DEFF Research Database (Denmark)
Peng, Nan; Xia, Qiu; Chen, Zhengjun
2009-01-01
S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...
DEFF Research Database (Denmark)
Preker, Pascal; Almvig, Kristina; Christensen, Marianne S
2011-01-01
RNAs, PROMPTs are largely nuclear and rapidly turned over by the RNA exosome. PROMPT-transcribing DNA is occupied by RNA polymerase II (RNAPII) complexes with serine 2 phosphorylated C-terminal domains (CTDs), mimicking that of the associated genic region. Thus, the inefficient elongation capacity of PROMPT...... transcription cannot solely be assigned to poor CTD phosphorylation. Conditions that reduce gene transcription increase RNAPII occupancy of the upstream PROMPT region, suggesting that they reside in a common transcription compartment. Surprisingly, gene promoters that are actively transcribed by RNAPI...
Energy Technology Data Exchange (ETDEWEB)
Damiani, R.D. Jr.; Wessler, S.R. (Univ. of Georgia, Athens, GA (United States))
1993-09-01
The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open reading frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.
Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques
2018-04-06
The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Energy Technology Data Exchange (ETDEWEB)
Kleinert, H.; Benecke, B.J.
1988-02-25
The authors have analyzed the transcription of a recently isolated human 7S K RNA gene in vitro and in vivo. In contrast to hitherto characterized class III genes (genes transcribed by RNA polymerase III), the coding sequence of this gene is not required for faithful and efficient transcription by RNA polymerase III. In fact, a procaryotic vector DNA sequence was efficiently transcribed by RNA polymerase III under the control of the 7S K RNA gene upstream sequence in vitro and in vivo. S/sub 1/-nuclease protection analyses confirmed that the 7S K 5'flanking sequence was sufficient for accurate transcription initiation. These data demonstrate that 7S K DNA represents a novel class III gene, the promoter elements of which are located outside the coding sequence.
International Nuclear Information System (INIS)
Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H.
2005-01-01
Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of σ 54 in transcription from several σ 54 -dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative σ 54 -dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted σ 54 -binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ
Zhu, Bo; Tang, Liming; Chen, Shuyang; Yin, Chengqian; Peng, Shiguang; Li, Xin; Liu, Tongzheng; Liu, Wei; Han, Changpeng; Stawski, Lukasz; Xu, Zhi-Xiang; Zhou, Guangbiao; Chen, Xiang; Gao, Xiumei; Goding, Colin R; Xu, Nan; Cui, Rutao; Cao, Peng
2018-05-22
Programmed cell death ligand 1 (PD-L1) interacts with programmed cell death protein-1 (PD-1) as an immune checkpoint. Reactivating the immune response by inhibiting PD-L1 using therapeutic antibodies provides substantial clinical benefits in many, though not all, melanoma patients. However, transcriptional suppression of PD-L1 expression as an alternative therapeutic anti-melanoma strategy has not been exploited. Here we provide biochemical evidence demonstrating that ultraviolet radiation (UVR) induction of PD-L1 in skin is directly controlled by nuclear factor E2-related transcription factor 2 (NRF2). Depletion of NRF2 significantly induces tumor infiltration by both CD8 + and CD4 + T cells to suppress melanoma progression, and combining NRF2 inhibition with anti-PD-1 treatment enhanced its anti-tumor function. Our studies identify a critical and targetable PD-L1 upstream regulator and provide an alternative strategy to inhibit the PD-1/PD-L1 signaling in melanoma treatment.
Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng
2017-10-20
Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.
Modelling reveals kinetic advantages of co-transcriptional splicing.
Directory of Open Access Journals (Sweden)
Stuart Aitken
2011-10-01
Full Text Available Messenger RNA splicing is an essential and complex process for the removal of intron sequences. Whereas the composition of the splicing machinery is mostly known, the kinetics of splicing, the catalytic activity of splicing factors and the interdependency of transcription, splicing and mRNA 3' end formation are less well understood. We propose a stochastic model of splicing kinetics that explains data obtained from high-resolution kinetic analyses of transcription, splicing and 3' end formation during induction of an intron-containing reporter gene in budding yeast. Modelling reveals co-transcriptional splicing to be the most probable and most efficient splicing pathway for the reporter transcripts, due in part to a positive feedback mechanism for co-transcriptional second step splicing. Model comparison is used to assess the alternative representations of reactions. Modelling also indicates the functional coupling of transcription and splicing, because both the rate of initiation of transcription and the probability that step one of splicing occurs co-transcriptionally are reduced, when the second step of splicing is abolished in a mutant reporter.
Modelling reveals kinetic advantages of co-transcriptional splicing.
Aitken, Stuart; Alexander, Ross D; Beggs, Jean D
2011-10-01
Messenger RNA splicing is an essential and complex process for the removal of intron sequences. Whereas the composition of the splicing machinery is mostly known, the kinetics of splicing, the catalytic activity of splicing factors and the interdependency of transcription, splicing and mRNA 3' end formation are less well understood. We propose a stochastic model of splicing kinetics that explains data obtained from high-resolution kinetic analyses of transcription, splicing and 3' end formation during induction of an intron-containing reporter gene in budding yeast. Modelling reveals co-transcriptional splicing to be the most probable and most efficient splicing pathway for the reporter transcripts, due in part to a positive feedback mechanism for co-transcriptional second step splicing. Model comparison is used to assess the alternative representations of reactions. Modelling also indicates the functional coupling of transcription and splicing, because both the rate of initiation of transcription and the probability that step one of splicing occurs co-transcriptionally are reduced, when the second step of splicing is abolished in a mutant reporter.
Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji
2018-05-03
Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.
Upstream ORF affects MYCN translation depending on exon 1b alternative splicing
International Nuclear Information System (INIS)
Besançon, Roger; Puisieux, Alain; Valsesia-Wittmann, Sandrine; Locher, Clara; Delloye-Bourgeois, Céline; Furhman, Lydie; Tutrone, Giovani; Bertrand, Christophe; Jallas, Anne-Catherine; Garin, Elisabeth
2009-01-01
The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN) and one exon 1b-spliced (MYCN Δ1b ) mRNA. But nothing is known about their respective ability to translate the MYCN protein. Plasmids were prepared to enable translation from the upstream (uORF) and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCN Δ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Both are translated, but higher levels of protein were seen with MYCN Δ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCN Δ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCN Δ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCN Δ1b mRNA. Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction
Two distinct promoters drive transcription of the human D1A dopamine receptor gene.
Lee, S H; Minowa, M T; Mouradian, M M
1996-10-11
The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has
Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E
2012-01-01
Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.
Multiple upstream modules regulate zebrafish myf5 expression
Directory of Open Access Journals (Sweden)
Weng Chih-Wei
2007-01-01
Full Text Available Abstract Background Myf5 is one member of the basic helix-loop-helix family of transcription factors, and it functions as a myogenic factor that is important for the specification and differentiation of muscle cells. The expression of myf5 is somite- and stage-dependent during embryogenesis through a delicate regulation. However, this complex regulatory mechanism of myf5 is not clearly understood. Results We isolated a 156-kb bacterial artificial chromosome clone that includes an upstream 80-kb region and a downstream 70-kb region of zebrafish myf5 and generated a transgenic line carrying this 156-kb segment fused to a green fluorescent protein (GFP reporter gene. We find strong GFP expression in the most rostral somite and in the presomitic mesoderm during segmentation stages, similar to endogenous myf5 expression. Later, the GFP signals persist in caudal somites near the tail bud but are down-regulated in the older, rostral somites. During the pharyngula period, we detect GFP signals in pectoral fin buds, dorsal rostral myotomes, hypaxial myotomes, and inferior oblique and superior oblique muscles, a pattern that also corresponds well with endogenous myf5 transcripts. To characterize the specific upstream cis-elements that regulate this complex and dynamic expression pattern, we also generated several transgenic lines that harbor various lengths within the upstream 80-kb segment. We find that (1 the -80 kb/-9977 segment contains a fin and cranial muscle element and a notochord repressor; (2 the -9977/-6213 segment contains a strong repressive element that does not include the notochord-specific repressor; (3 the -6212/-2938 segment contains tissue-specific elements for bone and spinal cord; (4 the -2937/-291 segment contains an eye enhancer, and the -2937/-2457 segment is required for notochord and myocyte expression; and (5 the -290/-1 segment is responsible for basal transcription in somites and the presomitic mesoderm. Conclusion We suggest
DEFF Research Database (Denmark)
Xie, Yakun; Straub, Daniel; Eguen, Teinai Ebimienere
2015-01-01
An intricate network of antagonistically acting transcription factors mediates formation of a flat leaf lamina of Arabidopsis thaliana plants. In this context, members of the class III homeodomain leucine zipper (HD-ZIPIII) transcription factor family specify the adaxial domain (future upper side......) of the leaf, while antagonistically acting KANADI transcription factors determine the abaxial domain (future lower side). Here we used an mRNA-seq approach to identify genes regulated by KANADI1 (KAN1) and subsequently performed a meta-analysis approach combining our datasets with published genome......-wide datasets. Our analysis revealed that KAN1 acts upstream of several genes encoding auxin biosynthetic enzymes. When exposed to shade, we find three YUCCA genes, YUC2, YUC5 and YUC8 to be transcriptionally upregulated, which correlates with an increase in the levels of free auxin. When ectopically expressed...
Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter
2010-01-01
The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111
DEFF Research Database (Denmark)
Rennie, Sarah; Dalby, Maria; van Duin, Lucas
2018-01-01
Transcriptional regulation is tightly coupled with chromosomal positioning and three-dimensional chromatin architecture. However, it is unclear what proportion of transcriptional activity is reflecting such organisation, how much can be informed by RNA expression alone and how this impacts disease...... proportion of total levels and is highly informative of topological associating domain activities and organisation, revealing boundaries and chromatin compartments. Furthermore, expression data alone accurately predict individual enhancer-promoter interactions, drawing features from expression strength...... between transcription and chromatin architecture....
Directory of Open Access Journals (Sweden)
Alonso Ángel
2006-03-01
Full Text Available Abstract Background Papillomaviruses (PVs infect stratified squamous epithelia in warm-blooded vertebrates and have undergone a complex evolutionary process. The control of the expression of the early ORFs in PVs depends on the binding of cellular and viral transcription factors to the upstream regulatory region (URR of the virus. It is believed that there is a core of transcription factor binding sites (TFBS common to all PVs, with additional individual differences, although most of the available information focuses only on a handful of viruses. Results We have studied the URR of sixty-one PVs, covering twenty different hosts. We have predicted the TFBS present in the URR and analysed these results by principal component analysis and genetic algorithms. The number and nature of TFBS in the URR might be much broader than thus far described, and different PVs have different repertoires of TFBS. Conclusion There are common fingerprints in the URR in PVs that infect primates, although the ancestors of these viruses diverged a long time ago. Additionally, there are obvious differences between the URR of alpha and beta PVs, despite these PVs infect similar histological cell types in the same host, i.e. human. A thorough analysis of the TFBS in the URR might provide crucial information about the differential biology of cancer-associated PVs.
The WW domain protein Kibra acts upstream of Hippo in Drosophila
DEFF Research Database (Denmark)
Baumgartner, Roland; Poernbacher, Ingrid; Buser, Nathalie
2010-01-01
inactivating the transcriptional coactivator Yorkie is well established, much less is known about the upstream events that regulate Hippo signaling activity. The FERM domain proteins Expanded and Merlin appear to represent two different signaling branches that feed into the Hippo pathway. Signaling...... by the atypical cadherin Fat may act via Expanded, but how Merlin is regulated has remained elusive. Here, we show that the WW domain protein Kibra is a Hippo signaling component upstream of Hippo and Merlin. Kibra acts synergistically with Expanded, and it physically interacts with Merlin. Thus, Kibra...
Directory of Open Access Journals (Sweden)
Kristel Kaer
Full Text Available Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown.Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3' ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals.Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression.
Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting
2017-03-17
The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Daniela Fiocco
2011-08-01
Full Text Available Small heat shock proteins (sHsps are ubiquitous conserved chaperone-like proteins involved in cellular proteins protection under stressful conditions. In this study, a reverse transcription quantitative PCR (RT-qPCR procedure was developed and used to quantify the transcript level of a small heat shock gene (shs in the probiotic bacterium Lactobacillus acidophilus NCFM, under stress conditions such as heat (45 °C and 53 °C, bile (0.3% w/v, hyperosmosis (1 M and 2.5 M NaCl, and low pH value (pH 4. The shs gene of L. acidophilus NCFM was induced by salt, high temperature and acidic stress, while repression was observed upon bile stress. Analysis of the 5' noncoding region of the hsp16 gene reveals the presence of an inverted repeat (IR sequence (TTAGCACTC-N9-GAGTGCTAA homologue to the controlling IR of chaperone expression (CIRCE elements found in the upstream regulatory region of Gram-positive heat shock operons, suggesting that the hsp16 gene of L. acidophilus might be transcriptionally controlled by HrcA. In addition, the alignment of several small heat shock proteins identified so far in lactic acid bacteria, reveals that the Hsp16 of L. acidophilus exhibits a strong evolutionary relationship with members of the Lactobacillus acidophilus group.
Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.
Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen
2018-04-10
Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Chen, Yun; Pai, Athma A; Herudek, Jan
2016-01-01
Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation s...... suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provide a framework with which evolution shapes transcriptomes.......Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation...
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells
International Nuclear Information System (INIS)
Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada
1988-01-01
HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription
Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.
da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A
2017-07-01
One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions
Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism
Directory of Open Access Journals (Sweden)
Jurian Schuijers
2018-04-01
Full Text Available Summary: Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. : Schuijers et al. show that a conserved CTCF site at the promoter of the MYC oncogene plays an important role in enhancer-promoter looping with tumor-specific super-enhancers. Perturbation of this site provides a potential therapeutic vulnerability. Keywords: gene regulation, super-enhancers, chromosome structure, enhancer docking
Reimand, Jüri; Vaquerizas, Juan M; Todd, Annabel E; Vilo, Jaak; Luscombe, Nicholas M
2010-08-01
Transcription factor (TF) perturbation experiments give valuable insights into gene regulation. Genome-scale evidence from microarray measurements may be used to identify regulatory interactions between TFs and targets. Recently, Hu and colleagues published a comprehensive study covering 269 TF knockout mutants for the yeast Saccharomyces cerevisiae. However, the information that can be extracted from this valuable dataset is limited by the method employed to process the microarray data. Here, we present a reanalysis of the original data using improved statistical techniques freely available from the BioConductor project. We identify over 100,000 differentially expressed genes-nine times the total reported by Hu et al. We validate the biological significance of these genes by assessing their functions, the occurrence of upstream TF-binding sites, and the prevalence of protein-protein interactions. The reanalysed dataset outperforms the original across all measures, indicating that we have uncovered a vastly expanded list of relevant targets. In summary, this work presents a high-quality reanalysis that maximizes the information contained in the Hu et al. compendium. The dataset is available from ArrayExpress (accession: E-MTAB-109) and it will be invaluable to any scientist interested in the yeast transcriptional regulatory system.
Connections between transcription, mRNP assembly and quality control in S. cerevisiae
DEFF Research Database (Denmark)
Jensen, Torben Heick
in the context of THO and rna14-3 mutants improves mRNP quality by acting upstream of transcription-site retention and nuclear degradation of the transcripts. As Rad3p mutant effects can be phenocopied by other mutations known to affect transcription and by the addition of transcription elongation drugs, our...
Energy Technology Data Exchange (ETDEWEB)
Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others
1994-09-01
The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.
Directory of Open Access Journals (Sweden)
Joshi NV
2009-01-01
Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.
Duplication of an upstream silencer of FZP increases grain yield in rice.
Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong
2017-11-01
Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.
POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2003-10-23
The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.
Enhancer elements upstream of the SHOX gene are active in the developing limb.
Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun
2010-05-01
Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.
Directory of Open Access Journals (Sweden)
Emily Y Smith
2011-12-01
Full Text Available The Prader-Willi syndrome (PWS [MIM 17620] and Angelman syndrome (AS [MIM 105830] locus is controlled by a bipartite imprinting center (IC consisting of the PWS-IC and the AS-IC. The most widely accepted model of IC function proposes that the PWS-IC activates gene expression from the paternal allele, while the AS-IC acts to epigenetically inactivate the PWS-IC on the maternal allele, thus silencing the paternally expressed genes. Gene order and imprinting patterns at the PWS/AS locus are well conserved from human to mouse; however, a murine AS-IC has yet to be identified. We investigated a potential regulatory role for transcription from the Snrpn alternative upstream exons in silencing the maternal allele using a murine transgene containing Snrpn and three upstream exons. This transgene displayed appropriate imprinted expression and epigenetic marks, demonstrating the presence of a functional AS-IC. Transcription of the upstream exons from the endogenous locus correlates with imprint establishment in oocytes, and this upstream exon expression pattern was conserved on the transgene. A transgene bearing targeted deletions of each of the three upstream exons exhibited loss of imprinting upon maternal transmission. These results support a model in which transcription from the Snrpn upstream exons directs the maternal imprint at the PWS-IC.
Calonge, María Julia; Seoane, Joan; Massagué, Joan
2004-05-28
A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.
Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma
Directory of Open Access Journals (Sweden)
Dinesh K. Singh
2017-01-01
Full Text Available Efforts to identify and target glioblastoma (GBM drivers have primarily focused on receptor tyrosine kinases (RTKs. Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2 transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2 and zinc-finger E-box binding homeobox 1 (ZEB1, which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo.
A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1
International Nuclear Information System (INIS)
Sebastian, J.; Sancar, G.B.
1991-01-01
The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription
Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J
2016-06-01
Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.
Genome-Wide Search for Translated Upstream Open Reading Frames in Arabidopsis Thaliana.
Hu, Qiwen; Merchante, Catharina; Stepanova, Anna N; Alonso, Jose M; Heber, Steffen
2016-03-01
Upstream open reading frames (uORFs) are open reading frames that occur within the 5' UTR of an mRNA. uORFs have been found in many organisms. They play an important role in gene regulation, cell development, and in various metabolic processes. It is believed that translated uORFs reduce the translational efficiency of the main coding region. However, only few uORFs are experimentally characterized. In this paper, we use ribosome footprinting together with a semi-supervised approach based on stacking classification models to identify translated uORFs in Arabidopsis thaliana. Our approach identified 5360 potentially translated uORFs in 2051 genes. GO terms enriched in genes with translated uORFs include catalytic activity, binding, transferase activity, phosphotransferase activity, kinase activity, and transcription regulator activity. The reported uORFs occur with a higher frequency in multi-isoform genes, and some uORFs are affected by alternative transcript start sites or alternative splicing events. Association rule mining revealed sequence features associated with the translation status of the uORFs. We hypothesize that uORF translation is a complex process that might be regulated by multiple factors. The identified uORFs are available online at:https://www.dropbox.com/sh/zdutupedxafhly8/AABFsdNR5zDfiozB7B4igFcja?dl=0. This paper is the extended version of our research presented at ISBRA 2015.
International Nuclear Information System (INIS)
Black, C.G.; Fyfe, J.A.M.; Davies, J.K.
1997-01-01
A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)
Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.
Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K
1989-01-01
The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.
Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.
Directory of Open Access Journals (Sweden)
Amanda Malvessi Cattani
Full Text Available Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.
Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.
Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira
2016-01-01
Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.
Identification of pathogenic genes and upstream regulators in age-related macular degeneration.
Zhao, Bin; Wang, Mengya; Xu, Jing; Li, Min; Yu, Yuhui
2017-06-26
Age-related macular degeneration (AMD) is the leading cause of irreversible blindness in older individuals. Our study aims to identify the key genes and upstream regulators in AMD. To screen pathogenic genes of AMD, an integrated analysis was performed by using the microarray datasets in AMD derived from the Gene Expression Omnibus (GEO) database. The functional annotation and potential pathways of differentially expressed genes (DEGs) were further discovered by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. We constructed the AMD-specific transcriptional regulatory network to find the crucial transcriptional factors (TFs) which target the DEGs in AMD. Quantitative real time polymerase chain reaction (qRT-PCR) was performed to verify the DEGs and TFs obtained by integrated analysis. From two GEO datasets obtained, we identified 1280 DEGs (730 up-regulated and 550 down-regulated genes) between AMD and normal control (NC). After KEGG analysis, steroid biosynthesis is a significantly enriched pathway for DEGs. The expression of 8 genes (TNC, GRP, TRAF6, ADAMTS5, GPX3, FAP, DHCR7 and FDFT1) was detected. Except for TNC and GPX3, the other 6 genes in qRT-PCR played the same pattern with that in our integrated analysis. The dysregulation of these eight genes may involve with the process of AMD. Two crucial transcription factors (c-rel and myogenin) were concluded to play a role in AMD. Especially, myogenin was associated with AMD by regulating TNC, GRP and FAP. Our finding can contribute to developing new potential biomarkers, revealing the underlying pathogenesis, and further raising new therapeutic targets for AMD.
A long HBV transcript encoding pX is inefficiently exported from the nucleus
International Nuclear Information System (INIS)
Doitsh, Gilad; Shaul, Yosef
2003-01-01
The longest hepatitis B virus transcript is a 3.9-kb mRNA whose function remained unclear. In this study, we wished to identify the translation products and physiological role of this viral transcript. This transcript initiates from the X promoter region ignoring the inefficient and noncanonical viral polyadenylation signal at the first round of transcription. However, an HBV mutant with canonical polyadenylation signal continues, though with lower efficiency, to program the synthesis of this long transcript, indicating that the deviated HBV polyadenylation signal is important but not essential to enable transcription of the 3.9-kb species. The 3.9-kb RNA contains two times the X open reading frame (ORF). The X ORF at the 5'-end is positioned upstream of the CORE gene. By generating an HBV DNA mutant in which the X and Core ORFs are fused, we demonstrated the production of a 40-kDa X-Core fusion protein that must be encoded by the 3.9-kb transcript. Mutagenesis studies revealed that the production of this protein depends on the 5' X ORF ATG, suggesting that the 3.9-kb RNA is active in translation of the X ORF. Based on these features, the 3.9-kb transcript was designated lxRNA for long X RNA. Unlike other HBV transcripts, lxRNA harbors two copies of PRE, the posttranscriptional regulatory element that controls the nuclear export of HBV mRNAs. Unexpectedly, despite the presence of PRE sequences, RNA fractionation analysis revealed that lxRNA barely accumulates in the cytoplasm, suggesting that nuclear export of lxRNA is poor. Collectively, our data suggest that two distinct HBV mRNA species encode pX and that the HBV transcripts are differentially regulated at the level of nuclear export
Gao, Xin; Oei, Maria S; Ovitt, Catherine E; Sincan, Murat; Melvin, James E
2018-04-01
RNA-Seq was used to better understand the molecular nature of the biological differences among the three major exocrine salivary glands in mammals. Transcriptional profiling found that the adult murine parotid, submandibular, and sublingual salivary glands express greater than 14,300 protein-coding genes, and nearly 2,000 of these genes were differentially expressed. Principle component analysis of the differentially expressed genes revealed three distinct clusters according to gland type. The three salivary gland transcriptomes were dominated by a relatively few number of highly expressed genes (6.3%) that accounted for more than 90% of transcriptional output. Of the 912 transcription factors expressed in the major salivary glands, greater than 90% of them were detected in all three glands, while expression for ~2% of them was enriched in an individual gland. Expression of these unique transcription factors correlated with sublingual and parotid specific subsets of both highly expressed and differentially expressed genes. Gene ontology analyses revealed that the highly expressed genes common to all glands were associated with global functions, while many of the genes expressed in a single gland play a major role in the function of that gland. In summary, transcriptional profiling of the three murine major salivary glands identified a limited number of highly expressed genes, differentially expressed genes, and unique transcription factors that represent the transcriptional signatures underlying gland-specific biological properties.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe
2014-06-01
Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.
Upstream waves simultaneously observed by ISEE and UKS
International Nuclear Information System (INIS)
Russell, C.T.; Luhmann, J.G.; Elphic, R.C.; Southwood, D.J.; Smith, M.F.; Johnstone, A.D.
1987-01-01
Measurements obtained in the solar wind by ISEE-2 and the United Kingdom Subsatellite (UKS) have been examined for observations of upstream waves. These data reveal that the waves in the foreshock region are enhanced at all frequencies from at least 0.003 Hz to 0.5 Hz. The wave spectra generally have a spectral peak, but this peak is usually broad and the peak frequency depends on the position of the spacecraft. Generally, the spectra seen at the two spacecraft are most similar at high frequencies and least similar at low frequencies. The geometry of the interaction is displayed in the plane containing the magnetic field, the solar wind velocity, and the spacecraft location. However, this coordinate system does not order all the observed wave properties. It does not clearly explain or order the handedness of the waves, or their direction of propagation. It is clear that the upstream region is inherently three-dimensional. The position-dependent nature of the upstream waves indicates that comparisons between ground-based measurements and in-situ observations must be undertaken with some caution
Directory of Open Access Journals (Sweden)
Olivier Poupel
Full Text Available The WalKR two-component system, controlling cell wall metabolism, is highly conserved among Bacilli and essential for cell viability. In Staphylococcus aureus, walR and walK are followed by three genes of unknown function: walH, walI and walJ. Sequence analysis and transcript mapping revealed a unique genetic structure for this locus in S. aureus: the last gene of the locus, walJ, is transcribed independently, whereas transcription of the tetra-cistronic walRKHI operon occurred from two independent promoters located upstream from walR. Protein topology analysis and protein-protein interactions in E. coli as well as subcellular localization in S. aureus allowed us to show that WalH and WalI are membrane-bound proteins, which associate with WalK to form a complex at the cell division septum. While these interactions suggest that WalH and WalI play a role in activity of the WalKR regulatory pathway, deletion of walH and/or walI did not have a major effect on genes whose expression is strongly dependent on WalKR or on associated phenotypes. No effect of WalH or WalI was seen on tightly controlled WalKR regulon genes such as sle1 or saouhsc_00773, which encodes a CHAP-domain amidase. Of the genes encoding the two major S. aureus autolysins, AtlA and Sle1, only transcription of atlA was increased in the ΔwalH or ΔwalI mutants. Likewise, bacterial autolysis was not increased in the absence of WalH and/or WalI and biofilm formation was lowered rather than increased. Our results suggest that contrary to their major role as WalK inhibitors in B. subtilis, the WalH and WalI proteins have evolved a different function in S. aureus, where they are more accessory. A phylogenomic analysis shows a striking conservation of the 5 gene wal cluster along the evolutionary history of Bacilli, supporting the key importance of this signal transduction system, and indicating that the walH and walI genes were lost in the ancestor of Streptococcaceae, leading to their
Poupel, Olivier; Moyat, Mati; Groizeleau, Julie; Antunes, Luísa C S; Gribaldo, Simonetta; Msadek, Tarek; Dubrac, Sarah
2016-01-01
The WalKR two-component system, controlling cell wall metabolism, is highly conserved among Bacilli and essential for cell viability. In Staphylococcus aureus, walR and walK are followed by three genes of unknown function: walH, walI and walJ. Sequence analysis and transcript mapping revealed a unique genetic structure for this locus in S. aureus: the last gene of the locus, walJ, is transcribed independently, whereas transcription of the tetra-cistronic walRKHI operon occurred from two independent promoters located upstream from walR. Protein topology analysis and protein-protein interactions in E. coli as well as subcellular localization in S. aureus allowed us to show that WalH and WalI are membrane-bound proteins, which associate with WalK to form a complex at the cell division septum. While these interactions suggest that WalH and WalI play a role in activity of the WalKR regulatory pathway, deletion of walH and/or walI did not have a major effect on genes whose expression is strongly dependent on WalKR or on associated phenotypes. No effect of WalH or WalI was seen on tightly controlled WalKR regulon genes such as sle1 or saouhsc_00773, which encodes a CHAP-domain amidase. Of the genes encoding the two major S. aureus autolysins, AtlA and Sle1, only transcription of atlA was increased in the ΔwalH or ΔwalI mutants. Likewise, bacterial autolysis was not increased in the absence of WalH and/or WalI and biofilm formation was lowered rather than increased. Our results suggest that contrary to their major role as WalK inhibitors in B. subtilis, the WalH and WalI proteins have evolved a different function in S. aureus, where they are more accessory. A phylogenomic analysis shows a striking conservation of the 5 gene wal cluster along the evolutionary history of Bacilli, supporting the key importance of this signal transduction system, and indicating that the walH and walI genes were lost in the ancestor of Streptococcaceae, leading to their atypical 3 wal gene
Transcriptional control in the segmentation gene network of Drosophila.
Directory of Open Access Journals (Sweden)
Mark D Schroeder
2004-09-01
Full Text Available The segmentation gene network of Drosophila consists of maternal and zygotic factors that generate, by transcriptional (cross- regulation, expression patterns of increasing complexity along the anterior-posterior axis of the embryo. Using known binding site information for maternal and zygotic gap transcription factors, the computer algorithm Ahab recovers known segmentation control elements (modules with excellent success and predicts many novel modules within the network and genome-wide. We show that novel module predictions are highly enriched in the network and typically clustered proximal to the promoter, not only upstream, but also in intronic space and downstream. When placed upstream of a reporter gene, they consistently drive patterned blastoderm expression, in most cases faithfully producing one or more pattern elements of the endogenous gene. Moreover, we demonstrate for the entire set of known and newly validated modules that Ahab's prediction of binding sites correlates well with the expression patterns produced by the modules, revealing basic rules governing their composition. Specifically, we show that maternal factors consistently act as activators and that gap factors act as repressors, except for the bimodal factor Hunchback. Our data suggest a simple context-dependent rule for its switch from repressive to activating function. Overall, the composition of modules appears well fitted to the spatiotemporal distribution of their positive and negative input factors. Finally, by comparing Ahab predictions with different categories of transcription factor input, we confirm the global regulatory structure of the segmentation gene network, but find odd skipped behaving like a primary pair-rule gene. The study expands our knowledge of the segmentation gene network by increasing the number of experimentally tested modules by 50%. For the first time, the entire set of validated modules is analyzed for binding site composition under a
Susanna, Kim A.; Mironczuk, Aleksandra M.; Smits, Wiep Klaas; Hamoen, Leendert W.; Kuipers, Oscar P.
The competence transcription factor ComK plays a central role in competence development in Bacillus subtilis by activating the transcription of the K regulon. ComK-activated genes are characterized by the presence of a specific sequence to which ComK binds, a K-box, in their upstream DNA region.
Energy Technology Data Exchange (ETDEWEB)
Lim, Sang Yong; Kim, Dong Ho; Joe, Min Ho
2010-03-15
The transcriptional expression of the uscA promote (P{sub uscA}) only occurred under aerobic conditions and a dose of 2Gy maximally activated transcription of P{sub uscA}. However, various environmental stress including physical shocks (pH, temperature, osmotic shock), DNA damaging agents (UV and MMC) or oxidative stressagents (paraquat, menadione, and H{sub 2}O{sub 2}) didn't cause the transcriptional activationof P{sub uscA}. The transcription of uscA was initiated at 170 bp upstream of the cyoA start codon, and ended around the ampG stop codon. The size of uscA was determined through reverse transcription assay, approximately 250 bp. The deletion analysis of uscA promoter demonstrates that radiation inducibility of P{sub uscA} is mediated by sequences present between -20 and +111 relativeto +1 of P{sub uscA} and radiation causes P{sub uscA} activation thorough permitting the expression that is repressed under non-irradiated conditions
International Nuclear Information System (INIS)
Lim, Sang Yong; Kim, Dong Ho; Joe, Min Ho
2010-03-01
The transcriptional expression of the uscA promote (P uscA ) only occurred under aerobic conditions and a dose of 2Gy maximally activated transcription of P uscA . However, various environmental stress including physical shocks (pH, temperature, osmotic shock), DNA damaging agents (UV and MMC) or oxidative stressagents (paraquat, menadione, and H 2 O 2 ) didn't cause the transcriptional activationof P uscA . The transcription of uscA was initiated at 170 bp upstream of the cyoA start codon, and ended around the ampG stop codon. The size of uscA was determined through reverse transcription assay, approximately 250 bp. The deletion analysis of uscA promoter demonstrates that radiation inducibility of P uscA is mediated by sequences present between -20 and +111 relativeto +1 of P uscA and radiation causes P uscA activation thorough permitting the expression that is repressed under non-irradiated conditions
Tanaka, Mizuki; Yoshimura, Midori; Ogawa, Masahiro; Koyama, Yasuji; Shintani, Takahiro; Gomi, Katsuya
2016-07-01
Aspergillus oryzae produces a large amount of secreted proteins in solid-state culture, and some proteins such as glucoamylase (GlaB) and acid protease (PepA) are specifically produced in solid-state culture, but rarely in submerged culture. From the disruption mutant library of A. oryzae transcriptional regulators, we successfully identified a disruption mutant showing an extremely low production level of GlaB but a normal level of α-amylase production. This strain was a disruption mutant of the C2H2-type transcription factor, FlbC, which is reported to be involved in the regulation of conidiospore development. Disruption mutants of other upstream regulators comprising a conidiation regulatory network had no apparent effect on GlaB production in solid-state culture. In addition to GlaB, the production of acid protease in solid-state culture was also markedly decreased by flbC disruption. Northern blot analyses revealed that transcripts of glaB and pepA were significantly decreased in the flbC disruption strain. These results suggested that FlbC is involved in the transcriptional regulation of genes specifically expressed under solid-state cultivation conditions, possibly independent of the conidiation regulatory network.
