude and color information will complement the available extensive high-precision Kepler photometry and recent spectroscopic results. The photometric observations were made with the following telescopes: 1-m and 41-cm telescopes of Lulin Observatory (Taiwan), 81-cm telescope of Tenagra Observatory (Arizona, USA), 1-m telescope at the Mt. Lemmon Optical Astronomy Observatory (LOAO, Arizona, USA), 1.8-m and 15-cm telescopes at the Bohyunsan Optical Astronomy Observatory (BOAO, Korea) and 61-cm telescope at the Sobaeksan Optical Astronomy Observatory (SOAO, Korea). The observations span from 2010 to 2013, with ~200 to ~600 data points per light curve. Preliminary results of the Korean observations were presented at the 5th KASC workshop in Hungary. In this work, we analyze all observations. These observations permit the construction of full light curves for these RR Lyrae stars and can be used to derive multi-filter Fourier parameters.

  18. Estimated long lived isotope activities in ET-RR-1 reactor structural materials for decommissioning study

    International Nuclear Information System (INIS)

    Ashoub, N.; Saleh, H.

    1995-01-01

    The first Egyptian research reactor, ET-RR-1 is tank type with light water as a moderator, coolant and reflector. Its nominal power is 2MWt and the average thermal neutron flux is 10 13 n/cm 2 sec -1 . Its criticality was on the fall of 1961. The reactor went through several modifications and updating and is still utilized for experimental research. A plan for decommissioning of ET-RR-1 reactor should include estimation of radioactivity in structural materials. The inventory will help in assessing the radiological consequences of decommissioning. This paper presents a conservative calculation to estimate the activity of the long lived isotopes which can be produced by neutron activation. The materials which are presented in significant quantities in the reactor structural materials are aluminum, cast iron, graphite, ordinary and iron shot concrete. The radioactivity of each component is dependent not only upon the major elements, but also on the concentration of the trace elements. The main radioactive inventory are expected to be from 60 Co and 55 Fe which are presented in aluminium as trace elements and in large quantities in other construction materials. (author)

  19. Semi-Nested Real-Time Reverse Transcription Polymerase Chain Reaction Methods for the Successful Quantitation of Cytokeratin mRNA Expression Levels for the Subtyping of Non-Small-Cell Lung Carcinoma Using Paraffin-Embedded and Microdissected Lung Biopsy Specimens

    International Nuclear Information System (INIS)

    Nakanishi, Yoko; Shimizu, Tetsuo; Tsujino, Ichiro; Obana, Yukari; Seki, Toshimi; Fuchinoue, Fumi; Ohni, Sumie; Oinuma, Toshinori; Kusumi, Yoshiaki; Yamada, Tsutomu; Takahashi, Noriaki; Hashimoto, Shu; Nemoto, Norimichi

    2013-01-01

    In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC

  20. Gas-phase rate coefficients of the reaction of ozone with four sesquiterpenes at 295 ± 2 K.

    Science.gov (United States)

    Richters, Stefanie; Herrmann, Hartmut; Berndt, Torsten

    2015-05-07

    The rate coefficients of the reaction of ozone with the four atmospherically relevant sesquiterpenes β-caryophyllene, α-humulene, α-cedrene and isolongifolene were investigated at 295 ± 2 K and atmospheric pressure by at least two independent experimental investigations for each reaction. Relative rate experiments were carried out in a flow tube using two different experimental approaches with GC-MS detection (RR 1) and PTR-MS analysis (RR 2) as the analytical techniques. Absolute rate coefficients were determined in a stopped-flow experiment following the ozone depletion by means of UV spectroscopy. The average rate coefficients from the combined investigations representing the mean values of the different experimental methods are (unit: cm(3) molecule(-1) s(-1)): k(O3+β-caryophyllene) = (1.1 ± 0.3) × 10(-14) (methods: RR 1, RR 2, absolute), k(O3+α-humulene) = (1.2 ± 0.3) × 10(-14) (RR 1, RR 2), k(O3+α-cedrene) = (1.7 ± 0.5) × 10(-16) (RR 2, absolute) and k(O3+isolongifolene) = (1.1 ± 0.5) × 10(-17) (RR 2, absolute). The high ozonolysis rate coefficients for β-caryophyllene and α-humulene agree well with the results by Shu and Atkinson (Int. J. Chem. Kinet., 1994, 26) and lead to short atmospheric lifetimes of about two minutes with respect to the ozone reaction. The relatively small rate coefficients for α-cedrene and isolongifolene differ from the available literature values by a factor of about 2.5-6. Possible reasons for the deviations are discussed. Finally, calibrated sesquiterpene FT-IR spectra were recorded for the first time.

  1. Reversibly Bistable Flexible Electronics

    KAUST Repository

    Alfaraj, Nasir

    2015-05-01

    Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent. While maintaining large-scale production and prototyping rapidity, this flexible and translucent scheme demonstrates the potential to transform conventionally stiff electronic devices into thin and foldable ones without compromising long-term performance and reliability. In this work, we report on the fabrication and characterization of reversibly bistable flexible electronic switches that utilize flexible n-channel metal-oxide-semiconductor field-effect transistors. The transistors are fabricated initially on rigid (100) silicon substrates before they are peeled off. They can be used to control flexible batches of light-emitting diodes, demonstrating both the relative ease of scaling at minimum cost and maximum reliability and the feasibility of integration. The peeled-off silicon fabric is about 25 µm thick. The fabricated devices are transferred to a reversibly bistable flexible platform through which, for example, a flexible smartphone can be wrapped around a user’s wrist and can also be set back to its original mechanical position. Buckling and cyclic bending of such host platforms brings a completely new dimension to the development of flexible electronics, especially rollable displays.

  2. Reaction mechanisms

    International Nuclear Information System (INIS)

    Nguyen Trong Anh

    1988-01-01

    The 1988 progress report of the Reaction Mechanisms laboratory (Polytechnic School, France), is presented. The research topics are: the valence bond methods, the radical chemistry, the modelling of the transition states by applying geometric constraints, the long range interactions (ion - molecule) in gaseous phase, the reaction sites in gaseous phase and the mass spectroscopy applications. The points of convergence between the investigations of the mass spectroscopy and the theoretical chemistry teams, as well as the purposes guiding the research programs, are discussed. The published papers, the conferences, the congress communications and the thesis, are also reported [fr

  3. Recycling tires? Reversible crosslinking of poly(butadiene).

    Science.gov (United States)

    Trovatti, Eliane; Lacerda, Talita M; Carvalho, Antonio J F; Gandini, Alessandro

    2015-04-01

    Furan-modified poly(butadiene) prepared by the thiol-ene click reaction is crosslinked with bismaleimides through the Diels-Alder reaction, giving rise to a novel recyclable elastomer. This is possible because of the thermal reversibility of the adducts responsible for the formation of the network. The use of this strategy provides the possibility to produce recyclable tires. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Reversed rainbow with a nonlocal metamaterial

    Energy Technology Data Exchange (ETDEWEB)

    Morgado, Tiago A., E-mail: tiago.morgado@co.it.pt; Marcos, João S.; Silveirinha, Mário G., E-mail: mario.silveirinha@co.it.pt [Department of Electrical Engineering, Instituto de Telecomunicações, University of Coimbra, 3030 Coimbra (Portugal); Costa, João T. [CST AG, Bad Nauheimer Strasse 19, 64289 Darmstadt (Germany); Costa, Jorge R. [Instituto de Telecomunicações and Instituto Universitário de Lisboa (ISCTE-IUL), 1649-026 Lisboa (Portugal); Fernandes, Carlos A. [Instituto de Telecomunicações, and Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal)

    2014-12-29

    One of the intriguing potentials of metamaterials is the possibility to realize a nonlocal electromagnetic reaction, such that the effective medium response at a given point is fundamentally entangled with the macroscopic field distribution at long distances. Here, it is experimentally and numerically verified that a microwave nonlocal metamaterial formed by crossed metallic wires enables a low-loss broadband anomalous material response such that the refractive index decreases with frequency. Notably, it is shown that an electromagnetic beam refracted by our metamaterial prism creates a reversed microwave rainbow.

  5. The suppression of radiation reaction and laser field depletion in laser-electron beam interaction

    Science.gov (United States)

    Ong, J. F.; Moritaka, T.; Takabe, H.

    2018-03-01

    The effects of radiation reaction (RR) have been studied extensively by using the interaction of ultraintense lasers with a counter-propagating relativistic electron. At the laser intensity at the order of 1023 W/cm2, the effects of RR are significant in a few laser periods for a relativistic electron. However, a laser at such intensity is tightly focused and the laser energy is usually assumed to be fixed. Then, the signal of RR and energy conservation cannot be guaranteed. To assess the effects of RR in a tightly focused laser pulse and the evolution of the laser energy, we simulated this interaction with a beam of 109 electrons by means of a Particle-In-Cell method. We observe that the effects of RR are suppressed due to the ponderomotive force and accompanied by a non-negligible amount of laser field energy reduction. This is because the ponderomotive force prevents the electrons from approaching the center of the laser pulse and leads to an interaction at the weaker field region. At the same time, the laser energy is absorbed through ponderomotive acceleration. Thus, the kinetic energy of the electron beam has to be carefully selected such that the effects of RR become obvious.

  6. O desflorestamento ao longo da rodovia BR-174 (Manaus/Am - Boa Vista/Rr / The deforestation along the BR-174 road (Manaus / Am - Boa Vista / Rr

    Directory of Open Access Journals (Sweden)

    Eduardo Paschoal Rodrigues,

    2011-12-01

    Full Text Available Pesquisas indicam que o processo de desflorestamento na Amazônia está associado à abertura de estradas, uma vez que favorece o fluxo migratório, a ocupação de terras e a exploração de madeiras. O objetivo deste trabalho foi analisar o desflorestamento no entorno (20 km da rodovia BR-174 para um período de 30 anos (1978-2008. Foram utilizadas imagens LANDSAT, dados do INPE/PRODES, dados cartográficos e econômicos e trabalhos de campo. Os resultados demonstraram um crescimento do desflorestamento, passando de 622,15 km2 em 1978 para 2.618,58 km2 em 2008. As principais atividades econômicas dos municípios por onde passa a BR-174, exceto Manaus, estão associadas à agropecuária. Em Manaus, o desflorestamento ocorre principalmente na área urbana. Ainda que a construção da BR-174 esteja associada a processos de desflorestamento, a rodovia possui grande importância para a região, pois foi responsável pela ligação terrestre entre duas capitais do norte do país (Manaus/AM e Boa Vista/RR e possibilitou formar comunidades onde são desenvolvidas atividades econômicas e sociais. A criação de projetos de desenvolvimento sustentável é o grande desafio dos governos locais, para agregar valor aos empreendimentos existentes e desenvolver novos modelos de uso e ocupação na região.

  7. Direct Oral Anticoagulant- or Warfarin-Related Major Bleeding: Characteristics, Reversal Strategies, and Outcomes From a Multicenter Observational Study.