Directory of Open Access Journals (Sweden)
Kohane Isaac
2005-11-01
Full Text Available Abstract Background Recent advances in genome sequencing suggest a remarkable conservation in gene content of mammalian organisms. The similarity in gene repertoire present in different organisms has increased interest in studying regulatory mechanisms of gene expression aimed at elucidating the differences in phenotypes. In particular, a proximal promoter region contains a large number of regulatory elements that control the expression of its downstream gene. Although many studies have focused on identification of these elements, a broader picture on the complexity of transcriptional regulation of different biological processes has not been addressed in mammals. The regulatory complexity may strongly correlate with gene function, as different evolutionary forces must act on the regulatory systems under different biological conditions. We investigate this hypothesis by comparing the conservation of promoters upstream of genes classified in different functional categories. Results By conducting a rank correlation analysis between functional annotation and upstream sequence alignment scores obtained by human-mouse and human-dog comparison, we found a significantly greater conservation of the upstream sequence of genes involved in development, cell communication, neural functions and signaling processes than those involved in more basic processes shared with unicellular organisms such as metabolism and ribosomal function. This observation persists after controlling for G+C content. Considering conservation as a functional signature, we hypothesize a higher density of cis-regulatory elements upstream of genes participating in complex and adaptive processes. Conclusion We identified a class of functions that are associated with either high or low promoter conservation in mammals. We detected a significant tendency that points to complex and adaptive processes were associated with higher promoter conservation, despite the fact that they have emerged
Promoter proximal polyadenylation sites reduce transcription activity
DEFF Research Database (Denmark)
Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick
2012-01-01
Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site......, which in turn causes reduced transcription. Functional depletion of U1 snRNP in the context of the wild-type SD triggers the same CpA event accompanied by decreased RNA levels. Thus, in accordance with recent findings, U1 snRNP can shield premature pA sites. The negative impact of unshielded pA sites...... on transcription requires promoter proximity, as demonstrated using artificial constructs and supported by a genome-wide data set. Importantly, transcription down-regulation can be recapitulated in a gene context devoid of splice sites by placing a functional bona fide pA site/transcription terminator within ∼500...
Specificity and robustness in transcription control networks.
Sengupta, Anirvan M; Djordjevic, Marko; Shraiman, Boris I
2002-02-19
Recognition by transcription factors of the regulatory DNA elements upstream of genes is the fundamental step in controlling gene expression. How does the necessity to provide stability with respect to mutation constrain the organization of transcription control networks? We examine the mutation load of a transcription factor interacting with a set of n regulatory response elements as a function of the factor/DNA binding specificity and conclude on theoretical grounds that the optimal specificity decreases with n. The predicted correlation between variability of binding sites (for a given transcription factor) and their number is supported by the genomic data for Escherichia coli. The analysis of E. coli genomic data was carried out using an algorithm suggested by the biophysical model of transcription factor/DNA binding. Complete results of the search for candidate transcription factor binding sites are available at http://www.physics.rockefeller.edu/~boris/public/search_ecoli.
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Global transcription profiling reveals comprehensive insights into hypoxic response in Arabidopsis.
Liu, Fenglong; Vantoai, Tara; Moy, Linda P; Bock, Geoffrey; Linford, Lara D; Quackenbush, John
2005-03-01
Plants have evolved adaptation mechanisms to sense oxygen deficiency in their environments and make coordinated physiological and structural adjustments to enhance their hypoxic tolerance. To gain insight into how plants respond to low-oxygen stress, gene expression profiling using whole-genome DNA amplicon microarrays was carried out at seven time points over 24 h, in wild-type and transgenic P(SAG12):ipt Arabidopsis (Arabidopsis thaliana) plants under normoxic and hypoxic conditions. Transcript levels of genes involved in glycolysis and fermentation pathways, ethylene synthesis and perception, calcium signaling, nitrogen utilization, trehalose metabolism, and alkaloid synthesis were significantly altered in response to oxygen limitation. Analysis based on gene ontology assignments suggested a significant down-regulation of genes whose functions are associated with cell walls, nucleosome structures, water channels, and ion transporters and a significant up-regulation of genes involved in transcriptional regulation, protein kinase activity, and auxin responses under conditions of oxygen shortage. Promoter analysis on a cluster of up-regulated genes revealed a significant overrepresentation of the AtMYB2-binding motif (GT motif), a sugar response element-like motif, and a G-box-related sequence, and also identified several putative anaerobic response elements. Finally, quantitative real-time polymerase chain reactions using 29 selected genes independently verified the microarray results. This study represents one of the most comprehensive analyses conducted to date investigating hypoxia-responsive transcriptional networks in plants.
Directory of Open Access Journals (Sweden)
Gerasimos F Kremmydas
Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.
Zang, Hongyan; Li, Ning; Pan, Yuling; Hao, Jingguang
2017-03-01
Breast cancer is a common malignancy among women with a rising incidence. Our intention was to detect transcription factors (TFs) for deeper understanding of the underlying mechanisms of breast cancer. Integrated analysis of gene expression datasets of breast cancer was performed. Then, functional annotation of differentially expressed genes (DEGs) was conducted, including Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment. Furthermore, TFs were identified and a global transcriptional regulatory network was constructed. Seven publically available GEO datasets were obtained, and a set of 1196 DEGs were identified (460 up-regulated and 736 down-regulated). Functional annotation results showed that cell cycle was the most significantly enriched pathway, which was consistent with the fact that cell cycle is closely related to various tumors. Fifty-three differentially expressed TFs were identified, and the regulatory networks consisted of 817 TF-target interactions between 46 TFs and 602 DEGs in the context of breast cancer. Top 10 TFs covering the most downstream DEGs were SOX10, NFATC2, ZNF354C, ARID3A, BRCA1, FOXO3, GATA3, ZEB1, HOXA5 and EGR1. The transcriptional regulatory networks could enable a better understanding of regulatory mechanisms of breast cancer pathology and provide an opportunity for the development of potential therapy.
Hidalgo, Alejandro A.; Deeb, Kristin K.; Pike, J. Wesley; Johnson, Candace S.; Trump, Donald L.
2011-01-01
Calcitriol, the active form of vitamin D, in combination with the glucocorticoid dexamethasone (Dex) has been shown to increase the antitumor effects of calcitriol in squamous cell carcinoma. In this study we found that pretreatment with Dex potentiates calcitriol effects by inhibiting cell growth and increasing vitamin D receptor (VDR) and VDR-mediated transcription. Treatment with actinomycin D inhibits Vdr mRNA synthesis, indicating that Dex regulates VDR expression at transcriptional level. Real time PCR shows that treatment with Dex increases Vdr transcripts in a time- and a dose-dependent manner, indicating that Dex directly regulates expression of Vdr. RU486, an inhibitor of glucocorticoids, inhibits Dex-induced Vdr expression. In addition, the silencing of glucocorticoid receptor (GR) abolishes the induction of Vdr by Dex, indicating that Dex increases Vdr transcripts in a GR-dependent manner. A fragment located 5.2 kb upstream of Vdr transcription start site containing two putative glucocorticoid response elements (GREs) was evaluated using a luciferase-based reporter assay. Treatment with 100 nm Dex induces transcription of luciferase driven by the fragment. Deletion of the GRE distal to transcription start site was sufficient to abolish Dex induction of luciferase. Also, chromatin immunoprecipitation reveals recruitment of GR to distal GRE with Dex treatment. We conclude that Dex increases VDR and vitamin D effects by increasing Vdr de novo transcription in a GR-dependent manner. PMID:21868377
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Directory of Open Access Journals (Sweden)
Stacey L Lehman
2015-06-01
Full Text Available Multiple transcripts encode for the cell cycle inhibitor p21(Cip1. These transcripts produce identical proteins but differ in their 5' untranslated regions (UTRs. Although several stresses that induce p21 have been characterized, the mechanisms regulating the individual transcript variants and their functional significance are unknown. Here we demonstrate through (35S labeling, luciferase reporter assays, and polysome transcript profiling that activation of the Integrated Stress Response (ISR kinase GCN2 selectively upregulates the translation of a p21 transcript variant containing 5' upstream open reading frames (uORFs through phosphorylation of the eukaryotic translation initiation factor eIF2α. Mutational analysis reveals that the uORFs suppress translation under basal conditions, but promote translation under stress. Functionally, ablation of p21 ameliorates G1/S arrest and reduces cell survival in response to GCN2 activation. These findings uncover a novel mechanism of p21 post-transcriptional regulation, offer functional significance for the existence of multiple p21 transcripts, and support a key role for GCN2 in regulating the cell cycle under stress.
Directory of Open Access Journals (Sweden)
Keeling Patrick J
2007-09-01
Full Text Available Abstract Background Dinoflagellates comprise an ecologically significant and diverse eukaryotic phylum that is sister to the phylum containing apicomplexan endoparasites. The mitochondrial genome of apicomplexans is uniquely reduced in gene content and size, encoding only three proteins and two ribosomal RNAs (rRNAs within a highly compacted 6 kb DNA. Dinoflagellate mitochondrial genomes have been comparatively poorly studied: limited available data suggest some similarities with apicomplexan mitochondrial genomes but an even more radical type of genomic organization. Here, we investigate structure, content and expression of dinoflagellate mitochondrial genomes. Results From two dinoflagellates, Crypthecodinium cohnii and Karlodinium micrum, we generated over 42 kb of mitochondrial genomic data that indicate a reduced gene content paralleling that of mitochondrial genomes in apicomplexans, i.e., only three protein-encoding genes and at least eight conserved components of the highly fragmented large and small subunit rRNAs. Unlike in apicomplexans, dinoflagellate mitochondrial genes occur in multiple copies, often as gene fragments, and in numerous genomic contexts. Analysis of cDNAs suggests several novel aspects of dinoflagellate mitochondrial gene expression. Polycistronic transcripts were found, standard start codons are absent, and oligoadenylation occurs upstream of stop codons, resulting in the absence of termination codons. Transcripts of at least one gene, cox3, are apparently trans-spliced to generate full-length mRNAs. RNA substitutional editing, a process previously identified for mRNAs in dinoflagellate mitochondria, is also implicated in rRNA expression. Conclusion The dinoflagellate mitochondrial genome shares the same gene complement and fragmentation of rRNA genes with its apicomplexan counterpart. However, it also exhibits several unique characteristics. Most notable are the expansion of gene copy numbers and their arrangements
Nascent-Seq reveals novel features of mouse circadian transcriptional regulation
Menet, Jerome S; Rodriguez, Joseph; Abruzzi, Katharine C; Rosbash, Michael
2012-01-01
A substantial fraction of the metazoan transcriptome undergoes circadian oscillations in many cells and tissues. Based on the transcription feedback loops important for circadian timekeeping, it is commonly assumed that this mRNA cycling reflects widespread transcriptional regulation. To address this issue, we directly measured the circadian dynamics of mouse liver transcription using Nascent-Seq (genome-wide sequencing of nascent RNA). Although many genes are rhythmically transcribed, many rhythmic mRNAs manifest poor transcriptional rhythms, indicating a prominent contribution of post-transcriptional regulation to circadian mRNA expression. This analysis of rhythmic transcription also showed that the rhythmic DNA binding profile of the transcription factors CLOCK and BMAL1 does not determine the transcriptional phase of most target genes. This likely reflects gene-specific collaborations of CLK:BMAL1 with other transcription factors. These insights from Nascent-Seq indicate that it should have broad applicability to many other gene expression regulatory issues. DOI: http://dx.doi.org/10.7554/eLife.00011.001 PMID:23150795
D'Alessio, Maya; Nordeste, Ricardo; Doxey, Andrew C; Charles, Trevor C
2017-01-01
Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti , we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis ( phbA , phbB , phbAB , and phbC ), PHB degradation ( bdhA , phaZ , and acsA2 ), and glycogen synthesis ( glgA1 ). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to
Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru
2017-11-01
We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.
Cloning and functional analysis of 5'-upstream region of the Pokemon gene.
Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang
2008-04-01
Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.
Richardson, Dale N.; Wiehe, Thomas
Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.
Zhang, Chao; Peng, Xi; Guo, Xiaofeng; Tang, Gaijuan; Sun, Fengli; Liu, Shudong; Xi, Yajun
2018-01-01
Switchgrass ( Panicum virgatum L.) is a model biofuel plant because of its high biomass, cellulose-richness, easy degradation to ethanol, and the availability of extensive genomic information. However, a little is currently known about the molecular responses of switchgrass plants to dehydration stress, especially multiple dehydration stresses. Studies on the transcriptional profiles of 35-day-old tissue culture plants revealed 741 dehydration memory genes. Gene Ontology and pathway analysis showed that these genes were enriched in phenylpropanoid biosynthesis, starch and sucrose metabolism, and plant hormone signal transduction. Further analysis of specific pathways combined with physiological data suggested that switchgrass improved its dehydration resistance by changing various aspects of its responses to secondary dehydration stress (D2), including the regulation of abscisic acid (ABA) and jasmonic acid (JA) biosynthesis and signal transduction, the biosynthesis of osmolytes (l-proline, stachyose and trehalose), energy metabolism (i.e., metabolic process relating to photosynthetic systems, glycolysis, and the TCA cycle), and lignin biosynthesis. The transcriptional data and chemical substance assays showed that ABA was significantly accumulated during both primary (D1) and secondary (D2) dehydration stresses, whereas JA accumulated during D1 but became significantly less abundant during D2. This suggests the existence of a complicated signaling network of plant hormones in response to repeated dehydration stresses. A homology analysis focusing on switchgrass, maize, and Arabidopsis revealed the conservation and species-specific distribution of dehydration memory genes. The molecular responses of switchgrass plants to successive dehydration stresses have been systematically characterized, revealing a previously unknown transcriptional memory behavior. These results provide new insights into the mechanisms of dehydration stress responses in plants. The genes and
Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2007-01-01
Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.
Meex, S.J.; Vliet-Ostaptchouk, J.V.; Kallen, van der C.J.H.; Greevenbroek, M.M.; Schalkwijk, C.G.; Feskens, E.J.M.; Blaak, E.E.; Wijmenga, C.; Hofker, M.H.; Stehouwer, C.D.; Bruin, T.W.
2008-01-01
Type 2 diabetes shares substantial genetic and phenotypic overlap with familial combined hyperlipidemia. Upstream stimulatory factor 1 (USF1), a well-established susceptibility gene for familial combined hyperlipidemia, is postulated to be such a shared genetic determinant. We evaluated two
Directory of Open Access Journals (Sweden)
Wayne Chadwick
Full Text Available The central nervous system normally functions at O(2 levels which would be regarded as hypoxic by most other tissues. However, most in vitro studies of neurons and astrocytes are conducted under hyperoxic conditions without consideration of O(2-dependent cellular adaptation. We analyzed the reactivity of astrocytes to 1, 4 and 9% O(2 tensions compared to the cell culture standard of 20% O(2, to investigate their ability to sense and translate this O(2 information to transcriptional activity. Variance of ambient O(2 tension for rat astrocytes resulted in profound changes in ribosomal activity, cytoskeletal and energy-regulatory mechanisms and cytokine-related signaling. Clustering of transcriptional regulation patterns revealed four distinct response pattern groups that directionally pivoted around the 4% O(2 tension, or demonstrated coherent ascending/decreasing gene expression patterns in response to diverse oxygen tensions. Immune response and cell cycle/cancer-related signaling pathway transcriptomic subsets were significantly activated with increasing hypoxia, whilst hemostatic and cardiovascular signaling mechanisms were attenuated with increasing hypoxia. Our data indicate that variant O(2 tensions induce specific and physiologically-focused transcript regulation patterns that may underpin important physiological mechanisms that connect higher neurological activity to astrocytic function and ambient oxygen environments. These strongly defined patterns demonstrate a strong bias for physiological transcript programs to pivot around the 4% O(2 tension, while uni-modal programs that do not, appear more related to pathological actions. The functional interaction of these transcriptional 'programs' may serve to regulate the dynamic vascular responsivity of the central nervous system during periods of stress or heightened activity.
Transcriptional regulation of hepatic lipogenesis.
Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook
2015-11-01
Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.
Directory of Open Access Journals (Sweden)
Jeffrey A Pleiss
2007-04-01
Full Text Available Appropriate expression of most eukaryotic genes requires the removal of introns from their pre-messenger RNAs (pre-mRNAs, a process catalyzed by the spliceosome. In higher eukaryotes a large family of auxiliary factors known as SR proteins can improve the splicing efficiency of transcripts containing suboptimal splice sites by interacting with distinct sequences present in those pre-mRNAs. The yeast Saccharomyces cerevisiae lacks functional equivalents of most of these factors; thus, it has been unclear whether the spliceosome could effectively distinguish among transcripts. To address this question, we have used a microarray-based approach to examine the effects of mutations in 18 highly conserved core components of the spliceosomal machinery. The kinetic profiles reveal clear differences in the splicing defects of particular pre-mRNA substrates. Most notably, the behaviors of ribosomal protein gene transcripts are generally distinct from other intron-containing transcripts in response to several spliceosomal mutations. However, dramatically different behaviors can be seen for some pairs of transcripts encoding ribosomal protein gene paralogs, suggesting that the spliceosome can readily distinguish between otherwise highly similar pre-mRNAs. The ability of the spliceosome to distinguish among its different substrates may therefore offer an important opportunity for yeast to regulate gene expression in a transcript-dependent fashion. Given the high level of conservation of core spliceosomal components across eukaryotes, we expect that these results will significantly impact our understanding of how regulated splicing is controlled in higher eukaryotes as well.
International Nuclear Information System (INIS)
Bucek, Pavel; Gargallo, Raimundo; Kudrev, Andrei
2010-01-01
The c-kit oncogene shows a cytosine-rich DNA region upstream of the transcription initiation site which forms an i-motif structure at slightly acidic pH values (Bucek et al. ). In the present study, the pH-induced formation of i-motif - forming sequences 5'-CCC CTC CCT CGC GCC CGC CCG-3' (ckitC1, native), 5'-CCC TTC CCT TGT GCC CGC CCG-3' (ckitC2) and 5'-CCCTT CCC TTTTT CCC T CCC T-3' (ckitC3) was studied by spectroscopic techniques, such as UV molecular absorption and circular dichroism (CD), in tandem with two multivariate data analysis methods, the hard modelling-based matrix method and the soft modelling-based MCR-ALS approach. Use of the hard chemical modelling enabled us to propose the equilibrium model, which describes spectral changes as functions of solution acidity. Additionally, the intrinsic protonation constant, K in , and the cooperativity parameters, ω c , and ω a , were calculated from the fitting procedure of the coupled CD and molecular absorption spectra. In the case of ckitC2 and ckitC3, the hard model correctly reproduced the spectral variations observed experimentally. The results indicated that folding was accompanied by a cooperative process, i.e. the enhancement of protonated structure stability upon protonation. In contrast, unfolding was accompanied by an anticooperative process. Finally, folding of the native sequence, ckitC1, seemed to follow a more complex mechanism.
Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.
Xue, Gongda; Hemmings, Brian A
2012-02-01
The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.
Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin
2017-02-14
Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter
2008-01-01
Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of
2018-01-01
Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404
Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S
2012-05-01
The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.
Mycoplasma hyopneumoniae Transcription Unit Organization: Genome Survey and Prediction
Siqueira, Franciele Maboni; Schrank, Augusto; Schrank, Irene Silveira
2011-01-01
Mycoplasma hyopneumoniae is associated with swine respiratory diseases. Although gene organization and regulation are well known in many prokaryotic organisms, knowledge on mycoplasma is limited. This study performed a comparative analysis of three strains of M. hyopneumoniae (7448, J and 232), with a focus on genome organization and gene comparison for open read frame (ORF) cluster (OC) identification. An in silico analysis of gene organization demonstrated 117 OCs and 34 single ORFs in M. hyopneumoniae 7448 and J, while 116 OCs and 36 single ORFs were identified in M. hyopneumoniae 232. Genomic comparison revealed high synteny and conservation of gene order between the OCs defined for 7448 and J strains as well as for 7448 and 232 strains. Twenty-one OCs were chosen and experimentally confirmed by reverse transcription–PCR from M. hyopneumoniae 7448 genome, validating our prediction. A subset of the ORFs within an OC could be independently transcribed due to the presence of internal promoters. Our results suggest that transcription occurs in ‘run-on’ from an upstream promoter in M. hyopneumoniae, thus forming large ORF clusters (from 2 to 29 ORFs in the same orientation) and indicating a complex transcriptional organization. PMID:22086999
Directory of Open Access Journals (Sweden)
Najmeh Jouyan
2015-03-01
Conclusion: It appears that the usf1s2 variant in upstream transcription factor 1 gene is an independent predictor of premature coronary artery disease in our population and applies its effects without affecting blood sugar and lipid levels.
Zhu, Jufen; Yu, Xinxu; Xie, Baogui; Gu, Xiaokui; Zhang, Zhenying; Li, Shaojie
2013-06-01
To gain insight into the regulatory mechanisms of oxidative stress responses in filamentous fungi, the genome-wide transcriptional response of Neurospora crassa to menadione was analysed by digital gene expression (DGE) profiling, which identified 779 upregulated genes and 576 downregulated genes. Knockout mutants affecting 130 highly-upregulated genes were tested for menadione sensitivity, which revealed that loss of the transcription factor siderophore regulation (SRE) (a transcriptional repressor for siderophore biosynthesis), catatase-3, cytochrome c peroxidase or superoxide dismutase 1 copper chaperone causes hypersensitivity to menadione. Deletion of sre dramatically increased transcription of the siderophore biosynthesis gene ono and the siderophore iron transporter gene sit during menadione stress, suggesting that SRE is required for repression of iron uptake under oxidative stress conditions. Contrary to its phenotype, the sre deletion mutant showed higher transcriptional levels of genes encoding reactive oxygen species (ROS) scavengers than wild type during menadione stress, which implies that the mutant suffers a higher level of oxidative stress than wild type. Uncontrolled iron uptake in the sre mutant might exacerbate cellular oxidative stress. This is the first report of a negative regulator of iron assimilation participating in the fungal oxidative stress response. In addition to SRE, eight other transcription factor genes were also menadione-responsive but their single gene knockout mutants showed wild-type menadione sensitivity. Two of them, named as mit-2 (menadione induced transcription factor-2) and mit-4 (menadione induced transcription factor-4), were selected for double mutant analysis. The double mutant was hypersensitive to menadione. Similarly, the double mutation of mit-2 and sre also had additive effects on menadione sensitivity, suggesting multiple transcription factors mediate oxidative stress resistance in an additive manner
Pan, Ya-Jie; Liu, Jia; Guo, Xiao-Rui; Zu, Yuan-Gang; Tang, Zhong-Hua
2015-05-01
Research on transcriptional regulation of terpenoid indole alkaloid (TIA) biosynthesis of the medicinal plant, Catharanthus roseus, has largely been focused on gene function and not clustering analysis of multiple genes at the transcript level. Here, more than ten key genes encoding key enzyme of alkaloid synthesis in TIA biosynthetic pathways were chosen to investigate the integrative responses to exogenous elicitor ethylene and copper (Cu) at both transcriptional and metabolic levels. The ethylene-induced gene transcripts in leaves and roots, respectively, were subjected to principal component analysis (PCA) and the results showed the overall expression of TIA pathway genes indicated as the Q value followed a standard normal distribution after ethylene treatments. Peak gene expression was at 15-30 μM of ethephon, and the pre-mature leaf had a higher Q value than the immature or mature leaf and root. Treatment with elicitor Cu found that Cu up-regulated overall TIA gene expression more in roots than in leaves. The combined effects of Cu and ethephon on TIA gene expression were stronger than their separate effects. It has been documented that TIA gene expression is tightly regulated by the transcriptional factor (TF) ethylene responsive factor (ERF) and mitogen-activated protein kinase (MAPK) cascade. The loading plot combination with correlation analysis for the genes of C. roseus showed that expression of the MPK gene correlated with strictosidine synthase (STR) and strictosidine b-D-glucosidase(SGD). In addition, ERF expression correlated with expression of secologanin synthase (SLS) and tryptophan decarboxylase (TDC), specifically in roots, whereas MPK and myelocytomatosis oncogene (MYC) correlated with STR and SGD genes. In conclusion, the ERF regulates the upstream pathway genes in response to heavy metal Cu mainly in C. roseus roots, while the MPK mainly participates in regulating the STR gene in response to ethylene in pre-mature leaf. Interestingly, the
Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.
Directory of Open Access Journals (Sweden)
Shan Goh
Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.
Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R
1996-03-01
In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.
Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M; Evans, Ronald M; Gage, Fred H
2012-02-17
Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs.
Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M.; Evans, Ronald M.; Gage, Fred H.
2012-01-01
Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs. PMID:22194602
Directory of Open Access Journals (Sweden)
Deyholos Michael K
2006-10-01
Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent
Intrinsic terminators in Mycoplasma hyopneumoniae transcription.
Fritsch, Tiago Ebert; Siqueira, Franciele Maboni; Schrank, Irene Silveira
2015-04-08
Mycoplasma hyopneumoniae, an important pathogen of swine, exhibits a low guanine and cytosine (GC) content genome. M. hyopneumoniae genome is organised in long transcriptional units and promoter sequences have been mapped upstream of all transcription units. These analysis provided insights into the gene organisation and transcription initiation at the genome scale. However, the presence of transcriptional terminator sequences in the M. hyopneumoniae genome is poorly understood. In silico analyses demonstrated the presence of putative terminators in 82% of the 33 monocistronic units (mCs) and in 74% of the 116 polycistronic units (pCs) considering different classes of terminators. The functional activity of 23 intrinsic terminators was confirmed by RT-PCR and qPCR. Analysis of all terminators found by three software algorithms, combined with experimental results, allowed us to propose a pattern of RNA hairpin formation during the termination process and to predict the location of terminators in the M. hyopneumoniae genome sequence. The stem-loop structures of intrinsic terminators of mycoplasma diverge from the pattern of terminators found in other bacteria due the low content of guanine and cytosine. In M. hyopneumoniae, transcription can end after a transcriptional unit and before its terminator sequence and can also continue past the terminator sequence with RNA polymerases gradually releasing the RNA.
DEFF Research Database (Denmark)
Österlund, Tobias; Bordel, Sergio; Nielsen, Jens
2015-01-01
% for the human network. The high controllability (low number of drivers needed to control the system) in yeast, mouse and human is due to the presence of internal loops in their regulatory networks where the TFs regulate each other in a circular fashion. We refer to these internal loops as circular control...... motifs (CCM). The E. coli transcriptional regulatory network, which does not have any CCMs, shows a hierarchical structure of the transcriptional regulatory network in contrast to the eukaryal networks. The presence of CCMs also has influence on the stability of these networks, as the presence of cycles...
Auxin-dependent compositional change in Mediator in ARF7- and ARF19-mediated transcription.
Ito, Jun; Fukaki, Hidehiro; Onoda, Makoto; Li, Lin; Li, Chuanyou; Tasaka, Masao; Furutani, Masahiko
2016-06-07
Mediator is a multiprotein complex that integrates the signals from transcription factors binding to the promoter and transmits them to achieve gene transcription. The subunits of Mediator complex reside in four modules: the head, middle, tail, and dissociable CDK8 kinase module (CKM). The head, middle, and tail modules form the core Mediator complex, and the association of CKM can modify the function of Mediator in transcription. Here, we show genetic and biochemical evidence that CKM-associated Mediator transmits auxin-dependent transcriptional repression in lateral root (LR) formation. The AUXIN/INDOLE 3-ACETIC ACID 14 (Aux/IAA14) transcriptional repressor inhibits the transcriptional activity of its binding partners AUXIN RESPONSE FACTOR 7 (ARF7) and ARF19 by making a complex with the CKM-associated Mediator. In addition, TOPLESS (TPL), a transcriptional corepressor, forms a bridge between IAA14 and the CKM component MED13 through the physical interaction. ChIP assays show that auxin induces the dissociation of MED13 but not the tail module component MED25 from the ARF7 binding region upstream of its target gene. These findings indicate that auxin-induced degradation of IAA14 changes the module composition of Mediator interacting with ARF7 and ARF19 in the upstream region of their target genes involved in LR formation. We suggest that this regulation leads to a quick switch of signal transmission from ARFs to target gene expression in response to auxin.
Directory of Open Access Journals (Sweden)
Hong Hao
Full Text Available A stringent control of homeostasis is critical for functional maintenance and survival of neurons. In the mammalian retina, the basic motif leucine zipper transcription factor NRL determines rod versus cone photoreceptor cell fate and activates the expression of many rod-specific genes. Here, we report an integrated analysis of NRL-centered gene regulatory network by coupling chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-Seq data from Illumina and ABI platforms with global expression profiling and in vivo knockdown studies. We identified approximately 300 direct NRL target genes. Of these, 22 NRL targets are associated with human retinal dystrophies, whereas 95 mapped to regions of as yet uncloned retinal disease loci. In silico analysis of NRL ChIP-Seq peak sequences revealed an enrichment of distinct sets of transcription factor binding sites. Specifically, we discovered that genes involved in photoreceptor function include binding sites for both NRL and homeodomain protein CRX. Evaluation of 26 ChIP-Seq regions validated their enhancer functions in reporter assays. In vivo knockdown of 16 NRL target genes resulted in death or abnormal morphology of rod photoreceptors, suggesting their importance in maintaining retinal function. We also identified histone demethylase Kdm5b as a novel secondary node in NRL transcriptional hierarchy. Exon array analysis of flow-sorted photoreceptors in which Kdm5b was knocked down by shRNA indicated its role in regulating rod-expressed genes. Our studies identify candidate genes for retinal dystrophies, define cis-regulatory module(s for photoreceptor-expressed genes and provide a framework for decoding transcriptional regulatory networks that dictate rod homeostasis.
Liu, Fenglong; VanToai, Tara; Moy, Linda P.; Bock, Geoffrey; Linford, Lara D.; Quackenbush, John
2005-01-01
Plants have evolved adaptation mechanisms to sense oxygen deficiency in their environments and make coordinated physiological and structural adjustments to enhance their hypoxic tolerance. To gain insight into how plants respond to low-oxygen stress, gene expression profiling using whole-genome DNA amplicon microarrays was carried out at seven time points over 24 h, in wild-type and transgenic PSAG12:ipt Arabidopsis (Arabidopsis thaliana) plants under normoxic and hypoxic conditions. Transcript levels of genes involved in glycolysis and fermentation pathways, ethylene synthesis and perception, calcium signaling, nitrogen utilization, trehalose metabolism, and alkaloid synthesis were significantly altered in response to oxygen limitation. Analysis based on gene ontology assignments suggested a significant down-regulation of genes whose functions are associated with cell walls, nucleosome structures, water channels, and ion transporters and a significant up-regulation of genes involved in transcriptional regulation, protein kinase activity, and auxin responses under conditions of oxygen shortage. Promoter analysis on a cluster of up-regulated genes revealed a significant overrepresentation of the AtMYB2-binding motif (GT motif), a sugar response element-like motif, and a G-box-related sequence, and also identified several putative anaerobic response elements. Finally, quantitative real-time polymerase chain reactions using 29 selected genes independently verified the microarray results. This study represents one of the most comprehensive analyses conducted to date investigating hypoxia-responsive transcriptional networks in plants. PMID:15734912
Li, Guohui; Hu, Zhaoyang; Guo, Xuli; Li, Guangtian; Tang, Qi; Wang, Peng; Chen, Keping; Yao, Qin
2013-06-01
Bombyx mori bidensovirus (BmBDV) VD1-ORF4 (open reading frame 4, ORF4) consists of 3,318 nucleotides, which codes for a predicted 1,105-amino acid protein containing a conserved DNA polymerase motif. However, its functions in viral propagation remain unknown. In the current study, the transcription of VD1-ORF4 was examined from 6 to 96 h postinfection (p.i.) by RT-PCR, 5'-RACE revealed the transcription initiation site of BmBDV ORF4 to be -16 nucleotides upstream from the start codon, and 3'-RACE revealed the transcription termination site of VD1-ORF4 to be +7 nucleotides downstream from termination codon. Three different proteins were examined in the extracts of BmBDV-infected silkworms midguts by Western blot using raised antibodies against VD1-ORF4 deduced amino acid, and a specific protein band about 53 kDa was further detected in purified virions using the same antibodies. Taken together, BmBDV VD1-ORF4 codes for three or more proteins during the viral life cycle, one of which is a 53 kDa protein and confirmed to be a component of BmBDV virion.
Observations of two distinct populations of bow shock ions in the upstream solar wind
International Nuclear Information System (INIS)
Gosling, J.T.; Asbridge, J.; Bame, S.J.; Paschmann, G.; Sckopke, N.
1978-01-01
Observations upstream of the earth's bow shock with the LASL/MPI fast plasma experiments on ISEE 1 and 2 reveal the presence of two distinct and mutually exclusive populations of low energy (< or approx. =40keV) ions apparently accelerated at the bow shock. The first of these, the ''reflected'' population, is characterized by 1) sharply peaked spectra seldom extending much above approx. 10 keV/ion and 2) relatively collimated flow coming from the direction of the shock. On the other hand, the ''diffuse'' ions are distinguished by relatively flat energy spectra above approx. 10 keV and broad angular distributions. They are by far the most commonly observed upstream ion event. A close causal association is suggested between the diffuse ion population in the upstream solar wind and energetic plasma ions observed within the magnetosheath
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Directory of Open Access Journals (Sweden)
Lindblad Peter
2008-04-01
Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the
Enhancing yeast transcription analysis through integration of heterogeneous data
DEFF Research Database (Denmark)
Grotkjær, Thomas; Nielsen, Jens
2004-01-01
of Saccharomyces cerevisiae whole genome transcription data. A special focus is on the quantitative aspects of normalisation and mathematical modelling approaches, since they are expected to play an increasing role in future DNA microarray analysis studies. Data analysis is exemplified with cluster analysis......DNA microarray technology enables the simultaneous measurement of the transcript level of thousands of genes. Primary analysis can be done with basic statistical tools and cluster analysis, but effective and in depth analysis of the vast amount of transcription data requires integration with data...... from several heterogeneous data Sources, such as upstream promoter sequences, genome-scale metabolic models, annotation databases and other experimental data. In this review, we discuss how experimental design, normalisation, heterogeneous data and mathematical modelling can enhance analysis...