    Science.gov (United States)

    Xu, Yan; Schulman, Sam; Dowlatshahi, Dar; Holbrook, Anne M; Simpson, Christopher S; Shepherd, Lois E; Wells, Philip S; Giulivi, Antonio; Gomes, Tara; Mamdani, Muhammad; Khuu, Wayne; Frymire, Eliot; Johnson, Ana P

    2017-07-01

    Direct oral anticoagulants (DOACs) have expanded the armamentarium for antithrombotic therapy. Although DOAC-related major bleeding was associated with favorable outcomes compared with warfarin in clinical trials, warfarin effects were reversed in bleeding events. Red blood cell transfusions occurred more often in DOAC bleeding events than in warfarin events (52.0% vs 39.5%; adjusted relative risk [aRR], 1.32; 95% CI, 1.19-2.47). However, units of blood products transfused were not different between the two groups. Thirty-four DOAC cases (7.4%) received activated prothrombin complex concentrates or recombinant factor VIIa. In-hospital mortality was lower following DOAC bleeding events (9.8% vs 15.2%; aRR, 0.66; 95% CI, 0.49-0.89), although differences in 30-day mortality did not reach statistical significance (12.6% vs 16.3%; aRR, 0.79; 95% CI, 0.61-1.03). In this unselected cohort of patients with oral anticoagulant-related hemorrhage with high rates of warfarin reversal, in-hospital mortality was lower among DOAC-associated bleeding events. These findings support the safety of DOACs in routine care and present useful baseline measures for evaluations of DOAC-specific reversal agents. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Allergic reactions

    Science.gov (United States)

    ... that don't bother most people (such as venom from bee stings and certain foods, medicines, and pollens) can ... person. If the allergic reaction is from a bee sting, scrape the ... more venom. If the person has emergency allergy medicine on ...

  9. Reversible posterior leukoencephalopathy syndrome

    International Nuclear Information System (INIS)

    Lee, Eun Ja; Yu, Won Jong; Ahn, Kook Jin; Jung, So Lyung; Lee, Yeon Soo; Kim, Ji Chang; Kang, Si Won; Song, Chang Joon; Song, Soon-Young; Koo, Ja Hong; Kim, Man Deuk

    2001-01-01

    To review reversible posterior leukoencephalopathy syndrome. We reviewed 22 patients (M:F=3:19; age, 17-46 years) with the characteristic clinical and imaging features of reversible posterior leukoencephalopathy syndrome. All underwent brain MRI, and in three cases both CT and MRI were performed. In one, MRA was obtained, and in eleven, follow-up MR images were obtained. We evaluated the causes of this syndrome, its clinical manifestations, and MR findings including the locations of lesions, the presence or absence of contrast enhancement, and the changes seen at follow-up MRI. Of the 22 patients, 13 had eclampsia (six during pregnancy and seven during puerperium). Four were receiving immunosuppressive therapy (three, cyclosporine ; one, FK 506). Four suffered renal failure and one had complicated migraine. The clinical manifestations included headache (n=12), visual disturbance (n=13), seizure (n=15), focal neurologic sign (n=3), and altered mental status (n=2). Fifteen patients had hypertension and the others normotension. MRI revealed that lesions were bilateral (n=20) or unilateral (n=2). In all patients the lesion was found in the cortical and subcortical areas of the parieto-occipital lobes ; other locations were the basal ganglia (n=9), posterior temporal lobe (n=8), frontal lobe (n=5), cerebellum (n=5), pons (n=2), and thalamus (n=1). All lesions were of high signal intensity on T2-weighted images, and of iso to low intensity on T1-weighted images. One was combined with acute hematoma in the left basal ganglia. In eight of 11 patients who underwent postcontrast T1-weighted MRI, there was no definite enhancement ; in one, enhancement was mild, and in tow, patchy. CT studies showed low attenuation, and MRA revealed mild vasospasm. The symptoms of all patients improved. Follow-up MRI in nine of 11 patients depicted complete resolution of the lesions ; in two, small infarctions remained but the extent of the lesions had decreased. Reversible posterior

  10. Reversible posterior leukoencephalopathy syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eun Ja; Yu, Won Jong; Ahn, Kook Jin; Jung, So Lyung; Lee, Yeon Soo; Kim, Ji Chang; Kang, Si Won [The Catholic Univ. of Korea, Taejon (Korea, Republic of); Song, Chang Joon [Chungnam National Univ. School of Medicine, Cheonju (Korea, Republic of); Song, Soon-Young; Koo, Ja Hong [Kwandong Univ. College of Medicine, Myungji Hospital, Seoul (Korea, Republic of); Kim, Man Deuk [College of Medicine Pochon CHA Univ., Seoul (Korea, Republic of)

    2001-10-01

    To review reversible posterior leukoencephalopathy syndrome. We reviewed 22 patients (M:F=3:19; age, 17-46 years) with the characteristic clinical and imaging features of reversible posterior leukoencephalopathy syndrome. All underwent brain MRI, and in three cases both CT and MRI were performed. In one, MRA was obtained, and in eleven, follow-up MR images were obtained. We evaluated the causes of this syndrome, its clinical manifestations, and MR findings including the locations of lesions, the presence or absence of contrast enhancement, and the changes seen at follow-up MRI. Of the 22 patients, 13 had eclampsia (six during pregnancy and seven during puerperium). Four were receiving immunosuppressive therapy (three, cyclosporine ; one, FK 506). Four suffered renal failure and one had complicated migraine. The clinical manifestations included headache (n=12), visual disturbance (n=13), seizure (n=15), focal neurologic sign (n=3), and altered mental status (n=2). Fifteen patients had hypertension and the others normotension. MRI revealed that lesions were bilateral (n=20) or unilateral (n=2). In all patients the lesion was found in the cortical and subcortical areas of the parieto-occipital lobes ; other locations were the basal ganglia (n=9), posterior temporal lobe (n=8), frontal lobe (n=5), cerebellum (n=5), pons (n=2), and thalamus (n=1). All lesions were of high signal intensity on T2-weighted images, and of iso to low intensity on T1-weighted images. One was combined with acute hematoma in the left basal ganglia. In eight of 11 patients who underwent postcontrast T1-weighted MRI, there was no definite enhancement ; in one, enhancement was mild, and in tow, patchy. CT studies showed low attenuation, and MRA revealed mild vasospasm. The symptoms of all patients improved. Follow-up MRI in nine of 11 patients depicted complete resolution of the lesions ; in two, small infarctions remained but the extent of the lesions had decreased. Reversible posterior

  11. Reversible exciplex formation followed charge separation.

    Science.gov (United States)

    Petrova, M V; Burshtein, A I

    2008-12-25

    The reversible exciplex formation followed by its decomposition into an ion pair is considered, taking into account the subsequent geminate and bulk ion recombination to the triplet and singlet products (in excited and ground states). The integral kinetic equations are derived for all state populations, assuming that the spin conversion is performed by the simplest incoherent (rate) mechanism. When the forward and backward electron transfer is in contact as well as all dissociation/association reactions of heavy particles, the kernels of integral equations are specified and expressed through numerous reaction constants and characteristics of encounter diffusion. The solutions of these equations are used to specify the quantum yields of the excited state and exciplex fluorescence induced by pulse or stationary pumping. In the former case, the yields of the free ions and triplet products are also found, while in the latter case their stationary concentrations are obtained.

  12. Reverse osmosis application studies

    International Nuclear Information System (INIS)

    Golomb, A.

    1982-02-01

    To assess the feasibility of applying reverse osmosis (RO) and ultrafiltration (UF) for effective treatment of process and waste streams from operations at Ontario Hydro's thermal and nuclear stations, an extensive literature survey has been carried out. It is concluded that RO is not at present economic for pretreatment of Great Lakes water prior to ion exchange demineralization for boiler makeup. Using both conventional and novel commercial membrane modules, RO pilot studies are recommended for treatment of boiler cleaning wastes, fly ash leachates, and flue gas desulphurization scrubber discharges for removal of heavy metals. Volume reduction and decontamination of nuclear station low-level active liquid waste streams by RO/UF also appear promising. Research programmes are proposed

  13. Reverse photoacoustic standoff spectroscopy

    Science.gov (United States)

    Van Neste, Charles W [Kingston, TN; Senesac, Lawrence R [Knoxville, TN; Thundat, Thomas G [Knoxville, TN

    2011-04-12

    A system and method are disclosed for generating a reversed photoacoustic spectrum at a greater distance. A source may emit a beam to a target and a detector measures signals generated as a result of the beam being emitted on the target. By emitting a chopped/pulsed light beam to the target, it may be possible to determine the target's optical absorbance by monitoring the intensity of light collected at the detector at different wavelengths. As the wavelength of light is changed, the target may absorb or reject each optical frequency. Rejection may increase the intensity at the sensing element and absorption may decrease the intensity. Accordingly, an identifying spectrum of the target may be made with the intensity variation of the detector as a function of illuminating wavelength.

  14. Reverse Osmosis Optimization

    Energy Technology Data Exchange (ETDEWEB)

    McMordie Stoughton, Kate; Duan, Xiaoli; Wendel, Emily M.

    2013-08-26

    This technology evaluation was prepared by Pacific Northwest National Laboratory on behalf of the U.S. Department of Energy’s Federal Energy Management Program (FEMP). ¬The technology evaluation assesses techniques for optimizing reverse osmosis (RO) systems to increase RO system performance and water efficiency. This evaluation provides a general description of RO systems, the influence of RO systems on water use, and key areas where RO systems can be optimized to reduce water and energy consumption. The evaluation is intended to help facility managers at Federal sites understand the basic concepts of the RO process and system optimization options, enabling them to make informed decisions during the system design process for either new projects or recommissioning of existing equipment. This evaluation is focused on commercial-sized RO systems generally treating more than 80 gallons per hour.¬

  15. Reverse Osmosis Optimization

    Energy Technology Data Exchange (ETDEWEB)

    None

    2013-08-01

    This technology evaluation was prepared by Pacific Northwest National Laboratory on behalf of the U.S. Department of Energy’s Federal Energy Management Program (FEMP). The technology evaluation assesses techniques for optimizing reverse osmosis (RO) systems to increase RO system performance and water efficiency. This evaluation provides a general description of RO systems, the influence of RO systems on water use, and key areas where RO systems can be optimized to reduce water and energy consumption. The evaluation is intended to help facility managers at Federal sites understand the basic concepts of the RO process and system optimization options, enabling them to make informed decisions during the system design process for either new projects or recommissioning of existing equipment. This evaluation is focused on commercial-sized RO systems generally treating more than 80 gallons per hour.

  16. Sex Reversal in Amphibians.

    Science.gov (United States)

    Flament, Stéphane

    2016-01-01

    Amphibians have been widely used to study developmental biology due to the fact that embryo development takes place independently of the maternal organism and that observations and experimental approaches are easy. Some amphibians like Xenopus became model organisms in this field. In the first part of this article, the differentiation of the gonads in amphibians and the mechanisms governing this process are reviewed. In the second part, the state of the art about sex reversal, which can be induced by steroid hormones in general and by temperature in some species, is presented. Also information about pollutants found in the environment that could interfere with the development of the amphibian reproductive apparatus or with their reproductive physiology is given. Such compounds could play a part in the amphibian decline, since in the wild, many amphibians are endangered species. © 2016 S. Karger AG, Basel.

  17. Human action contribution to ET-RR-II reactor systems unstems unavailability

    International Nuclear Information System (INIS)

    Sabek, M.G.

    2001-01-01

    This paper gives a study on the human action contribution to the systems unavailability of ET-RR-II reactor as a result of the test and maintenance procedures. The human contribution is expressed in terms of Fussel-Vesely importance which is defined by the probability that event is contributing to system failure (unavailability). The human error basic events contribution was analyzed for all initiating events and systems fault trees. The calculations result shows a high contribution value (61%) for the human error to systems unavailability. This means that the operator and the maintenance people should be highly qualified trained. Moreover, there should be programs for continuous training. Also, the procedures of tests and maintenance should be in a simple way and clear in order to minimize the contribution of the human errors. The calculations were done using the IRRAS cods

  18. The double rotor neutron monochromator facility at the ET-RR-1 reactor

    International Nuclear Information System (INIS)

    Adib, M.; Maayouf, R.M.A.; Abdel-Kawy, A.; Gwaily, S.E.; Hamouda, I.

    1983-01-01

    A double rotor neutron monochromator recently installed in front of one of the ET-RR-1 reactor horizontal channels is described. The system consists of two rotors, suspended in magnetic field, spinning at speeds up to 16000 rpm with a constant phase angle relative to each producing bursts of monochromatic neutrons at the sample. Each of the rotors, 32 cm in diameter and 27 Kg in weight, has two slits to produce two neutron bursts per revolution. The slits are with radius of curvature 65.65 cm and 7 x 10 sq.mm cross-sectional area. The jitters of the phase between the rotors were measured at different rotation rates and were found not to exceed +- 1.5 μsec. The transmission function of one rotor system was measured and found to be in agreement with that theoretically predicted. (Auth.)

  19. Galactic archaeology for amateur astronomers: RR Lyrae stars as tracers of the Milky Way formation

    Science.gov (United States)

    Carballo-Bello, Julio A.; Martínez-Delgado, David; Fliri, Jürgen

    2011-06-01

    Cosmological models predict that large galaxies like the Milky Way formed from the accretion of smaller stellar systems. The most spectacular of these merger events are stellar tidal streams, rivers of stars and dark matter that envelop the discs of spiral galaxies. We present a research project for a collaboration with amateur astronomers in the study of the formation process of our Galaxy. The main objective is the search for RR Lyrae variable stars in the known stellar streams (Sagitarius, Monoceros, Orphan, etc) a project that can be carried out using small telescopes. The catalogue of candidate variable stars were selected from SDSS data based in colour criteria and it will be sent to interested amateur astronomers who wish to participate in scientific research in one of the most active and competitive topics in Galactic astronomy.

  20. Gaia Data Release 1. Testing parallaxes with local Cepheids and RR Lyrae stars

    Science.gov (United States)

    Gaia Collaboration; Clementini, G.; Eyer, L.; Ripepi, V.; Marconi, M.; Muraveva, T.; Garofalo, A.; Sarro, L. M.; Palmer, M.; Luri, X.; Molinaro, R.; Rimoldini, L.; Szabados, L.; Musella, I.; Anderson, R. I.; Prusti, T.; de Bruijne, J. H. J.; Brown, A. G. A.; Vallenari, A.; Babusiaux, C.; Bailer-Jones, C. A. L.; Bastian, U.; Biermann, M.; Evans, D. W.; Jansen, F.; Jordi, C.; Klioner, S. A.; Lammers, U.; Lindegren, L.; Mignard, F.; Panem, C.; Pourbaix, D.; Randich, S.; Sartoretti, P.; Siddiqui, H. I.; Soubiran, C.; Valette, V.; van Leeuwen, F.; Walton, N. A.; Aerts, C.; Arenou, F.; Cropper, M.; Drimmel, R.; Høg, E.; Katz, D.; Lattanzi, M. G.; O'Mullane, W.; Grebel, E. K.; Holland, A. D.; Huc, C.; Passot, X.; Perryman, M.; Bramante, L.; Cacciari, C.; Castañeda, J.; Chaoul, L.; Cheek, N.; De Angeli, F.; Fabricius, C.; Guerra, R.; Hernández, J.; Jean-Antoine-Piccolo, A.; Masana, E.; Messineo, R.; Mowlavi, N.; Nienartowicz, K.; Ordóñez-Blanco, D.; Panuzzo, P.; Portell, J.; Richards, P. J.; Riello, M.; Seabroke, G. M.; Tanga, P.; Thévenin, F.; Torra, J.; Els, S. G.; Gracia-Abril, G.; Comoretto, G.; Garcia-Reinaldos, M.; Lock, T.; Mercier, E.; Altmann, M.; Andrae, R.; Astraatmadja, T. L.; Bellas-Velidis, I.; Benson, K.; Berthier, J.; Blomme, R.; Busso, G.; Carry, B.; Cellino, A.; Cowell, S.; Creevey, O.; Cuypers, J.; Davidson, M.; De Ridder, J.; de Torres, A.; Delchambre, L.; Dell'Oro, A.; Ducourant, C.; Frémat, Y.; García-Torres, M.; Gosset, E.; Halbwachs, J.-L.; Hambly, N. C.; Harrison, D. L.; Hauser, M.; Hestroffer, D.; Hodgkin, S. T.; Huckle, H. E.; Hutton, A.; Jasniewicz, G.; Jordan, S.; Kontizas, M.; Korn, A. J.; Lanzafame, A. C.; Manteiga, M.; Moitinho, A.; Muinonen, K.; Osinde, J.; Pancino, E.; Pauwels, T.; Petit, J.-M.; Recio-Blanco, A.; Robin, A. C.; Siopis, C.; Smith, M.; Smith, K. W.; Sozzetti, A.; Thuillot, W.; van Reeven, W.; Viala, Y.; Abbas, U.; Abreu Aramburu, A.; Accart, S.; Aguado, J. J.; Allan, P. M.; Allasia, W.; Altavilla, G.; Álvarez, M. A.; Alves, J.; Andrei, A. H.; Anglada Varela, E.; Antiche, E.; Antoja, T.; Antón, S.; Arcay, B.; Bach, N.; Baker, S. G.; Balaguer-Núñez, L.; Barache, C.; Barata, C.; Barbier, A.; Barblan, F.; Barrado y Navascués, D.; Barros, M.; Barstow, M. A.; Becciani, U.; Bellazzini, M.; Bello García, A.; Belokurov, V.; Bendjoya, P.; Berihuete, A.; Bianchi, L.; Bienaymé, O.; Billebaud, F.; Blagorodnova, N.; Blanco-Cuaresma, S.; Boch, T.; Bombrun, A.; Borrachero, R.; Bouquillon, S.; Bourda, G.; Bragaglia, A.; Breddels, M. A.; Brouillet, N.; Brüsemeister, T.; Bucciarelli, B.; Burgess, P.; Burgon, R.; Burlacu, A.; Busonero, D.; Buzzi, R.; Caffau, E.; Cambras, J.; Campbell, H.; Cancelliere, R.; Cantat-Gaudin, T.; Carlucci, T.; Carrasco, J. M.; Castellani, M.; Charlot, P.; Charnas, J.; Chiavassa, A.; Clotet, M.; Cocozza, G.; Collins, R. S.; Costigan, G.; Crifo, F.; Cross, N. J. G.; Crosta, M.; Crowley, C.; Dafonte, C.; Damerdji, Y.; Dapergolas, A.; David, P.; David, M.; De Cat, P.; de Felice, F.; de Laverny, P.; De Luise, F.; De March, R.; de Souza, R.; Debosscher, J.; del Pozo, E.; Delbo, M.; Delgado, A.; Delgado, H. E.; Di Matteo, P.; Diakite, S.; Distefano, E.; Dolding, C.; Dos Anjos, S.; Drazinos, P.; Durán, J.; Dzigan, Y.; Edvardsson, B.; Enke, H.; Evans, N. W.; Eynard Bontemps, G.; Fabre, C.; Fabrizio, M.; Falcão, A. J.; Farràs Casas, M.; Federici, L.; Fedorets, G.; Fernández-Hernández, J.; Fernique, P.; Fienga, A.; Figueras, F.; Filippi, F.; Findeisen, K.; Fonti, A.; Fouesneau, M.; Fraile, E.; Fraser, M.; Fuchs, J.; Gai, M.; Galleti, S.; Galluccio, L.; Garabato, D.; García-Sedano, F.; Garralda, N.; Gavras, P.; Gerssen, J.; Geyer, R.; Gilmore, G.; Girona, S.; Giuffrida, G.; Gomes, M.; González-Marcos, A.; González-Núñez, J.; González-Vidal, J. J.; Granvik, M.; Guerrier, A.; Guillout, P.; Guiraud, J.; Gúrpide, A.; Gutiérrez-Sánchez, R.; Guy, L. P.; Haigron, R.; Hatzidimitriou, D.; Haywood, M.; Heiter, U.; Helmi, A.; Hobbs, D.; Hofmann, W.; Holl, B.; Holland, G.; Hunt, J. A. S.; Hypki, A.; Icardi, V.; Irwin, M.; Jevardat de Fombelle, G.; Jofré, P.; Jonker, P. G.; Jorissen, A.; Julbe, F.; Karampelas, A.; Kochoska, A.; Kohley, R.; Kolenberg, K.; Kontizas, E.; Koposov, S. E.; Kordopatis, G.; Koubsky, P.; Krone-Martins, A.; Kudryashova, M.; Bachchan, R. K.; Lacoste-Seris, F.; Lanza, A. F.; Lavigne, J.-B.; Le Poncin-Lafitte, C.; Lebreton, Y.; Lebzelter, T.; Leccia, S.; Leclerc, N.; Lecoeur-Taibi, I.; Lemaitre, V.; Lenhardt, H.; Leroux, F.; Liao, S.; Licata, E.; Lindstrøm, H. E. P.; Lister, T. A.; Livanou, E.; Lobel, A.; Löffler, W.; López, M.; Lorenz, D.; MacDonald, I.; Magalhães Fernandes, T.; Managau, S.; Mann, R. G.; Mantelet, G.; Marchal, O.; Marchant, J. M.; Marinoni, S.; Marrese, P. M.; Marschalkó, G.; Marshall, D. J.; Martín-Fleitas, J. M.; Martino, M.; Mary, N.; Matijevič, G.; McMillan, P. J.; Messina, S.; Michalik, D.; Millar, N. R.; Miranda, B. M. H.; Molina, D.; Molinaro, M.; Molnár, L.; Moniez, M.; Montegriffo, P.; Mor, R.; Mora, A.; Morbidelli, R.; Morel, T.; Morgenthaler, S.; Morris, D.; Mulone, A. F.; Narbonne, J.; Nelemans, G.; Nicastro, L.; Noval, L.; Ordénovic, C.; Ordieres-Meré, J.; Osborne, P.; Pagani, C.; Pagano, I.; Pailler, F.; Palacin, H.; Palaversa, L.; Parsons, P.; Pecoraro, M.; Pedrosa, R.; Pentikäinen, H.; Pichon, B.; Piersimoni, A. M.; Pineau, F.-X.; Plachy, E.; Plum, G.; Poujoulet, E.; Prša, A.; Pulone, L.; Ragaini, S.; Rago, S.; Rambaux, N.; Ramos-Lerate, M.; Ranalli, P.; Rauw, G.; Read, A.; Regibo, S.; Reylé, C.; Ribeiro, R. A.; Riva, A.; Rixon, G.; Roelens, M.; Romero-Gómez, M.; Rowell, N.; Royer, F.; Ruiz-Dern, L.; Sadowski, G.; Sagristà Sellés, T.; Sahlmann, J.; Salgado, J.; Salguero, E.; Sarasso, M.; Savietto, H.; Schultheis, M.; Sciacca, E.; Segol, M.; Segovia, J. C.; Segransan, D.; Shih, I.-C.; Smareglia, R.; Smart, R. L.; Solano, E.; Solitro, F.; Sordo, R.; Soria Nieto, S.; Souchay, J.; Spagna, A.; Spoto, F.; Stampa, U.; Steele, I. A.; Steidelmüller, H.; Stephenson, C. A.; Stoev, H.; Suess, F. F.; Süveges, M.; Surdej, J.; Szegedi-Elek, E.; Tapiador, D.; Taris, F.; Tauran, G.; Taylor, M. B.; Teixeira, R.; Terrett, D.; Tingley, B.; Trager, S. C.; Turon, C.; Ulla, A.; Utrilla, E.; Valentini, G.; van Elteren, A.; Van Hemelryck, E.; van Leeuwen, M.; Varadi, M.; Vecchiato, A.; Veljanoski, J.; Via, T.; Vicente, D.; Vogt, S.; Voss, H.; Votruba, V.; Voutsinas, S.; Walmsley, G.; Weiler, M.; Weingrill, K.; Wevers, T.; Wyrzykowski, Ł.; Yoldas, A.; Žerjal, M.; Zucker, S.; Zurbach, C.; Zwitter, T.; Alecu, A.; Allen, M.; Allende Prieto, C.; Amorim, A.; Anglada-Escudé, G.; Arsenijevic, V.; Azaz, S.; Balm, P.; Beck, M.; Bernstein, H.-H.; Bigot, L.; Bijaoui, A.; Blasco, C.; Bonfigli, M.; Bono, G.; Boudreault, S.; Bressan, A.; Brown, S.; Brunet, P.-M.; Bunclark, P.; Buonanno, R.; Butkevich, A. G.; Carret, C.; Carrion, C.; Chemin, L.; Chéreau, F.; Corcione, L.; Darmigny, E.; de Boer, K. S.; de Teodoro, P.; de Zeeuw, P. T.; Delle Luche, C.; Domingues, C. D.; Dubath, P.; Fodor, F.; Frézouls, B.; Fries, A.; Fustes, D.; Fyfe, D.; Gallardo, E.; Gallegos, J.; Gardiol, D.; Gebran, M.; Gomboc, A.; Gómez, A.; Grux, E.; Gueguen, A.; Heyrovsky, A.; Hoar, J.; Iannicola, G.; Isasi Parache, Y.; Janotto, A.-M.; Joliet, E.; Jonckheere, A.; Keil, R.; Kim, D.-W.; Klagyivik, P.; Klar, J.; Knude, J.; Kochukhov, O.; Kolka, I.; Kos, J.; Kutka, A.; Lainey, V.; LeBouquin, D.; Liu, C.; Loreggia, D.; Makarov, V. V.; Marseille, M. G.; Martayan, C.; Martinez-Rubi, O.; Massart, B.; Meynadier, F.; Mignot, S.; Munari, U.; Nguyen, A.-T.; Nordlander, T.; O'Flaherty, K. S.; Ocvirk, P.; Olias Sanz, A.; Ortiz, P.; Osorio, J.; Oszkiewicz, D.; Ouzounis, A.; Park, P.; Pasquato, E.; Peltzer, C.; Peralta, J.; Péturaud, F.; Pieniluoma, T.; Pigozzi, E.; Poels, J.; Prat, G.; Prod'homme, T.; Raison, F.; Rebordao, J. M.; Risquez, D.; Rocca-Volmerange, B.; Rosen, S.; Ruiz-Fuertes, M. I.; Russo, F.; Serraller Vizcaino, I.; Short, A.; Siebert, A.; Silva, H.; Sinachopoulos, D.; Slezak, E.; Soffel, M.; Sosnowska, D.; Straižys, V.; ter Linden, M.; Terrell, D.; Theil, S.; Tiede, C.; Troisi, L.; Tsalmantza, P.; Tur, D.; Vaccari, M.; Vachier, F.; Valles, P.; Van Hamme, W.; Veltz, L.; Virtanen, J.; Wallut, J.-M.; Wichmann, R.; Wilkinson, M. I.; Ziaeepour, H.; Zschocke, S.