Directory of Open Access Journals (Sweden)
Taketo Wakai
Full Text Available Transcriptional negative regulation of the proteolytic system of Lactobacillus helveticus CM4 in response to amino acids seems to be very important for the control of antihypertensive peptide production; however, it remains poorly understood. A 26-kDa protein with N-terminal cystathionine β-synthase domains (CBS domain protein, which seems to be involved in the regulatory system, was purified by using a DNA-sepharose bound 300-bp DNA fragment corresponding to the upstream regions of the six proteolytic genes that are down-regulated by amino acids. The CBS domain protein bound to a DNA fragment corresponding to the region upstream of the pepV gene in response to branched chain amino acids (BCAAs. The expression of the pepV gene in Escherichia coli grown in BCAA-enriched medium was repressed when the CBS domain protein was co-expressed. These results reveal that the CBS domain protein acts as a novel type of BCAA-responsive transcriptional regulator (BCARR in L. helveticus. From comparative analysis of the promoter regions of the six proteolysis genes, a palindromic AT-rich motif, 5'-AAAAANNCTWTTATT-3', was predicted as the consensus DNA motif for the BCARR protein binding. Footprint analysis using the pepV promotor region and gel shift analyses with the corresponding short DNA fragments strongly suggested that the BCARR protein binds adjacent to the pepV promoter region and affects the transcription level of the pepV gene in the presence of BCAAs. Homology search analysis of the C-terminal region of the BCARR protein suggested the existence of a unique βαββαβ fold structure that has been reported in a variety of ACT (aspartate kinase-chorismate mutase-tyrA domain proteins for sensing amino acids. These results also suggest that the sensing of BCAAs by the ACT domain might promote the binding of the BCARR to DNA sequences upstream of proteolysis genes, which affects the gene expression of the proteolytic system in L. helveticus.
Kurose, Kouichi; Koyano, Satoru; Ikeda, Shinobu; Tohkin, Masahiro; Hasegawa, Ryuichi; Sawada, Jun-Ichi
2005-05-01
The human pregnane X receptor (PXR) is a crucial regulator of the genes encoding several major cytochrome P450 enzymes and transporters, such as CYP3A4 and MDR1, but its own transcriptional regulation remains unclear. To elucidate the transcriptional mechanisms of human PXR gene, we first endeavored to identify the transcription initiation site of human PXR using 5'-RACE. Five types of 5'-variable transcripts (a, b, c, d, and e) with common exon 2 sequence were found, and comparison of these sequences with the genomic sequence suggested that their 5' diversity is derived from initiation by alternative promoters and alternative splicing. None of the exons found in our study contain any new in-frame coding regions. Newly identified introns IVS-a and IVS-b were found to have CT-AC splice sites that do not follow the GT-AG rule of conventional donor and acceptor splice sites. Of the five types of 5' variable transcripts identified, RT-PCR showed that type-a was the major transcript type. Four transcription initiation sites (A-D) for type-a transcript were identified by 5'-RACE using GeneRacer RACE Ready cDNA (human liver) constructed by the oligo-capping method. Putative TATA boxes were located approximately 30 bp upstream from the transcriptional start sites of the major transcript (C) and the longest minor transcript (A) expressed in the human liver. These results indicate that the initiation of transcription of human PXR is more complex than previously reported.
Kawashima, Tomokazu; Wang, Xingjun; Henry, Kelli F; Bi, Yuping; Weterings, Koen; Goldberg, Robert B
2009-03-03
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the scarlet runner bean (Phaseolus coccineus) G564 gene to understand how genes are activated specifically within the suspensor during early embryo development. Previously, we showed that the G564 upstream region has a block of tandem repeats, which contain a conserved 10-bp motif (GAAAAG(C)/(T)GAA), and that deletion of these repeats results in a loss of suspensor transcription. Here, we use gain-of-function (GOF) experiments with transgenic globular-stage tobacco embryos to show that only 1 of the 5 tandem repeats is required to drive suspensor-specific transcription. Fine-scale deletion and scanning mutagenesis experiments with 1 tandem repeat uncovered a 54-bp region that contains all of the sequences required to activate transcription in the suspensor, including the 10-bp motif (GAAAAGCGAA) and a similar 10-bp-like motif (GAAAAACGAA). Site-directed mutagenesis and GOF experiments indicated that both the 10-bp and 10-bp-like motifs are necessary, but not sufficient to activate transcription in the suspensor, and that a sequence (TTGGT) between the 10-bp and the 10-bp-like motifs is also necessary for suspensor transcription. Together, these data identify sequences that are required to activate transcription in the suspensor of a plant embryo after fertilization.
Metabolic Network Topology Reveals Transcriptional Regulatory Signatures of Type 2 Diabetes
DEFF Research Database (Denmark)
Zelezniak, Aleksej; Pers, Tune Hannes; Pinho Soares, Simao Pedro
2010-01-01
mechanisms underlying these transcriptional changes and their impact on the cellular metabolic phenotype is a challenging task due to the complexity of transcriptional regulation and the highly interconnected nature of the metabolic network. In this study we integrate skeletal muscle gene expression datasets...... with human metabolic network reconstructions to identify key metabolic regulatory features of T2DM. These features include reporter metabolites—metabolites with significant collective transcriptional response in the associated enzyme-coding genes, and transcription factors with significant enrichment...... factor regulatory network connecting several parts of metabolism. The identified transcription factors include members of the CREB, NRF1 and PPAR family, among others, and represent regulatory targets for further experimental analysis. Overall, our results provide a holistic picture of key metabolic...
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells.
Directory of Open Access Journals (Sweden)
Colin R Lickwar
2017-08-01
Full Text Available The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development
Directory of Open Access Journals (Sweden)
Izumi Kaneko
2015-05-01
Full Text Available Stage-specific transcription is a fundamental biological process in the life cycle of the Plasmodium parasite. Proteins containing the AP2 DNA-binding domain are responsible for stage-specific transcriptional regulation and belong to the only known family of transcription factors in Plasmodium parasites. Comprehensive identification of their target genes will advance our understanding of the molecular basis of stage-specific transcriptional regulation and stage-specific parasite development. AP2-O is an AP2 family transcription factor that is expressed in the mosquito midgut-invading stage, called the ookinete, and is essential for normal morphogenesis of this stage. In this study, we identified the genome-wide target genes of AP2-O by chromatin immunoprecipitation-sequencing and elucidate how this AP2 family transcription factor contributes to the formation of this motile stage. The analysis revealed that AP2-O binds specifically to the upstream genomic regions of more than 500 genes, suggesting that approximately 10% of the parasite genome is directly regulated by AP2-O. These genes are involved in distinct biological processes such as morphogenesis, locomotion, midgut penetration, protection against mosquito immunity and preparation for subsequent oocyst development. This direct and global regulation by AP2-O provides a model for gene regulation in Plasmodium parasites and may explain how these parasites manage to control their complex life cycle using a small number of sequence-specific AP2 transcription factors.
The ygaVP Genes of Escherichia coli Form a Tributyltin-Inducible Operon▿ †
Gueuné, Hervé; Durand, Marie-José; Thouand, Gérald; DuBow, Michael S.
2008-01-01
A tributyltin (TBT) luxAB transcriptional fusion in Escherichia coli revealed that a TBT-activated promoter is located upstream of two cotranscribed orphan genes, ygaV and ygaP. We demonstrate that transcription from the promoter upstream of ygaVP is constitutive in a ygaVP mutant, suggesting that YgaV is an autoregulated, TBT-inducible repressor.
Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan
2014-01-01
Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.
Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization
Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue
2010-01-01
Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873
Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi
2018-05-17
Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.
Directory of Open Access Journals (Sweden)
Umberto Rosani
Full Text Available BACKGROUND: Effective innate responses against potential pathogens are essential in the living world and possibly contributed to the evolutionary success of invertebrates. Taken together, antimicrobial peptide (AMP precursors of defensin, mytilin, myticin and mytimycin can represent about 40% of the hemocyte transcriptome in mussels injected with viral-like and bacterial preparations, and unique profiles of myticin C variants are expressed in single mussels. Based on amplicon pyrosequencing, we have ascertained and compared the natural and Vibrio-induced diversity of AMP transcripts in mussel hemocytes from three European regions. METHODOLOGY/PRINCIPAL FINDINGS: Hemolymph was collected from mussels farmed in the coastal regions of Palavas (France, Vigo (Spain and Venice (Italy. To represent the AMP families known in M. galloprovincialis, nine transcript sequences have been selected, amplified from hemocyte RNA and subjected to pyrosequencing. Hemolymph from farmed (offshore and wild (lagoon Venice mussels, both injected with 10(7 Vibrio cells, were similarly processed. Amplicon pyrosequencing emphasized the AMP transcript diversity, with Single Nucleotide Changes (SNC minimal for mytilin B/C and maximal for arthropod-like defensin and myticin C. Ratio of non-synonymous vs. synonymous changes also greatly differed between AMP isotypes. Overall, each amplicon revealed similar levels of nucleotidic variation across geographical regions, with two main sequence patterns confirmed for mytimycin and no substantial changes after immunostimulation. CONCLUSIONS/SIGNIFICANCE: Barcoding and bidirectional pyrosequencing allowed us to map and compare the transcript diversity of known mussel AMPs. Though most of the genuine cds variation was common to the analyzed samples we could estimate from 9 to 106 peptide variants in hemolymph pools representing 100 mussels, depending on the AMP isoform and sampling site. In this study, no prevailing SNC patterns related
Monitoring upstream sinkhole development by detailed sonar profiling
Energy Technology Data Exchange (ETDEWEB)
Rigbey, S. [Acres International Ltd., Niagara Falls, ON (Canada)
2004-09-01
This paper describes the development and use of a simple sonar system that has been used by engineers for routine monitoring of small sinkholes on the upstream face of a distressed earth dam. Improper construction of the dam led to the development of several sinkholes measuring 10 to 20 m in diameter upstream from the dam which is founded on deep alluvial sands and gravels. The dam has a central core of silt and leakage varies between 200 and 500 l/s, depending on the water level of the reservoir. The main issues with the upstream blanket are: improper fill placement due to the inability to dewater the area properly; omission of a filter material between the blanket and the alluvium foundation; thin placement of fill and runnelling of the blanket prior to impoundment; and, short upstream extent of the blanket. A downstream weighting toe of material was placed to address the seepage and piping that developed immediately following impounding. Other incidents continued over the years, such as downstream sinkholes, slumping of the crest and repairs about 12 years after construction. An inverter filter was also constructed to better control the seepage. Simple bathymetric surveys conducted by sounding the bottom of the reservoir from the ice surface each winter revealed the presence of several large sinkholes. Although infilling programs were conducted, sinkholes redeveloped after each program. The bathymetric surveys were found to be limited in accuracy and repeatability. Therefore, it was not possible to monitor small developments on a yearly basis. A 3-dimensional seepage model was developed to reconcile some of the unexplained piezometric patterns and to better understand the seepage patterns. However, this was also unsuccessful on its own. A trial sonar survey was then undertaken in 2002 by a Vancouver-based sonar company using an Imagenix profiling sonar head. It was successful in locating a small, previously unknown sinkhole measuring a few metres in diameter at
Directory of Open Access Journals (Sweden)
Sheo Shankar Pandey
2016-11-01
Full Text Available Abilities of bacterial pathogens to adapt to the iron limitation present in hosts is critical to their virulence. Bacterial pathogens have evolved diverse strategies to coordinately regulate iron metabolism and virulence associated functions to maintain iron homeostasis in response to changing iron availability in the environment. In many bacteria the ferric uptake regulator (Fur functions as transcription factor that utilize ferrous form of iron as cofactor to regulate transcription of iron metabolism and many cellular functions. However, mechanisms of fine-tuning and coordinated regulation of virulence associated function beyond iron and Fur-Fe2+ remain undefined. In this study, we show that a novel transcriptional regulator XibR (named Xanthomonas iron binding regulator of the NtrC family, is required for fine-tuning and co-coordinately regulating the expression of several iron regulated genes and virulence associated functions in phytopathogen Xanthomonas campestris pv. campestris (Xcc. Genome wide expression analysis of iron-starvation stimulon and XibR regulon, GUS assays, genetic and functional studies of xibR mutant revealed that XibR positively regulates functions involved in iron storage and uptake, chemotaxis, motility and negatively regulates siderophore production, in response to iron. Furthermore, chromatin immunoprecipitation followed by quantitative real-time PCR indicated that iron promoted binding of the XibR to the upstream regulatory sequence of operon's involved in chemotaxis and motility. Circular dichroism spectroscopy showed that purified XibR bound ferric form of iron. Electrophoretic mobility shift assay revealed that iron positively affected the binding of XibR to the upstream regulatory sequences of the target virulence genes, an effect that was reversed by ferric iron chelator deferoxamine. Taken together, these data revealed that how XibR coordinately regulates virulence associated and iron metabolism functions in
Pandey, Sheo Shankar; Patnana, Pradeep Kumar; Lomada, Santosh Kumar; Tomar, Archana; Chatterjee, Subhadeep
2016-01-01
Abilities of bacterial pathogens to adapt to the iron limitation present in hosts is critical to their virulence. Bacterial pathogens have evolved diverse strategies to coordinately regulate iron metabolism and virulence associated functions to maintain iron homeostasis in response to changing iron availability in the environment. In many bacteria the ferric uptake regulator (Fur) functions as transcription factor that utilize ferrous form of iron as cofactor to regulate transcription of iron metabolism and many cellular functions. However, mechanisms of fine-tuning and coordinated regulation of virulence associated function beyond iron and Fur-Fe2+ remain undefined. In this study, we show that a novel transcriptional regulator XibR (named X anthomonas iron binding regulator) of the NtrC family, is required for fine-tuning and co-coordinately regulating the expression of several iron regulated genes and virulence associated functions in phytopathogen Xanthomonas campestris pv. campestris (Xcc). Genome wide expression analysis of iron-starvation stimulon and XibR regulon, GUS assays, genetic and functional studies of xibR mutant revealed that XibR positively regulates functions involved in iron storage and uptake, chemotaxis, motility and negatively regulates siderophore production, in response to iron. Furthermore, chromatin immunoprecipitation followed by quantitative real-time PCR indicated that iron promoted binding of the XibR to the upstream regulatory sequence of operon’s involved in chemotaxis and motility. Circular dichroism spectroscopy showed that purified XibR bound ferric form of iron. Electrophoretic mobility shift assay revealed that iron positively affected the binding of XibR to the upstream regulatory sequences of the target virulence genes, an effect that was reversed by ferric iron chelator deferoxamine. Taken together, these data revealed that how XibR coordinately regulates virulence associated and iron metabolism functions in Xanthomonads in
Regulation, initiation, and termination of the cenA and cex transcripts of Cellulomonas fimi
International Nuclear Information System (INIS)
Greenberg, N.M.; Warren, R.A.J.; Kilburn, D.G.; Miller, R.C. Jr.
1987-01-01
The authors characterized the in vivo transcripts of two Cellulomonas fimi genes, which encodes an extracellular endo-β-1,4-glucanase. By Northern blot analysis, cenA mRNA was detected in C. fimi RNA preparations from glycerol- and carboxymethyl cellulose-grown cells but not from glucose-grown cells. In contrast, cex mRNA was detected only in the preparations from carboxymethyl cellulose-grown cells. Therefore, the transcription of these genes is subject to regulation by the carbon source provided to C. fimi. By nuclease SI protection studies with unique 5'-labeled DNA probes and C. fimi RNA isolated in vivo, 5' termini were found 51 and 62 bases before the cenA translational initiation codon and 28 bases before the cex translational initiation codon. S1 mapping with unlabeled DNA probes and C. fimi RNA which had been isolated in vivo but which had been 5' labeled in vitro with guanylyltransferase and [α- 32 P]GTP confirmed that true transcription initiation sites for cenA and cex mRNA had been identified. Comparative analysis of the DNA sequences immediately upstream of the initiation sites of the cenA and cex mRNAs revealed a 30-base-pair region where these two sequences display at least 66% homology. S1 mapping was also used to locate the 3' termini of the cenA and cex transcripts. Three 3' termini were found for cenA messages, whereas only one 3' terminus was identified for cex mRNA. The transcripts of both genes terminate in regions where their corresponding DNA sequences contain inverted repeats
Arishima, Taichi; Sasaki, Shinji; Isobe, Tomohiro; Ikebata, Yoshihisa; Shimbara, Shinichi; Ikeda, Shogo; Kawashima, Keisuke; Suzuki, Yutaka; Watanabe, Manabu; Sugano, Sumio; Mizoshita, Kazunori; Sugimoto, Yoshikazu
2017-12-06
Repeat breeding, which is defined as cattle failure to conceive after three or more inseminations in the absence of clinical abnormalities, is a substantial problem in cattle breeding. To identify maternal genetic variants of repeat breeding in Japanese Black cattle, we selected 29 repeat-breeding heifers that failed to conceive following embryo transfer (ET) and conducted a genome-wide association study (GWAS) using the traits. We found that a single-nucleotide polymorphism (SNP; g.92,377,635A > G) in the upstream region of the FOXP3 gene on the X chromosome was highly associated with repeat breeding and failure to conceive following ET (P = 1.51 × 10 -14 ). FOXP3 is a master gene for differentiation of regulatory T (T reg ) cells that function in pregnancy maintenance. Reporter assay results revealed that the activity of the FOXP3 promoter was lower in reporter constructs with the risk-allele than in those with the non-risk-allele by approximately 0.68 fold. These findings suggest that the variant in the upstream region of FOXP3 with the risk-allele decreased FOXP3 transcription, which in turn, could reduce the number of maternal T reg cells and lead to infertility. The frequency of the risk-allele in repeat-breeding heifers is more than that in cows, suggesting that the risk-allele could be associated with infertility in repeat-breeding heifers. This GWAS identified a maternal variant in the upstream region of FOXP3 that was associated with infertility in repeat-breeding Japanese Black cattle that failed to conceive using ET. The variant affected the level of FOXP3 mRNA expression. Thus, the results suggest that the risk-allele could serve as a useful marker to reduce and eliminate animals with inferior fertility in Japanese Black cattle.
DEFF Research Database (Denmark)
Nielsen, Henrik
2011-01-01
The application of new and less biased methods to study the transcriptional output from genomes, such as tiling arrays and deep sequencing, has revealed that most of the genome is transcribed and that there is substantial overlap of transcripts derived from the two strands of DNA. In protein coding...... regions, the map of transcripts is very complex due to small transcripts from the flanking ends of the transcription unit, the use of multiple start and stop sites for the main transcript, production of multiple functional RNA molecules from the same primary transcript, and RNA molecules made...... by independent transcription from within the unit. In genomic regions separating those that encode proteins or highly abundant RNA molecules with known function, transcripts are generally of low abundance and short-lived. In most of these cases, it is unclear to what extent a function is related to transcription...
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen
2016-09-16
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Feng-Yu Wang
Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.
Hindman, Ryan; Gollnick, Paul
2016-01-01
Vaccinia virus early genes are transcribed immediately upon infection. Nucleoside triphosphate phosphohydrolase I (NPH I) is an essential component of the early gene transcription complex. NPH I hydrolyzes ATP to release transcripts during transcription termination. The ATPase activity of NPH I requires single-stranded (ss) DNA as a cofactor; however, the source of this cofactor within the transcription complex is not known. Based on available structures of transcription complexes it has been hypothesized that the ssDNA cofactor is obtained from the unpaired non-template strand within the transcription bubble. In vitro transcription on templates that lack portions of the non-template strand within the transcription bubble showed that the upstream portion of the transcription bubble is required for efficient NPH I-mediated transcript release. Complementarity between the template and non-template strands in this region is also required for NPH I-mediated transcript release. This observation complicates locating the source of the ssDNA cofactor within the transcription complex because removal of the non-template strand also disrupts transcription bubble reannealing. Prior studies have shown that ssRNA binds to NPH I, but it does not activate ATPase activity. Chimeric transcription templates with RNA in the non-template strand confirm that the source of the ssDNA cofactor for NPH I is the upstream portion of the non-template strand in the transcription bubble. Consistent with this conclusion we also show that isolated NPH I acts as a 5′ to 3′ translocase on single-stranded DNA. PMID:27189950
Directory of Open Access Journals (Sweden)
Donghyuk Kim
Full Text Available Genome-wide transcription start site (TSS profiles of the enterobacteria Escherichia coli and Klebsiella pneumoniae were experimentally determined through modified 5' RACE followed by deep sequencing of intact primary mRNA. This identified 3,746 and 3,143 TSSs for E. coli and K. pneumoniae, respectively. Experimentally determined TSSs were then used to define promoter regions and 5' UTRs upstream of coding genes. Comparative analysis of these regulatory elements revealed the use of multiple TSSs, identical sequence motifs of promoter and Shine-Dalgarno sequence, reflecting conserved gene expression apparatuses between the two species. In both species, over 70% of primary transcripts were expressed from operons having orthologous genes during exponential growth. However, expressed orthologous genes in E. coli and K. pneumoniae showed a strikingly different organization of upstream regulatory regions with only 20% identical promoters with TSSs in both species. Over 40% of promoters had TSSs identified in only one species, despite conserved promoter sequences existing in the other species. 662 conserved promoters having TSSs in both species resulted in the same number of comparable 5' UTR pairs, and that regulatory element was found to be the most variant region in sequence among promoter, 5' UTR, and ORF. In K. pneumoniae, 48 sRNAs were predicted and 36 of them were expressed during exponential growth. Among them, 34 orthologous sRNAs between two species were analyzed in depth, and the analysis showed that many sRNAs of K. pneumoniae, including pleiotropic sRNAs such as rprA, arcZ, and sgrS, may work in the same way as in E. coli. These results reveal a new dimension of comparative genomics such that a comparison of two genomes needs to be comprehensive over all levels of genome organization.
Sieira, Rodrigo; Bialer, Magalí G; Roset, Mara S; Ruiz-Ranwez, Verónica; Langer, Tomás; Arocena, Gastón M; Mancini, Estefanía; Zorreguieta, Angeles
2017-02-01
Regulatory network plasticity is a key attribute underlying changes in bacterial gene expression and a source of phenotypic diversity to interact with the surrounding environment. Here, we sought to study the transcriptional circuit of HutC, a regulator of both metabolic and virulence genes of the facultative intracellular pathogen Brucella. Using in silico and biochemical approaches, we identified a novel functional HutC-binding site upstream of btaE, a trimeric-autotransporter adhesin involved in the attachment of Brucella to host extracellular matrix components. Moreover, we identified two additional regulators, one of which, MdrA, acts in concert with HutC to exert a combinatorial control of both btaE promoter activity and attachment of Brucella to HeLa cells. Analysis of btaE promoter sequences of different species indicated that this HutC-binding site was generated de novo by a single point mutation in a virulent Brucella strain, indicative of a transcriptional rewiring event. In addition to major domain organization differences existing between BtaE proteins within the genus Brucella, our analyses revealed that sequences upstream of btaE display high variability probably associated to intrinsic promoter structural features, which may serve as a substrate for reciprocal selection during co-evolution between this pathogen and its mammalian host. © 2016 John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Newberry, K.J.; Huffman, J.L.; Miller, M.C.; Vazquez-Laslop, N.; Neyfakh, A.A.; Brennan, R.G.
2009-05-22
BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets, that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.
DEFF Research Database (Denmark)
Mourier, Tobias; Willerslev, Eske
2010-01-01
of transcriptional activity are observed from both strands of solitary LTR sequences. Transcriptome data collected during meiosis suggests that transcription of solitary LTRs is correlated with the transcription of nearby protein-coding genes. CONCLUSIONS: Presumably, the host organism negatively regulates...
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Institute of Scientific and Technical Information of China (English)
HSU Heng; Robert L. CHURCH
2004-01-01
During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.
Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta
2016-01-15
Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Shepherd, R.
1998-01-01
This paper focuses on the effects of the slowdown in budgetary growth on the upstream business and offshore services. The dangers facing investors, the strong growth in energy demand, oil company priorities, the dip in profits of the oil companies, new field economics, the budgets for exploration and production, and the rig market outlook are discussed. (UK)
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription
International Nuclear Information System (INIS)
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia
2016-01-01
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.
Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui
2017-06-01
The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.
International Nuclear Information System (INIS)
Chen Long-Quan; Qiao Yao-Jun; Ji Yue-Feng
2013-01-01
In this paper, we propose a new structure of a centralized-light-source wavelength division multiplexed passive optical network (WDM-PON) utilizing inverse-duobinary-return-to-zero (inverse-duobinary-RZ) downstream and DPSK upstream. It reuses downstream light for the upstream modulation, which retrenches lasers assembled at each optical network unit (ONU), and ultimately cuts down the cost of ONUs a great deal. Meanwhile, a 50-km-reach WDM-PON experiment with 10-Gb/s inverse-duobinary-RZ downstream and 6-Gb/s DPSK upstream is demonstrated here. It is revealed to be a novel cost-effective alternative for the next generation access network. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)
Jaber, Tareq; Henderson, Gail; Li, Sumin; Perng, Guey-Chuen; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton
2009-10-01
The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected sensory neurons. In small animal models of infection, expression of the first 1.5 kb of LAT coding sequences is necessary and sufficient for wild-type reactivation from latency. The ability of LAT to inhibit apoptosis is important for reactivation from latency. Within the first 1.5 kb of LAT coding sequences and LAT promoter sequences, additional transcripts have been identified. For example, the anti-sense to LAT transcript (AL) is expressed in the opposite direction to LAT from the 5' end of LAT and LAT promoter sequences. In addition, the upstream of LAT (UOL) transcript is expressed in the LAT direction from sequences in the LAT promoter. Further examination of the first 1.5 kb of LAT coding sequences revealed two small ORFs that are anti-sense with respect to LAT (AL2 and AL3). A transcript spanning AL3 was detected in productively infected cells, mouse neuroblastoma cells stably expressing LAT and trigeminal ganglia (TG) of latently infected mice. Peptide-specific IgG directed against AL3 specifically recognized a protein migrating near 15 kDa in cells stably transfected with LAT, mouse neuroblastoma cells transfected with a plasmid containing the AL3 ORF and TG of latently infected mice. The inability to detect the AL3 protein during productive infection may have been because the 5' terminus of the AL3 transcript was downstream of the first in-frame methionine of the AL3 ORF during productive infection.
Directory of Open Access Journals (Sweden)
Minami Mazda
Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.
Bailey, Fiona P; Clarke, Kim; Kalirai, Helen; Kenyani, Jenna; Shahidipour, Haleh; Falciani, Francesco; Coulson, Judy M; Sacco, Joseph J; Coupland, Sarah E; Eyers, Patrick A
2018-03-01
Metastatic uveal melanoma (UM) is invariably fatal, usually within a year of diagnosis. There are currently no effective therapies, and clinical studies employing kinase inhibitors have so far demonstrated limited success. This is despite common activating mutations in GNAQ/11 genes, which trigger signalling pathways that might predispose tumours to a variety of targeted drugs. In this study, we have profiled kinome expression network dynamics in various human ocular melanomas. We uncovered a shared transcriptional profile in human primary UM samples and across a variety of experimental cell-based models. The poor overall response of UM cells to FDA-approved kinase inhibitors contrasted with much higher sensitivity to the bromodomain inhibitor JQ1, a broad transcriptional repressor. Mechanistically, we identified a repressed FOXM1-dependent kinase subnetwork in JQ1-exposed cells that contained multiple cell cycle-regulated protein kinases. Consistently, we demonstrated vulnerability of UM cells to inhibitors of mitotic protein kinases within this network, including the investigational PLK1 inhibitor BI6727. We conclude that analysis of kinome-wide signalling network dynamics has the potential to reveal actionable drug targets and inhibitors of potential therapeutic benefit for UM patients. © 2017 The Authors. Pigment Cell & Melanoma Research Published by John Wiley & Sons.
Lee, Donna M; Duensing, Anette
2018-02-01
Transcriptional regulation of the KIT receptor tyrosine kinase, a master regulator in gastrointestinal stromal tumors (GIST) and their precursors, the interstitial cells of Cajal (ICC), is part of a positive feedback loop involving the transcription factor ETV1. A new study now shows that the forkhead box (FOX) family transcription factor FOXF1 not only is an upstream regulator of ETV1 and hence ICC/GIST lineage-specific gene transcription, but also functions as lineage-specific pioneer factor with an active role in chromatin rearrangement to facilitate ETV1 binding and transcriptional activity. Cancer Discov; 8(2); 146-9. ©2018 AACR See related article by Ran et al., p. 234 . ©2018 American Association for Cancer Research.
Bao, Zhao-Shi; Chen, Hui-Min; Yang, Ming-Yu; Zhang, Chuan-Bao; Yu, Kai; Ye, Wan-Lu; Hu, Bo-Qiang; Yan, Wei; Zhang, Wei; Akers, Johnny; Ramakrishnan, Valya; Li, Jie; Carter, Bob; Liu, Yan-Wei; Hu, Hui-Min; Wang, Zheng; Li, Ming-Yang; Yao, Kun; Qiu, Xiao-Guang; Kang, Chun-Sheng; You, Yong-Ping; Fan, Xiao-Long; Song, Wei Sonya; Li, Rui-Qiang; Su, Xiao-Dong; Chen, Clark C; Jiang, Tao
2014-11-01
Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of MET. ZM fusion transcripts were found in GBMs irrespective of isocitrate dehydrogenase 1 (IDH1) mutation status. sGBMs harboring ZM fusion showed higher expression of genes required for PIK3CA signaling and lowered expression of genes that suppressed RB1 or TP53 function. Expression of the ZM fusion was mutually exclusive with EGFR overexpression in sGBMs. Exogenous expression of the ZM fusion in the U87MG glioblastoma line enhanced cell migration and invasion. Clinically, patients afflicted with ZM fusion harboring glioblastomas survived poorly relative to those afflicted with non-ZM-harboring sGBMs (P < 0.001). Our study profiles the shifting RNA landscape of gliomas during progression and reveled ZM as a novel, recurrent fusion transcript in sGBMs. © 2014 Bao et al.; Published by Cold Spring Harbor Laboratory Press.
Directory of Open Access Journals (Sweden)
Walker M Andrew
2010-07-01
Full Text Available Abstract Background Plant cytochrome P450 monooxygenases (CYP mediate synthesis and metabolism of many physiologically important primary and secondary compounds that are related to plant defense against a range of pathogenic microbes and insects. To determine if cytochrome P450 monooxygenases are involved in defense response to Xylella fastidiosa (Xf infection, we investigated expression and regulatory mechanisms of the cytochrome P450 monooxygenase CYP736B gene in both disease resistant and susceptible grapevines. Results Cloning of genomic DNA and cDNA revealed that the CYP736B gene was composed of two exons and one intron with GT as a donor site and AG as an acceptor site. CYP736B transcript was up-regulated in PD-resistant plants and down-regulated in PD-susceptible plants 6 weeks after Xf inoculation. However, CYP736B expression was very low in stem tissues at all evaluated time points. 5'RACE and 3'RACE sequence analyses revealed that there were three candidate transcription start sites (TSS in the upstream region and three candidate polyadenylation (PolyA sites in the downstream region of CYP736B. Usage frequencies of each transcription initiation site and each polyadenylation site varied depending on plant genotype, developmental stage, tissue, and treatment. These results demonstrate that expression of CYP736B is regulated developmentally and in response to Xf infection at both transcriptional and post-transcriptional levels. Multiple transcription start and polyadenylation sites contribute to regulation of CYP736B expression. Conclusions This report provides evidence that the cytochrome P450 monooxygenase CYP736B gene is involved in defense response at a specific stage of Xf infection in grapevines; multiple transcription initiation and polyadenylation sites exist for CYP736B in grapevine; and coordinative and selective use of transcription initiation and polyadenylation sites play an important role in regulation of CYP736B expression
Epigenetic landscapes reveal transcription factors regulating CD8+ T cell differentiation
Yu, Bingfei; Zhang, Kai; Milner, J. Justin; Toma, Clara; Chen, Runqiang; Scott-Browne, James P.; Pereira, Renata M.; Crotty, Shane; Chang, John T.; Pipkin, Matthew E.; Wang, Wei; Goldrath, Ananda W.
2017-01-01
Dynamic changes in the expression of transcription factors (TFs) can influence specification of distinct CD8+ T cell fates, but the observation of equivalent expression of TF among differentially-fated precursor cells suggests additional underlying mechanisms. Here, we profiled genome-wide histone modifications, open chromatin and gene expression of naive, terminal-effector, memory-precursor and memory CD8+ T cell populations induced during the in vivo response to bacterial infection. Integration of these data suggested that TF expression and binding contributed to establishment of subset-specific enhancers during differentiation. We developed a new bioinformatics method using the PageRank algorithm to reveal novel TFs influencing the generation of effector and memory populations. The TFs YY1 and Nr3c1, both constitutively expressed during CD8+ T cell differentiation, regulated the formation of terminal-effector and memory-precursor cell-fates, respectively. Our data define the epigenetic landscape of differentiation intermediates, facilitating identification of TFs with previously unappreciated roles in CD8+ T cell differentiation. PMID:28288100
Chiu, Isaac M; Barrett, Lee B; Williams, Erika K; Strochlic, David E; Lee, Seungkyu; Weyer, Andy D; Lou, Shan; Bryman, Gregory S; Roberson, David P; Ghasemlou, Nader; Piccoli, Cara; Ahat, Ezgi; Wang, Victor; Cobos, Enrique J; Stucky, Cheryl L; Ma, Qiufu; Liberles, Stephen D; Woolf, Clifford J
2014-01-01
The somatosensory nervous system is critical for the organism's ability to respond to mechanical, thermal, and nociceptive stimuli. Somatosensory neurons are functionally and anatomically diverse but their molecular profiles are not well-defined. Here, we used transcriptional profiling to analyze the detailed molecular signatures of dorsal root ganglion (DRG) sensory neurons. We used two mouse reporter lines and surface IB4 labeling to purify three major non-overlapping classes of neurons: 1) IB4+SNS-Cre/TdTomato+, 2) IB4−SNS-Cre/TdTomato+, and 3) Parv-Cre/TdTomato+ cells, encompassing the majority of nociceptive, pruriceptive, and proprioceptive neurons. These neurons displayed distinct expression patterns of ion channels, transcription factors, and GPCRs. Highly parallel qRT-PCR analysis of 334 single neurons selected by membership of the three populations demonstrated further diversity, with unbiased clustering analysis identifying six distinct subgroups. These data significantly increase our knowledge of the molecular identities of known DRG populations and uncover potentially novel subsets, revealing the complexity and diversity of those neurons underlying somatosensation. DOI: http://dx.doi.org/10.7554/eLife.04660.001 PMID:25525749
Chen, Chih-Yu; Shi, Wenqiang; Balaton, Bradley P; Matthews, Allison M; Li, Yifeng; Arenillas, David J; Mathelier, Anthony; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R R; Brown, Carolyn J; Wasserman, Wyeth W
2016-11-18
Sex differences in susceptibility and progression have been reported in numerous diseases. Female cells have two copies of the X chromosome with X-chromosome inactivation imparting mono-allelic gene silencing for dosage compensation. However, a subset of genes, named escapees, escape silencing and are transcribed bi-allelically resulting in sexual dimorphism. Here we conducted in silico analyses of the sexes using human datasets to gain perspectives into such regulation. We identified transcription start sites of escapees (escTSSs) based on higher transcription levels in female cells using FANTOM5 CAGE data. Significant over-representations of YY1 transcription factor binding motif and ChIP-seq peaks around escTSSs highlighted its positive association with escapees. Furthermore, YY1 occupancy is significantly biased towards the inactive X (Xi) at long non-coding RNA loci that are frequent contacts of Xi-specific superloops. Our study suggests a role for YY1 in transcriptional activity on Xi in general through sequence-specific binding, and its involvement at superloop anchors.