    2017-09-01

    Context. Parallaxes for 331 classical Cepheids, 31 Type II Cepheids, and 364 RR Lyrae stars in common between Gaia and the Hipparcos and Tycho-2 catalogues are published in Gaia Data Release 1 (DR1) as part of the Tycho-Gaia Astrometric Solution (TGAS). Aims: In order to test these first parallax measurements of the primary standard candles of the cosmological distance ladder, which involve astrometry collected by Gaia during the initial 14 months of science operation, we compared them with literature estimates and derived new period-luminosity (PL), period-Wesenheit (PW) relations for classical and Type II Cepheids and infrared PL, PL-metallicity (PLZ), and optical luminosity-metallicity (MV-[Fe/H]) relations for the RR Lyrae stars, with zero points based on TGAS. Methods: Classical Cepheids were carefully selected in order to discard known or suspected binary systems. The final sample comprises 102 fundamental mode pulsators with periods ranging from 1.68 to 51.66 days (of which 33 with σϖ/ϖimpressive. Conclusions: TGAS parallaxes bring a significant added value to the previous Hipparcos estimates. The relations presented in this paper represent the first Gaia-calibrated relations and form a work-in-progress milestone report in the wait for Gaia-only parallaxes of which a first solution will become available with Gaia Data Release 2 (DR2) in 2018. Full Tables A.1-A.3 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/605/A79

  1. Optimization of a neutron guide facility for the ET-RR-1 reactor. Vol. 2

    Energy Technology Data Exchange (ETDEWEB)

    Maayouf, R M.A.; El-Kady, A S [Reactor and Nutron Physics Department, Nuclear Research Center, Atomic Energy Authority, Cairo, (Egypt)

    1996-03-01

    This work deals with the optimization calculations carried out for a neutron guide facility at the ET-RR-1 reactor. The facility is intended for delivering slow neutrons, emitted from one of the ET-RR-1 reactor horizontal channels, to a Fourier RTOF diffractometer. Accordingly, wavelength-dependent neutron reflectivity calculations were carried out for Cu, Ge, natural Ni, and {sup 58} Ni; materials which are usually used as reflecting surfaces of the neutron guide mirror channel walls. The results of calculations were in favour of {sup 58} Ni as the best coating of the neutron guide mirror channel walls. {sup 58} Ni gives a characteristic wavelength {lambda}{sup *}=1.36 A degree of the neutron guide. This also leads to a value of the neutron flux, at the neutron guide output, 1.4 times more than that one resulting from coating the mirror channel walls with natural nickel. The optimized neutron guide, for effective luminosity value 2.4 x 10{sup 6}, was found to be 22 m in length with mirror channel walls coated with {sup 58} Ni. Such optimization of the neutron guide length, along which a curvature 3345 m in radius, leads to a strong suppression of the background of gamma quanta and fast neutrons. Besides, the neutron wavelength range, 1.O{Alpha} degree -4.O{Alpha} degree, produced by the optimized neutron guide facility allows for neutron diffraction measurements at D values between 0.71{Alpha} degree -2.33 {Alpha} degree. 5 figs., 1 tab.

  2. The occurrence of binary evolution pulsators in classical instability strip of RR Lyrae and Cepheid variables

    Science.gov (United States)

    Karczmarek, P.; Wiktorowicz, G.; Iłkiewicz, K.; Smolec, R.; Stępień, K.; Pietrzyński, G.; Gieren, W.; Belczynski, K.

    2017-04-01

    Single star evolution does not allow extremely low-mass stars to cross the classical instability strip (IS) during the Hubble time. However, within binary evolution framework low-mass stars can appear inside the IS once the mass transfer (MT) is taken into account. Triggered by a discovery of low-mass (0.26 M⊙) RR Lyrae-like variable in a binary system, OGLE-BLG-RRLYR-02792, we investigate the occurrence of similar binary components in the IS, which set up a new class of low-mass pulsators. They are referred to as binary evolution pulsators (BEPs) to underline the interaction between components, which is crucial for substantial mass-loss prior to the IS entrance. We simulate a population of 500 000 metal-rich binaries and report that 28 143 components of binary systems experience severe MT (losing up to 90 per cent of mass), followed by at least one IS crossing in luminosity range of RR Lyrae (RRL) or Cepheid variables. A half of these systems enter the IS before the age of 4 Gyr. BEPs display a variety of physical and orbital parameters, with the most important being the BEP mass in range 0.2-0.8 M⊙, and the orbital period in range 10-2 500 d. Based on the light curve only, BEPs can be misclassified as genuine classical pulsators, and as such they would contaminate genuine RRL and classical Cepheid variables at levels of 0.8 and 5 per cent, respectively. We state that the majority of BEPs will remain undetected and we discuss relevant detection limitations.

  3. R-R interval variations influence the degree of mitral regurgitation in dogs with myxomatous mitral valve disease

    DEFF Research Database (Denmark)

    Reimann, M. J.; Moller, J. E.; Haggstrom, J.

    2014-01-01

    of congestive heart failure due to MMVD. The severity of MR was evaluated in apical four-chamber view using colour Doppler flow mapping (maximum % of the left atrium area) and colour Doppler M-mode (duration in ms). The influence of the ratio between present and preceding R-R interval on MR severity......Mitral regurgitation (MR) due to myxomatous mitral valve disease (MMVD) is a frequent finding in Cavalier King Charles Spaniels (CKCSs). Sinus arrhythmia and atrial premature complexes leading to R-R interval variations occur in dogs. The aim of the study was to evaluate whether the duration...... of the RR interval immediately influences the degree of MR assessed by echocardiography in dogs. Clinical examination including echocardiography was performed in 103 privately-owned dogs: 16 control Beagles, 70 CKCSs with different degree of MR and 17 dogs of different breeds with clinical signs...

  4. 49 CFR 230.89 - Reverse gear.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Reverse gear. 230.89 Section 230.89 Transportation... Reversing Gear § 230.89 Reverse gear. (a) General provisions. Reverse gear, reverse levers, and quadrants... quadrant. Proper counterbalance shall be provided for the valve gear. (b) Air-operated power reverse gear...

  5. On the RR Lyrae Stars in Globulars. V. The Complete Near-infrared (JHK s ) Census of ω Centauri RR Lyrae Variables

    Science.gov (United States)

    Braga, V. F.; Stetson, P. B.; Bono, G.; Dall’Ora, M.; Ferraro, I.; Fiorentino, G.; Iannicola, G.; Marconi, M.; Marengo, M.; Monson, A. J.; Neeley, J.; Persson, S. E.; Beaton, R. L.; Buonanno, R.; Calamida, A.; Castellani, M.; Di Carlo, E.; Fabrizio, M.; Freedman, W. L.; Inno, L.; Madore, B. F.; Magurno, D.; Marchetti, E.; Marinoni, S.; Marrese, P.; Matsunaga, N.; Minniti, D.; Monelli, M.; Nonino, M.; Piersimoni, A. M.; Pietrinferni, A.; Prada-Moroni, P.; Pulone, L.; Stellingwerf, R.; Tognelli, E.; Walker, A. R.; Valenti, E.; Zoccali, M.