Directory of Open Access Journals (Sweden)
Guillaume Blanc
Full Text Available Paramecium bursaria chlorella virus 1 (PBCV-1 is the prototype of the genus Chlorovirus (family Phycodnaviridae that infects the unicellular, eukaryotic green alga Chlorella variabilis NC64A. The 331-kb PBCV-1 genome contains 416 major open reading frames. A mRNA-seq approach was used to analyze PBCV-1 transcriptomes at 6 progressive times during the first hour of infection. The alignment of 17 million reads to the PBCV-1 genome allowed the construction of single-base transcriptome maps. Significant transcription was detected for a subset of 50 viral genes as soon as 7 min after infection. By 20 min post infection (p.i., transcripts were detected for most PBCV-1 genes and transcript levels continued to increase globally up to 60 min p.i., at which time 41% or the poly (A+-containing RNAs in the infected cells mapped to the PBCV-1 genome. For some viral genes, the number of transcripts in the latter time points (20 to 60 min p.i. was much higher than that of the most highly expressed host genes. RNA-seq data revealed putative polyadenylation signal sequences in PBCV-1 genes that were identical to the polyadenylation signal AAUAAA of green algae. Several transcripts have an RNA fragment excised. However, the frequency of excision and the resulting putative shortened protein products suggest that most of these excision events have no functional role but are probably the result of the activity of misled splicesomes.
LENUS (Irish Health Repository)
Yu, Hoi-Tin
2010-03-01
FE65 is a neuronal-enriched adaptor protein that binds to the Alzheimer\\'s disease amyloid precursor protein (APP). FE65 forms a transcriptionally active complex with the APP intracellular domain (AICD). The precise gene targets for this complex are unclear but several Alzheimer\\'s disease-linked genes have been proposed. Additionally, evidence suggests that FE65 influences APP metabolism. The mechanism by which FE65 expression is regulated is as yet unknown. To gain insight into the regulatory mechanism, we cloned a 1.6 kb fragment upstream of the human FE65 gene and found that it possesses particularly strong promoter activity in neurones. To delineate essential regions in the human FE65 promoter, a series of deletion mutants were generated. The minimal FE65 promoter was located between -100 and +5, which contains a functional Sp1 site. Overexpression of the transcription factor Sp1 potentiates the FE65 promoter activity. Conversely, suppression of the FE65 promoter was observed in cells either treated with an Sp1 inhibitor or in which Sp1 was knocked down. Furthermore, reduced levels of Sp1 resulted in downregulation of endogenous FE65 mRNA and protein. These findings reveal that Sp1 plays a crucial role in transcriptional control of the human FE65 gene.
International Nuclear Information System (INIS)
Parker, R.C.
1986-01-01
A region that forms the S1 nuclease site in Co1E1 DNA is shown to code for an in vitro transcript, called S1 RNA-B, which contains a 5'-terminal GTP residue that exhibits noncomplementarity with the template's DNA sequence. The synthesis of S1 RNA-B initiates four bases upstream from the start point for S1 RNA-C. The initial four bases in S1 RNA-B and S1 RNA-C are identical. The relative synthesis of S1 RNA-B to S1 RNA-C is sensitive to the concentration of GTP, a substrate that is required for elongation past the +4 position in S1 RNA-C. Dinucleotides that are expected to only initiate synthesis of S1 RNA-C yield two transcripts that appear to initiate from the S1 RNA-C and S1 RNA-B start sites. In vitro studies involving other Co1E1 transcripts, RNA-B and RNA-C, provide similar observations concerning the noncomplementary initiation phenomenon. A model involving transcriptional slippage is suggested to explain the noncomplementary initiation phenomenon. The model proposes that the cycling reaction of Escherichia coli RNA polymerase produces tetranucleotides that are transposed to nearby upstream sequences for priming transcription
International Nuclear Information System (INIS)
Guo, Wencheng; Yang, Jiandong
2017-01-01
Highlights: • Nonlinear mathematical model and Hopf bifurcation analysis of turbine regulating system are presented. • Dynamic performance of turbine regulating system under 0.5 times Thoma sectional area is analyzed and a novel dynamic performance is revealed. • Relationship between two bifurcation lines and wave superposition is studied. • Combined effect mechanisms of upstream surge chamber and sloping ceiling tailrace tunnel on stability are revealed and optimization methods are proposed. - Abstract: Based on the nonlinear mathematical model of the turbine regulating system of hydroelectric power plant with upstream surge chamber and sloping ceiling tailrace tunnel and the Hopf bifurcation theory, this paper firstly studies the dynamic performance of the turbine regulating system under 0.5 times Thoma sectional area of surge chamber, and reveals a novel dynamic performance. Then, the relationship between the two bifurcation lines and the wave superposition of upstream surge chamber and sloping ceiling tailrace tunnel is analyzed. Finally, the effect mechanisms of the wave superposition on the system stability are investigated, and the methods to improve the system stability are proposed. The results indicate that: Under the combined effect of upstream surge chamber and sloping ceiling tailrace tunnel, the dynamic performance of the turbine regulating system of hydroelectric power plant shows an obvious difference on the two sides of the critical sectional area of surge chamber. There are two bifurcation lines for the condition of 0.5 times Thoma sectional area, i.e. Bifurcation line 1 and Bifurcation line 2, which represent the stability characteristics of the flow oscillation of “penstock-sloping ceiling tailrace tunnel” and the water-level fluctuation in upstream surge chamber, respectively. The stable domain of the system is determined by Bifurcation line 2. The effect of upstream surge chamber mainly depends on its sectional area, while the
Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha
DEFF Research Database (Denmark)
Hwang, C S; Mandrup, S; MacDougald, O A
1996-01-01
Like other adipocyte genes that are transcriptionally activated by CCAAT/enhancer binding protein alpha (C/EBP alpha) during preadipocyte differentiation, expression of the mouse obese (ob) gene is immediately preceded by the expression of C/EBP alpha. While the 5' flanking region of the mouse ob...... gene contains several consensus C/EBP binding sites, only one of these sites appears to be functional. DNase I cleavage inhibition patterns (footprinting) of the ob gene promoter revealed that recombinant C/EBP alpha, as well as a nuclear factor present in fully differentiated 3T3-L1 adipocytes...... to a consensus C/EBP binding site at nucleotides -55 to -47 generated a specific protein-oligonucleotide complex that was supershifted by antibody against C/EBP alpha. Probes corresponding to two upstream consensus C/EBP binding sites failed to generate protein-oligonucleotide complexes. Cotransfection of a C...
Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol
2016-01-01
The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulat...
Upstream Atlantic salmon (Salmo salar) passage
International Nuclear Information System (INIS)
Clay, C.H.
1993-01-01
Upstream salmon passage though a dam is discussed with respect to three main components: the fishway entrance, the fishway, and the exit. Design considerations and alternative types of components are presented. For fishway entrances, an important consideration is the positioning of the entrance as far upstream as the fish can swim with respect to obstacles. For powerhouses using water diverted from a river, the problem of leading fish past the powerhouse may be overcome by either installing a tailrace barrier or increasing the flow until the home stream odor is sufficient to attract fish. Swimming ability should be the first consideration in fishway design. Fishways with 50 cm drops per pool would be satisfactory in most cases. The problem of headwater fluctuation is overcome through careful fishway selection. Fish locks, hoists, and elevators are other alternatives to pool/weir fishways. The location for a fish exit must be decided on the basis of whether the fishway will be used only for upstream migrations. 5 refs., 1 fig., 1 tab
Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong
2017-10-19
Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.
Lim, Daniel A; Suárez-Fariñas, Mayte; Naef, Felix; Hacker, Coleen R; Menn, Benedicte; Takebayashi, Hirohide; Magnasco, Marcelo; Patil, Nila; Alvarez-Buylla, Arturo
2006-01-01
Neural stem cells and neurogenesis persist in the adult mammalian brain subventricular zone (SVZ). Cells born in the rodent SVZ migrate to the olfactory bulb (Ob) where they differentiate into interneurons. To determine the gene expression and functional profile of SVZ neurogenesis, we performed three complementary sets of transcriptional analysis experiments using Affymetrix GeneChips: (1) comparison of adult mouse SVZ and Ob gene expression profiles with those of the striatum, cerebral cortex, and hippocampus; (2) profiling of SVZ stem cells and ependyma isolated by fluorescent-activated cell sorting (FACS); and (3) analysis of gene expression changes during in vivo SVZ regeneration after anti-mitotic treatment. Gene Ontology (GO) analysis of data from these three separate approaches showed that in adult SVZ neurogenesis, RNA splicing and chromatin remodeling are biological processes as statistically significant as cell proliferation, transcription, and neurogenesis. In non-neurogenic brain regions, RNA splicing and chromatin remodeling were not prominent processes. Fourteen mRNA splicing factors including Sf3b1, Sfrs2, Lsm4, and Khdrbs1/Sam68 were detected along with 9 chromatin remodeling genes including Mll, Bmi1, Smarcad1, Baf53a, and Hat1. We validated the transcriptional profile data with Northern blot analysis and in situ hybridization. The data greatly expand the catalogue of cell cycle components, transcription factors, and migration genes for adult SVZ neurogenesis and reveal RNA splicing and chromatin remodeling as prominent biological processes for these germinal cells.
Gao, Shuai; Hou, Xinfeng; Jiang, Yonghua; Xu, Zijian; Cai, Tao; Chen, Jiajie; Chang, Gang
2017-01-23
Transcription factor-mediated reprogramming can reset the epigenetics of somatic cells into a pluripotency compatible state. Recent studies show that induced pluripotent stem cells (iPSCs) always inherit starting cell-specific characteristics, called epigenetic memory, which may be advantageous, as directed differentiation into specific cell types is still challenging; however, it also may be unpredictable when uncontrollable differentiation occurs. In consideration of biosafety in disease modeling and personalized medicine, the availability of high-quality iPSCs which lack a biased differentiation capacity and somatic memory could be indispensable. Herein, we evaluate the hematopoietic differentiation capacity and somatic memory state of hematopoietic progenitor and stem cell (HPC/HSC)-derived-iPSCs (HPC/HSC-iPSCs) using a previously established sequential reprogramming system. We found that HPC/HSCs are amenable to being reprogrammed into iPSCs with unbiased differentiation capacity to hematopoietic progenitors and mature hematopoietic cells. Genome-wide analyses revealed that no global epigenetic memory was detectable in HPC/HSC-iPSCs, but only a minor transcriptional memory of HPC/HSCs existed in a specific tetraploid complementation (4 N)-incompetent HPC/HSC-iPSC line. However, the observed minor transcriptional memory had no influence on the hematopoietic differentiation capacity, indicating the reprogramming of the HPC/HSCs was nearly complete. Further analysis revealed the correlation of minor transcriptional memory with the aberrant distribution of H3K27me3. This work provides a comprehensive framework for obtaining high-quality iPSCs from HPC/HSCs with unbiased hematopoietic differentiation capacity and minor transcriptional memory.
Sage, William M; McIlhattan, Kelley
2014-01-01
For the first time, entrepreneurs are aggressively developing new technologies and business models designed to improve individual and population health, not just to deliver specialized medical care. Consumers of these goods and services are not yet "patients"; they are simply people. As this sector of the health care industry expands, it is likely to require new forms of legal governance, which we term "upstream health law." © 2014 American Society of Law, Medicine & Ethics, Inc.
DEFF Research Database (Denmark)
Amulic, Borko; Salanti, Ali; Lavstsen, Thomas
2009-01-01
contains a small upstream open reading frame that acts to repress translation of the resulting mRNA, revealing a novel form of gene regulation in malaria parasites. The mechanism underlying this translational repression is reversible, allowing high levels of protein translation upon selection, thus...
de Castro, Minique Hilda; de Klerk, Daniel; Pienaar, Ronel; Rees, D Jasper G; Mans, Ben J
2017-08-10
Ticks secrete a diverse mixture of secretory proteins into the host to evade its immune response and facilitate blood-feeding, making secretory proteins attractive targets for the production of recombinant anti-tick vaccines. The largely neglected tick species, Rhipicephalus zambeziensis, is an efficient vector of Theileria parva in southern Africa but its available sequence information is limited. Next generation sequencing has advanced sequence availability for ticks in recent years and has assisted the characterisation of secretory proteins. This study focused on the de novo assembly and annotation of the salivary gland transcriptome of R. zambeziensis and the temporal expression of secretory protein transcripts in female and male ticks, before the onset of feeding and during early and late feeding. The sialotranscriptome of R. zambeziensis yielded 23,631 transcripts from which 13,584 non-redundant proteins were predicted. Eighty-six percent of these contained a predicted start and stop codon and were estimated to be putatively full-length proteins. A fifth (2569) of the predicted proteins were annotated as putative secretory proteins and explained 52% of the expression in the transcriptome. Expression analyses revealed that 2832 transcripts were differentially expressed among feeding time points and 1209 between the tick sexes. The expression analyses further indicated that 57% of the annotated secretory protein transcripts were differentially expressed. Dynamic expression profiles of secretory protein transcripts were observed during feeding of female ticks. Whereby a number of transcripts were upregulated during early feeding, presumably for feeding site establishment and then during late feeding, 52% of these were downregulated, indicating that transcripts were required at specific feeding stages. This suggested that secretory proteins are under stringent transcriptional regulation that fine-tunes their expression in salivary glands during feeding. No open
Cerveau, Nicolas; Gilbert, Clément; Liu, Chao; Garrett, Roger A; Grève, Pierre; Bouchon, Didier; Cordaux, Richard
2015-06-10
Transposable elements (TEs) are DNA pieces that are present in almost all the living world at variable genomic density. Due to their mobility and density, TEs are involved in a large array of genomic modifications. In eukaryotes, TE expression has been studied in detail in several species. In prokaryotes, studies of IS expression are generally linked to particular copies that induce a modification of neighboring gene expression. Here we investigated global patterns of IS transcription in the Alphaproteobacterial endosymbiont Wolbachia wVulC, using both RT-PCR and bioinformatic analyses. We detected several transcriptional promoters in all IS groups. Nevertheless, only one of the potentially functional IS groups possesses a promoter located upstream of the transposase gene, that could lead up to the production of a functional protein. We found that the majority of IS groups are expressed whatever their functional status. RT-PCR analyses indicate that the transcription of two IS groups lacking internal promoters upstream of the transposase start codon may be driven by the genomic environment. We confirmed this observation with the transcription analysis of individual copies of one IS group. These results suggest that the genomic environment is important for IS expression and it could explain, at least partly, copy number variability of the various IS groups present in the wVulC genome and, more generally, in bacterial genomes. Copyright © 2015 Elsevier B.V. All rights reserved.
Ancient mtDNA genetic variants modulate mtDNA transcription and replication.
Directory of Open Access Journals (Sweden)
Sarit Suissa
2009-05-01
Full Text Available Although the functional consequences of mitochondrial DNA (mtDNA genetic backgrounds (haplotypes, haplogroups have been demonstrated by both disease association studies and cell culture experiments, it is not clear which of the mutations within the haplogroup carry functional implications and which are "evolutionary silent hitchhikers". We set forth to study the functionality of haplogroup-defining mutations within the mtDNA transcription/replication regulatory region by in vitro transcription, hypothesizing that haplogroup-defining mutations occurring within regulatory motifs of mtDNA could affect these processes. We thus screened >2500 complete human mtDNAs representing all major populations worldwide for natural variation in experimentally established protein binding sites and regulatory regions comprising a total of 241 bp in each mtDNA. Our screen revealed 77/241 sites showing point mutations that could be divided into non-fixed (57/77, 74% and haplogroup/sub-haplogroup-defining changes (i.e., population fixed changes, 20/77, 26%. The variant defining Caucasian haplogroup J (C295T increased the binding of TFAM (Electro Mobility Shift Assay and the capacity of in vitro L-strand transcription, especially of a shorter transcript that maps immediately upstream of conserved sequence block 1 (CSB1, a region associated with RNA priming of mtDNA replication. Consistent with this finding, cybrids (i.e., cells sharing the same nuclear genetic background but differing in their mtDNA backgrounds harboring haplogroup J mtDNA had a >2 fold increase in mtDNA copy number, as compared to cybrids containing haplogroup H, with no apparent differences in steady state levels of mtDNA-encoded transcripts. Hence, a haplogroup J regulatory region mutation affects mtDNA replication or stability, which may partially account for the phenotypic impact of this haplogroup. Our analysis thus demonstrates, for the first time, the functional impact of particular mt
Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks
Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.
1989-01-01
The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.
Directory of Open Access Journals (Sweden)
Henry D Priest
Full Text Available Brachypodium distachyon is a close relative of many important cereal crops. Abiotic stress tolerance has a significant impact on productivity of agriculturally important food and feedstock crops. Analysis of the transcriptome of Brachypodium after chilling, high-salinity, drought, and heat stresses revealed diverse differential expression of many transcripts. Weighted Gene Co-Expression Network Analysis revealed 22 distinct gene modules with specific profiles of expression under each stress. Promoter analysis implicated short DNA sequences directly upstream of module members in the regulation of 21 of 22 modules. Functional analysis of module members revealed enrichment in functional terms for 10 of 22 network modules. Analysis of condition-specific correlations between differentially expressed gene pairs revealed extensive plasticity in the expression relationships of gene pairs. Photosynthesis, cell cycle, and cell wall expression modules were down-regulated by all abiotic stresses. Modules which were up-regulated by each abiotic stress fell into diverse and unique gene ontology GO categories. This study provides genomics resources and improves our understanding of abiotic stress responses of Brachypodium.
Directory of Open Access Journals (Sweden)
Jianjin Guo
Full Text Available Fat mass and obesity associated gene (FTO is the first gene associated with body mass index (BMI and risk for diabetes. FTO is highly expressed in the brain and pancreas, and is involved in regulating dietary intake and energy expenditure. To investigate the transcriptional regulation of FTO expression, we created 5'-deletion constructs of the FTO promoter to determine which transcription factors are most relevant to FTO expression. The presence of an activation region at -201/+34 was confirmed by luciferase activity analysis. A potential Foxa2 (called HNF-3β binding site and an upstream stimulatory factor (USF-binding site was identified in the -100 bp fragment upstream of the transcription start site (TSS. Furthermore, using mutagenesis, we identified the Foxa2 binding sequence (-26/-14 as a negative regulatory element to the activity of the human FTO promoter. The USF binding site did not affect the FTO promoter activity. Chromatin immunoprecipitation (ChIP assays were performed to confirm Foxa2 binding to the FTO promoter. Overexpression of Foxa2 in HEK 293 cells significantly down-regulated FTO promoter activity and expression. Conversely, knockdown of Foxa2 by siRNA significantly up-regulated FTO expression. These findings suggest that Foxa2 negatively regulates the basal transcription and expression of the human FTO gene.
An activator of transcription regulates phage TP901-1 late gene expression
DEFF Research Database (Denmark)
Brøndsted, Lone; Pedersen, Margit; Hammer, Karin
2001-01-01
bp contains both the promoter and the region necessary for activation by ORF29. The transcriptional start site of the promoter was identified by primer extension to position 13073 on the TP901-1 genome, thus located 87 bp downstream of orf29 in a 580-bp intergenic region between orf29 and orf30....... Furthermore, the region located -85 to -61 bp upstream of the start site was shown to be necessary for promoter activity. During infection, the transcript arising from the late promoter is fully induced at 40 min postinfection, and our results suggest that a certain level of ORF29 must he reached in order...... to activate transcription of the promoter. Several lactococcal bacteriophages encode ORF29 homologous proteins, indicating that late transcription may be controlled by a similar mechanism in these phages. With the identification of this novel regulator, our results suggest that within the P335 group...
Anthocyanin biosynthesis in pears is regulated by a R2R3-MYB transcription factor PyMYB10.
Feng, Shouqian; Wang, Yanling; Yang, Song; Xu, Yuting; Chen, Xuesen
2010-06-01
Skin color is an important factor in pear breeding programs. The degree of red coloration is determined by the content and composition of anthocyanins. In plants, many MYB transcriptional factors are involved in regulating anthocyanin biosynthesis. In this study, a R2R3-MYB transcription factor gene, PyMYB10, was isolated from Asian pear (Pyrus pyrifolia) cv. 'Aoguan'. Sequence analysis suggested that the PyMYB10 gene was an ortholog of MdMYB10 gene, which regulates anthocyanin biosynthesis in red fleshed apple (Malus x domestica) cv. 'Red Field'. PyMYB10 was identified at the genomic level and had three exons, with its upstream sequence containing core sequences of cis-acting regulatory elements involved in light responsiveness. Fruit bagging showed that light could induce expression of PyMYB10 and anthocyanin biosynthesis. Quantitative real-time PCR revealed that PyMYB10 was predominantly expressed in pear skins, buds, and young leaves, and the level of transcription in buds was higher than in skin and young leaves. In ripening fruits, the transcription of PyMYB10 in the skin was positively correlated with genes in the anthocyanin pathway and with anthocyanin biosynthesis. In addition, the transcription of PyMYB10 and genes of anthocyanin biosynthesis were more abundant in red-skinned pear cultivars compared to blushed cultivars. Transgenic Arabidopsis plants overexpressing PyMYB10 exhibited ectopic pigmentation in immature seeds. The study suggested that PyMYB10 plays a role in regulating anthocyanin biosynthesis and the overexpression of PyMYB10 was sufficient to induce anthocyanin accumulation.
Ido, Ayaka; Iwata, Shinya; Iwata, Yuka; Igarashi, Hisako; Hamada, Takahiro; Sonobe, Seiji; Sugiura, Masahiro; Yukawa, Yasushi
2016-01-01
In vitro transcription is an essential tool to study the molecular mechanisms of transcription. For over a decade, we have developed an in vitro transcription system from tobacco (Nicotiana tabacum)-cultured cells (BY-2), and this system supported the basic activities of the three RNA polymerases (Pol I, Pol II, and Pol III). However, it was not suitable to study photosynthetic genes, because BY-2 cells have lost their photosynthetic activity. Therefore, Arabidopsis (Arabidopsis thaliana) in vitro transcription systems were developed from green and etiolated suspension cells. Sufficient in vitro Pol II activity was detected after the minor modification of the nuclear soluble extracts preparation method; removal of vacuoles from protoplasts and L-ascorbic acid supplementation in the extraction buffer were particularly effective. Surprisingly, all four Arabidopsis Rubisco small subunit (rbcS-1A, rbcS-1B, rbcS-2B, and rbcS-3B) gene members were in vitro transcribed from the naked DNA templates without any light-dependent manner. However, clear light-inducible transcriptions were observed using chromatin template of rbcS-1A gene, which was prepared with a human nucleosome assembly protein 1 (hNAP1) and HeLa histones. This suggested that a key determinant of light-dependency through the rbcS gene transcription was a higher order of DNA structure (i.e. chromatin). PMID:26662274
Regulation of zebrafish CYP3A65 transcription by AHR2
International Nuclear Information System (INIS)
Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting; Tseng, Hua-Pin; Tzou, Wen-Shyong; Hu, Chin-Hwa
2013-01-01
CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenic lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in
Regulation of zebrafish CYP3A65 transcription by AHR2
Energy Technology Data Exchange (ETDEWEB)
Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting; Tseng, Hua-Pin [Institute of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China); Tzou, Wen-Shyong [Institute of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China); Center of Excellence for Marine Bioenvironment and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China); Hu, Chin-Hwa, E-mail: chhu@mail.ntou.edu.tw [Institute of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China); Center of Excellence for Marine Bioenvironment and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China)
2013-07-15
CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenic lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in
Human Resource Local Content in Ghana's Upstream Petroleum Industry
Benin, Papa
Enactment of Ghana's Petroleum (Local Content and Local Participation) Regulations, 2013 (L.I. 2204) was intended to regulate the percentage of local products, personnel, financing, and goods and services rendered within Ghana's upstream petroleum industry value chain. Five years after the inception of Ghana's upstream oil and gas industry, a gap is evident between the requirements of L.I. 2204 and professional practice. Drawing on Lewin's change theory, a cross-sectional study was conducted to examine the extent of differences between the prevailing human resource local content and the requirements of L.I. 2204 in Ghana's upstream petroleum industry. The extent to which training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its upstream petroleum industry was also examined. Survey data were collected from 97 management, technical, and other staff in 2 multinational petroleum companies whose oil and gas development plans have been approved by the Petroleum Commission of Ghana. To answer the research questions and test their hypotheses, one-way ANOVA was performed with staff category (management, technical, and other) as the independent variable and prevalent local content as the dependent variable. Results indicated that prevailing local content in Ghana's upstream petroleum industry meets the requirements of L.I. 2204. Further, training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its offshore petroleum industry. Findings may encourage leaders within multinational oil companies and the Petroleum Commission of Ghana to organize educational seminars that equip indigenous Ghanaians with specialized skills for working in Ghana's upstream petroleum industry.
Akbari, Omar S; Antoshechkin, Igor; Hay, Bruce A; Ferree, Patrick M
2013-09-04
A widespread phenomenon in nature is sex ratio distortion of arthropod populations caused by microbial and genetic parasites. Currently little is known about how these agents alter host developmental processes to favor one sex or the other. The paternal sex ratio (PSR) chromosome is a nonessential, paternally transmitted centric fragment that segregates in natural populations of the jewel wasp, Nasonia vitripennis. To persist, PSR is thought to modify the hereditary material of the developing sperm, with the result that all nuclear DNA other than the PSR chromosome is destroyed shortly after fertilization. This results in the conversion of a fertilized embryo--normally a female--into a male, thereby insuring transmission of the "selfish" PSR chromosome, and simultaneously leading to wasp populations that are male-biased. To begin to understand this system at the mechanistic level, we carried out transcriptional profiling of testis from WT and PSR-carrying males. We identified a number of transcripts that are differentially expressed between these conditions. We also discovered nine transcripts that are uniquely expressed from the PSR chromosome. Four of these PSR-specific transcripts encode putative proteins, whereas the others have very short open reading frames and no homology to known proteins, suggesting that they are long noncoding RNAs. We propose several different models for how these transcripts could facilitate PSR-dependent effects. Our analyses also revealed 15.71 MB of novel transcribed regions in the N. vitripennis genome, thus increasing the current annotation of total transcribed regions by 53.4%. Finally, we detected expression of multiple meiosis-related genes in the wasp testis, despite the lack of conventional meiosis in the male sex.
Clustering in large networks does not promote upstream reciprocity.
Directory of Open Access Journals (Sweden)
Naoki Masuda
Full Text Available Upstream reciprocity (also called generalized reciprocity is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.
Clustering in large networks does not promote upstream reciprocity.
Masuda, Naoki
2011-01-01
Upstream reciprocity (also called generalized reciprocity) is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.
Chen, Liang; Chen, Jia-Yu; Zhang, Xuan; Gu, Ying; Xiao, Rui; Shao, Changwei; Tang, Peng; Qian, Hao; Luo, Daji; Li, Hairi; Zhou, Yu; Zhang, Dong-Er; Fu, Xiang-Dong
2017-11-16
R-loop, a three-stranded RNA/DNA structure, has been linked to induced genome instability and regulated gene expression. To enable precision analysis of R-loops in vivo, we develop an RNase-H-based approach; this reveals predominant R-loop formation near gene promoters with strong G/C skew and propensity to form G-quadruplex in non-template DNA, corroborating with all biochemically established properties of R-loops. Transcription perturbation experiments further indicate that R-loop induction correlates to transcriptional pausing. Interestingly, we note that most mapped R-loops are each linked to a nearby free RNA end; by using a ribozyme to co-transcriptionally cleave nascent RNA, we demonstrate that such a free RNA end coupled with a G/C-skewed sequence is necessary and sufficient to induce R-loop. These findings provide a topological solution for RNA invasion into duplex DNA and suggest an order for R-loop initiation and elongation in an opposite direction to that previously proposed. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jonathan G Boucher
Full Text Available Bisphenol S (BPS is increasingly used as a replacement plasticizer for bisphenol A (BPA but its effects on human health have not been thoroughly examined. Recent evidence indicates that both BPA and BPS induce adipogenesis, although the mechanisms leading to this effect are unclear. In an effort to identify common and distinct mechanisms of action in inducing adipogenesis, transcriptional profiles of differentiating human preadipocytes exposed to BPA or BPS were compared. Human subcutaneous primary preadipocytes were differentiated in the presence of either 25 μM BPA or BPS for 2 and 4 days. Poly-A RNA-sequencing was used to identify differentially expressed genes (DEGs. Functional analysis of DEGs was undertaken in Ingenuity Pathway Analysis. BPA-treatment resulted in 472 and 176 DEGs on days 2 and 4, respectively, affecting pathways such as liver X receptor (LXR/retinoid X receptor (RXR activation, hepatic fibrosis and cholestasis. BPS-treatment resulted in 195 and 51 DEGs on days 2 and 4, respectively, revealing enrichment of genes associated with adipogenesis and lipid metabolism including the adipogenesis pathway and cholesterol biosynthesis. Interestingly, the transcription repressor N-CoR was identified as a negative upstream regulator in both BPA- and BPS-treated cells. This study presents the first comparison of BPA- and BPS-induced transcriptional profiles in human differentiating preadipocytes. While we previously showed that BPA and BPS both induce adipogenesis, the results from this study show that BPS affects adipose specific transcriptional changes earlier than BPA, and alters the expression of genes specifically related to adipogenesis and lipid metabolism. The findings provide insight into potential BPS and BPA-mediated mechanisms of action in inducing adipogenesis in human primary preadipocytes.
Wei, Yunxie; Liu, Guoyin; Bai, Yujing; Xia, Feiyu; He, Chaozu; Shi, Haitao; Foyer, Christine
2017-10-13
Similar to the situation in animals, melatonin biosynthesis is regulated by four sequential enzymatic steps in plants. Although the melatonin synthesis genes have been identified in various plants, the upstream transcription factors of them remain unknown. In this study on cassava (Manihot esculenta), we found that MeWRKY79 and heat-shock transcription factor 20 (MeHsf20) targeted the W-box and the heat-stress elements (HSEs) in the promoter of N-acetylserotonin O-methyltransferase 2 (MeASMT2), respectively. The interaction between MeWRKY79, MeHsf20, and the MeASMT2 promoter was evidenced by the activation of promoter activity and chromatin immunoprecipitation (ChIP) in cassava protoplasts, and by an in vitro electrophoretic mobility shift assay (EMSA). The transcripts of MeWRKY79, MeHsf20, and MeASMT2 were all regulated by a 22-amino acid flagellin peptide (flg22) and by Xanthomonas axonopodis pv manihotis (Xam). In common with the phenotype of MeASMT2, transient expression of MeWRKY79 and MeHsf20 in Nicotiana benthamiana leaves conferred improved disease resistance. Through virus-induced gene silencing (VIGS) in cassava, we found that MeWRKY79- and MeHsf20-silenced plants showed lower transcripts of MeASMT2 and less accumulation of melatonin, which resulted in disease sensitivity that could be reversed by exogenous melatonin. Taken together, these results indicate that MeASMT2 is a target of MeWRKY79 and MeHsf20 in plant disease resistance. This study identifies novel upstream transcription factors of melatonin synthesis genes in cassava, thus extending our knowledge of the complex modulation of melatonin synthesis in plant defense. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Grégoire, Catherine-Alexandra; Tobin, Stephanie; Goldenstein, Brianna L; Samarut, Éric; Leclerc, Andréanne; Aumont, Anne; Drapeau, Pierre; Fulton, Stephanie; Fernandes, Karl J L
2018-01-01
Environmental enrichment (EE) is a powerful stimulus of brain plasticity and is among the most accessible treatment options for brain disease. In rodents, EE is modeled using multi-factorial environments that include running, social interactions, and/or complex surroundings. Here, we show that running and running-independent EE differentially affect the hippocampal dentate gyrus (DG), a brain region critical for learning and memory. Outbred male CD1 mice housed individually with a voluntary running disk showed improved spatial memory in the radial arm maze compared to individually- or socially-housed mice with a locked disk. We therefore used RNA sequencing to perform an unbiased interrogation of DG gene expression in mice exposed to either a voluntary running disk (RUN), a locked disk (LD), or a locked disk plus social enrichment and tunnels [i.e., a running-independent complex environment (CE)]. RNA sequencing revealed that RUN and CE mice showed distinct, non-overlapping patterns of transcriptomic changes versus the LD control. Bio-informatics uncovered that the RUN and CE environments modulate separate transcriptional networks, biological processes, cellular compartments and molecular pathways, with RUN preferentially regulating synaptic and growth-related pathways and CE altering extracellular matrix-related functions. Within the RUN group, high-distance runners also showed selective stress pathway alterations that correlated with a drastic decline in overall transcriptional changes, suggesting that excess running causes a stress-induced suppression of running's genetic effects. Our findings reveal stimulus-dependent transcriptional signatures of EE on the DG, and provide a resource for generating unbiased, data-driven hypotheses for novel mediators of EE-induced cognitive changes.
Directory of Open Access Journals (Sweden)
Christopher A Lavender
2016-08-01
Full Text Available Antisense transcription is a prevalent feature at mammalian promoters. Previous studies have primarily focused on antisense transcription initiating upstream of genes. Here, we characterize promoter-proximal antisense transcription downstream of gene transcription starts sites in human breast cancer cells, investigating the genomic context of downstream antisense transcription. We find extensive correlations between antisense transcription and features associated with the chromatin environment at gene promoters. Antisense transcription downstream of promoters is widespread, with antisense transcription initiation observed within 2 kb of 28% of gene transcription start sites. Antisense transcription initiates between nucleosomes regularly positioned downstream of these promoters. The nucleosomes between gene and downstream antisense transcription start sites carry histone modifications associated with active promoters, such as H3K4me3 and H3K27ac. This region is bound by chromatin remodeling and histone modifying complexes including SWI/SNF subunits and HDACs, suggesting that antisense transcription or resulting RNA transcripts contribute to the creation and maintenance of a promoter-associated chromatin environment. Downstream antisense transcription overlays additional regulatory features, such as transcription factor binding, DNA accessibility, and the downstream edge of promoter-associated CpG islands. These features suggest an important role for antisense transcription in the regulation of gene expression and the maintenance of a promoter-associated chromatin environment.
Directory of Open Access Journals (Sweden)
Valero Francisco
2007-07-01
specific mRNA species in P. pastoris cells grown in fed-batch cultures. As a proof-of-principle, the influence of the carbon and nitrogen sources, the specific growth rate, as well as the ROL overexpression on the transcriptional levels of a reduced set of bioprocess-relevant genes has been quantitatively studied, revealing that ROL overexpression and secretion seems to trigger the UPR in P. pastoris, resulting in a physiological bottleneck for the production process.
Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T
2015-12-01
The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Magnani, Enrico; de Klein, Niek; Nam, Hye-In; Kim, Jung-Gun; Pham, Kimberly; Fiume, Elisa; Mudgett, Mary Beth; Rhee, Seung Yon
2014-01-01
Truncated transcription factor-like proteins called microProteins (miPs) can modulate transcription factor activities, thereby increasing transcriptional regulatory complexity. To understand their prevalence, evolution, and function, we predicted over 400 genes that encode putative miPs from
Almeida, Tânia; Menéndez, Esther; Capote, Tiago; Ribeiro, Teresa; Santos, Conceição; Gonçalves, Sónia
2013-01-15
The molecular processes associated with cork development in Quercus suber L. are poorly understood. A previous molecular approach identified a list of genes potentially important for cork formation and differentiation, providing a new basis for further molecular studies. This report is the first molecular characterization of one of these candidate genes, QsMYB1, coding for an R2R3-MYB transcription factor. The R2R3-MYB gene sub-family has been described as being involved in the phenylpropanoid and lignin pathways, both involved in cork biosynthesis. The results showed that the expression of QsMYB1 is putatively mediated by an alternative splicing (AS) mechanism that originates two different transcripts (QsMYB1.1 and QsMYB1.2), differing only in the 5'-untranslated region, due to retention of the first intron in one of the variants. Moreover, within the retained intron, a simple sequence repeat (SSR) was identified. The upstream regulatory region of QsMYB1 was extended by a genome walking approach, which allowed the identification of the putative gene promoter region. The relative expression pattern of QsMYB1 transcripts determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR) revealed that both transcripts were up-regulated in cork tissues; the detected expression was several times higher in newly formed cork harvested from trees producing virgin, second or reproduction cork when compared with wood. Moreover, the expression analysis of QsMYB1 in several Q. suber organs showed very low expression in young branches and roots, whereas in leaves, immature acorns or male flowers, no expression was detected. These preliminary results suggest that QsMYB1 may be related to secondary growth and, in particular, with the cork biosynthesis process with a possible alternative splicing mechanism associated with its regulatory function. Copyright © 2012 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Andreas Tuerk
2017-05-01
Full Text Available Accuracy of transcript quantification with RNA-Seq is negatively affected by positional fragment bias. This article introduces Mix2 (rd. "mixquare", a transcript quantification method which uses a mixture of probability distributions to model and thereby neutralize the effects of positional fragment bias. The parameters of Mix2 are trained by Expectation Maximization resulting in simultaneous transcript abundance and bias estimates. We compare Mix2 to Cufflinks, RSEM, eXpress and PennSeq; state-of-the-art quantification methods implementing some form of bias correction. On four synthetic biases we show that the accuracy of Mix2 overall exceeds the accuracy of the other methods and that its bias estimates converge to the correct solution. We further evaluate Mix2 on real RNA-Seq data from the Microarray and Sequencing Quality Control (MAQC, SEQC Consortia. On MAQC data, Mix2 achieves improved correlation to qPCR measurements with a relative increase in R2 between 4% and 50%. Mix2 also yields repeatable concentration estimates across technical replicates with a relative increase in R2 between 8% and 47% and reduced standard deviation across the full concentration range. We further observe more accurate detection of differential expression with a relative increase in true positives between 74% and 378% for 5% false positives. In addition, Mix2 reveals 5 dominant biases in MAQC data deviating from the common assumption of a uniform fragment distribution. On SEQC data, Mix2 yields higher consistency between measured and predicted concentration ratios. A relative error of 20% or less is obtained for 51% of transcripts by Mix2, 40% of transcripts by Cufflinks and RSEM and 30% by eXpress. Titration order consistency is correct for 47% of transcripts for Mix2, 41% for Cufflinks and RSEM and 34% for eXpress. We, further, observe improved repeatability across laboratory sites with a relative increase in R2 between 8% and 44% and reduced standard deviation.
Transcription regulation by the Mediator complex.
Soutourina, Julie
2018-04-01
Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.
Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut
2014-01-01
targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.
eXpression2Kinases (X2K) Web: linking expression signatures to upstream cell signaling networks.
Clarke, Daniel J B; Kuleshov, Maxim V; Schilder, Brian M; Torre, Denis; Duffy, Mary E; Keenan, Alexandra B; Lachmann, Alexander; Feldmann, Axel S; Gundersen, Gregory W; Silverstein, Moshe C; Wang, Zichen; Ma'ayan, Avi
2018-05-25
While gene expression data at the mRNA level can be globally and accurately measured, profiling the activity of cell signaling pathways is currently much more difficult. eXpression2Kinases (X2K) computationally predicts involvement of upstream cell signaling pathways, given a signature of differentially expressed genes. X2K first computes enrichment for transcription factors likely to regulate the expression of the differentially expressed genes. The next step of X2K connects these enriched transcription factors through known protein-protein interactions (PPIs) to construct a subnetwork. The final step performs kinase enrichment analysis on the members of the subnetwork. X2K Web is a new implementation of the original eXpression2Kinases algorithm with important enhancements. X2K Web includes many new transcription factor and kinase libraries, and PPI networks. For demonstration, thousands of gene expression signatures induced by kinase inhibitors, applied to six breast cancer cell lines, are provided for fetching directly into X2K Web. The results are displayed as interactive downloadable vector graphic network images and bar graphs. Benchmarking various settings via random permutations enabled the identification of an optimal set of parameters to be used as the default settings in X2K Web. X2K Web is freely available from http://X2K.cloud.
Participation costs can suppress the evolution of upstream reciprocity.
Peña, Jorge; Pestelacci, Enea; Berchtold, André; Tomassini, Marco
2011-03-21
Indirect reciprocity, one of the many mechanisms proposed to explain the evolution of cooperation, is the idea that altruistic actions can be rewarded by third parties. Upstream or generalized reciprocity is one type of indirect reciprocity in which individuals help someone if they have been helped by somebody else in the past. Although empirically found to be at work in humans, the evolution of upstream reciprocity is difficult to explain from a theoretical point of view. A recent model of upstream reciprocity, first proposed by Nowak and Roch (2007) and further analyzed by Iwagami and Masuda (2010), shows that while upstream reciprocity alone does not lead to the evolution of cooperation, it can act in tandem with mechanisms such as network reciprocity and increase the total level of cooperativity in the population. We argue, however, that Nowak and Roch's model systematically leads to non-uniform interaction rates, where more cooperative individuals take part in more games than less cooperative ones. As a result, the critical benefit-to-cost ratios derived under this model in previous studies are not invariant with respect to the addition of participation costs. We show that accounting for these costs can hinder and even suppress the evolution of upstream reciprocity, both for populations with non-random encounters and graph-structured populations. Copyright © 2011 Elsevier Ltd. All rights reserved.
Planchais, Julien; Boutant, Marie; Fauveau, Véronique; Qing, Lou Dan; Sabra-Makke, Lina; Bossard, Pascale; Vasseur-Cognet, Mireille; Pégorier, Jean-Paul
2015-05-15
Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) is an orphan nuclear receptor involved in the control of numerous functions in various organs (organogenesis, differentiation, metabolic homeostasis, etc.). The aim of the present work was to characterize the regulation and contribution of COUP-TFII in the control of hepatic fatty acid and glucose metabolisms in newborn mice. Our data show that postnatal increase in COUP-TFII mRNA levels is enhanced by glucagon (via cAMP) and PPARα. To characterize COUP-TFII function in the liver of suckling mice, we used a functional (dominant negative form; COUP-TFII-DN) and a genetic (shRNA) approach. Adenoviral COUP-TFII-DN injection induces a profound hypoglycemia due to the inhibition of gluconeogenesis and fatty acid oxidation secondarily to reduced PEPCK, Gl-6-Pase, CPT I, and mHMG-CoA synthase gene expression. Using the crossover plot technique, we show that gluconeogenesis is inhibited at two different levels: 1) pyruvate carboxylation and 2) trioses phosphate synthesis. This could result from a decreased availability in fatty acid oxidation arising cofactors such as acetyl-CoA and reduced equivalents. Similar results are observed using the shRNA approach. Indeed, when fatty acid oxidation is rescued in response to Wy-14643-induced PPARα target genes (CPT I and mHMG-CoA synthase), blood glucose is normalized in COUP-TFII-DN mice. In conclusion, this work demonstrates that postnatal increase in hepatic COUP-TFII gene expression is involved in the regulation of liver fatty acid oxidation, which in turn sustains an active hepatic gluconeogenesis that is essential to maintain an appropriate blood glucose level required for newborn mice survival. Copyright © 2015 the American Physiological Society.
Upstream from OPERA: extreme attention to detail
CERN Bulletin
2011-01-01
Two weeks ago, at a seminar held at CERN, the OPERA collaboration revealed their astonishing observation: neutrinos might move faster than light. The finding is currently under scrutiny in the scientific community. While the result downstream at Gran Sasso speaks for itself, upstream at CERN things are no less intriguing, with high-tech GPS systems, novel techniques for accurately measuring the time, and unique ways keeping the initial particle beam stable. Take away one ingredient and the accuracy needed for the final measurement is spoiled. Underground installations of the CERN Neutrinos to Gran Sasso (CNGS) project. First ingredient: a stable beam CERN produces neutrinos by sending a beam of protons to hit a target. The collisions produce a secondary beam, which mostly consists of pions and kaons that decay in flight within an evacuated tunnel. Their decay products are muons and muon-neutrinos. An absorber stops the pions and kaons that do not decay, while the resulting muons are absorb...
Sp1/3 and NF-1 mediate basal transcription of the human P2X1 gene in megakaryoblastic MEG-01 cells
Directory of Open Access Journals (Sweden)
Ennion Steven J
2006-03-01
Full Text Available Abstract Background P2X1 receptors play an important role in platelet function as they can induce shape change, granule centralization and are also involved in thrombus formation. As platelets have no nuclei, the level of P2X1 expression depends on transcriptional regulation in megakaryocytes, the platelet precursor cell. Since nothing is known about the molecular mechanisms regulating megakaryocytic P2X1 expression, this study aimed to identify and functionally characterize the P2X1 core promoter utilized in the human megakaryoblastic cell line MEG-01. Results In order to identify cis-acting elements involved in the transcriptional regulation of P2X1 expression, the ability of 4.7 kb P2X1 upstream sequence to drive luciferase reporter gene expression was tested. Low promoter activity was detected in proliferating MEG-01 cells. This activity increased 20-fold after phorbol-12-myristate-13-acetate (PMA induced differentiation. A transcription start site was detected 365 bp upstream of the start codon by primer extension. Deletion analysis of reporter constructs indicated a core promoter located within the region -68 to +149 bp that contained two Sp1 sites (named Sp1a and Sp1b and an NF-1 site. Individual mutations of Sp1b or NF-1 binding sites severely reduced promoter activity whereas triple mutation of Sp1a, Sp1b and NF-1 sites completely abolished promoter activity in both untreated and PMA treated cells. Sp1/3 and NF-1 proteins were shown to bind their respective sites by EMSA and interaction of Sp1/3, NF-1 and TFIIB with the endogenous P2X1 core promoter in MEG-01 cells was demonstrated by chromatin immunoprecipitation. Alignment of P2X1 genes from human, chimp, rat, mouse and dog revealed consensus Sp1a, Sp1b and NF-1 binding sites in equivalent positions thereby demonstrating evolutionary conservation of these functionally important sites. Conclusion This study has identified and characterized the P2X1 promoter utilized in MEG-01 cells and
Camps, Jordi; Nguyen, Quang Tri; Padilla-Nash, Hesed M.; Knutsen, Turid; McNeil, Nicole E.; Wangsa, Danny; Hummon, Amanda B.; Grade, Marian; Ried, Thomas; Difilippantonio, Michael J.
2016-01-01
To evaluate the mechanisms and consequences of chromosomal aberrations in colorectal cancer (CRC), we used a combination of spectral karyotyping, array comparative genomic hybridization (aCGH), and array-based global gene expression profiling on 31 primary carcinomas and 15 established cell lines. Importantly, aCGH showed that the genomic profiles of primary tumors are recapitulated in the cell lines. We revealed a preponderance of chromosome breakpoints at sites of copy number variants (CNVs) in the CRC cell lines, a novel mechanism of DNA breakage in cancer. The integration of gene expression and aCGH led to the identification of 157 genes localized within high-level copy number changes whose transcriptional deregulation was significantly affected across all of the samples, thereby suggesting that these genes play a functional role in CRC. Genomic amplification at 8q24 was the most recurrent event and led to the overexpression of MYC and FAM84B. Copy number dependent gene expression resulted in deregulation of known cancer genes such as APC, FGFR2, and ERBB2. The identification of only 36 genes whose localization near a breakpoint could account for their observed deregulated expression demonstrates that the major mechanism for transcriptional deregulation in CRC is genomic copy number changes resulting from chromosomal aberrations. PMID:19691111
Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.
Kageyama, R; Merlino, G T; Pastan, I
1989-09-15
Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-01-01
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934
Directory of Open Access Journals (Sweden)
Catherine-Alexandra Grégoire
2018-04-01
Full Text Available Environmental enrichment (EE is a powerful stimulus of brain plasticity and is among the most accessible treatment options for brain disease. In rodents, EE is modeled using multi-factorial environments that include running, social interactions, and/or complex surroundings. Here, we show that running and running-independent EE differentially affect the hippocampal dentate gyrus (DG, a brain region critical for learning and memory. Outbred male CD1 mice housed individually with a voluntary running disk showed improved spatial memory in the radial arm maze compared to individually- or socially-housed mice with a locked disk. We therefore used RNA sequencing to perform an unbiased interrogation of DG gene expression in mice exposed to either a voluntary running disk (RUN, a locked disk (LD, or a locked disk plus social enrichment and tunnels [i.e., a running-independent complex environment (CE]. RNA sequencing revealed that RUN and CE mice showed distinct, non-overlapping patterns of transcriptomic changes versus the LD control. Bio-informatics uncovered that the RUN and CE environments modulate separate transcriptional networks, biological processes, cellular compartments and molecular pathways, with RUN preferentially regulating synaptic and growth-related pathways and CE altering extracellular matrix-related functions. Within the RUN group, high-distance runners also showed selective stress pathway alterations that correlated with a drastic decline in overall transcriptional changes, suggesting that excess running causes a stress-induced suppression of running’s genetic effects. Our findings reveal stimulus-dependent transcriptional signatures of EE on the DG, and provide a resource for generating unbiased, data-driven hypotheses for novel mediators of EE-induced cognitive changes.
Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru
2017-11-15
Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Karen Artiles
2009-11-01
Full Text Available The key molecular event that marks entry into the cell cycle is transcription of G1 cyclins, which bind and activate cyclin-dependent kinases. In yeast cells, initiation of G1 cyclin transcription is linked to achievement of a critical cell size, which contributes to cell-size homeostasis. The critical cell size is modulated by nutrients, such that cells growing in poor nutrients are smaller than cells growing in rich nutrients. Nutrient modulation of cell size does not work through known critical regulators of G1 cyclin transcription and is therefore thought to work through a distinct pathway. Here, we report that Rts1, a highly conserved regulatory subunit of protein phosphatase 2A (PP2A, is required for normal control of G1 cyclin transcription. Loss of Rts1 caused delayed initiation of bud growth and delayed and reduced accumulation of G1 cyclins. Expression of the G1 cyclin CLN2 from an inducible promoter rescued the delayed bud growth in rts1Delta cells, indicating that Rts1 acts at the level of transcription. Moreover, loss of Rts1 caused altered regulation of Swi6, a key component of the SBF transcription factor that controls G1 cyclin transcription. Epistasis analysis revealed that Rts1 does not work solely through several known critical upstream regulators of G1 cyclin transcription. Cells lacking Rts1 failed to undergo nutrient modulation of cell size. Together, these observations demonstrate that Rts1 is a key player in pathways that link nutrient availability, cell size, and G1 cyclin transcription. Since Rts1 is highly conserved, it may function in similar pathways in vertebrates.
Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali
2015-11-05
Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division. Copyright © 2015 Elsevier Inc. All rights reserved.
Kumar, V; Wong, D T; Pasion, S G; Biswas, D K
1987-12-08
The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.
Epigenetic landscapes reveal transcription factors that regulate CD8+ T cell differentiation.
Yu, Bingfei; Zhang, Kai; Milner, J Justin; Toma, Clara; Chen, Runqiang; Scott-Browne, James P; Pereira, Renata M; Crotty, Shane; Chang, John T; Pipkin, Matthew E; Wang, Wei; Goldrath, Ananda W
2017-05-01
Dynamic changes in the expression of transcription factors (TFs) can influence the specification of distinct CD8 + T cell fates, but the observation of equivalent expression of TFs among differentially fated precursor cells suggests additional underlying mechanisms. Here we profiled the genome-wide histone modifications, open chromatin and gene expression of naive, terminal-effector, memory-precursor and memory CD8 + T cell populations induced during the in vivo response to bacterial infection. Integration of these data suggested that the expression and binding of TFs contributed to the establishment of subset-specific enhancers during differentiation. We developed a new bioinformatics method using the PageRank algorithm to reveal key TFs that influence the generation of effector and memory populations. The TFs YY1 and Nr3c1, both constitutively expressed during CD8 + T cell differentiation, regulated the formation of terminal-effector cell fates and memory-precursor cell fates, respectively. Our data define the epigenetic landscape of differentiation intermediates and facilitate the identification of TFs with previously unappreciated roles in CD8 + T cell differentiation.
Sjöholm, Johannes; Oliveira, Paulo; Lindblad, Peter
2007-01-01
The filamentous, heterocystous cyanobacterium Nostoc sp. strain PCC 7120 (Anabaena sp. strain PCC 7120) possesses an uptake hydrogenase and a bidirectional enzyme, the latter being capable of catalyzing both H2 production and evolution. The completely sequenced genome of Nostoc sp. strain PCC 7120 reveals that the five structural genes encoding the bidirectional hydrogenase (hoxEFUYH) are separated in two clusters at a distance of approximately 8.8 kb. The transcription of the hox genes was examined under nitrogen-fixing conditions, and the results demonstrate that the cluster containing hoxE and hoxF can be transcribed as one polycistronic unit together with the open reading frame alr0750. The second cluster, containing hoxU, hoxY, and hoxH, is transcribed together with alr0763 and alr0765, located between the hox genes. Moreover, alr0760 and alr0761 form an additional larger operon. Nevertheless, Northern blot hybridizations revealed a rather complex transcription pattern in which the different hox genes are expressed differently. Transcriptional start points (TSPs) were identified 66 and 57 bp upstream from the start codon of alr0750 and hoxU, respectively. The transcriptions of the two clusters containing the hox genes are both induced under anaerobic conditions concomitantly with the induction of a higher level of hydrogenase activity. An additional TSP, within the annotated alr0760, 244 bp downstream from the suggested translation start codon, was identified. Electrophoretic mobility shift assays with purified LexA from Nostoc sp. strain PCC 7120 demonstrated specific interactions between the transcriptional regulator and both hox promoter regions. However, when LexA from Synechocystis sp. strain PCC 6803 was used, the purified protein interacted only with the promoter region of the alr0750-hoxE-hoxF operon. A search of the whole Nostoc sp. strain PCC 7120 genome demonstrated the presence of 216 putative LexA binding sites in total, including recA and rec
Chen, Lin; Yang, Yang; Liu, Can; Zheng, Yanyan; Xu, Mingshuang; Wu, Na; Sheng, Jiping; Shen, Lin
2015-08-28
WRKY transcription factors play an important role in cold defense of plants. However, little information is available about the cold-responsive WRKYs in tomato (Solanum lycopersicum). In the present study, a complete characterization of this gene family was described. Eighty WRKY genes in the tomato genome were identified. Almost all WRKY genes contain putative stress-responsive cis-elements in their promoter regions. Segmental duplications contributed significantly to the expansion of the SlWRKY gene family. Transcriptional analysis revealed notable differential expression in tomato tissues and expression patterns under cold stress, which indicated wide functional divergence in this family. Ten WRKYs in tomato were strongly induced more than 2-fold during cold stress. These genes represented candidate genes for future functional analysis of WRKYs involved in the cold-related signal pathways. Our data provide valuable information about tomato WRKY proteins and form a foundation for future studies of these proteins, especially for those that play an important role in response to cold stress. Copyright © 2015 Elsevier Inc. All rights reserved.
Analysis of key thresholds leading to upstream dependencies in global transboundary water bodies
Munia, Hafsa Ahmed; Guillaume, Joseph; Kummu, Matti; Mirumachi, Naho; Wada, Yoshihide
2017-04-01
Transboundary water bodies supply 60% of global fresh water flow and are home to about 1/3 of the world's population; creating hydrological, social and economic interdependencies between countries. Trade-offs between water users are delimited by certain thresholds, that, when crossed, result in changes in system behavior, often related to undesirable impacts. A wide variety of thresholds are potentially related to water availability and scarcity. Scarcity can occur because of the country's own water use, and that is potentially intensified by upstream water use. In general, increased water scarcity escalates the reliance on shared water resources, which increases interdependencies between riparian states. In this paper the upstream dependencies of global transboundary river basins are examined at the scale of sub-basin areas. We aim to assess how upstream water withdrawals cause changes in the scarcity categories, such that crossing thresholds is interpreted in terms of downstream dependency on upstream water availability. The thresholds are defined for different types of water availability on which a sub-basin relies: - reliable local runoff (available even in a dry year), - less reliable local water (available in the wet year), - reliable dry year inflows from possible upstream area, and - less reliable wet year inflows from upstream. Possible upstream withdrawals reduce available water downstream, influencing the latter two water availabilities. Upstream dependencies have then been categorized by comparing a sub-basin's scarcity category across different water availability types. When population (or water consumption) grows, the sub-basin satisfies its needs using less reliable water. Thus, the factors affecting the type of water availability being used are different not only for each type of dependency category, but also possibly for every sub- basin. Our results show that, in the case of stress (impacts from high use of water), in 104 (12%) sub- basins out of
Valuating Indonesian upstream oil management scenario through system dynamics modelling
Ketut Gunarta, I.; Putri, F. A.
2018-04-01
Under the existing regulation in Constitution Number 22 Year 2001 (UU No 22 Tahun 2001), Production Sharing Contract (PSC) continues to be the scenario in conducting oil and gas upstream mining activities as the previous regulation (UU No. 8 Tahun 1971). Because of the high costs and risks in upstream mining activities, the contractors are dominated by foreign companies, meanwhile National Oil Company (NOC) doesn’t act much. The domination of foreign contractor companies also warned Indonesia in several issues addressing to energy independence and energy security. Therefore, to achieve the goals of energy which is independence and security, there need to be a revision in upstream oil activities regulating scenario. The scenarios will be comparing the current scenario, which is PSC, with the “full concession” scenario for National Oil Company (NOC) in managing oil upstream mining activities. Both scenario will be modelled using System Dynamics methodology and assessed furthermore using financial valuation method of income approach. Under the 2 scenarios, the author will compare which scenario is better for upstream oil management in reaching the goals mentioned before and more profitable in financial aspect. From the simulation, it is gathered that concession scenario offers better option than PSC in reaching energy independence and energy security.
Kim, Gwang-Jin; Sock, Elisabeth; Buchberger, Astrid; Just, Walter; Denzer, Friederike; Hoepffner, Wolfgang; German, James; Cole, Trevor; Mann, Jillian; Seguin, John H; Zipf, William; Costigan, Colm; Schmiady, Hardi; Rostásy, Moritz; Kramer, Mildred; Kaltenbach, Simon; Rösler, Bernd; Georg, Ina; Troppmann, Elke; Teichmann, Anne-Christin; Salfelder, Anika; Widholz, Sebastian A; Wieacker, Peter; Hiort, Olaf; Camerino, Giovanna; Radi, Orietta; Wegner, Michael; Arnold, Hans-Henning; Scherer, Gerd
2015-04-01
SOX9 mutations cause the skeletal malformation syndrome campomelic dysplasia in combination with XY sex reversal. Studies in mice indicate that SOX9 acts as a testis-inducing transcription factor downstream of SRY, triggering Sertoli cell and testis differentiation. An SRY-dependent testis-specific enhancer for Sox9 has been identified only in mice. A previous study has implicated copy number variations (CNVs) of a 78 kb region 517-595 kb upstream of SOX9 in the aetiology of both 46,XY and 46,XX disorders of sex development (DSD). We wanted to better define this region for both disorders. By CNV analysis, we identified SOX9 upstream duplications in three cases of SRY-negative 46,XX DSD, which together with previously reported duplications define a 68 kb region, 516-584 kb upstream of SOX9, designated XXSR (XX sex reversal region). More importantly, we identified heterozygous deletions in four families with SRY-positive 46,XY DSD without skeletal phenotype, which define a 32.5 kb interval 607.1-639.6 kb upstream of SOX9, designated XY sex reversal region (XYSR). To localise the suspected testis-specific enhancer, XYSR subfragments were tested in cell transfection and transgenic experiments. While transgenic experiments remained inconclusive, a 1.9 kb SRY-responsive subfragment drove expression specifically in Sertoli-like cells. Our results indicate that isolated 46,XY and 46,XX DSD can be assigned to two separate regulatory regions, XYSR and XXSR, far upstream of SOX9. The 1.9 kb SRY-responsive subfragment from the XYSR might constitute the core of the Sertoli-cell enhancer of human SOX9, representing the so far missing link in the genetic cascade of male sex determination. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Directory of Open Access Journals (Sweden)
Richard A Jorgensen
2012-08-01
Full Text Available Upstream open reading frames (uORFs are common in eukaryotic transcripts, but those that encode conserved peptides (CPuORFs occur in less than 1% of transcripts. The peptides encoded by three plant CPuORF families are known to control translation of the downstream ORF in response to a small signal molecule (sucrose, polyamines and phosphocholine. In flowering plants, transcription factors are statistically over-represented among genes that possess CPuORFs, and in general it appeared that many CPuORF genes also had other regulatory functions, though the significance of this suggestion was uncertain (Hayden and Jorgensen, 2007. Five years later the literature provides much more information on the functions of many CPuORF genes. Here we reassess the functions of 27 known CPuORF gene families and find that 22 of these families play a variety of different regulatory roles, from transcriptional control to protein turnover, and from small signal molecules to signal transduction kinases. Clearly then, there is indeed a strong association of CPuORFs with regulatory genes. In addition, 16 of these families play key roles in a variety of different biological processes. Most strikingly, the core sucrose response network includes three different CPuORFs, creating the potential for sophisticated balancing of the network in response to three different molecular inputs. We propose that the function of most CPuORFs is to modulate translation of a downstream major ORF (mORF in response to a signal molecule recognized by the conserved peptide and that because the mORFs of CPuORF genes generally encode regulatory proteins, many of them centrally important in the biology of plants, CPuORFs play key roles in balancing such regulatory networks.
Bmp indicator mice reveal dynamic regulation of transcriptional response.
Directory of Open Access Journals (Sweden)
Anna L Javier
Full Text Available Cellular responses to Bmp ligands are regulated at multiple levels, both extracellularly and intracellularly. Therefore, the presence of these growth factors is not an accurate indicator of Bmp signaling activity. While a common approach to detect Bmp signaling activity is to determine the presence of phosphorylated forms of Smad1, 5 and 8 by immunostaining, this approach is time consuming and not quantitative. In order to provide a simpler readout system to examine the presence of Bmp signaling in developing animals, we developed BRE-gal mouse embryonic stem cells and a transgenic mouse line that specifically respond to Bmp ligand stimulation. Our reporter identifies specific transcriptional responses that are mediated by Smad1 and Smad4 with the Schnurri transcription factor complex binding to a conserved Bmp-Responsive Element (BRE, originally identified among Drosophila, Xenopus and human Bmp targets. Our BRE-gal mES cells specifically respond to Bmp ligands at concentrations as low as 5 ng/ml; and BRE-gal reporter mice, derived from the BRE-gal mES cells, show dynamic activity in many cellular sites, including extraembryonic structures and mammary glands, thereby making this a useful scientific tool.
Inlet effect induced ''upstream'' critical heat flux in smooth tubes
International Nuclear Information System (INIS)
Kitto, J.B. Jr.
1986-01-01
An unusual form of ''upstream'' critical heat flux (CHF) has been observed and directly linked to the inlet flow pattern during an experimental study of high pressure (17 - 20 MPa) water flowing through a vertical 38.1 mm ID smooth bore tube with uniform axial and nonuniform circumferential heating. These upstream CHF data were characterized by temperature excursions which initially occurred at a relatively fixed axial location in the middle of the test section while the outlet and inlet heated lengths experienced no change. A rifled tube inlet flow conditioner could be substituted for a smooth tube section to generate the desired swirling inlet flow pattern. The upstream CHF data were found to match data from a uniformly heated smooth bore tube when the comparison was made using the peak local heat flux. The mechanism proposed to account for the upstream CHF observations involves the destructive interference between the decaying swirl flow and the secondary circumferential liquid flow field resulting from the one-sided heating
LENUS (Irish Health Repository)
Murphy, Derek M
2009-01-01
BACKGROUND: Neuroblastoma, a cancer derived from precursor cells of the sympathetic nervous system, is a major cause of childhood cancer related deaths. The single most important prognostic indicator of poor clinical outcome in this disease is genomic amplification of MYCN, a member of a family of oncogenic transcription factors. METHODOLOGY: We applied MYCN chromatin immunoprecipitation to microarrays (ChIP-chip) using MYCN amplified\\/non-amplified cell lines as well as a conditional knockdown cell line to determine the distribution of MYCN binding sites within all annotated promoter regions. CONCLUSION: Assessment of E-box usage within consistently positive MYCN binding sites revealed a predominance for the CATGTG motif (p<0.0016), with significant enrichment of additional motifs CATTTG, CATCTG, CAACTG in the MYCN amplified state. For cell lines over-expressing MYCN, gene ontology analysis revealed enrichment for the binding of MYCN at promoter regions of numerous molecular functional groups including DNA helicases and mRNA transcriptional regulation. In order to evaluate MYCN binding with respect to other genomic features, we determined the methylation status of all annotated CpG islands and promoter sequences using methylated DNA immunoprecipitation (MeDIP). The integration of MYCN ChIP-chip and MeDIP data revealed a highly significant positive correlation between MYCN binding and DNA hypermethylation. This association was also detected in regions of hemizygous loss, indicating that the observed association occurs on the same homologue. In summary, these findings suggest that MYCN binding occurs more commonly at CATGTG as opposed to the classic CACGTG E-box motif, and that disease associated over expression of MYCN leads to aberrant binding to additional weaker affinity E-box motifs in neuroblastoma. The co-localization of MYCN binding and DNA hypermethylation further supports the dual role of MYCN, namely that of a classical transcription factor affecting the
The LHCb Upstream Tracker Project
Steinkamp, Olaf
2015-01-01
The LHCb detector performs searches for New Physics in CP-violating observables and rare heavy-quark decays at the LHC. A comprehensive upgrade is planned for the long shutdown of the LHC in 2018/19. A goal of this upgrade is to abolish hardware triggers and read out the full detector at 40 MHz. This requires to replace the existing TT station upstream of the LHCb magnet by a new silicon micro-strip detector, the Upstream Tracker (UT). The UT will have a new front-end chip compatible with 40 MHz readout, silicon sensors with improved radiation hardness, finer readout granularity, and improved acceptance coverage at small polar angles. The outer region of each detection layer will be covered by p-in-n sensors with 10 cm long strips and a pitch of about 180 mum, while n-in-p sensors with half the pitch and strip length will be employed in the regions of highest particle density close to the beam pipe. The innermost sensors will have a circular cutout to optimize the forward acceptance. The front-end chip is bei...
Directory of Open Access Journals (Sweden)
Petra Peters-Wendisch
2017-04-01
Full Text Available Corynebacterium glutamicum is a natural producer of the C50 carotenoid decaprenoxanthin. The crtEcg0722crtBIYEb operon comprises most of its genes for terpenoid biosynthesis. The MarR-type regulator encoded upstream and in divergent orientation of the carotenoid biosynthesis operon has not yet been characterized. This regulator, named CrtR in this study, is encoded in many actinobacterial genomes co-occurring with terpenoid biosynthesis genes. CrtR was shown to repress the crt operon of C. glutamicum since DNA microarray experiments revealed that transcript levels of crt operon genes were increased 10 to 70-fold in its absence. Transcriptional fusions of a promoter-less gfp gene with the crt operon and crtR promoters confirmed that CrtR represses its own gene and the crt operon. Gel mobility shift assays with purified His-tagged CrtR showed that CrtR binds to a region overlapping with the −10 and −35 promoter sequences of the crt operon. Isoprenoid pyrophosphates interfered with binding of CrtR to its target DNA, a so far unknown mechanism for regulation of carotenogenesis. The molecular details of protein-ligand interactions remain to be studied. Decaprenoxanthin synthesis by C. glutamicum wild type was enhanced 10 to 30-fold upon deletion of crtR and was decreased 5 to 6-fold as result of crtR overexpression. Moreover, deletion of crtR was shown as metabolic engineering strategy to improve production of native and non-native carotenoids including lycopene, β-carotene, C.p. 450 and sarcinaxanthin.