    2018-03-01

    We present a new complete near-infrared (NIR, JHK s ) census of RR Lyrae stars (RRLs) in the globular ω Cen (NGC 5139). We collected 15,472 JHK s images with 4–8 m class telescopes over 15 years (2000–2015) covering a sky area around the cluster center of 60 × 34 arcmin2. These images provided calibrated photometry for 182 out of the 198 cluster RRL candidates with 10 to 60 measurements per band. We also provide new homogeneous estimates of the photometric amplitude for 180 (J), 176 (H) and 174 (K s ) RRLs. These data were supplemented with single-epoch JK s magnitudes from VHS and with single-epoch H magnitudes from 2MASS. Using proprietary optical and NIR data together with new optical light curves (ASAS-SN) we also updated pulsation periods for 59 candidate RRLs. As a whole, we provide JHK s magnitudes for 90 RRab (fundamentals), 103 RRc (first overtones) and one RRd (mixed-mode pulsator). We found that NIR/optical photometric amplitude ratios increase when moving from first overtone to fundamental and to long-period (P > 0.7 days) fundamental RRLs. Using predicted period–luminosity–metallicity relations, we derive a true distance modulus of 13.674 ± 0.008 ± 0.038 mag (statistical error and standard deviation of the median) based on spectroscopic iron abundances, and of 13.698 ± 0.004 ± 0.048 mag based on photometric iron abundances. We also found evidence of possible systematics at the 5%–10% level in the zero-point of the period–luminosity relations based on the five calibrating RRLs whose parallaxes had been determined with the HST. This publication makes use of data gathered with the Magellan/Baade Telescope at Las Campanas Observatory, the Blanco Telescope at Cerro Tololo Inter-American Observatory, NTT at La Silla (ESO Program IDs: 64.N-0038(A), 66.D-0557(A), 68.D-0545(A), 073.D-0313(A), ID 073.D-0313(A) and 59.A-9004(D)), VISTA at Paranal (ESO Program ID: 179.A-2010) and VLT at Paranal (ESO Program ID: ID96406).

  6. The Half RR Rule: A Poor Rule of Thumb and Not a Risk Assessment Tool for QT Interval Prolongation.

    Science.gov (United States)

    Berling, Ingrid; Isbister, Geoffrey K

    2015-10-01

    Measuring the QT interval on an electrocardiogram (ECG) is integral to risk assessment of Torsade de Pointes (TdP). This study aimed to investigate the accuracy of the 1/2 RR rule as a risk assessment tool for drug-induced TdP, comparing it to the QT nomogram, Bazett's corrected QT (QTcB), and Fridericia's corrected QT (QTcF). The authors calculated sensitivity and specificity of the 1/2 RR rule using a published data set of 129 cases of drug-induced TdP and 316 controls (noncardiotoxic overdoses), compared to the QT nomogram, QTcB > 500 msec and QTcF > 500 msec. To further determine the value of the 1/2 RR rule, its observed positive, and negative agreement were calculated when compared to the QT nomogram for determining an abnormal QT in eight samples of different drugs in overdose. The sensitivity and specificity of the 1/2 RR rule were 88% (95% confidence interval [CI] = 80% to 93%) and 53% (95% CI = 47% to 58%), respectively, compared to the QT nomogram (sensitivity = 97%, 95% CI = 92% to 99%; specificity = 99%, 95% CI = 97% to 100%). It was also less sensitive than QTcB > 500 msec and had a lower specificity than QTcB > 500 msec and QTcF > 500 msec. In drug overdose patients, the 1/2 RR rule had poor observed agreement averaging 41%, which was mainly due to poor positive agreement, except for amisulpride where there was good agreement. The 1/2 RR rule was not as sensitive as the QT nomogram or QTcB > 500 msec for drug-induced TdP. It had poor positive agreement in almost all overdose patients, resulting in over half of patients receiving unnecessary cardiac monitoring and repeat ECGs. © 2015 by the Society for Academic Emergency Medicine.

  7. Computational reverse shoulder prosthesis model: Experimental data and verification.

    Science.gov (United States)

    Martins, A; Quental, C; Folgado, J; Ambrósio, J; Monteiro, J; Sarmento, M

    2015-09-18

    The reverse shoulder prosthesis aims to restore the stability and function of pathological shoulders, but the biomechanical aspects of the geometrical changes induced by the implant are yet to be fully understood. Considering a large-scale musculoskeletal model of the upper limb, the aim of this study is to evaluate how the Delta reverse shoulder prosthesis influences the biomechanical behavior of the shoulder joint. In this study, the kinematic data of an unloaded abduction in the frontal plane and an unloaded forward flexion in the sagittal plane were experimentally acquired through video-imaging for a control group, composed of 10 healthy shoulders, and a reverse shoulder group, composed of 3 reverse shoulders. Synchronously, the EMG data of 7 superficial muscles were also collected. The muscle force sharing problem was solved through the minimization of the metabolic energy consumption. The evaluation of the shoulder kinematics shows an increase in the lateral rotation of the scapula in the reverse shoulder group, and an increase in the contribution of the scapulothoracic joint to the shoulder joint. Regarding the muscle force sharing problem, the musculoskeletal model estimates an increased activity of the deltoid, teres minor, clavicular fibers of the pectoralis major, and coracobrachialis muscles in the reverse shoulder group. The comparison between the muscle forces predicted and the EMG data acquired revealed a good correlation, which provides further confidence in the model. Overall, the shoulder joint reaction force was lower in the reverse shoulder group than in the control group. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Why has reversal of the actin-myosin cross-bridge cycle not been observed experimentally?

    KAUST Repository

    Loiselle, D. S.; Tran, K.; Crampin, E. J.; Curtin, N. A.

    2010-01-01

    We trace the history of attempts to determine whether the experimentally observed diminution of metabolic energy expenditure when muscles lengthen during active contraction is consistent with reversibility of biochemical reactions and, in particular

  9. Reference genes for reverse transcription quantitative PCR in canine brain tissue

    NARCIS (Netherlands)

    Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

    2015-01-01

    BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

  10. Field reversal experiments (FRX)

    International Nuclear Information System (INIS)

    Linford, R.K.; Armstrong, W.T.; Platts, D.A.; Sherwood, E.G.

    1978-01-01

    The equilibrium, confinement, and stability properties of the reversed-field configuration (RFC) are being studied in two theta-pinch facilities. The RFC is an elongated toroidal plasma confined in a purely poloidal field geometry. The open field lines of the linear theta pinch support the closed-field RFC much like the vertical field centers the toroidal plasma in a tokamak. Depending on stability and confinement properties, the RFC might be used to greatly reduce the axial losses in linear fusion devices such as mirrors, theta pinches, and liners. The FRX systems produce RFC's with a major radius R = 2-6 cm, minor radius a approximately 2 cm, and a total length l approximately 35 cm. The observed temperatures are T/sub e/ approximately 100 eV and T/sub i/ = 150-350 eV with a peak density n approximately 2 x 10 15 cm -3 . After the plasma reaches equilibrium, the RFC remains stable for up to 30 μs followed by the rapid growth of the rotational m = 2 instability, which terminates the confinement. During the stable equilibrium, the particle and energy confinement times are more than 10 times longer than in an open-field system. The behavior of the m = 2 mode qualitatively agrees with the theoretically predicted instability for rotational velocities exceeding some critical value

  11. Field reversal experiments (FRX)

    International Nuclear Information System (INIS)

    Linford, R.K.; Armstrong, W.T.; Platts, D.A.; Sherwood, E.G.

    1979-01-01

    The equilibrium, confinement, and stability properties of the reversed-field configuration (RFC) are being studied in two theta-pinch facilities. The RFC is an elongated toroidal plasma confined in a purely poloidal field geometry. The open field lines of the linear theta pinch support the closed-field RFC much like the vertical field centres the toroidal plasma in a tokamak. Depending on stability and confinement properties, the RFC might be used to greatly reduce the axial losses in linear fusion devices such as mirrors, theta pinches, and liners. The FRX systems produce RFCs with a major radius R=2-6cm, a minor radius a approximately 2cm, and a total length l approximately 35cm. The observed temperatures are Tsub(e) approximately 100eV and Tsub(i)=150-350eV with a peak density n approximately 2x10 15 cm -3 . After the plasma has reached equilibrium, the RFC remains stable for up to 30μs, followed by the rapid growth of the rotational m=2 instability, which terminates the confinement. During the stable equilibrium, the particle and energy confinement times are more than 10 times longer than in an open-field system. The behaviour of the m=2 mode agrees qualitatively with the theoretically predicted instability for rotational velocities exceeding some critical value. (author)

  12. Quantifying fluctuations in reversible enzymatic cycles and clocks

    Science.gov (United States)

    Wierenga, Harmen; ten Wolde, Pieter Rein; Becker, Nils B.

    2018-04-01

    Biochemical reactions are fundamentally noisy at a molecular scale. This limits the precision of reaction networks, but it also allows fluctuation measurements that may reveal the structure and dynamics of the underlying biochemical network. Here, we study nonequilibrium reaction cycles, such as the mechanochemical cycle of molecular motors, the phosphorylation cycle of circadian clock proteins, or the transition state cycle of enzymes. Fluctuations in such cycles may be measured using either of two classical definitions of the randomness parameter, which we show to be equivalent in general microscopically reversible cycles. We define a stochastic period for reversible cycles and present analytical solutions for its moments. Furthermore, we associate the two forms of the randomness parameter with the thermodynamic uncertainty relation, which sets limits on the timing precision of the cycle in terms of thermodynamic quantities. Our results should prove useful also for the study of temporal fluctuations in more general networks.

  13. Luminescence quenching by reversible ionization or exciplex formation/dissociation.

    Science.gov (United States)

    Ivanov, Anatoly I; Burshtein, Anatoly I

    2008-11-20

    The kinetics of fluorescence quenching by both charge transfer and exciplex formation is investigated, with an emphasis on the reversibility and nonstationarity of the reactions. The Weller elementary kinetic scheme of bimolecular geminate ionization and the Markovian rate theory are shown to lead to identical results, provided the rates of the forward and backward reactions account for the numerous recontacts during the reaction encounter. For excitation quenching by the reversible exciplex formation, the Stern-Volmer constant is specified in the framework of the integral encounter theory. The bulk recombination affecting the Stern-Volmer quenching constant makes it different for pulse excited and stationary luminescence. The theory approves that the free energy gap laws for ionization and exciplex formation are different and only the latter fits properly the available data (for lumiflavin quenching by aliphatic amines and aromatic donors) in the endergonic region.

  14. A Reverse Stroop Task with Mouse Tracking

    Science.gov (United States)

    Yamamoto, Naohide; Incera, Sara; McLennan, Conor T.

    2016-01-01

    In a reverse Stroop task, observers respond to the meaning of a color word irrespective of the color in which the word is printed—for example, the word red may be printed in the congruent color (red), an incongruent color (e.g., blue), or a neutral color (e.g., white). Although reading of color words in this task is often thought to be neither facilitated by congruent print colors nor interfered with incongruent print colors, this interference has been detected by using a response method that does not give any bias in favor of processing of word meanings or processing of print colors. On the other hand, evidence for the presence of facilitation in this task has been scarce, even though this facilitation is theoretically possible. By modifying the task such that participants respond to a stimulus color word by pointing to a corresponding response word on a computer screen with a mouse, the present study investigated the possibility that not only interference but also facilitation would take place in a reverse Stroop task. Importantly, in this study, participants’ responses were dynamically tracked by recording the entire trajectories of the mouse. Arguably, this method provided richer information about participants’ performance than traditional measures such as reaction time and accuracy, allowing for more detailed (and thus potentially more sensitive) investigation of facilitation and interference in the reverse Stroop task. These trajectories showed that the mouse’s approach toward correct response words was significantly delayed by incongruent print colors but not affected by congruent print colors, demonstrating that only interference, not facilitation, was present in the current task. Implications of these findings are discussed within a theoretical framework in which the strength of association between a task and its response method plays a critical role in determining how word meanings and print colors interact in reverse Stroop tasks. PMID:27199881

  15. HIV-1 reverse transcription initiation: a potential target for novel antivirals?

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Berkhout, Ben

    2008-01-01

    Reverse transcription is an essential step in the retroviral life cycle, as it converts the genomic RNA into DNA. In this review, we describe recent developments concerning the initiation step of this complex, multi-step reaction. During initiation of reverse transcription, a cellular tRNA primer is

  16. Quasielastic reactions

    International Nuclear Information System (INIS)

    Hansen, O.