Directory of Open Access Journals (Sweden)
Buer Jan
2004-12-01
Full Text Available Abstract Background Cellular functions are coordinately carried out by groups of genes forming functional modules. Identifying such modules in the transcriptional regulatory network (TRN of organisms is important for understanding the structure and function of these fundamental cellular networks and essential for the emerging modular biology. So far, the global connectivity structure of TRN has not been well studied and consequently not applied for the identification of functional modules. Moreover, network motifs such as feed forward loop are recently proposed to be basic building blocks of TRN. However, their relationship to functional modules is not clear. Results In this work we proposed a top-down approach to identify modules in the TRN of E. coli. By studying the global connectivity structure of the regulatory network, we first revealed a five-layer hierarchical structure in which all the regulatory relationships are downward. Based on this regulatory hierarchy, we developed a new method to decompose the regulatory network into functional modules and to identify global regulators governing multiple modules. As a result, 10 global regulators and 39 modules were identified and shown to have well defined functions. We then investigated the distribution and composition of the two basic network motifs (feed forward loop and bi-fan motif in the hierarchical structure of TRN. We found that most of these network motifs include global regulators, indicating that these motifs are not basic building blocks of modules since modules should not contain global regulators. Conclusion The transcriptional regulatory network of E. coli possesses a multi-layer hierarchical modular structure without feedback regulation at transcription level. This hierarchical structure builds the basis for a new and simple decomposition method which is suitable for the identification of functional modules and global regulators in the transcriptional regulatory network of E
Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas
2013-05-21
Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.
Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling
2015-11-19
Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5'-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5'-TGTAAGCCCTAACA-3') upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network.
Zang, Dandan; Wang, Lina; Zhang, Yiming; Zhao, Huimin; Wang, Yucheng
2017-07-01
Identification of the upstream regulators of a gene is important to characterize the transcriptional pathway and the function of the gene. Previously, we found that a zinc finger protein (ThZFP1) is involved in abiotic stress tolerance of Tamarix hispida. In the present study, we further investigated the transcriptional pathway of ThZFP1. Dof motifs are abundant in the ThZFP1 promoter; therefore, we used them to screen for transcriptional regulators of ThZFP1. A Dof protein, ThDof1.4, binds to the Dof motif specifically, and was hypothesized as the upstream regulator of ThZFP1. Further study showed that overexpression of ThDof1.4 in T. hispida activated the expression of GUS controlled by the ThZFP1 promoter. In T. hispida, transient overexpression of ThDof1.4 increased the transcripts of ThZFP1; conversely, transient RNAi-silencing of ThDof1.4 reduced the expression of ThZFP1. Chromatin immunoprecipitation indicated that ThDof1.4 binds to the ThZFP1 promoter. Additionally, ThDof1.4 and ThZFP1 share similar expression patterns in response to salt or drought stress. Furthermore, like ThZFP1, ThDof1.4 could increase the proline level and enhance ROS scavenging capability to improve salt and osmotic stress tolerance. Together, these results suggested that ThDof1.4 and ThZFP1 form a transcriptional regulatory cascade involved in abiotic stress resistance in T. hispida.
Ung, Timothy H; Madsen, Helen J; Hellwinkel, Justin E; Lencioni, Alex M; Graner, Michael W
2014-11-01
Exosomes are virus-sized, membrane-enclosed vesicles with origins in the cellular endosomal system, but are released extracellularly. As a population, these tiny vesicles carry relatively enormous amounts of information in their protein, lipid and nucleic acid content, and the vesicles can have profound impacts on recipient cells. This review employs publically-available data combined with gene ontology applications to propose a novel concept, that exosomes transport transcriptional and translational machinery that may have direct impacts on gene expression in recipient cells. Here, we examine the previously published proteomic contents of medulloblastoma-derived exosomes, focusing on transcriptional regulators; we found that there are numerous proteins that may have potential roles in transcriptional and translational regulation with putative influence on downstream, cancer-related pathways. We expanded this search to all of the proteins in the Vesiclepedia database; using gene ontology approaches, we see that these regulatory factors are implicated in many of the processes involved in cancer initiation and progression. This information suggests that some of the effects of exosomes on recipient cells may be due to the delivery of protein factors that can directly and fundamentally change the transcriptional landscape of the cells. Within a tumor environment, this has potential to tilt the advantage towards the cancer. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.
Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke
2016-02-15
The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis
Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol
2016-07-19
The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.
Directory of Open Access Journals (Sweden)
Xiaoqing Rong-Mullins
2018-02-01
Full Text Available Cellular metabolism can change the potency of a chemical’s tumorigenicity. 4-nitroquinoline-1-oxide (4NQO is a tumorigenic drug widely used on animal models for cancer research. Polymorphisms of the transcription factor Yrr1 confer different levels of resistance to 4NQO in Saccharomyces cerevisiae. To study how different Yrr1 alleles regulate gene expression leading to resistance, transcriptomes of three isogenic S. cerevisiae strains carrying different Yrr1 alleles were profiled via RNA sequencing (RNA-Seq and chromatin immunoprecipitation coupled with sequencing (ChIP-Seq in the presence and absence of 4NQO. In response to 4NQO, all alleles of Yrr1 drove the expression of SNQ2 (a multidrug transporter, which was highest in the presence of 4NQO resistance-conferring alleles, and overexpression of SNQ2 alone was sufficient to overcome 4NQO-sensitive growth. Using shape metrics to refine the ChIP-Seq peaks, Yrr1 strongly associated with three loci including SNQ2. In addition to a known Yrr1 target SNG1, Yrr1 also bound upstream of RPL35B; however, overexpression of these genes did not confer 4NQO resistance. RNA-Seq data also implicated nucleotide synthesis pathways including the de novo purine pathway, and the ribonuclease reductase pathways were downregulated in response to 4NQO. Conversion of a 4NQO-sensitive allele to a 4NQO-resistant allele by a single point mutation mimicked the 4NQO-resistant allele in phenotype, and while the 4NQO resistant allele increased the expression of the ADE genes in the de novo purine biosynthetic pathway, the mutant Yrr1 increased expression of ADE genes even in the absence of 4NQO. These same ADE genes were only increased in the wild-type alleles in the presence of 4NQO, indicating that the point mutation activated Yrr1 to upregulate a pathway normally only activated in response to stress. The various Yrr1 alleles also influenced growth on different carbon sources by altering the function of the mitochondria
Directory of Open Access Journals (Sweden)
Thomas Spaller
Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.
Directory of Open Access Journals (Sweden)
Claudia Kruger
Full Text Available How signals from fatty acid metabolism are translated into changes in food intake remains unclear. Previously we reported that mice with a genetic inactivation of Acads (acyl-coenzyme A dehydrogenase, short-chain, the enzyme responsible for mitochondrial beta-oxidation of C4-C6 short-chain fatty acids (SCFAs, shift consumption away from fat and toward carbohydrate when offered a choice between diets. In the current study, we sought to indentify candidate genes and pathways underlying the effects of SCFA oxidation deficiency on food intake in Acads-/- mice.We performed a transcriptional analysis of gene expression in brain tissue of Acads-/- and Acads+/+ mice fed either a high-fat (HF or low-fat (LF diet for 2 d. Ingenuity Pathway Analysis revealed three top-scoring pathways significantly modified by genotype or diet: oxidative phosphorylation, mitochondrial dysfunction, and CREB signaling in neurons. A comparison of statistically significant responses in HF Acads-/- vs. HF Acads+/+ (3917 and Acads+/+ HF vs. LF Acads+/+ (3879 revealed 2551 genes or approximately 65% in common between the two experimental comparisons. All but one of these genes were expressed in opposite direction with similar magnitude, demonstrating that HF-fed Acads-deficient mice display transcriptional responses that strongly resemble those of Acads+/+ mice fed LF diet. Intriguingly, genes involved in both AMP-kinase regulation and the neural control of food intake followed this pattern. Quantitative RT-PCR in hypothalamus confirmed the dysregulation of genes in these pathways. Western blotting showed an increase in hypothalamic AMP-kinase in Acads-/- mice and HF diet increased, a key protein in an energy-sensing cascade that responds to depletion of ATP.Our results suggest that the decreased beta-oxidation of short-chain fatty acids in Acads-deficient mice fed HF diet produces a state of energy deficiency in the brain and that AMP-kinase may be the cellular energy
Directory of Open Access Journals (Sweden)
Aquino-Ferreira Roseli
2010-02-01
Full Text Available Abstract Background Cutaneous mycoses are common human infections among healthy and immunocompromised hosts, and the anthropophilic fungus Trichophyton rubrum is the most prevalent microorganism isolated from such clinical cases worldwide. The aim of this study was to determine the transcriptional profile of T. rubrum exposed to various stimuli in order to obtain insights into the responses of this pathogen to different environmental challenges. Therefore, we generated an expressed sequence tag (EST collection by constructing one cDNA library and nine suppression subtractive hybridization libraries. Results The 1388 unigenes identified in this study were functionally classified based on the Munich Information Center for Protein Sequences (MIPS categories. The identified proteins were involved in transcriptional regulation, cellular defense and stress, protein degradation, signaling, transport, and secretion, among other functions. Analysis of these unigenes revealed 575 T. rubrum sequences that had not been previously deposited in public databases. Conclusion In this study, we identified novel T. rubrum genes that will be useful for ORF prediction in genome sequencing and facilitating functional genome analysis. Annotation of these expressed genes revealed metabolic adaptations of T. rubrum to carbon sources, ambient pH shifts, and various antifungal drugs used in medical practice. Furthermore, challenging T. rubrum with cytotoxic drugs and ambient pH shifts extended our understanding of the molecular events possibly involved in the infectious process and resistance to antifungal drugs.
Directory of Open Access Journals (Sweden)
Ouyang Shu
2005-09-01
Full Text Available Abstract Background The Solanaceae is a family of closely related species with diverse phenotypes that have been exploited for agronomic purposes. Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae. The availability of large collections of Expressed Sequence Tags (ESTs for the Solanaceae now provides the opportunity to assess sequence conservation and divergence on a genomic scale. Results All available ESTs and Expressed Transcripts (ETs, 449,224 sequences for six Solanaceae species (potato, tomato, pepper, petunia, tobacco and Nicotiana benthamiana, were clustered and assembled into gene indices. Examination of gene ontologies revealed that the transcripts within the gene indices encode a similar suite of biological processes. Although the ESTs and ETs were derived from a variety of tissues, 55–81% of the sequences had significant similarity at the nucleotide level with sequences among the six species. Putative orthologs could be identified for 28–58% of the sequences. This high degree of sequence conservation was supported by expression profiling using heterologous hybridizations to potato cDNA arrays that showed similar expression patterns in mature leaves for all six solanaceous species. 16–19% of the transcripts within the six Solanaceae gene indices did not have matches among Solanaceae, Arabidopsis, rice or 21 other plant gene indices. Conclusion Results from this genome scale analysis confirmed a high level of sequence conservation at the nucleotide level of the coding sequence among Solanaceae. Additionally, the results indicated that part of the Solanaceae transcriptome is likely to be unique for each species.
Meeting the challenge : capturing the upstream
International Nuclear Information System (INIS)
Bogle, E.W.
1998-01-01
The challenge facing the exploration and production sector of the petroleum industry to capture and hold onto the upstream was the main focus of this paper. The exploration and production (E and P) business was described as being highly complex, characterized by constant change and increasing competition. Some of the dynamic changes which have occurred in the Western Canada Basin (WCB) during the last five years and how they relate to the international playing field were reviewed. Significant changes to the production ranking profile as a result of acquisitions, and basin reserve endowment and maturity are the two major factors affecting current and future dynamics of upstream WCB E and P activity. Competitive pressures, contractor relationships, infrastructure access and controls, environmental issues are some of the other factors. Taking these factors into account, Talisman Energy Inc. has used its growth in the WCB to leverage its international activities, diversifying to less mature, but proven hydrocarbon basins. The company's international exploration strategy is designed to be adaptive and flexible and is guided by focus on a limited number of core areas with proven source rock and existing production, achievement of a set production level within a five-year time frame, ensuring strong relationships with host governments and partners, and selecting areas where a multiple of opportunity types are available. In general, for any upstream company it is important to recognize that the more predictable traditional order has given way to a market-driven environment where the rules change almost daily, and success depends on the ability to adapt to change.14 figs
International Nuclear Information System (INIS)
Das, Debanu; Grishin, Nick V.; Kumar, Abhinav; Carlton, Dennis; Bakolitsa, Constantina; Miller, Mitchell D.; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Burra, Prasad; Chen, Connie; Chiu, Hsiu-Ju; Chiu, Michelle; Clayton, Thomas; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grzechnik, Anna; Grzechnik, Slawomir K.; Grant, Joanna C.; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Johnson, Hope A.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Marciano, David; McMullan, Daniel; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; Bedem, Henry van den; Weekes, Dana; Wooten, Tiffany; Xu, Qingping; Hodgson, Keith O.; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.
2009-01-01
The crystal structure of the NGO1945 gene product from N. gonorrhoeae (UniProt Q5F5IO) reveals that the N-terminal domain assigned as a domain of unknown function (DUF2063) is likely to bind DNA and that the protein may be involved in transcriptional regulation. Proteins with the DUF2063 domain constitute a new Pfam family, PF09836. The crystal structure of a member of this family, NGO1945 from Neisseria gonorrhoeae, has been determined and reveals that the N-terminal DUF2063 domain is likely to be a DNA-binding domain. In conjunction with the rest of the protein, NGO1945 is likely to be involved in transcriptional regulation, which is consistent with genomic neighborhood analysis. Of the 216 currently known proteins that contain a DUF2063 domain, the most significant sequence homologs of NGO1945 (∼40–99% sequence identity) are from various Neisseria and Haemophilus species. As these are important human pathogens, NGO1945 represents an interesting candidate for further exploration via biochemical studies and possible therapeutic intervention
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-07-27
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Dorcas J Orengo
Full Text Available The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO. We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription.
Chancey, Scott T; Bai, Xianhe; Kumar, Nikhil; Drabek, Elliott F; Daugherty, Sean C; Colon, Thomas; Ott, Sandra; Sengamalay, Naomi; Sadzewicz, Lisa; Tallon, Luke J; Fraser, Claire M; Tettelin, Hervé; Stephens, David S
2015-01-01
Macrolide resistance, emerging in Streptococcus pneumoniae and other Gram-positive bacteria, is increasingly due to efflux pumps encoded by mef/mel(msr) operons found on discrete mobile genetic elements. The regulation of mef/mel(msr) in these elements is not well understood. We identified the mef(E)/mel transcriptional start, localized the mef(E)/mel promoter, and demonstrated attenuation of transcription as a mechanism of regulation of macrolide-inducible mef-mediated macrolide resistance in S. pneumoniae. The mef(E)/mel transcriptional start site was a guanine 327 bp upstream of mef(E). Consensus pneumococcal promoter -10 (5'-TATACT-3') and -35 (5'-TTGAAC-3') boxes separated by 17 bp were identified 7 bp upstream of the start site. Analysis of the predicted secondary structure of the 327 5' region identified four pairs of inverted repeats R1-R8 predicted to fold into stem-loops, a small leader peptide [MTASMRLR, (Mef(E)L)] required for macrolide induction and a Rho-independent transcription terminator. RNA-seq analyses provided confirmation of transcriptional attenuation. In addition, expression of mef(E)L was also influenced by mef(E)L-dependent mRNA stability. The regulatory region 5' of mef(E) was highly conserved in other mef/mel(msr)-containing elements including Tn1207.1 and the 5612IQ complex in pneumococci and Tn1207.3 in Group A streptococci, indicating a regulatory mechanism common to a wide variety of Gram-positive bacteria containing mef/mel(msr) elements.
Upstream particles observed in the earth's foreshock region
International Nuclear Information System (INIS)
Eastman, T.E.; Anderson, R.R.; Frank, L.A.; Parks, G.K.
1981-01-01
On the basis of primarily an extensive study of fully three-dimensional plasma data, we describe the interrelationships of the upstream particles and plasma waves observed in the earth's foreshock region. The University of Iowa LEPEDEAs detect ions and electrons from 1 eV to 45 keV over all except approx.2% of the unit sphere. Comparisons are made with high time resolution particle data obtained by the University of California (Berkeley) instruments and plasma wave data collected by the University of Iowa plasma wave instruments on the two ISEE spacecraft. The presence of ion beams or dispersed ion distributions is found to be a sufficient condition for the presence of electrostatic and electromagnetic wave emissions. Detailed correlations of ions with plasma waves down to a tenth of an ion gyroperiod indicate that ion acoustic emission is enhanced when increased anisotropies and gyrophase organization are observed. Time aliasing effects limit the interpretation of velocity distributions taken within the foreshock region. High time resolution correlations between the different instruments, however, demonstrate that time variations of a single isotropic or anisotropic distribution cannot produce the dispersed ion distributions. Detailed analysis of high time resolution data reveals that the upstream particles undergo significant spatial and temporal variations including gyrophase organization. Gyrophase organization comprises groups of ion clusters each one of which includes ions with similar pitch angles that gyrate together about a common guiding center. On the basis of our high time resolution analysis of three-dimensional plasma data combined with magnetic field and plasma wave data, we conclude that (1) ions observed in the foreshock region display gyrophase organization produced by ion clusters with a spatial scale <1 R/sub g/, and (2) dispersed ion distributions are produced primarily by direct sources at or near the bow shock
Huang, Yuan-Dong; He, Wen-Rong; Kim, Chang-Nyung
2015-02-01
A two-dimensional numerical model for simulating flow and pollutant dispersion in an urban street canyon is firstly developed using the FLUENT code and then validated against the wind tunnel results. After this, the flow field and pollutant dispersion inside an urban street canyon with aspect ratio W/H = 1 are examined numerically considering five different shapes (vaulted, trapezoidal, slanted, upward wedged, and downward wedged roofs) as well as three different roof height to building height ratios (Z H /H = 1/6, 1/3, and 1/2) for the upstream building roof. The results obtained reveal that the shape and height of an upstream roof have significant influences on flow pattern and pollutant distribution in an urban canyon. A large single clockwise vortex is generated in the canyon for the vaulted upstream roof at Z H /H = 1/6, 1/3, and 1/2, the trapezoidal and downward wedged roofs at Z H /H = 1/6 and 1/3, and the slanted and upward wedged roofs at Z H /H = 1/6, while a main clockwise vortex and a secondary counterclockwise vortex are established for the trapezoidal and downward wedged roofs at Z H /H = 1/2 and the slanted and upward wedged roofs at Z H /H = 1/3 and 1/2. In the one-vortex flow regime, the clockwise vortex moves upward and grows in size with increasing upstream roof height for the vaulted, trapezoidal, and downward wedged roofs. In the two-vortex flow regime, the size and rotational velocity of both upper clockwise and lower counterclockwise vortices increase with the upstream roof height for the slanted and upward wedged roofs. At Z H /H = 1/6, the pollution levels in the canyon are close among all the upstream roof shapes studied. At Z H /H = 1/3, the pollution levels in the canyon for the upward wedged roof and slanted roof are much higher than those for the vaulted, trapezoidal, and downward wedged roofs. At Z H /H = 1/2, the lowest pollution level appears in the canyon for the vaulted upstream roof, while
Spatial distribution of upstream magnetospheric ≥50 keV ions
Directory of Open Access Journals (Sweden)
G. C. Anagnostopoulos
2000-01-01
Full Text Available We present for the first time a statistical study of \\geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks
Spatial distribution of upstream magnetospheric ≥50 keV ions
Directory of Open Access Journals (Sweden)
G. Kaliabetsos
Full Text Available We present for the first time a statistical study of geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks
Coevolution within a transcriptional network by compensatory trans and cis mutations
Kuo, D.
2010-10-26
Transcriptional networks have been shown to evolve very rapidly, prompting questions as to how such changes arise and are tolerated. Recent comparisons of transcriptional networks across species have implicated variations in the cis-acting DNA sequences near genes as the main cause of divergence. What is less clear is how these changes interact with trans-acting changes occurring elsewhere in the genetic circuit. Here, we report the discovery of a system of compensatory trans and cis mutations in the yeast AP-1 transcriptional network that allows for conserved transcriptional regulation despite continued genetic change. We pinpoint a single species, the fungal pathogen Candida glabrata, in which a trans mutation has occurred very recently in a single AP-1 family member, distinguishing it from its Saccharomyces ortholog. Comparison of chromatin immunoprecipitation profiles between Candida and Saccharomyces shows that, despite their different DNA-binding domains, the AP-1 orthologs regulate a conserved block of genes. This conservation is enabled by concomitant changes in the cis-regulatory motifs upstream of each gene. Thus, both trans and cis mutations have perturbed the yeast AP-1 regulatory system in such a way as to compensate for one another. This demonstrates an example of “coevolution” between a DNA-binding transcription factor and its cis-regulatory site, reminiscent of the coevolution of protein binding partners.
Structural basis for the initiation of eukaryotic transcription-coupled DNA repair.
Xu, Jun; Lahiri, Indrajit; Wang, Wei; Wier, Adam; Cianfrocco, Michael A; Chong, Jenny; Hare, Alissa A; Dervan, Peter B; DiMaio, Frank; Leschziner, Andres E; Wang, Dong
2017-11-30
Eukaryotic transcription-coupled repair (TCR) is an important and well-conserved sub-pathway of nucleotide excision repair that preferentially removes DNA lesions from the template strand that block translocation of RNA polymerase II (Pol II). Cockayne syndrome group B (CSB, also known as ERCC6) protein in humans (or its yeast orthologues, Rad26 in Saccharomyces cerevisiae and Rhp26 in Schizosaccharomyces pombe) is among the first proteins to be recruited to the lesion-arrested Pol II during the initiation of eukaryotic TCR. Mutations in CSB are associated with the autosomal-recessive neurological disorder Cockayne syndrome, which is characterized by progeriod features, growth failure and photosensitivity. The molecular mechanism of eukaryotic TCR initiation remains unclear, with several long-standing unanswered questions. How cells distinguish DNA lesion-arrested Pol II from other forms of arrested Pol II, the role of CSB in TCR initiation, and how CSB interacts with the arrested Pol II complex are all unknown. The lack of structures of CSB or the Pol II-CSB complex has hindered our ability to address these questions. Here we report the structure of the S. cerevisiae Pol II-Rad26 complex solved by cryo-electron microscopy. The structure reveals that Rad26 binds to the DNA upstream of Pol II, where it markedly alters its path. Our structural and functional data suggest that the conserved Swi2/Snf2-family core ATPase domain promotes the forward movement of Pol II, and elucidate key roles for Rad26 in both TCR and transcription elongation.
Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela
2015-12-01
Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu
2006-01-01
RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use
Coral-inferred Variability of Upstream Kuroshio Current from 1953-2004 AD
Li, X.; Yi, L.; Shen, C. C.; Hsin, Y. C.
2016-12-01
The Kuroshio Current (KC), one of the most important western boundary currents in the North Pacific Ocean, strongly impacts regional climate in East Asia and upper-ocean thermal structure. However, the responses of KC to regional and remote climate forcing are poorly understood owing to lacking of long-term KC observations. Here, we present a sea surface temperature (SST) record from 1953 to 2004 AD derived from monthly skeletal δ18O data of a living coral Porites core, drilled in Nanwan, southern Taiwan (22°N, 121°E), located on the western front of the Upstream KC. The increased/reduced Kuroshio transport would generate stronger/weaker upwelling in Southern Taiwan, which can cause lower/higher SST. Agreement between dynamics of interannual coral δ18O and modern KC data shows that the regional coral δ18O can be used as a promising proxy for Upstream KC intensity. The KC-induced SST anomaly record reveals prominent interannual and decadal variability predominantly controlled by the bifurcation latitude of North Equatorial Current. We also find that the reconstructed KC intensity at east of Taiwan and south of Japan have nearly simultaneous interannual changes, suggesting the same dominant forcing(s) for the entire KC system. Additional work is needed to understand the KC system with respect to the interannual to decadal climate variability and the influences of global warming.
Complexity of CNC transcription factors as revealed by gene targeting of the Nrf3 locus.
Derjuga, Anna; Gourley, Tania S; Holm, Teresa M; Heng, Henry H Q; Shivdasani, Ramesh A; Ahmed, Rafi; Andrews, Nancy C; Blank, Volker
2004-04-01
Cap'n'collar (CNC) family basic leucine zipper transcription factors play crucial roles in the regulation of mammalian gene expression and development. To determine the in vivo function of the CNC protein Nrf3 (NF-E2-related factor 3), we generated mice deficient in this transcription factor. We performed targeted disruption of two Nrf3 exons coding for CNC homology, basic DNA-binding, and leucine zipper dimerization domains. Nrf3 null mice developed normally and revealed no obvious phenotypic differences compared to wild-type animals. Nrf3(-/-) mice were fertile, and gross anatomy as well as behavior appeared normal. The mice showed normal age progression and did not show any apparent additional phenotype during their life span. We observed no differences in various blood parameters and chemistry values. We infected wild-type and Nrf3(-/-) mice with acute lymphocytic choriomeningitis virus and found no differences in these animals with respect to their number of virus-specific CD8 and CD4 T cells as well as their B-lymphocyte response. To determine whether the mild phenotype of Nrf3 null animals is due to functional redundancy, we generated mice deficient in multiple CNC factors. Contrary to our expectations, an absence of Nrf3 does not seem to cause additional lethality in compound Nrf3(-/-)/Nrf2(-/-) and Nrf3(-/-)/p45(-/-) mice. We hypothesize that the role of Nrf3 in vivo may become apparent only after appropriate challenge to the mice.
Artuso, Marina
2016-01-01
The detector for the LHCb upgrade is designed for 40MHz readout, allowing the experiment to run at an instantaneous luminosity of 2x10^33 cm$^2$s$^-1$. The upgrade of the tracker subsystem in front of the dipole magnet, the Upstream Tracker, is crucial for charged track reconstruction and fast trigger decisions based on a tracking algorithm involving also vertex detector information. The detector consists of 4 planes with a total area of about 8.5m$^2$, made of single sided silicon strip sensors read-out by a novel custom-made ASIC (SALT). Details on the performance of prototype sensors, front-end electronics, near-detector electronics and mechanical components are presented.
Inventories and upstream gasoline price dynamics
Kuper, Gerard H.
This paper sheds new light on the asymmetric dynamics in upstream U.S. gasoline prices. The model is based on Pindyck's inventory model of commodity price dynamics. We show that asymmetry in gasoline price dynamics is caused by changes in the net marginal convenience yield: higher costs of marketing
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Upstream-downstream cooperation approach in Guanting Reservoir watershed.
Yang, Zhi-Feng; Zhang, Wen-Guo
2005-01-01
A case study is introduced and discussed concerning water dispute of misuse and pollution between up- and down-stream parts. The relations between water usage and local industrial structures are analyzed. Results show it is important to change industrial structures of the target region along with controlling water pollution by technical and engineering methods. Three manners of upstream-downstream cooperation are presented and discussed based on the actual conditions of Guangting Reservoir watershed. Two typical scenarios are supposed and studied along with the local plan on water resources development. The best solution for this cooperation presents a good way to help the upstream developing in a new pattern of eco-economy.
Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens
2017-01-01
Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators.
Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya
2014-01-01
Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301
Directory of Open Access Journals (Sweden)
Amanda Pfaff Smith
2003-01-01
Full Text Available Atypical nevi are the precursors and risk markers of melanoma. Apart from persistently monitoring these nevocytic lesions and resecting them at the earliest signs of clinical changes, there is as yet no systemic clinical treatment available to interfere with their progression to melanoma. To explore clinical treatments that might interfere with and possibly prevent atypical nevus progression, a previous study documented that 3 months systemic low-dose interferon-α (IFN-α treatment of patients with a clinical history of melanoma and numerous atypical nevi, led to inactivation of the STAT1 and STAT3 transcription factors in atypical nevi. Based upon this finding, we initiated a second study to determine whether systemic low-dose IFN-α treatment also impairs the expression of upstream regulators and downstream targets of STAT1 and STAT3 in atypical nevi. Using cyanine dye-conjugated antibodies, fluorescence imaging analysis revealed expression of JAK2, JNK1, AKT1, NF-κB, and IFN-αβ receptor in benign and atypical nevi, and early- and advanced-stage melanomas. To determine possible changes in the level of expression of these molecules in atypical nevi, excised before and after 3 months of systemic low-dose IFN-α treatment, newly designed optical imaging software was used to quantitate the captured fluorescent hybridization signals on a cell-by-cell basis and across an entire nevus section. The results of this analysis did not provide evidence that systemic low-dose IFN-α treatment alters the level of expression of upstream regulators or downstream targets of STAT1 and STAT3.
High-resolution structure of TBP with TAF1 reveals anchoring patterns in transcriptional regulation.
Anandapadamanaban, Madhanagopal; Andresen, Cecilia; Helander, Sara; Ohyama, Yoshifumi; Siponen, Marina I; Lundström, Patrik; Kokubo, Tetsuro; Ikura, Mitsuhiko; Moche, Martin; Sunnerhagen, Maria
2013-08-01
The general transcription factor TFIID provides a regulatory platform for transcription initiation. Here we present the crystal structure (1.97 Å) and NMR analysis of yeast TAF1 N-terminal domains TAND1 and TAND2 bound to yeast TBP, together with mutational data. We find that yeast TAF1-TAND1, which in itself acts as a transcriptional activator, binds TBP's concave DNA-binding surface by presenting similar anchor residues to TBP as does Mot1 but from a distinct structural scaffold. Furthermore, we show how TAF1-TAND2 uses an aromatic and acidic anchoring pattern to bind a conserved TBP surface groove traversing the basic helix region, and we find highly similar TBP-binding motifs also presented by the structurally distinct TFIIA, Mot1 and Brf1 proteins. Our identification of these anchoring patterns, which can be easily disrupted or enhanced, provides insight into the competitive multiprotein TBP interplay critical to transcriptional regulation.
Ions upstream of the earth's bow shock: a theoretical comparison of alternative source populations
International Nuclear Information System (INIS)
Schwartz, S.J.; Thomsen, M.F.; Gosling, J.T.
1983-01-01
A theoretical framework is developed for studying trajectories of ions reflected or leaked upstream from the earth's bow shock and subject solely to the Lorentz force in a steady interplanetary magnetic field B and the V x B electric field. We include the effects of a sharp shock potential rise. Expressions are derived for the guiding center motion and gyromotion in a frame (the Hoffman-Teller frame) moving parallel to the shock surface with sufficient speed to transform the incident solar wind velocity into motion entirely along the interplanetary magnetic field: the appropriate equations are also provided to transform these motions back to the observer's frame. The utility of these expressions is illustrated by comparing the predicted upstream motions for four different source models for upstream ions: magnetic moment-conserving reflection of the solar wind ions, specular reflection of solar wind ions, magnetic moment-conserving leakage of magnetosheath ions, and leakage of magnetosheath ions parallel to the shock normal. This comparison reveals that, for identical geometries, the reflection models produce higher energies and/or gyromotion than do the leakage models. We further argue that in a single simple encounter with the shock, an ion should behave in an unmagnetized manner and hence should not conserve its magnetic moment. Conservation of magnetic moment, if it is to occur, would seem to require multiple encounters with the shock. We investigate the conditions under which such multiple encounters can occur and find that under most quasi-parallel geometries neither leaked nor reflected ions should probably conserve their magnetic moments
DEFF Research Database (Denmark)
Xu, Liang; Plouffe, Steven W; Chong, Jenny
2013-01-01
Transcription unlocked: A synthetic chemical biology approach involving unlocked nucleic acids was used to dissect the contribution of sugar backbone integrity to the RNA Polymerase II (Pol II) transcription process. An unexpected dominant role for sugar-ring integrity in Pol II transcriptional...
Roach, Melissa; Arrivault, Stéphanie; Mahboubi, Amir; Krohn, Nicole; Sulpice, Ronan; Stitt, Mark; Niittylä, Totte
2017-06-15
The contribution of transcriptional and post-transcriptional regulation to modifying carbon allocation to developing wood of trees is not well defined. To clarify the role of transcriptional regulation, the enzyme activity patterns of eight central primary metabolism enzymes across phloem, cambium, and developing wood of aspen (Populus tremula L.) were compared with transcript levels obtained by RNA sequencing of sequential stem sections from the same trees. Enzymes were selected on the basis of their importance in sugar metabolism and in linking primary metabolism to lignin biosynthesis. Existing enzyme assays were adapted to allow measurements from ~1 mm3 sections of dissected stem tissue. These experiments provided high spatial resolution of enzyme activity changes across different stages of wood development, and identified the gene transcripts probably responsible for these changes. In most cases, there was a clear positive relationship between transcripts and enzyme activity. During secondary cell wall formation, the increases in transcript levels and enzyme activities also matched with increased levels of glucose, fructose, hexose phosphates, and UDP-glucose, emphasizing an important role for transcriptional regulation in carbon allocation to developing aspen wood. These observations corroborate the efforts to increase carbon allocation to wood by engineering gene regulatory networks. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Directory of Open Access Journals (Sweden)
Yang eHu
2015-09-01
Full Text Available Heat shock transcription factors (Hsfs are known to play dominant roles in plant responses to heat, as well as other abiotic or biotic stress stimuli. While the strawberry is an economically important fruit plant, little is known about the Hsf family in the strawberry. To explore the functions of strawberry Hsfs in abiotic and biotic stress responses, this study identified 17 Hsf genes (FvHsfs in a wild diploid woodland strawberry (Fragaria vesca, 2n = 2x = 14 and isolated 14 of these genes. Phylogenetic analysis divided the strawberry FvHsfs genes into three main groups. The evolutionary and structural analyses revealed that the FvHsf family is conserved. The promoter sequences of the FvHsf genes contain upstream regulatory elements corresponding to different stress stimuli. In addition, 14 FvHsf-GFP fusion proteins showed differential subcellular localization in Arabidopsis mesophyll protoplasts. Furthermore, we examined the expression of the 17 FvHsf genes in wild diploid woodland strawberries under various conditions, including abiotic stresses (heat, cold, drought, and salt, biotic stress (powdery mildew infection, and hormone treatments (abscisic acid, ethephon, methyl jasmonate, and salicylic acid. Fifteen of the 17 FvHsf genes exhibited distinct changes on the transcriptional level during heat treatment. Of these 15 FvHsfs, 8 FvHsfs also exhibited distinct responses to other stimuli on the transcriptional level, indicating versatile roles in the response to abiotic and biotic stresses. Taken together, the present work may provide the basis for further studies to dissect FvHsf function in response to stress stimuli.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Transcriptional activation of Mina by Sp1/3 factors.
Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark
2013-01-01
Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.
Foyer, Christine H; Verrall, Susan R; Hancock, Robert D
2015-02-01
Phloem-feeding insects (PFIs), of which aphids are the largest group, are major agricultural pests causing extensive damage to crop plants. In contrast to chewing insects, the nature of the plant response to PFIs remains poorly characterized. Scrutiny of the literature concerning transcriptional responses of model and crop plant species to PFIs reveals surprisingly little consensus with respect to the transcripts showing altered abundance following infestation. Nevertheless, core features of the transcriptional response to PFIs can be defined in Arabidopsis thaliana. This comparison of the PFI-associated transcriptional response observed in A. thaliana infested by the generalists Myzus persicae and Bemisia tabaci with the specialist Brevicoryne brassicae highlights the importance of calcium-dependent and receptor kinase-associated signalling. We discuss these findings within the context of the complex cross-talk between the different hormones regulating basal immune response mechanisms in plants. We identify PFI-responsive genes, highlighting the importance of cell wall-associated kinases in plant-PFI interactions, as well as the significant role of kinases containing the domain of unknown function 26. A common feature of plant-PFI interaction is enhanced abundance of transcripts encoding WRKY transcription factors. However, significant divergence was observed with respect to secondary metabolism dependent upon the insect attacker. Transcripts encoding enzymes and proteins associated with glucosinolate metabolism were decreased following attack by the generalist M. persicae but not by the specialist B. brassicae. This analysis provides a comprehensive overview of the molecular patterns associated with the plant response to PFIs and suggests that plants recognize and respond to perturbations in the cell wall occurring during PFI infestation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights
DEFF Research Database (Denmark)
Pedersen, Lotte Bang; Murray, T; Popham, D L
1998-01-01
The pbp gene (renamed dacC), identified by the Bacillus subtilis genome sequencing project, encodes a putative 491-residue protein with sequence homology to low-molecular-weight penicillin-binding proteins. Use of a transcriptional dacC-lacZ fusion revealed that dacC expression (i) is initiated...... at the end of stationary phase; (ii) depends strongly on transcription factor sigmaH; and (iii) appears to be initiated from a promoter located immediately upstream of yoxA, a gene of unknown function located upstream of dacC on the B. subtilis chromosome. A B. subtilis dacC insertional mutant grew...
Detecting novel low-abundant transcripts in Drosophila
DEFF Research Database (Denmark)
Lee, Sanggyu; Bao, Jingyue; Zhou, Guolin
2005-01-01
Increasing evidence suggests that low-abundant transcripts may play fundamental roles in biological processes. In an attempt to estimate the prevalence of low-abundant transcripts in eukaryotic genomes, we performed a transcriptome analysis in Drosophila using the SAGE technique. We collected 244......,313 SAGE tags from transcripts expressed in Drosophila embryonic, larval, pupae, adult, and testicular tissue. From these SAGE tags, we identified 40,823 unique SAGE tags. Our analysis showed that 55% of the 40,823 unique SAGE tags are novel without matches in currently known Drosophila transcripts...... in the Drosophila genome. Our study reveals the presence of a significant number of novel low-abundant transcripts in Drosophila, and highlights the need to isolate these novel low-abundant transcripts for further biological studies. Udgivelsesdato: 2005-Jun...
Russian upstream joint ventures logging progress
International Nuclear Information System (INIS)
Anon.
1992-01-01
This paper reports that Occidental Petroleum Corp. has begun exporting oil from Russia as part of an enhanced recovery joint venture in western Siberia. Oxy holds a 50% interest in the joint venture company, Vanyoganneft, and will market the oil. In other activity, two Canadian companies are marking progress with Russian upstream joint ventures
Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W
1989-01-01
A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and...
Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W; Grubert, Fabian; Candille, Sophie I; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L; Tang, Hua; Ricci, Emiliano; Snyder, Michael P
2015-11-01
Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy--many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. © 2015 Cenik et al.; Published by Cold Spring Harbor Laboratory Press.
Mizutani, Tetsuya; Ju, Yunfeng; Imamichi, Yoshitaka; Osaki, Tsukasa; Yazawa, Takashi; Kawabe, Shinya; Ishikane, Shin; Matsumura, Takehiro; Kanno, Masafumi; Kamiki, Yasue; Kimura, Kohei; Minamino, Naoto; Miyamoto, Kaoru
2014-06-15
The transcription factor SF-1 (steroidogenic factor-1) is a master regulator of steroidogenesis. Previously, we have found that SF-1 induces the differentiation of mesenchymal stem cells into steroidogenic cells. To elucidate the molecular mechanisms of SF-1-mediated functions, we attempted to identify protein components of the SF-1 nuclear protein complex in differentiated cells. SF-1 immunoaffinity chromatography followed by MS/MS analysis was performed, and 24 proteins were identified. Among these proteins, we focused on C/EBPβ (CCAAT/enhancer-binding protein β), which is an essential transcription factor for ovulation and luteinization, as the transcriptional mechanisms of C/EBPβ working together with SF-1 are poorly understood. C/EBPβ knockdown attenuated cAMP-induced progesterone production in granulosa tumour-derived KGN cells by altering STAR (steroidogenic acute regulatory protein), CYP11A1 (cytochrome P450, family 11, subfamily A, polypeptide 1) and HSD3B2 (hydroxy-δ-5-steroid dehydrogenase, 3β- and steroid δ-isomerase 2) expression. EMSA and ChIP assays revealed novel C/EBPβ-binding sites in the upstream regions of the HSD3B2 and CYP11A1 genes. These interactions were enhanced by cAMP stimulation. Luciferase assays showed that C/EBPβ-responsive regions were found in each promoter and C/EBPβ is involved in the cAMP-induced transcriptional activity of these genes together with SF-1. These results indicate that C/EBPβ is an important mediator of progesterone production by working together with SF-1, especially under tropic hormone-stimulated conditions.
Grade, Marian; Hörmann, Patrick; Becker, Sandra; Hummon, Amanda B.; Wangsa, Danny; Varma, Sudhir; Simon, Richard; Liersch, Torsten; Becker, Heinz; Difilippantonio, Michael J.; Ghadimi, B. Michael; Ried, Thomas
2016-01-01
To characterize patterns of global transcriptional deregulation in primary colon carcinomas, we did gene expression profiling of 73 tumors [Unio Internationale Contra Cancrum stage II (n = 33) and stage III (n = 40)] using oligonucleotide microarrays. For 30 of the tumors, expression profiles were compared with those from matched normal mucosa samples. We identified a set of 1,950 genes with highly significant deregulation between tumors and mucosa samples (P 5-fold average expression difference between normal colon mucosa and carcinomas, including up-regulation of MYC and of HMGA1, a putative oncogene. Furthermore, we identified 68 genes that were significantly differentially expressed between lymph node–negative and lymph node–positive tumors (P deregulated genes were validated using quantitative real-time reverse transcription-PCR in >40 tumor and normal mucosa samples with good concordance between the techniques. Finally, we established a relationship between specific genomic imbalances, which were mapped for 32 of the analyzed colon tumors by comparative genomic hybridization, and alterations of global transcriptional activity. Previously, we had conducted a similar analysis of primary rectal carcinomas. The systematic comparison of colon and rectal carcinomas revealed a significant overlap of genomic imbalances and transcriptional deregulation, including activation of the Wnt/β-catenin signaling cascade, suggesting similar pathogenic pathways. PMID:17210682
Rim, Jong S; Kozak, Leslie P
2002-09-13
Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.
Directory of Open Access Journals (Sweden)
Nils Klüver
Full Text Available Acetylcholinesterase (AChE inhibitors are widely used as pesticides and drugs. Their primary effect is the overstimulation of cholinergic receptors which results in an improper muscular function. During vertebrate embryonic development nerve activity and intracellular downstream events are critical for the regulation of muscle fiber formation. Whether AChE inhibitors and related neurotoxic compounds also provoke specific changes in gene transcription patterns during vertebrate development that allow them to establish a mechanistic link useful for identification of developmental toxicity pathways has, however, yet not been investigated. Therefore we examined the transcriptomic response of a known AChE inhibitor, the organophosphate azinphos-methyl (APM, in zebrafish embryos and compared the response with two non-AChE inhibiting unspecific control compounds, 1,4-dimethoxybenzene (DMB and 2,4-dinitrophenol (DNP. A highly specific cluster of APM induced gene transcripts was identified and a subset of strongly regulated genes was analyzed in more detail. The small heat shock protein hspb11 was found to be the most sensitive induced gene in response to AChE inhibitors. Comparison of expression in wildtype, ache and sop(fixe mutant embryos revealed that hspb11 expression was dependent on the nicotinic acetylcholine receptor (nAChR activity. Furthermore, modulators of intracellular calcium levels within the whole embryo led to a transcriptional up-regulation of hspb11 which suggests that elevated intracellular calcium levels may regulate the expression of this gene. During early zebrafish development, hspb11 was specifically expressed in muscle pioneer cells and Hspb11 morpholino-knockdown resulted in effects on slow muscle myosin organization. Our findings imply that a comparative toxicogenomic approach and functional analysis can lead to the identification of molecular mechanisms and specific marker genes for potential neurotoxic compounds.
Transcriptional networks and chromatin remodeling controlling adipogenesis
DEFF Research Database (Denmark)
Siersbæk, Rasmus; Nielsen, Ronni; Mandrup, Susanne
2012-01-01
Adipocyte differentiation is tightly controlled by a transcriptional cascade, which directs the extensive reprogramming of gene expression required to convert fibroblast-like precursor cells into mature lipid-laden adipocytes. Recent global analyses of transcription factor binding and chromatin...... remodeling have revealed 'snapshots' of this cascade and the chromatin landscape at specific time-points of differentiation. These studies demonstrate that multiple adipogenic transcription factors co-occupy hotspots characterized by an open chromatin structure and specific epigenetic modifications....... Such transcription factor hotspots are likely to represent key signaling nodes which integrate multiple adipogenic signals at specific chromatin sites, thereby facilitating coordinated action on gene expression....
On-line soft sensing in upstream bioprocessing.
Randek, Judit; Mandenius, Carl-Fredrik
2018-02-01
This review provides an overview and a critical discussion of novel possibilities of applying soft sensors for on-line monitoring and control of industrial bioprocesses. Focus is on bio-product formation in the upstream process but also the integration with other parts of the process is addressed. The term soft sensor is used for the combination of analytical hardware data (from sensors, analytical devices, instruments and actuators) with mathematical models that create new real-time information about the process. In particular, the review assesses these possibilities from an industrial perspective, including sensor performance, information value and production economy. The capabilities of existing analytical on-line techniques are scrutinized in view of their usefulness in soft sensor setups and in relation to typical needs in bioprocessing in general. The review concludes with specific recommendations for further development of soft sensors for the monitoring and control of upstream bioprocessing.
Pattison, Jillian M.; Posternak, Valeriya; Cole, Michael D.
2016-01-01
It is well established that environmental toxins, such as exposure to arsenic, are risk factors in the development of urinary bladder cancer, yet recent genome-wide association studies (GWAS) provide compelling evidence that there is a strong genetic component associated with disease predisposition. A single nucleotide polymorphism (SNP), rs8102137, was identified on chromosome 19q12, residing 6 kb upstream of the important cell cycle regulator and proto-oncogene, Cyclin E1 (CCNE1). However, the functional role of this variant in bladder cancer predisposition has been unclear since it lies within a non-coding region of the genome. Here, it is demonstrated that bladder cancer cells heterozygous for this SNP exhibit biased allelic expression of CCNE1 with 1.5-fold more transcription occurring from the risk allele. Furthermore, using chromatin immunoprecipitation assays, a novel enhancer element was identified within the first intron of CCNE1 that binds Kruppel-like Factor 5 (KLF5), a known transcriptional activator in bladder cancer. Moreover, the data reveal that the presence of rs200996365, a SNP in high linkage disequilibrium with rs8102137 residing in the center of a KLF5 motif, alters KLF5 binding to this genomic region. Through luciferase assays and CRISPR-Cas9 genome editing, a novel polymorphic intronic regulatory element controlling CCNE1 transcription is characterized. These studies uncover how a cancer-associated polymorphism mechanistically contributes to an increased predisposition for bladder cancer development. Implications A polymorphic KLF5 binding site near the CCNE1 gene explains genetic risk identified through genome wide association studies. PMID:27514407
Bogeas, Alexandra; Morvan-Dubois, Ghislaine; El-Habr, Elias A; Lejeune, François-Xavier; Defrance, Matthieu; Narayanan, Ashwin; Kuranda, Klaudia; Burel-Vandenbos, Fanny; Sayd, Salwa; Delaunay, Virgile; Dubois, Luiz G; Parrinello, Hugues; Rialle, Stéphanie; Fabrega, Sylvie; Idbaih, Ahmed; Haiech, Jacques; Bièche, Ivan; Virolle, Thierry; Goodhardt, Michele; Chneiweiss, Hervé; Junier, Marie-Pierre
2018-02-01
Although a growing body of evidence indicates that phenotypic plasticity exhibited by glioblastoma cells plays a central role in tumor development and post-therapy recurrence, the master drivers of their aggressiveness remain elusive. Here we mapped the changes in active (H3K4me3) and repressive (H3K27me3) histone modifications accompanying the repression of glioblastoma stem-like cells tumorigenicity. Genes with changing histone marks delineated a network of transcription factors related to cancerous behavior, stem state, and neural development, highlighting a previously unsuspected association between repression of ARNT2 and loss of cell tumorigenicity. Immunohistochemistry confirmed ARNT2 expression in cell sub-populations within proliferative zones of patients' glioblastoma. Decreased ARNT2 expression was consistently observed in non-tumorigenic glioblastoma cells, compared to tumorigenic cells. Moreover, ARNT2 expression correlated with a tumorigenic molecular signature at both the tissue level within the tumor core and at the single cell level in the patients' tumors. We found that ARNT2 knockdown decreased the expression of SOX9, POU3F2 and OLIG2, transcription factors implicated in glioblastoma cell tumorigenicity, and repressed glioblastoma stem-like cell tumorigenic properties in vivo. Our results reveal ARNT2 as a pivotal component of the glioblastoma cell tumorigenic signature, located at a node of a transcription factor network controlling glioblastoma cell aggressiveness.
International Nuclear Information System (INIS)
Lee, Ja-Rang; Kwon, Chae Hwa; Choi, Yuri; Park, Hye Ji; Kim, Hyun Sung; Jo, Hong-Jae; Oh, Nahmgun; Park, Do Youn
2016-01-01
Despite the clinical significance of liver metastases, the difference between molecular and cellular changes in primary colorectal cancers (CRC) and matched liver metastases is poorly understood. In order to compare gene expression patterns and identify fusion genes in these two types of tumors, we performed high-throughput transcriptome sequencing of five sets of quadruple-matched tissues (primary CRC, liver metastases, normal colon, and liver). The gene expression patterns in normal colon and liver were successfully distinguished from those in CRCs; however, RNA sequencing revealed that the gene expression between primary CRCs and their matched liver metastases is highly similar. We identified 1895 genes that were differentially expressed in the primary carcinoma and liver metastases, than that in the normal colon tissues. A major proportion of the transcripts, identified by gene expression profiling as significantly enriched in the primary carcinoma and metastases, belonged to gene ontology categories involved in the cell cycle, mitosis, and cell division. Furthermore, we identified gene fusion events in primary carcinoma and metastases, and the fusion transcripts were experimentally confirmed. Among these, a chimeric transcript resulting from the fusion of RNF43 and SUPT4H1 was found to occur frequently in primary colorectal carcinoma. In addition, knockdown of the expression of this RNF43-SUPT4H1 chimeric transcript was found to have a growth-inhibitory effect in colorectal cancer cells. The present study reports a high concordance of gene expression in the primary carcinoma and liver metastases, and reveals potential new targets, such as fusion genes, against primary and metastatic colorectal carcinoma. The online version of this article (doi:10.1186/s12885-016-2596-3) contains supplementary material, which is available to authorized users
Uncovering transcriptional interactions via an adaptive fuzzy logic approach
Directory of Open Access Journals (Sweden)
Chen Chung-Ming
2009-12-01
Full Text Available Abstract Background To date, only a limited number of transcriptional regulatory interactions have been uncovered. In a pilot study integrating sequence data with microarray data, a position weight matrix (PWM performed poorly in inferring transcriptional interactions (TIs, which represent physical interactions between transcription factors (TF and upstream sequences of target genes. Inferring a TI means that the promoter sequence of a target is inferred to match the consensus sequence motifs of a potential TF, and their interaction type such as AT or RT is also predicted. Thus, a robust PWM (rPWM was developed to search for consensus sequence motifs. In addition to rPWM, one feature extracted from ChIP-chip data was incorporated to identify potential TIs under specific conditions. An interaction type classifier was assembled to predict activation/repression of potential TIs using microarray data. This approach, combining an adaptive (learning fuzzy inference system and an interaction type classifier to predict transcriptional regulatory networks, was named AdaFuzzy. Results AdaFuzzy was applied to predict TIs using real genomics data from Saccharomyces cerevisiae. Following one of the latest advances in predicting TIs, constrained probabilistic sparse matrix factorization (cPSMF, and using 19 transcription factors (TFs, we compared AdaFuzzy to four well-known approaches using over-representation analysis and gene set enrichment analysis. AdaFuzzy outperformed these four algorithms. Furthermore, AdaFuzzy was shown to perform comparably to 'ChIP-experimental method' in inferring TIs identified by two sets of large scale ChIP-chip data, respectively. AdaFuzzy was also able to classify all predicted TIs into one or more of the four promoter architectures. The results coincided with known promoter architectures in yeast and provided insights into transcriptional regulatory mechanisms. Conclusion AdaFuzzy successfully integrates multiple types of
Fujita, Yasutaro; Ogura, Mitsuo; Nii, Satomi; Hirooka, Kazutake
2017-01-01
It is known that transcription of kinB encoding a trigger for Bacillus subtilis sporulation is under repression by SinR, a master repressor of biofilm formation, and under positive stringent transcription control depending on the adenine species at the transcription initiation nucleotide (nt). Deletion and base substitution analyses of the kinB promoter (P kinB ) region using lacZ fusions indicated that either a 5-nt deletion (Δ5, nt -61/-57, +1 is the transcription initiation nt) or the substitution of G at nt -45 with A (G-45A) relieved kinB repression. Thus, we found a pair of SinR-binding consensus sequences (GTTCTYT; Y is T or C) in an inverted orientation (SinR-1) between nt -57/-42, which is most likely a SinR-binding site for kinB repression. This relief from SinR repression likely requires SinI, an antagonist of SinR. Surprisingly, we found that SinR is essential for positive stringent transcription control of P kinB . Electrophoretic mobility shift assay (EMSA) analysis indicated that SinR bound not only to SinR-1 but also to SinR-2 (nt -29/-8) consisting of another pair of SinR consensus sequences in a tandem repeat arrangement; the two sequences partially overlap the '-35' and '-10' regions of P kinB . Introduction of base substitutions (T-27C C-26T) in the upstream consensus sequence of SinR-2 affected positive stringent transcription control of P kinB , suggesting that SinR binding to SinR-2 likely causes this positive control. EMSA also implied that RNA polymerase and SinR are possibly bound together to SinR-2 to form a transcription initiation complex for kinB transcription. Thus, it was suggested in this work that derepression of kinB from SinR repression by SinI induced by Spo0A∼P and occurrence of SinR-dependent positive stringent transcription control of kinB might induce effective sporulation cooperatively, implying an intimate interplay by stringent response, sporulation, and biofilm formation.
Traverse, Charles C; Ochman, Howard
2017-08-29
Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions
Directory of Open Access Journals (Sweden)
Nicolas M Bertagnolli
Full Text Available To search for evolutionary forces that might act upon transcript length, we use the singular value decomposition (SVD to identify the length distribution functions of sets and subsets of human and yeast transcripts from profiles of mRNA abundance levels across gel electrophoresis migration distances that were previously measured by DNA microarrays. We show that the SVD identifies the transcript length distribution functions as "asymmetric generalized coherent states" from the DNA microarray data and with no a-priori assumptions. Comparing subsets of human and yeast transcripts of the same gene ontology annotations, we find that in both disparate eukaryotes, transcripts involved in protein synthesis or mitochondrial metabolism are significantly shorter than typical, and in particular, significantly shorter than those involved in glucose metabolism. Comparing the subsets of human transcripts that are overexpressed in glioblastoma multiforme (GBM or normal brain tissue samples from The Cancer Genome Atlas, we find that GBM maintains normal brain overexpression of significantly short transcripts, enriched in transcripts that are involved in protein synthesis or mitochondrial metabolism, but suppresses normal overexpression of significantly longer transcripts, enriched in transcripts that are involved in glucose metabolism and brain activity. These global relations among transcript length, cellular metabolism and tumor development suggest a previously unrecognized physical mode for tumor and normal cells to differentially regulate metabolism in a transcript length-dependent manner. The identified distribution functions support a previous hypothesis from mathematical modeling of evolutionary forces that act upon transcript length in the manner of the restoring force of the harmonic oscillator.
Directory of Open Access Journals (Sweden)
Fei eZhou
2015-04-01
Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Transcriptional Mechanisms Controlling miR-375 Gene Expression in the Pancreas
Directory of Open Access Journals (Sweden)
Tali Avnit-Sagi
2012-01-01
Full Text Available MicroRNAs (miRNAs are a class of small non-coding RNAs that play an important role in mediating a broad and expanding range of biological activities. miR-375 is expressed selectively in the pancreas. We have previously shown that selective expression of miR-375 in pancreatic beta cells is controlled by transcriptional mechanisms operating through a TATA box-containing promoter. Expression of miR-375 has been reported in non-beta cells within the endocrine pancreas, and indeed inactivation of miR-375 leads to perturbation in cell mass and number of both alpha and beta cells. Consistent with its expression throughout the endocrine pancreas, we now show that the promoter of the miR-375 gene shows selective activity in pancreatic endocrine alpha cells, comparable to that observed in beta cells. We previously identified a novel negative regulatory element located downstream of the miR-375 gene transcription start site. By generating luciferase reporter genes, we now show that the sequence is functional also when positioned upstream of a heterologous promoter, thus proving that the repressor effect is mediated at least in part at the level of transcription. Further characterization of the transcriptional control mechanism regulating expression of miR-375 and other pancreatic miRNAs will contribute to a better understanding of pancreas development and function.
Upstream magnetospheric ion flux tube within a magnetic cloud: Wind/STICS
Posner, Arik; Liemohn, Michael W.; Zurbuchen, Thomas H.
2003-03-01
We present a case study of a remarkable upstream O+ and N+ ion outflow event. We present observational evidence for spatially structured outflow of these Low Charge State Heavy Ions (LCSHIs) of magnetospheric origin along a small reconnected field line region within the framework of a magnetic cloud of an ICME. From the particles' in situ 3D distribution function we conclude that in this case the interaction of the outflow with the bow shock is small. We conclude further that the gyrophases of outflowing ions at the reconnection point are randomly distributed. This leads to the formation of a flux tube with a specific geometry. In particular, the outflow reveals spatial dispersion and non-gyrotropy. This result has implications for the size of the dayside reconnection site.
Upstream structural management measures for an urban area flooding in Turkey
Akyurek, Z.; Bozoğlu, B.; Sürer, S.; Mumcu, H.
2015-06-01
In recent years, flooding has become an increasing concern across many parts of the world of both the general public and their governments. The climate change inducing more intense rainfall events occurring in short period of time lead flooding in rural and urban areas. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is performed. MIKE21 with flexible grid is used in 2-dimensional shallow water flow modelling. 1 × 1000-1 scaled maps with the buildings for the urbanized area and 1 × 5000-1 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of 500 m3 s-1 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The upstream structural base precautions against flooding are modelled. The effect of four main upstream catchments on the flooding in the downstream urban area are modelled as different scenarios. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in one of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed.
DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS
Energy Technology Data Exchange (ETDEWEB)
Pitňa, A.; Šafránková, J.; Němeček, Z.; Goncharov, O.; Němec, F.; Přech, L. [Charles University, Faculty of Mathematics and Physics, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Chen, C. H. K. [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom); Zastenker, G. N., E-mail: jana.safrankova@mff.cuni.cz [Space Research Institute of Russian Academy of Sciences, Moscow, Russia, Profsoyuznaya ul. 84/32, Moscow 117997 (Russian Federation)
2016-03-01
Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those in the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.
Directory of Open Access Journals (Sweden)
Valentina Tosetti
Full Text Available The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA Sox2 overlapping transcript (Sox2OT plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE, and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT.
Exploring Social Learning through Upstream Engagement in Science and Technology
DEFF Research Database (Denmark)
Mortensen, Jonas Egmose
This discussion paper deliberates on how the concept of social learning can be used for evaluating upstream engagement initiatives in science and technology. The paper briefly introduces to the concept of upstream engagement and a concrete case, the UK Citizen Science for Sustainability project...... (SuScit), as an outset for discussing how the concept of social learning can be used for analysing and understanding relations between citizen participation, Science and research, and sustainability. A number of relevant research questions and methodological considerations are distilled...
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
A tobacco cDNA reveals two different transcription patterns in vegetative and reproductive organs
Directory of Open Access Journals (Sweden)
I. da Silva
2002-08-01
Full Text Available In order to identify genes expressed in the pistil that may have a role in the reproduction process, we have established an expressed sequence tags project to randomly sequence clones from a Nicotiana tabacum stigma/style cDNA library. A cDNA clone (MTL-8 showing high sequence similarity to genes encoding glycine-rich RNA-binding proteins was chosen for further characterization. Based on the extensive identity of MTL-8 to the RGP-1a sequence of N. sylvestris, a primer was defined to extend the 5' sequence of MTL-8 by RT-PCR from stigma/style RNAs. The amplification product was sequenced and it was confirmed that MTL-8 corresponds to an mRNA encoding a glycine-rich RNA-binding protein. Two transcripts of different sizes and expression patterns were identified when the MTL-8 cDNA insert was used as a probe in RNA blots. The largest is 1,100 nucleotides (nt long and markedly predominant in ovaries. The smaller transcript, with 600 nt, is ubiquitous to the vegetative and reproductive organs analyzed (roots, stems, leaves, sepals, petals, stamens, stigmas/styles and ovaries. Plants submitted to stress (wounding, virus infection and ethylene treatment presented an increased level of the 600-nt transcript in leaves, especially after tobacco necrosis virus infection. In contrast, the level of the 1,100-nt transcript seems to be unaffected by the stress conditions tested. Results of Southern blot experiments have suggested that MTL-8 is present in one or two copies in the tobacco genome. Our results suggest that the shorter transcript is related to stress while the larger one is a flower predominant and nonstress-inducible messenger.
Anand, Sanjay; Hasan, Tayyaba; Maytin, Edward V.
2013-03-01
Photodynamic therapy (PDT) with aminolevulinate (ALA) is widely accepted as an effective treatment for superficial carcinomas and pre-cancers. However, PDT is still suboptimal for deeper tumors, mainly due to inadequate ALA penetration and subsequent conversion to PpIX. We are interested in improving the effectiveness of photodynamic therapy (PDT) for deep tumors, using a combination approach (cPDT) in which target protoporphyrin (PpIX) levels are significantly enhanced by differentiation caused by giving Vitamin D or methotrexate (MTX) for 3 days prior to ALAPDT. In LNCaP and MEL cells, a strong correlation between inducible differentiation and expression of C/EBP transcription factors, as well as between differentiation and mRNA levels of CPO (a key heme-synthetic enzyme), indicates the possibility of CPO transcriptional regulation by the C/EBPs. Sequence analysis of the first 1300 base pairs of the murine CPO upstream region revealed 15 consensus C/EBP binding sites. Electrophoretic Mobility Shift Assays (EMSA) proved that these sites form specific complexes that have strong, moderate or weak affinities for C/EBPs. However, in the context of the full-length CPO promoter, inactivation of any type of site (strong or weak) reduced CPO promoter activity (luciferase assay) to nearly the same extent, suggesting cooperative interactions. A comparative analysis of murine and human CPO promoters revealed possible protein-protein interactions between C/EBPs and several neighboring transcription factors such as NFkB, Sp1, AP-1, CBP/p300 and CREB (an enhanceosome complex). Overall, these results confirm that C/EBP's are important for CPO expression via complex mechanisms which upregulate PpIX and enhance the outcome of cPDT.
Roy, Ajit; Ranjan, Akash
2016-02-23
Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.
Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
Directory of Open Access Journals (Sweden)
Masfique Mehedi
Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.
Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz
2013-01-01
Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.
Directory of Open Access Journals (Sweden)
Craigon Marie
2009-08-01
Full Text Available Abstract Background Interferons (IFNs are potent antiviral cytokines capable of reprogramming the macrophage phenotype through the induction of interferon-stimulated genes (ISGs. Here we have used targeted RNA interference to suppress the expression of a number of key genes associated with IFN signalling in murine macrophages prior to stimulation with interferon-gamma. Genome-wide changes in transcript abundance caused by siRNA activity were measured using exon-level microarrays in the presence or absence of IFNγ. Results Transfection of murine bone-marrow derived macrophages (BMDMs with a non-targeting (control siRNA and 11 sequence-specific siRNAs was performed using a cationic lipid transfection reagent (Lipofectamine2000 prior to stimulation with IFNγ. Total RNA was harvested from cells and gene expression measured on Affymetrix GeneChip Mouse Exon 1.0 ST Arrays. Network-based analysis of these data revealed six siRNAs to cause a marked shift in the macrophage transcriptome in the presence or absence IFNγ. These six siRNAs targeted the Ifnb1, Irf3, Irf5, Stat1, Stat2 and Nfkb2 transcripts. The perturbation of the transcriptome by the six siRNAs was highly similar in each case and affected the expression of over 600 downstream transcripts. Regulated transcripts were clustered based on co-expression into five major groups corresponding to transcriptional networks associated with the type I and II IFN response, cell cycle regulation, and NF-KB signalling. In addition we have observed a significant non-specific immune stimulation of cells transfected with siRNA using Lipofectamine2000, suggesting use of this reagent in BMDMs, even at low concentrations, is enough to induce a type I IFN response. Conclusion Our results provide evidence that the type I IFN response in murine BMDMs is dependent on Ifnb1, Irf3, Irf5, Stat1, Stat2 and Nfkb2, and that siRNAs targeted to these genes results in perturbation of key transcriptional networks associated
Mustakhimov, Ildar I.; Reshetnikov, Alexander S.; Glukhov, Anatoly S.; Khmelenina, Valentina N.; Kalyuzhnaya, Marina G.; Trotsenko, Yuri A.
2009-01-01
Genes encoding key enzymes of the ectoine biosynthesis pathway in the halotolerant obligate methanotroph Methylomicrobium alcaliphilum 20Z have been shown to be organized into an ectABC-ask operon. Transcription of the ect operon is initiated from two promoters, ectAp1 and ectAp2 (ectAp1p2), similar to the σ70-dependent promoters of Escherichia coli. Upstream of the gene cluster, an open reading frame (ectR1) encoding a MarR-like transcriptional regulator was identified. Investigation of the ...
Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver
2017-01-11
A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization
International Nuclear Information System (INIS)
Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R.
2014-01-01
In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria.
Alkane biosynthesis genes in cyanobacteria and their transcriptional organization
Directory of Open Access Journals (Sweden)
Stephan eKlähn
2014-07-01
Full Text Available In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl-acyl carrier protein reductase (AAR and aldehyde deformylating oxygenase (ADO. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado and sll0209 (aar, that give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313 and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in
Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization
Energy Technology Data Exchange (ETDEWEB)
Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R., E-mail: wolfgang.hess@biologie.uni-freiburg.de [Genetics and Experimental Bioinformatics, Institute of Biology 3, Faculty of Biology, University of Freiburg, Freiburg (Germany)
2014-07-14
In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria.
Grünberg, Sebastian; Henikoff, Steven; Hahn, Steven; Zentner, Gabriel E
2016-11-15
Mediator is a conserved, essential transcriptional coactivator complex, but its in vivo functions have remained unclear due to conflicting data regarding its genome-wide binding pattern obtained by genome-wide ChIP Here, we used ChEC-seq, a method orthogonal to ChIP, to generate a high-resolution map of Mediator binding to the yeast genome. We find that Mediator associates with upstream activating sequences (UASs) rather than the core promoter or gene body under all conditions tested. Mediator occupancy is surprisingly correlated with transcription levels at only a small fraction of genes. Using the same approach to map TFIID, we find that TFIID is associated with both TFIID- and SAGA-dependent genes and that TFIID and Mediator occupancy is cooperative. Our results clarify Mediator recruitment and binding to the genome, showing that Mediator binding to UASs is widespread, partially uncoupled from transcription, and mediated in part by TFIID. © 2016 The Authors.
Kim, K H; Hemenway, C
1997-05-26
The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.
Moving Upstream in U.S. Hospital Care Toward Investments in Population Health.