    1983-01-01

    A brief review is presented of the experimental and theoretical situation regarding transfer reactions and inelastic scattering. In the first category there is little (very little) precision data for heavy projectiles and consequently almost no experience with quantitative theoretical analysis. For the inelastic scattering the rather extensive data strongly supports the coupled channels models with collective formfactors. At the most back angles, at intensities about 10 -5 of Rutherford scattering, a second, compound-like mechanism becomes dominant. The description of the interplay of these two opposite mechanisms provides a new challenge for our understanding

  17. LSM-YSZ Reactions in Different Atmospheres

    DEFF Research Database (Denmark)

    Chen, Ming; Liu, Yi-Lin; Hagen, Anke

    2009-01-01

    -powder reaction. LSM reacts differently with YSZ in different atmospheres. In air, m-ZrO2 (monoclinic) is formed; while in N2, SrZrO3 and/or La2Zr2O7 are formed depending on the initial LSM/YSZ ratio. The reactions are reversible with varying P(O2) i.e. treating the sample in air after the heat treatment in N2...

  18. Towards a reversible functional language

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2012-01-01

    /equality operator also simplifies inverse computation and program inversion. We discuss the advantages of a reversible functional language using example programs, including run-length encoding. Program inversion is seen to be as lightweight as for imperative reversible languages and realized by recursive descent...

  19. Reverse engineering of RFID devices

    NARCIS (Netherlands)

    Bokslag, W.

    2015-01-01

    This paper discusses the relevance and potential impact of both RFID and reverse engineering of RFID technology, followed by a discussion of common protocols and internals of RFID technology. The focus of the paper is on providing an overview of the different approaches to reverse engineering RFID

  20. How decision reversibility affects motivation

    NARCIS (Netherlands)

    Bullens, L.; van Harreveld, F.; Förster, J.; Higgins, T.E.

    2014-01-01

    The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making,

  1. Reversible networks in supramolecular polymers

    NARCIS (Netherlands)

    Havermans - van Beek, D.J.M.

    2007-01-01

    Non–covalent interactions between low molecular weight polymers form the basis of supramolecular polymers. The material properties of such polymers are determined by the strength and lifetime of the non–covalent reversible interactions. Due to the reversibility of the interactions between the low

  2. Reverse genetics of avian metapneumoviruses

    Science.gov (United States)

    An overview of avian metapneumovirus (aMPV) infection in turkeys and development of a reverse genetics system for aMPV subgroup C (aMPV-C) virus will be presented. By using reverse genetics technology, we generated recombinant aMPV-C viruses containing a different length of glycoprotein (G) gene or...

  3. VizieR Online Data Catalog: Standard Galactic field RR Lyrae. I. Photometry (Monson+, 2017)

    Science.gov (United States)

    Monson, A. J.; Beaton, R. L.; Scowcroft, V.; Freedman, W. L.; Madore, B. F.; Rich, J. A.; Seibert, M.; Kollmeier, J. A.; Clementini, G.

    2017-06-01

    The Three-hundred MilliMeter Telescope (TMMT) is a fully robotic, 300mm telescope at Las Campanas Observatory (LCO), for which the nightly operation and data processing have been completely automated. Over the course of two years data were collected on 179 individual nights for our sample of the 55 RR Lyrae in the B, V, and IC broadband filters. Of these nights, 76 were under photometric conditions and calibrated directly. The 103 nonphotometric nights were roughly calibrated by using the default transformation equations, but only provide differential photometry relative to the calibrated frames. This resulted in 59698 final individual observations. Individual data points have a typical photometric precision of 0.02mag. The statistical error falls rapidly with hundreds of observations, with the zero-point uncertainties being the largest source of uncertainty in the final reported mean magnitude. To compare the results of our TMMT campaign to previous studies of these RR Lyrae (RRL) and to fill gaps in our TMMT phase coverage, we have compiled available broadband data from literature published over the past 30 years and spanning our full wavelength coverage (0.4 to 4.5μm) from the optical to mid-infrared. We have homogenized these diverse data sets to the following filter systems: Johnson UBV, Kron-Cousins RI, 2MASS J,H,Ks, and Spitzer [3.6], [4.5]. The All Sky Automated Survey (ASAS; http://www.astrouw.edu.pl/asas/) is a long-term project monitoring all stars brighter than V~14mag. The program covers both hemispheres, with telescopes at Las Campanas Observatory in Chile and Haleakala on Maui, both of which provide simultaneous I and V photometry. The GEOS RR Lyr Survey (http://www.ast.obs-mip.fr/users/leborgne/dbRR/grrs.html) is a long-term program utilizing TAROT (http://tarot.obs-hp.fr/) at Calern Observatory (Nice University, France). Annual data releases from this project add times for maximum light for program stars over the last year of observations. In

  4. Reciprocity theory of homogeneous reactions

    Science.gov (United States)

    Agbormbai, Adolf A.

    1990-03-01

    The reciprocity formalism is applied to the homogeneous gaseous reactions in which the structure of the participating molecules changes upon collision with one another, resulting in a change in the composition of the gas. The approach is applied to various classes of dissociation, recombination, rearrangement, ionizing, and photochemical reactions. It is shown that for the principle of reciprocity to be satisfied it is necessary that all chemical reactions exist in complementary pairs which consist of the forward and backward reactions. The backward reaction may be described by either the reverse or inverse process. The forward and backward processes must satisfy the same reciprocity equation. Because the number of dynamical variables is usually unbalanced on both sides of a chemical equation, it is necessary that this balance be established by including as many of the dynamical variables as needed before the reciprocity equation can be formulated. Statistical transformation models of the reactions are formulated. The models are classified under the titles free exchange, restricted exchange and simplified restricted exchange. The special equations for the forward and backward processes are obtained. The models are consistent with the H theorem and Le Chatelier's principle. The models are also formulated in the context of the direct simulation Monte Carlo method.

  5. MODELS OF PROJECT REVERSE ENGINEERING

    Directory of Open Access Journals (Sweden)

    Віктор Володимирович ІВАНОВ

    2017-03-01

    Full Text Available Reverse engineering decided important scientific and technical problems of increasing the cost of the existing technical product by transforming it into a product with other features or design. Search ideas of the new application of existing products on the base of heuristic analysis were created. The concept of reverse engineering and its division into three types: conceptual, aggregate and complete was expanded. The use of heuristic methods for reverse engineering concept was showed. The modification model of Reverse engineering based on the model of РМВОК was developed. Our model includes two new phases: identification and transformation. At the identification phase, technical control is made. At the transformation phase, search heuristic idea of the new applied existing technical product was made. The model of execution phase that included heuristic methods, metrological equipment, and CAD/CAM/CAE program complex was created. The model that connected economic indicators of reverse engineering project was developed.

  6. What do reversible programs compute?

    DEFF Research Database (Denmark)

    Axelsen, Holger Bock; Glück, Robert

    2011-01-01

    Reversible computing is the study of computation models that exhibit both forward and backward determinism. Understanding the fundamental properties of such models is not only relevant for reversible programming, but has also been found important in other fields, e.g., bidirectional model...... transformation, program transformations such as inversion, and general static prediction of program properties. Historically, work on reversible computing has focussed on reversible simulations of irreversible computations. Here, we take the viewpoint that the property of reversibility itself should...... are not strictly classically universal, but that they support another notion of universality; we call this RTM-universality. Thus, even though the RTMs are sub-universal in the classical sense, they are powerful enough as to include a self-interpreter. Lifting this to other computation models, we propose r...

  7. Fundamentals of reversible flowchart languages

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2016-01-01

    Abstract This paper presents the fundamentals of reversible flowcharts. They are intended to naturally represent the structure and control flow of reversible (imperative) programming languages in a simple computation model, in the same way classical flowcharts do for conventional languages......, structured reversible flowcharts are as expressive as unstructured ones, as shown by a reversible version of the classic Structured Program Theorem. We illustrate how reversible flowcharts can be concretized with two example programming languages, complete with syntax and semantics: a low-level unstructured...... language and a high-level structured language. We introduce concrete tools such as program inverters and translators for both languages, which follow the structure suggested by the flowchart model. To further illustrate the different concepts and tools brought together in this paper, we present two major...

  8. Nuclear reactions

    International Nuclear Information System (INIS)

    Corner, J.; Richardson, K.; Fenton, N.

    1990-01-01

    Nuclear reactions' marks a new development in the study of television as an agency of public policy debate. During the Eighties, nuclear energy became a major international issue. The disasters at Three-mile Island and Chernobyl created a global anxiety about its risks and a new sensitivity to it among politicians and journalists. This book is a case-study into documentary depictions of nuclear energy in television and video programmes and into the interpretations and responses of viewers drawn from many different occupational groupings. How are the complex and specialist arguments about benefit, risk and proof conveyed through the different conventions of commentary, interview and film sequence? What symbolic associations does the visual language of television bring to portrayals of the issue? And how do viewers make sense of various and conflicting accounts, connecting what they see and hear on the screen with their pre-existing knowledge, experience and 'civic' expectations. The authors examine some of the contrasting forms and themes which have been used by programme makers to explain and persuade, and then give a sustained analysis of the nature and sources of viewers' own accounts. 'Nuclear Reactions' inquires into the public meanings surrounding energy and the environment, spelling out in its conclusion some of the implications for future media treatments of this issue. It is also a key contribution to the international literature on 'television knowledge' and the processes of active viewing. (author)

  9. The Geomagnetic Field During a Reversal

    Science.gov (United States)

    Heirtzler, James R.

    2003-01-01

    By modifying the IGRF it is possible to learn what may happen to the geomagnetic field during a geomagnetic reversal. If the entire IGRF reverses then the declination and inclination only reverse when the field strength is zero. If only the dipole component of the IGRF reverses a large geomagnetic field remains when the dipole component is zero and he direction of the field at the end of the reversal is not exactly reversed from the directions at the beginning of the reversal.

  10. Structural characterisation of the exopolysaccharide produced by Lactobacillus delbrückii subspecies bulgaricus rr grown in skimmed milk

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Gruter, M.; Leeflang, B.R.; Kuiper, J.; Kamerling, J.P.

    1993-01-01

    The exopolysaccharide of Lactobacillus delbrückii subsp. bulgaricus rr. isolated from skimmed milk, is a heteropolymer of D-galactopyranosyl, D-glucopyranosyl, and L-rhamnopyranosyl residues in the molar ratio 5:1:1. The structure was established by linkage analysis and 1D and 2D NMR spectroscopy of

  11. Vasyl' Danylenko, ed. Ukrains'ka intelihentsiia i vlada: Zvedennia sekretnoho viddilu DPU USRR 1927–1929 rr.

    Directory of Open Access Journals (Sweden)

    Olena Palko

    2015-01-01

    Full Text Available Vasyl' Danylenko, ed. Ukrains'ka intelihentsiia i vlada: Zvedennia sekretnoho viddilu DPU USRR 1927–1929 rr. [The Ukrainian Intelligentsia and State Power. Summaries of the Secret Department of State Political Administration of the Ukrainian SSR for 1927–1929]. Kyiv: Tempora, 2012. 756 pp. Illustrations. Appendix. Indexes. 70 UAH, cloth.

  12. 75 FR 61361 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engines

    Science.gov (United States)

    2010-10-05

    ...-0994; Directorate Identifier 2009-NE-39-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR...-Royce plc., P.O. Box 31, Derby, DE24 8BJ, United Kingdom; Telephone: 011 44 1332 242424, Fax: 011 44... based on those comments. We will post all comments we receive, without change, to http://www.regulations...

  13. 76 FR 65997 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engines

    Science.gov (United States)

    2011-10-25

    ...-0994; Directorate Identifier 2009-NE-39-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... Friday, except Federal holidays. For service information identified in this AD, contact Rolls-Royce plc.... Based on these figures, we estimate the cost of this proposed AD on U.S. operators to be $1,499,400. FAA...

  14. 75 FR 45560 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines

    Science.gov (United States)

    2010-08-03

    ...-0755; Directorate Identifier 2010-NE-12-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... based on engine thrust rating but now based on operating shaft speeds) introduced by Rolls- Royce. The...-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom: Telephone 44 (0) 1332 242424; fax 44 (0) 1332...

  15. 77 FR 10355 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines

    Science.gov (United States)

    2012-02-22

    ... Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation... service of certain critical engine parts based on reduced life limits. This new AD reduces the life limits... effective March 28, 2012. ADDRESSES: For service information identified in this AD, contact Rolls-Royce plc...

  16. 77 FR 4648 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engine

    Science.gov (United States)

    2012-01-31

    ... Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engine AGENCY: Federal Aviation... identified in this AD, contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; phone: 011 44... parts are required. Based on these figures, we estimate the cost of this AD on U.S. operators to be $1...

  17. 75 FR 63727 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines

    Science.gov (United States)

    2010-10-18

    ...-0162; Directorate Identifier 2004-NE-19-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR...-2251. Contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; telephone: 011-44-1332... would cost $0. Based on these figures, we estimate the total cost of the AD to U.S. operators would be...

  18. 76 FR 68663 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines

    Science.gov (United States)

    2011-11-07

    ...-0755; Directorate Identifier 2010-NE-12-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... Rolls-Royce plc, Corporate Communications, P.O. Box 31, Derby, England, DE248BJ; phone: 011-44-1332... date and may amend this proposed AD based on those comments. We will post all comments we receive...

  19. 77 FR 1009 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines

    Science.gov (United States)

    2012-01-09

    ... Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines AGENCY: Federal Aviation... 5, 2005). ADDRESSES: For service information identified in this AD, contact Rolls-Royce plc, P.O...,000. Based on these figures, we estimate the total cost of the AD to U.S. operators to be $4,206,960...

  20. 76 FR 72650 - Airworthiness Directives; Rolls-Royce plc (RR) RB211 Trent 800 Series Turbofan Engines

    Science.gov (United States)

    2011-11-25

    ...-0959; Directorate Identifier 2011-NE-25-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... holidays. Fax: (202) 493-2251. Contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; phone... AD. We will consider all comments received by the closing date and may amend this proposed AD based...

  1. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Directory of Open Access Journals (Sweden)

    Gaodao Liang

    2011-01-01

    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  2. Spallation reactions; Reactions de spallation

    Energy Technology Data Exchange (ETDEWEB)

    Cugon, J.

    1996-12-31

    Spallation reactions dominate the interactions of hadrons with nuclei in the GeV range (from {approx} 0.1 to {approx} 10 GeV). They correspond to a sometimes important ejection of light particles leaving most of the time a residue of mass commensurate with the target mass. The main features of the experimental data are briefly reviewed. The most successful theoretical model, namely the intranuclear cascade + evaporation model, is presented. Its physical content, results and possible improvements are critically discussed. Alternative approaches are shortly reviewed. (author). 84 refs.

  3. Transfer and breakup reactions at intermediate energies

    International Nuclear Information System (INIS)

    Stokstad, R.G.

    1986-04-01

    The origin of the quasi-elastic peak in peripheral heavy-ion reactions is discussed in terms of inelastic scattering and transfer reactions to unbound states of the primary projectile-like fragment. The situation is analogous to the use of reverse kinematics in fusion reactions, a technique in which the object of study is moving with nearly the beam velocity. It appears that several important features of the quasi-elastic peak may be explained by this approach. Projectile-breakup reactions have attractive features for the study of nuclear structure. They may also be used to determine the partition of excitation energy in peripheral reactions. At intermediate energies, neutron-pickup reactions leading to four-body final states become important. Examples of experiments are presented that illustrate these points. 15 refs., 14 figs

  4. Supercritical fluid reverse micelle separation

    Science.gov (United States)

    Fulton, J.L.; Smith, R.D.

    1993-11-30

    A method of separating solute material from a polar fluid in a first polar fluid phase is provided. The method comprises combining a polar fluid, a second fluid that is a gas at standard temperature and pressure and has a critical density, and a surfactant. The solute material is dissolved in the polar fluid to define the first polar fluid phase. The combined polar and second fluids, surfactant, and solute material dissolved in the polar fluid is maintained under near critical or supercritical temperature and pressure conditions such that the density of the second fluid exceeds the critical density thereof. In this way, a reverse micelle system defining a reverse micelle solvent is formed which comprises a continuous phase in the second fluid and a plurality of reverse micelles dispersed in the continuous phase. The solute material is dissolved in the polar fluid and is in chemical equilibrium with the reverse micelles. The first polar fluid phase and the continuous phase are immiscible. The reverse micelles each comprise a dynamic aggregate of surfactant molecules surrounding a core of the polar fluid. The reverse micelle solvent has a polar fluid-to-surfactant molar ratio W, which can vary over a range having a maximum ratio W[sub o] that determines the maximum size of the reverse micelles. The maximum ratio W[sub o] of the reverse micelle solvent is then varied, and the solute material from the first polar fluid phase is transported into the reverse micelles in the continuous phase at an extraction efficiency determined by the critical or supercritical conditions. 27 figures.

  5. Machine-learned Identification of RR Lyrae Stars from Sparse, Multi-band Data: The PS1 Sample

    Science.gov (United States)

    Sesar, Branimir; Hernitschek, Nina; Mitrović, Sandra; Ivezić, Željko; Rix, Hans-Walter; Cohen, Judith G.; Bernard, Edouard J.; Grebel, Eva K.; Martin, Nicolas F.; Schlafly, Edward F.; Burgett, William S.; Draper, Peter W.; Flewelling, Heather; Kaiser, Nick; Kudritzki, Rolf P.; Magnier, Eugene A.; Metcalfe, Nigel; Tonry, John L.; Waters, Christopher

    2017-05-01

    RR Lyrae stars may be the best practical tracers of Galactic halo (sub-)structure and kinematics. The PanSTARRS1 (PS1) 3π survey offers multi-band, multi-epoch, precise photometry across much of the sky, but a robust identification of RR Lyrae stars in this data set poses a challenge, given PS1's sparse, asynchronous multi-band light curves (≲ 12 epochs in each of five bands, taken over a 4.5 year period). We present a novel template fitting technique that uses well-defined and physically motivated multi-band light curves of RR Lyrae stars, and demonstrate that we get accurate period estimates, precise to 2 s in > 80 % of cases. We augment these light-curve fits with other features from photometric time-series and provide them to progressively more detailed machine-learned classification models. From these models, we are able to select the widest (three-fourths of the sky) and deepest (reaching 120 kpc) sample of RR Lyrae stars to date. The PS1 sample of ˜45,000 RRab stars is pure (90%) and complete (80% at 80 kpc) at high galactic latitudes. It also provides distances that are precise to 3%, measured with newly derived period-luminosity relations for optical/near-infrared PS1 bands. With the addition of proper motions from Gaia and radial velocity measurements from multi-object spectroscopic surveys, we expect the PS1 sample of RR Lyrae stars to become the premier source for studying the structure, kinematics, and the gravitational potential of the Galactic halo. The techniques presented in this study should translate well to other sparse, multi-band data sets, such as those produced by the Dark Energy Survey and the upcoming Large Synoptic Survey Telescope Galactic plane sub-survey.

  6. Macho project photometry of RR Lyrae stars in the Sagittarius dwarf galaxy

    Energy Technology Data Exchange (ETDEWEB)

    Alcock, C. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)]|[Center for Particle Astrophysics, University of California, Berkeley, California 94720 (United States); Allsman, R.A. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)]|[Mount Stromlo and Siding Spring Observatories, Australian National University, Weston, ACT 2611 (Australia); Alves, D.R. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)]|[Department of Physics, University of California, Davis, California 95616 (United States); Axelrod, T.S. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)]|[Mount Stromlo and Siding Spring Observatories, Australian National University, Weston, ACT 2611 (Australia); Becker, A.C. [Center for Particle Astrophysics, University of California, Berkeley, California 94720 (United States)]|[Department of Astronomy, University of Washington, Seattle, Washington 98195 (United States); Bennett, D.P.; Cook, K.H. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)]|[Center for Particle Astrophysics, University of California, Berkeley, California 94720 (United States); Freeman, K.C. [Mount Stromlo and Siding Spring Observatories, Australian National University, Weston, ACT 2611 (Australia); Griest, K. [Center for Particle Astrophysics, University of California, Berkeley, California 94720 (United States)]|[Department of Physics, University of California, San Diego, California 92093 (United States); Guern, J.A.; Lehner, M.J. [Department of Physics, University of California, San Diego, California 92093 (United States); Marshall, S.L.; Minniti, D. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Peterson, B.A. [Mount Stromlo and Siding Spring Observatories, Australian National University, Weston, ACT 2611 (Australia); Pratt, M.R.

    1997-01-01

    We report the discovery of 30 type a, b RR Lyrae (RRab) stars that are likely members of the Sagittarius dwarf galaxy (Sgr). Accurate positions, periods, amplitudes, and magnitudes are presented. Their distances are determined with respect to RRab stars in the Galactic bulge found also in the MACHO 1993 data. For R{sub {circle_dot}}=8kpc, the mean distance to these stars is D=22{plus_minus}1kpc, smaller than previous determinations for this galaxy. This indicates that Sgr has an elongated main body extending for more than 10 kpc, which is inclined along the line of sight, with its northern part (in Galactic coordinates) closer to us. The size and shape of Sgr give clues about the past history of this galaxy. If the shape of Sgr follows the direction of its orbit, the observed spatial orientation suggests that Sgr is moving away from the Galactic plane. Also, Sgr stars may be the sources of some of the microlensing events seen toward the bulge. {copyright} {ital 1997} {ital The American Astronomical Society}

  7. Dependence of the red edge of the RR Lyrae gap on helium abundance

    International Nuclear Information System (INIS)

    Deupree, R.G.

    1976-01-01

    Calculations have been performed to determine the position of the red edge of the RR Lyrae gap with the chemical compositions (X,Z) = (0.7, 0.001) and (0.8, 0.001). The calculations are composed of the time integration of the conservation equations of mass, momentum, and energy in two spatial dimensions. The calculations allow time-dependent convection to be followed without either arbitrary assumptions regarding time dependence or the application of any theory of convection. The primary assumptions are the restriction to two spatial dimensions and that an ''eddy viscosity'' is employed to mimic the process of turbulent cascade and the conversion of convective kinetic energy into heat. The ability of time dependent convection to stabilize pulsation is shown, and the process by which this is achieved is discussed. The time dependence of convection is found to play a crucial role in the stabilization process. The dependence of the position of the red edge on helium abundance is examined. The results indicate that the color difference between the red and blue edges is a sensitive indicator of helium abundance. Comparison is made with certain globular cluster color differences which indicate that the helium abundance is close to 0.3 by weight

  8. A pulsed neutron monochromatic beam at the ET-RR-1 reactor

    International Nuclear Information System (INIS)

    Adib, M.; Abdel-Kawy, A.; Eid, Y.; Maayouf, R.M.A.

    1985-01-01

    A pulsed neutron monochromatic beam, at the ET-RR-1 reactor, is produced by two 32 cm diameter rotors suspended in magnetic fields, whose centres are 126 cm apart rotating at speeds up to 16,000 rev/min. Each of the rotors has two slots, which are of constant cross-section in area - 7x10mm 2 , and are curved so that they have a maximum transmission for neutrons whose speed is 8.2 times that of the rotor tip. The jitter of the phase between the rotors at different rotation rates is found not to exceed +-1 μs. It has been found that both the observed time distribution and the TOF distribution of the neutrons at different rotation rates are in good agreement with the calculated ones. The observed intensity of the monochromatic neutrons of wavelength 2.74+-0.09 A, obtained by the rotors rotating at a speed of 10,500 rev/min with 864+-1 μs difference in phase between them, is 66.8 n/s. This value is found to be less than the predicted one by a factor of 5.5. (author)

  9. Chemical Composition of RR Lyn - an Eclipsing Binary System with Am and λ Boo Type Components

    Science.gov (United States)

    Jeong, Yeuncheol; Yushchenko, Alexander V.; Doikov, Dmytry N.; Gopka, Vira F.; Yushchenko, Volodymyr O.

    2017-06-01

    High-resolution spectroscopic observations of the eclipsing binary system RR Lyn were made using the 1.8 m telescope at the Bohuynsan Optical Astronomical Observatory in Korea. The spectral resolving power was R = 82,000, with a signal to noise ratio of S/N > 150. We found the effective temperatures and surface gravities of the primary and secondary components to be equal to Teff = 7,920 & 7,210 K and log(g) = 3.80 & 4.16, respectively. The abundances of 34 and 17 different chemical elements were found in the atmospheric components. Correlations between the derived abundances with condensation temperatures and the second ionization potentials of these elements are discussed. The primary component is a typical metallic line star with the abundances of light and iron group elements close to solar values, while elements with atomic numbers Z > 30 are overabundant by 0.5-1.5 dex with respect to solar values. The secondary component is a λ Boo type star. In this type of stars, CNO abundances are close to solar values, while the abundance pattern shows a negative correlation with condensation temperatures.

  10. Sympathetic skin response and R-R interval variation in cases with rheumatoid arthritis.

    Science.gov (United States)

    Gozke, E; Erdogan, N; Akyuz, G; Turan, B; Akyuz, E; Us, O

    2003-03-01

    To investigate the autonomic nervus system involvement in cases with rheumatoid arthritis (RA) by assesing sympathetic skin response (SSR) and R-R interval variation (RRIV), 14 healthy women and 10 women with RA, all of them without clinic dysautonomies were examined. SSR's were recorded palmar surface of both hands and soles of both feet, after stimulating median and tibial nerves individually. RRIV's were assessed at rest and during six deep breathing in one minute with electrodes placed on dorsal surfaces of both hands. SSR could not be obtained from lower extremities of one case with RA. We could not find any significant difference between two groups in terms of SSR latencies. RRIV values obtained during deep breathing to those recorded at rest (D%/R%) was found to be significantly lower in RA cases than healthy controls. RRIV values increased with deep breathing in healthy subjects, while they decreased in 50% of the RA cases. We conclude that assessment of SSR and RRIV are valuble methods for revelation of subclinical autonomic involvement in cases with RA.

  11. POPULARIZING EPIC NARRATIVE IN GEORGE R.R. MARTIN'S A GAME OF THRONES

    Directory of Open Access Journals (Sweden)

    Ida Rochani Adi

    2012-11-01

    Full Text Available This research is intended to show the sustainability of epic in latest years of human history through the most phenomenal fantasy in American literature, A Game of Thrones. Along with the capability of human beings in thinking dearly and sensibly, it is commonsensical that people tend to free themselves from irrationality. The reality shows, however, that the existence of epic fantasy still has power in appealing audiences or readers. This is the case with A Game of Thrones written by George RR Martin who was given the award of One of The Most Influential People in 2011 by Time magazine. This qualitative march, using genre approach, finds out that in order to be compatible with today's society, an epic seen in A Game of Thrones, which is commonly known as a story centering on the legendary hero and his heroic deed in oral folk tradition, keeps its power as an epic fantasy narrative through certain archetypes and formulas. Through genre analysis using semiotic approach, the research brings about conclusions that the elements of high fantasy, elements built through rational representation, and a smart combination of convention and invention brings about its popularity. It is also concluded that there is a close relationship between the myth and the mode of people living even in the most modern context.

  12. Expanding the storage capability at ET-RR-1 research reactor at Inshass

    International Nuclear Information System (INIS)

    Sultan, Mariy M.; Khattab, M.

    1999-01-01

    Storing of spent fuel from Test Reactor in developing countries has become a big dilemma for the following reasons: The transportation of spent fuel is very expensive; There are no reprocessing plants in most developing countries; The expanding of existing storage facilities in reactor building require experience that most of developing countries lack; Some political motivations from Nuclear Developed countries intervene which makes the transportation procedures and logistics to those countries difficult. This paper gives the conceptual design of a new spent fuel storage now under construction at Inshass research reactor (ET-RR-1). The location of the new storage facility is chosen to be within the premises of the reactor facility so that both reactor and the new storage are one Material Balance Area. The paper also proposes some ideas that can enhance the transportation and storage of spent fuel of test reactors, such as: Intensifying the role of IAEA in helping countries to get rid of the spent fuel; The initiation of regional spent fuel storage facilities in some developing countries. (author)

  13. Reverse engineering for quality systems

    International Nuclear Information System (INIS)

    Nolan, A.J.

    1995-01-01

    When the age of software engineering began, many companies were faced with a problem of how to support the older, pre-software-engineering, programs. The techniques of reverse engineering and re-engineering were developed to bridge the gap between the past and the present. Although reverse engineering can be used for generating missing documentation, it can also be used as a means to demonstrate quality in these older programs. This paper presents, in the form of a case study, how Rolls-Royce and Associates Limited addressed the quality issues of reverse engineering and re-engineering. (author)

  14. Field reversal in mirror machines

    International Nuclear Information System (INIS)

    Pearlstein, L.D.; Anderson, D.V.; Boozer, A.H.

    1978-01-01

    This report discusses some of the physics issues anticipated in field-reversed mirrors. The effect of current cancellation due to electrons is described. An estimate is made of the required impurity level to maintain a field-reversed configuration. The SUPERLAYER code is used to simulate the high-β 2XIIB results, and favorable comparisons require inclusion of quasilinear RF turbulence. Impact of a quadrupole field on field-line closure and resonant transport is discussed. A simple self-consistent model of ion currents is presented. Conditions for stability of field-reversed configurations to E x B driven rotations are determined

  15. Zero field reversal probability in thermally assisted magnetization reversal

    Science.gov (United States)

    Prasetya, E. B.; Utari; Purnama, B.

    2017-11-01

    This paper discussed about zero field reversal probability in thermally assisted magnetization reversal (TAMR). Appearance of reversal probability in zero field investigated through micromagnetic simulation by solving stochastic Landau-Lifshitz-Gibert (LLG). The perpendicularly anisotropy magnetic dot of 50×50×20 nm3 is considered as single cell magnetic storage of magnetic random acces memory (MRAM). Thermally assisted magnetization reversal was performed by cooling writing process from near/almost Curie point to room temperature on 20 times runs for different randomly magnetized state. The results show that the probability reversal under zero magnetic field decreased with the increase of the energy barrier. The zero-field probability switching of 55% attained for energy barrier of 60 k B T and the reversal probability become zero noted at energy barrier of 2348 k B T. The higest zero-field switching probability of 55% attained for energy barrier of 60 k B T which corespond to magnetif field of 150 Oe for switching.

  16. A Typology of Reverse Innovation

    DEFF Research Database (Denmark)

    von Zedtwitz, Max; Corsi, Simone; Søberg, Peder Veng

    2015-01-01

    secondary market introduction, this study expands the espoused definition of reverse innovation beyond its market-introduction focus with reversals in the flow of innovation in the ideation and product development phases. Recognizing that each phase can take place in different geographical locations...... taking place in an emerging country. This analytical framework allows recasting of current research at the intersection between innovation and international business. Of the 10 reverse innovation flows, six are new and have not been covered in the literature to date. The study addresses questions......’s portfolio of global innovation competence and capability. The implications for management are concerned with internal and external resistance to reverse innovation. Most significantly, while greater recognition and power of innovation in formerly subordinate organizational units is inconvenient to some...

  17. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.

    1991-01-01

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  18. Spontaneous direct and reverse osmosis

    International Nuclear Information System (INIS)

    Valitov, N.Kh.

    1996-01-01

    It has been ascertained experimentally that in the course of separation of CsCl, KCl, NaCl aqueous solutions by semi-permeable membrane from distilled water the direct and then reverse osmosis are observed. The same sequence is observed in case of separation of CsCl aqueous solutions from NaCl of different concentrations. The reason for the direct and reverse osmosis has been explained. 5 refs.; 3 figs. 1 tab

  19. 76 FR 20229 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 768-60 and Trent 772-60 Turbofan Engines

    Science.gov (United States)

    2011-04-12

    ... inspections of the MCD. We are issuing this AD to prevent in-flight engine shutdowns caused by step aside... Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 768-60 and Trent 772-60 Turbofan Engines AGENCY... superseding an existing airworthiness directive (AD) for RR RB211-Trent 700 series turbofan engines. That AD...

  20. Direct costs of managing adverse drug reactions during rifampicin-resistant tuberculosis treatment in South Africa.

    Science.gov (United States)

    Schnippel, K; Firnhaber, C; Berhanu, R; Page-Shipp, L; Sinanovic, E

    2018-04-01

    To estimate the provider costs of managing adverse drug reactions (ADRs) to standard long-course treatment for multidrug- and rifampicin-resistant tuberculosis (MDR/RR-TB) according to South African guidelines. We parameterised a published Markov health state model for MDR/RR-TB with guidelines-based, bottom-up public-sector provider costing of ADR management. Frequency of ADR occurrence was extracted from the literature. Costs were estimated over 10 years, discounted 3% annually and tested using probabilistic sensitivity analysis. On average, guidelines-based costing of moderate ADRs weighted by the frequency of occurrence was US$135.76 (standard deviation [SD] US$17.18) and the cost of serious ADRs was US$521.29 (SD US$55.99). We estimated that the incremental costs of ADR management were US$380.17 annually per patient initiating MDR/RR-TB treatment. The incremental costs of ADR management for the public health sector in South Africa was US$4.76 million, 8.3% of the estimated cohort costs of MDR/RR-TB treatment ($57.55 million) for the 2015 cohort of 12 527 patients. Management of multiple ADRs and serious ADRs, which are common during the first 6 months of standard, long-course MDR/RR-TB treatment, substantially increases provider treatment costs. These results need to be taken into account when comparing regimen costs, and highlight the urgent need to identify drug regimens with improved safety profiles.