Begun, James W; Potthoff, Sandra
The root causes for most health outcomes are often collectively referred to as the social determinants of health. Hospitals and health systems now must decide how much to "move upstream," or invest in programs that directly affect the social determinants of health. Moving upstream in healthcare delivery requires an acceptance of responsibility for the health of populations. We examine responses of 950 nonfederal, general hospitals in the United States to the 2015 American Hospital Association Population Health Survey to identify characteristics that distinguish those hospitals that are most aligned with population health and most engaged in addressing social determinants of health. Those "upstream" hospitals are significantly more likely to be large, not-for-profit, metropolitan, teaching-affiliated, and members of systems. Internally, the more upstream hospitals are more likely to organize their population health activities with strong executive-level involvement, full-time-equivalent support, and coordination at the system level.The characteristics differentiating hospitals strongly involved in population health and upstream activity are not unlike those characteristics associated with diffusion of many innovations in hospitals. These hospitals may be the early adopters in a diffusion process that will eventually include most hospitals or, at least, most not-for-profit hospitals. Alternatively, the population health and social determinants movements could be transient or could be limited to a small portion of hospitals such as those identified here, with distinctive patient populations, missions, and resources.
Directory of Open Access Journals (Sweden)
Carsten Marr
Full Text Available The set of regulatory interactions between genes, mediated by transcription factors, forms a species' transcriptional regulatory network (TRN. By comparing this network with measured gene expression data, one can identify functional properties of the TRN and gain general insight into transcriptional control. We define the subnet of a node as the subgraph consisting of all nodes topologically downstream of the node, including itself. Using a large set of microarray expression data of the bacterium Escherichia coli, we find that the gene expression in different subnets exhibits a structured pattern in response to environmental changes and genotypic mutation. Subnets with fewer changes in their expression pattern have a higher fraction of feed-forward loop motifs and a lower fraction of small RNA targets within them. Our study implies that the TRN consists of several scales of regulatory organization: (1 subnets with more varying gene expression controlled by both transcription factors and post-transcriptional RNA regulation and (2 subnets with less varying gene expression having more feed-forward loops and less post-transcriptional RNA regulation.
Golumbeanu, Monica; Cristinelli, Sara; Rato, Sylvie; Munoz, Miguel; Cavassini, Matthias; Beerenwinkel, Niko; Ciuffi, Angela
2018-04-24
Despite effective treatment, HIV can persist in latent reservoirs, which represent a major obstacle toward HIV eradication. Targeting and reactivating latent cells is challenging due to the heterogeneous nature of HIV-infected cells. Here, we used a primary model of HIV latency and single-cell RNA sequencing to characterize transcriptional heterogeneity during HIV latency and reactivation. Our analysis identified transcriptional programs leading to successful reactivation of HIV expression. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Daugeron, Marie-Claire; Lenstra, Tineke L; Frizzarin, Martina; El Yacoubi, Basma; Liu, Xipeng; Baudin-Baillieu, Agnès; Lijnzaad, Philip; Decourty, Laurence; Saveanu, Cosmin; Jacquier, Alain; Holstege, Frank C P; de Crécy-Lagard, Valérie; van Tilbeurgh, Herman; Libri, Domenico
2011-08-01
The EKC/KEOPS complex is universally conserved in Archaea and Eukarya and has been implicated in several cellular processes, including transcription, telomere homeostasis and genomic instability. However, the molecular function of the complex has remained elusive so far. We analyzed the transcriptome of EKC/KEOPS mutants and observed a specific profile that is highly enriched in targets of the Gcn4p transcriptional activator. GCN4 expression was found to be activated at the translational level in mutants via the defective recognition of the inhibitory upstream ORFs (uORFs) present in its leader. We show that EKC/KEOPS mutants are defective for the N6-threonylcarbamoyl adenosine modification at position 37 (t(6)A(37)) of tRNAs decoding ANN codons, which affects initiation at the inhibitory uORFs and provokes Gcn4 de-repression. Structural modeling reveals similarities between Kae1 and bacterial enzymes involved in carbamoylation reactions analogous to t(6)A(37) formation, supporting a direct role for the EKC in tRNA modification. These findings are further supported by strong genetic interactions of EKC mutants with a translation initiation factor and with threonine biosynthesis genes. Overall, our data provide a novel twist to understanding the primary function of the EKC/KEOPS and its impact on several essential cellular functions like transcription and telomere homeostasis.
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
International Nuclear Information System (INIS)
Garfinkel, S.; Thompson, J.A.; Cohen, R.B.; Brendler, T.; Safer, B.
1987-01-01
Affinity adsorption, precipitation, and partitioning techniques have been developed to purify and characterize RNA Pol II transcription components from whole cell extracts (WCE) (HeLa) and nuclear extracts (K562). The titration of these extracts with multicopy constructs of the Ad2 MLP but not pUC8, inhibits transcriptional activity. DNA-binding factors precipitated by this technique are greatly enriched by centrifugation. Using this approach, factors binding to the upstream promoter sequence (UPS) of the Ad2 MLP have been rapidly isolated by Mono Q, Mono S, and DNA affinity chromatography. By U.V. crosslinking to nucleotides containing specific 32 P-phosphodiester bonds within the recognition sequence, this factor is identified as a M/sub r/ = 45,000 polypeptide. To generate an assay system for the functional evaluation of single transcription components, a similar approach using synthetic oligonucleotide sequences spanning single promoter binding sites has been developed. The addition of a synthetic 63-mer containing the UPS element of the Ad2 MLP to HeLa WCE inhibited transcription by 60%. The addition of partially purified UPS binding protein, but not RNA Pol II, restored transcriptional activity. The addition of synthetic oligonucleotides containing other regulatory sequences not present in the Ad2 MLP was without effect
Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W
1989-12-01
A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.
Optical power equalization for upstream traffic with injection-locked Fabry-Perot lasers in TDM-PON
Huang, Ting-Tsan; Sheu, Lih-Gen; Chi, Sien
2010-10-01
An optical power equalization of upstream traffic in time-division-multiplexed passive optical network (TDM-PON) based on injection-locked Fabry-Perot lasers has been experimentally investigated. The upstream transmitters with stable spectrum are achieved by using an external injection light source in the optical line terminal (OLT). The different upstream powers can be equalized by injection locking a Fabry-Perot laser diode (FP-LD) biased below threshold current in OLT. The dynamic upstream power range from - 8.5 to - 19.5 db m is reduced to a 1.6 dB maximal power variation, when the uplink signal is directly modulated at 1.25 Gb/s.
Anatomy of top 100 upstream players
International Nuclear Information System (INIS)
Burk, V.A.
1992-01-01
A brief review is given of a recent survey of the top one hundred upstream oil and gas companies which file financial data with the US Securities and Exchange Commission. The analysis indicates the increasing globalisation of the industry with exploration and development spending increasing dramatically outside the US. To survive, companies must operate as efficient low cost finders and producers of oil and gas and anticipate and meet changing market demands quickly. (UK)
Ying, Shibo; Dünnebier, Thomas; Si, Jing; Hamann, Ute
2013-01-01
UBC9 encodes a protein that conjugates small ubiquitin-related modifier (SUMO) to target proteins thereby changing their functions. Recently, it was noted that UBC9 expression and activity play a role in breast tumorigenesis and response to anticancer drugs. However, the underlying mechanism is poorly understood. To investigate the transcriptional regulation of the UBC9 gene, we identified and characterized its promoter and cis-elements. Promoter activity was tested using luciferase reporter assays. The binding of transcription factors to the promoter was detected by chromatin immunoprecipitation (ChIP), and their functional role was confirmed by siRNA knockdown. UBC9 mRNA and protein levels were measured by quantitative reverse transcription PCR and Western blot analysis, respectively. An increased expression of UBC9 mRNA and protein was found in MCF-7 breast cancer cells treated with 17β-estradiol (E2). Analysis of various deletion mutants revealed a 137 bp fragment upstream of the transcription initiation site to be sufficient for reporter gene transcription. Mutations of putative estrogen receptor α (ER-α) (one imperfect estrogen response element, ERE) and/or nuclear factor Y (NF-Y) binding sites (two CCAAT boxes) markedly reduced promoter activity. Similar results were obtained in ER-negative MDA-MB-231 cells except that the ERE mutation did not affect promoter activity. Additionally, promoter activity was stimulated upon E2 treatment and overexpression of ER-α or NF-YA in MCF-7 cells. ChIP confirmed direct binding of both transcription factors to the UBC9 promoter in vivo. Furthermore, UBC9 expression was diminished by ER-α and NF-Y siRNAs on the mRNA and protein levels. In conclusion, we identified the proximal UBC9 promoter and provided evidence that ER-α and NF-Y regulate UBC9 expression on the transcriptional level in response to E2 in MCF-7 cells. These findings may contribute to a better understanding of the regulation of UBC9 in ER
Multispacecraft observations of energetic ions upstream and downstream of the bow shock
International Nuclear Information System (INIS)
Scholer, M.; Mobius, E.; Kistler, L.M.; Klecker, B.; Ipavich, F.M.; Department of Physics and Astronomy, University of Maryland, College Park)
1989-01-01
We present simultaneous measurements of energetic protons and alpha particles inside and outside of the magnetopause, immediately upstream, and downstream as well as further upstream of the bow shock. A comparison between the intensity at the bow shock and further upstream results in an e-folding distance at 30 keV of similar to 6.2 R/sub E/. After transformation of the angular distribution into the solar wind frame a diffusion coefficeint of κ/sub parallel/similar to 3 R/sub E/ is obtained from the anisotropy and the intensity gradient. Immediately downstream of the bow shock the anisotropy in the shock frame is directed toward the magnetopause. After transformation into the plasma rest frame the distribution is isotropic. The intensity in the magnetosheath just outside the magnetopause is smaller than the intensity behind the bow shock. Thus, in the magnetosheath there is no gradient or streaming in the upstream direction. The spectra, intensities, and relative abundances in the magnetosheath and inside the magnetosphere are totally different. These observations are consistent with first order Fermi acceleration at the bow shock and subsequent downstream convection, and exclude a magnetospheric source for these particles. Copyright American Geophysical Union 1989
Influence of Upstream and Downstream Compressor Stators on Rotor Exit Flow Field
Directory of Open Access Journals (Sweden)
Nicole L. Key
2014-01-01
Full Text Available Measurements acquired at the rotor exit plane illuminate the interaction of the rotor with the upstream vane row and the downstream vane row. The relative phase of the upstream and downstream vane rows is adjusted using vane clocking so that the effect of the upstream propagating potential field from the downstream stator can be distinguished from the effects associated with the wakes shed from the upstream stator. Unsteady absolute flow angle information shows that the downstream potential field causes the absolute flow angle to increase in the vicinity of the downstream stator leading edge. The presence of Stator 1 wake is also detected at this measurement plane using unsteady total pressure data. The rotor wakes are measured at different circumferential locations across the vane passage, and the influence of Stator 1 wake on the suction side of the rotor wake is evident. Also, the influence of the downstream stator is detected on the pressure side of the rotor wake for a particular clocking configuration. Understanding the role of the surrounding vane rows on rotor wake development will lead to improved comparison between experimental data and results from computational models.
Genome-wide transcription analyses in rice using tiling microarrays
DEFF Research Database (Denmark)
Li, Lei; Wang, Xiangfeng; Stolc, Viktor
2006-01-01
. We report here a full-genome transcription analysis of the indica rice subspecies using high-density oligonucleotide tiling microarrays. Our results provided expression data support for the existence of 35,970 (81.9%) annotated gene models and identified 5,464 unique transcribed intergenic regions...... that share similar compositional properties with the annotated exons and have significant homology to other plant proteins. Elucidating and mapping of all transcribed regions revealed an association between global transcription and cytological chromosome features, and an overall similarity of transcriptional......Sequencing and computational annotation revealed several features, including high gene numbers, unusual composition of the predicted genes and a large number of genes lacking homology to known genes, that distinguish the rice (Oryza sativa) genome from that of other fully sequenced model species...
International Nuclear Information System (INIS)
Ma Shiliang; Lovmand, Jette; Soerensen, Annette Balle; Luz, Arne; Schmidt, Joerg; Pedersen, Finn Skou
2003-01-01
A highly conserved sequence upstream of the transcriptional enhancer in the U3 of murine leukemia viruses (MLVs) was reported to mediate negative regulation of their expression. In transient expression studies, negative regulation was reported to be conferred by coexpression of the transcription factor YY1, which binds to a motif in the upstream conserved region (UCR). To address the function of the UCR and its YY1-motif in an in vivo model of MLV-host interactions we introduced six consecutive triple basepair mutations into this region of the potent T-lymphomagenic SL3-3 MLV. We report that all mutants have retained their replication competence and that they all, like the SL3-3 wild type (wt), induce T-cell lymphomas when injected into newborn mice of the SWR strain. However, all mutants induced disease with slightly shorter latency periods than the wt SL3-3, suggesting that the YY1 motif as well as its immediate context in the UCR have a negative effect on the pathogenicity of the virus. This result may have implications for the design of retroviral vectors
CHD chromatin remodelers and the transcription cycle
Murawska, Magdalena
2011-01-01
It is well established that ATP-dependent chromatin remodelers modulate DNA access of transcription factors and RNA polymerases by “opening” or “closing” chromatin structure. However, this view is far too simplistic. Recent findings have demonstrated that these enzymes not only set the stage for the transcription machinery to act but also are actively involved at every step of the transcription process. As a consequence, they affect initiation, elongation, termination and RNA processing. In this review we will use the CHD family as a paradigm to illustrate the progress that has been made in revealing these new concepts. PMID:22223048
The role of upstream sequences in selecting the reading frame on tmRNA
Directory of Open Access Journals (Sweden)
Dewey Jonathan D
2008-06-01
Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.
Upstream waves in Saturn's foreshock
Bavassano Cattaneo, M. B.; Cattaneo, P.; Moreno, G.; Lepping, R. P.
1991-01-01
An analysis based on plasma and magnetic-field data obtained from Voyager 1 during its Saturn encounter is reported. The plasma data provided every 96 sec and magnetic-field data averaged over 48 sec are utilized. The evidence of upstream waves at Saturn are detected. The waves have a period, in the spacecraft frame, of about 550 sec and a relative amplitude larger than 0.3, are left- and right-hand elliptically polarized, and propagate at about 30 deg with respect to the average magnetic field. The appearance of the waves is correlated with the spacecraft being magnetically connected to the bow shock.
Fujisawa, Masaki; Ito, Yasuhiro
2013-01-01
The developmental process of ripening is unique to fleshy fruits and a key factor in fruit quality. The tomato (Solanum lycopersicum) MADS-box transcription factor RIPENING INHIBITOR (RIN), one of the earliest-acting ripening regulators, is required for broad aspects of ripening, including ethylene-dependent and -independent pathways. However, our knowledge of direct RIN target genes has been limited, considering the broad effects of RIN on ripening. In a recent work published in The Plant Cell, we identified 241 direct RIN target genes by chromatin immunoprecipitation coupled with DNA microarray (ChIP-chip) and transcriptome analysis. Functional classification of the targets revealed that RIN participates in the regulation of many biological processes including well-known ripening processes such as climacteric ethylene production and lycopene accumulation. In addition, we found that ethylene is required for the full expression of RIN and several RIN-targeting transcription factor genes at the ripening stage. Here, based on our recently published findings and additional data, we discuss the ripening processes regulated by RIN and the interplay between RIN and ethylene. PMID:23518588
Fleckenstein, E C; Dirks, W G; Drexler, H G
2000-02-01
The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.
An upstream open reading frame modulates ebola virus polymerase translation and virus replication.
Directory of Open Access Journals (Sweden)
Reed S Shabman
2013-01-01
Full Text Available Ebolaviruses, highly lethal zoonotic pathogens, possess longer genomes than most other non-segmented negative-strand RNA viruses due in part to long 5' and 3' untranslated regions (UTRs present in the seven viral transcriptional units. To date, specific functions have not been assigned to these UTRs. With reporter assays, we demonstrated that the Zaire ebolavirus (EBOV 5'-UTRs lack internal ribosomal entry site function. However, the 5'-UTRs do differentially regulate cap-dependent translation when placed upstream of a GFP reporter gene. Most dramatically, the 5'-UTR derived from the viral polymerase (L mRNA strongly suppressed translation of GFP compared to a β-actin 5'-UTR. The L 5'-UTR is one of four viral genes to possess upstream AUGs (uAUGs, and ablation of each uAUG enhanced translation of the primary ORF (pORF, most dramatically in the case of the L 5'-UTR. The L uAUG was sufficient to initiate translation, is surrounded by a "weak" Kozak sequence and suppressed pORF translation in a position-dependent manner. Under conditions where eIF2α was phosphorylated, the presence of the uORF maintained translation of the L pORF, indicating that the uORF modulates L translation in response to cellular stress. To directly address the role of the L uAUG in virus replication, a recombinant EBOV was generated in which the L uAUG was mutated to UCG. Strikingly, mutating two nucleotides outside of previously-defined protein coding and cis-acting regulatory sequences attenuated virus growth to titers 10-100-fold lower than a wild-type virus in Vero and A549 cells. The mutant virus also exhibited decreased viral RNA synthesis as early as 6 hours post-infection and enhanced sensitivity to the stress inducer thapsigargin. Cumulatively, these data identify novel mechanisms by which EBOV regulates its polymerase expression, demonstrate their relevance to virus replication and identify a potential therapeutic target.
Analysis of an upstream weighted collocation approximation to the transport equation
International Nuclear Information System (INIS)
Shapiro, A.; Pinder, G.F.
1981-01-01
The numerical behavior of a modified orthogonal collocation method, as applied to the transport equations, can be examined through the use of a Fourier series analysis. The necessity of such a study becomes apparent in the analysis of several techniques which emulate classical upstream weighting schemes. These techniques are employed in orthogonal collocation and other numerical methods as a means of handling parabolic partial differential equations with significant first-order terms. Divergent behavior can be shown to exist in one upstream weighting method applied to orthogonal collocation
International Nuclear Information System (INIS)
Asselman, Jana; Shaw, Joseph R.; Glaholt, Stephen P.; Colbourne, John K.; De Schamphelaere, Karel A.C.
2013-01-01
Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species
Energy Technology Data Exchange (ETDEWEB)
Asselman, Jana, E-mail: jana.asselman@ugent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium); Shaw, Joseph R.; Glaholt, Stephen P. [The School of Public and Environmental Affairs, Indiana University, Bloomington, IN (United States); Colbourne, John K. [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium)
2013-10-15
Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species.
Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E
2016-01-01
Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in
Directory of Open Access Journals (Sweden)
Adam G Marsh
Full Text Available Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera and an anemone (Nematostella vectensis. Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to
Structural Basis of Mitochondrial Transcription Initiation.
Hillen, Hauke S; Morozov, Yaroslav I; Sarfallah, Azadeh; Temiakov, Dmitry; Cramer, Patrick
2017-11-16
Transcription in human mitochondria is driven by a single-subunit, factor-dependent RNA polymerase (mtRNAP). Despite its critical role in both expression and replication of the mitochondrial genome, transcription initiation by mtRNAP remains poorly understood. Here, we report crystal structures of human mitochondrial transcription initiation complexes assembled on both light and heavy strand promoters. The structures reveal how transcription factors TFAM and TFB2M assist mtRNAP to achieve promoter-dependent initiation. TFAM tethers the N-terminal region of mtRNAP to recruit the polymerase to the promoter whereas TFB2M induces structural changes in mtRNAP to enable promoter opening and trapping of the DNA non-template strand. Structural comparisons demonstrate that the initiation mechanism in mitochondria is distinct from that in the well-studied nuclear, bacterial, or bacteriophage transcription systems but that similarities are found on the topological and conceptual level. These results provide a framework for studying the regulation of gene expression and DNA replication in mitochondria. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2011-06-01
Full Text Available Abstract Background MicroRNAs (miRNAs play a fundamental role in the regulation of gene expression by translational repression or target mRNA degradation. Regulatory elements in miRNA promoters are less well studied, but may reveal a link between their expression and a specific cell type. Results To explore this link in myeloid cells, miRNA expression profiles were generated from monocytes and dendritic cells (DCs. Differences in miRNA expression among monocytes, DCs and their stimulated progeny were observed. Furthermore, putative promoter regions of miRNAs that are significantly up-regulated in DCs were screened for Transcription Factor Binding Sites (TFBSs based on TFBS motif matching score, the degree to which those TFBSs are over-represented in the promoters of the up-regulated miRNAs, and the extent of conservation of the TFBSs in mammals. Conclusions Analysis of evolutionarily conserved TFBSs in DC promoters revealed preferential clustering of sites within 500 bp upstream of the precursor miRNAs and that many mRNAs of cognate TFs of the conserved TFBSs were indeed expressed in the DCs. Taken together, our data provide evidence that selected miRNAs expressed in DCs have evolutionarily conserved TFBSs relevant to DC biology in their promoters.
Directory of Open Access Journals (Sweden)
Xu Fuyu
2012-09-01
Full Text Available Abstract Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa formed ten clusters of orthologous groups (COG with genes from the monocot sorghum (Sorghum bicolor and dicot Arabidopsis (Arabidopsis thaliana. The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in
Directory of Open Access Journals (Sweden)
Filomena Perrone
2017-10-01
Full Text Available Mycobacterium tuberculosis has the ability to survive inside macrophages under acid-nitrosative stress. M. tuberculosis Rv1685c and its ortholog in M. smegmatis, MSMEG_3765, are induced on exposure to acid-nitrosative stress. Both genes are annotated as TetR transcriptional regulators, a family of proteins that regulate a wide range of cellular activities, including multidrug resistance, carbon catabolism and virulence. Here, we demonstrate that MSMEG_3765 is co-transcribed with the upstream genes MSMEG_3762 and MSMEG_3763, encoding efflux pump components. RTq-PCR and GFP-reporter assays showed that the MSMEG_3762/63/65 gene cluster, and the orthologous region in M. tuberculosis (Rv1687c/86c/85c, was up-regulated in a MSMEG_3765 null mutant, suggesting that MSMEG_3765 acts as a repressor, typical of this family of regulators. We further defined the MSMEG_3765 regulon using genome-wide transcriptional profiling and used reporter assays to confirm that the MSMEG_3762/63/65 promoter was induced under acid-nitrosative stress. A putative 36 bp regulatory motif was identified upstream of the gene clusters in both M. smegmatis and M. tuberculosis and purified recombinant MSMEG_3765 protein was found to bind to DNA fragments containing this motif from both M. smegmatis and M. tuberculosis upstream regulatory regions. These results suggest that the TetR repressor MSMEG_3765/Rv1685c controls expression of an efflux pump with an, as yet, undefined role in the mycobacterial response to acid-nitrosative stress.
Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M.; Evans, Ronald M.; Gage, Fred H.
2012-01-01
Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively r...
Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes.
Riechmann, J L; Heard, J; Martin, G; Reuber, L; Jiang, C; Keddie, J; Adam, L; Pineda, O; Ratcliffe, O J; Samaha, R R; Creelman, R; Pilgrim, M; Broun, P; Zhang, J Z; Ghandehari, D; Sherman, B K; Yu, G
2000-12-15
The completion of the Arabidopsis thaliana genome sequence allows a comparative analysis of transcriptional regulators across the three eukaryotic kingdoms. Arabidopsis dedicates over 5% of its genome to code for more than 1500 transcription factors, about 45% of which are from families specific to plants. Arabidopsis transcription factors that belong to families common to all eukaryotes do not share significant similarity with those of the other kingdoms beyond the conserved DNA binding domains, many of which have been arranged in combinations specific to each lineage. The genome-wide comparison reveals the evolutionary generation of diversity in the regulation of transcription.
Directory of Open Access Journals (Sweden)
Ching-Ping Lin
Full Text Available We performed deep sequencing of the nuclear and organellar genomes of three mungbean genotypes: Vigna radiata ssp. sublobata TC1966, V. radiata var. radiata NM92 and the recombinant inbred line RIL59 derived from a cross between TC1966 and NM92. Moreover, we performed deep sequencing of the RIL59 transcriptome to investigate transcript variability. The mungbean chloroplast genome has a quadripartite structure including a pair of inverted repeats separated by two single copy regions. A total of 213 simple sequence repeats were identified in the chloroplast genomes of NM92 and RIL59; 78 single nucleotide variants and nine indels were discovered in comparing the chloroplast genomes of TC1966 and NM92. Analysis of the mungbean chloroplast transcriptome revealed mRNAs that were affected by transcriptional slippage and RNA editing. Transcriptional slippage frequency was positively correlated with the length of simple sequence repeats of the mungbean chloroplast genome (R2=0.9911. In total, 41 C-to-U editing sites were found in 23 chloroplast genes and in one intergenic spacer. No editing site that swapped U to C was found. A combination of bioinformatics and experimental methods revealed that the plastid-encoded RNA polymerase-transcribed genes psbF and ndhA are affected by transcriptional slippage in mungbean and in main lineages of land plants, including three dicots (Glycine max, Brassica rapa, and Nicotiana tabacum, two monocots (Oryza sativa and Zea mays, two gymnosperms (Pinus taeda and Ginkgo biloba and one moss (Physcomitrella patens. Transcript analysis of the rps2 gene showed that transcriptional slippage could affect transcripts at single sequence repeat regions with poly-A runs. It showed that transcriptional slippage together with incomplete RNA editing may cause sequence diversity of transcripts in chloroplasts of land plants.
ENHANCING THE ROLE OF STAKEHOLDERS IN THE MANAGEMENT OF UPSTREAM CILIWUNG WATERSHED
Directory of Open Access Journals (Sweden)
Iis Alviya
2016-08-01
Full Text Available Stakeholders have a ver y important role interm of the management of upstream watershed. Thus, the common understanding on the existence and role of stakeholders is an important factor in order to achieve good governance of watershed management, leading to the attainment of environmental, social and economic benefits. This paper aims to analyse the role, interests, and cooperation among stakeholders and its relationship with the condition of upper Ciliwung watershed. Stakeholder analysis was used in this study to identify stakeholders, to categorize them, and to investigate the relationship between stakeholders. The analysis showed the lack of cooperation among stakeholders both between key stakeholders with primar y stakeholders. This resulted in lack of communities' understanding on the benefits and the importance of conservation activities in the upstream Ciliwung watershed. Meanwhile, the cooperation between key stakeholders and supporting stakeholders, especially the providers of funds, was relatively better/stronger. This can be seen from a better management of inter-agency cooperation in the upstream Ciliwung watershed, although the effort was tend to be project-oriented. Therefore, communication forum need to be established, to taking role for synchronizing , collaborating and coordinating stakeholders' efforts, so that the management programs of upstream Ciliwung watershed can be integrated.
DOWNSTREAM ECOCIDE FROM UPSTREAM WATER PIRACY
Miah Muhammad Adel
2012-01-01
Upstream India and downstream Bangladesh share more than 50 international rivers. India has set up water diversion constructions in more than 50% of these rivers, the largest one being on the Bangladeshâs northwest upon the Ganges River, puts Bangladeshâs Gangetic ecosystem at stake. In some border rivers, India has set up groins on her side of river banks. Also, Indian side pumps Bangladesh river water stealthily from border-rivers. Further, India is constructing another dam and reservoir up...
Peralta-Gil, Martín; Segura, Daniel; Guzmán, Josefina; Servín-González, Luis; Espín, Guadalupe
2002-01-01
The Azotobacter vinelandii phbBAC genes encode the enzymes for poly-β-hydroxybutyrate (PHB) synthesis. The phbR gene, which is located upstream of and in the opposite direction of phbBAC, encodes PhbR, a transcriptional activator which is a member of the AraC family of activators. Here we report that a mutation in phbR reduced PHB accumulation and transcription of a phbB-lacZ fusion. We also report that phbB is transcribed from two overlapping promoters, pB1 and pB2. The region corresponding ...
Energy Technology Data Exchange (ETDEWEB)
Masters, A.; Dougherty, M. K. [The Blackett Laboratory, Imperial College London, Prince Consort Road, London, SW7 2AZ (United Kingdom); Sulaiman, A. H. [Department of Physics and Astronomy, University of Iowa, Iowa City, IA 52242 (United States); Stawarz, Ł. [Astronomical Observatory, Jagiellonian University, ul. Orla 171, 30-244 Krakow (Poland); Reville, B. [School of Mathematics and Physics, Queens University Belfast, Belfast BT7 1NN (United Kingdom); Sergis, N. [Office of Space Research and Technology, Academy of Athens, Soranou Efesiou 4, 11527 Athens (Greece); Fujimoto, M. [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Burgess, D. [School of Physics and Astronomy, Queen Mary University of London, London E1 4NS (United Kingdom); Coates, A. J., E-mail: a.masters@imperial.ac.uk [Mullard Space Science Laboratory, Department of Space and Climate Physics, University College London, Holmbury St. Mary, Dorking RH5 6NT (United Kingdom)
2017-07-10
A leading explanation for the origin of Galactic cosmic rays is acceleration at high-Mach number shock waves in the collisionless plasma surrounding young supernova remnants. Evidence for this is provided by multi-wavelength non-thermal emission thought to be associated with ultrarelativistic electrons at these shocks. However, the dependence of the electron acceleration process on the orientation of the upstream magnetic field with respect to the local normal to the shock front (quasi-parallel/quasi-perpendicular) is debated. Cassini spacecraft observations at Saturn’s bow shock have revealed examples of electron acceleration under quasi-perpendicular conditions, and the first in situ evidence of electron acceleration at a quasi-parallel shock. Here we use Cassini data to make the first comparison between energy spectra of locally accelerated electrons under these differing upstream magnetic field regimes. We present data taken during a quasi-perpendicular shock crossing on 2008 March 8 and during a quasi-parallel shock crossing on 2007 February 3, highlighting that both were associated with electron acceleration to at least MeV energies. The magnetic signature of the quasi-perpendicular crossing has a relatively sharp upstream–downstream transition, and energetic electrons were detected close to the transition and immediately downstream. The magnetic transition at the quasi-parallel crossing is less clear, energetic electrons were encountered upstream and downstream, and the electron energy spectrum is harder above ∼100 keV. We discuss whether the acceleration is consistent with diffusive shock acceleration theory in each case, and suggest that the quasi-parallel spectral break is due to an energy-dependent interaction between the electrons and short, large-amplitude magnetic structures.
Linking Core Promoter Classes to Circadian Transcription.
Directory of Open Access Journals (Sweden)
Pål O Westermark
2016-08-01
Full Text Available Circadian rhythms in transcription are generated by rhythmic abundances and DNA binding activities of transcription factors. Propagation of rhythms to transcriptional initiation involves the core promoter, its chromatin state, and the basal transcription machinery. Here, I characterize core promoters and chromatin states of genes transcribed in a circadian manner in mouse liver and in Drosophila. It is shown that the core promoter is a critical determinant of circadian mRNA expression in both species. A distinct core promoter class, strong circadian promoters (SCPs, is identified in mouse liver but not Drosophila. SCPs are defined by specific core promoter features, and are shown to drive circadian transcriptional activities with both high averages and high amplitudes. Data analysis and mathematical modeling further provided evidence for rhythmic regulation of both polymerase II recruitment and pause release at SCPs. The analysis provides a comprehensive and systematic view of core promoters and their link to circadian mRNA expression in mouse and Drosophila, and thus reveals a crucial role for the core promoter in regulated, dynamic transcription.
Impact of upstream industrial effluents on irrigation water quality ...
African Journals Online (AJOL)
Impact of upstream industrial effluents on irrigation water quality, soils and ... Knowledge of irrigation water quality is critical to predicting, managing and reducing salt ... Presence of heavy metals in concentration higher than the recommended ...
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Direct Transcriptional Consequences of Somatic Mutation in Breast Cancer
Directory of Open Access Journals (Sweden)
Adam Shlien
2016-08-01
Full Text Available Disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription, coordinated secondary pathway alterations, and increased transcriptional noise. To catalog the rules governing how somatic mutation exerts direct transcriptional effects, we developed an exhaustive pipeline for analyzing RNA sequencing data, which we integrated with whole genomes from 23 breast cancers. Using X-inactivation analyses, we found that cancer cells are more transcriptionally active than intermixed stromal cells. This is especially true in estrogen receptor (ER-negative tumors. Overall, 59% of substitutions were expressed. Nonsense mutations showed lower expression levels than expected, with patterns characteristic of nonsense-mediated decay. 14% of 4,234 rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusions, and premature polyadenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data reveals the rules by which transcriptional machinery interprets somatic mutation.
Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.
Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E
2016-11-18
Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.
D'Souza, Alicia D; Belotserkovskii, Boris P; Hanawalt, Philip C
2018-02-01
The selective inhibition of transcription of a chosen gene by an artificial agent has numerous applications. Usually, these agents are designed to bind a specific nucleotide sequence in the promoter or within the transcribed region of the chosen gene. However, since optimal binding sites might not exist within the gene, it is of interest to explore the possibility of transcription inhibition when the agent is designed to bind at other locations. One of these possibilities arises when an additional transcription initiation site (e.g. secondary promoter) is present upstream from the primary promoter of the target gene. In this case, transcription inhibition might be achieved by inducing the formation of an RNA-DNA hybrid (R-loop) upon transcription from the secondary promoter. The R-loop could extend into the region of the primary promoter, to interfere with promoter recognition by RNA polymerase and thereby inhibit transcription. As a sequence-specific R-loop-inducing agent, a peptide nucleic acid (PNA) could be designed to facilitate R-loop formation by sequestering the non-template DNA strand. To investigate this mode for transcription inhibition, we have employed a model system in which a PNA binding site is localized between the T3 and T7 phage RNA polymerase promoters, which respectively assume the roles of primary and secondary promoters. In accord with our model, we have demonstrated that with PNA-bound DNA substrates, transcription from the T7 promoter reduces transcription from the T3 promoter by 30-fold, while in the absence of PNA binding there is no significant effect of T7 transcription upon T3 transcription. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Lu Tingting
2012-12-01
Full Text Available Abstract Background Cis-natural antisense transcripts (cis-NATs are RNAs transcribed from the antisense strand of a gene locus, and are complementary to the RNA transcribed from the sense strand. Common techniques including microarray approach and analysis of transcriptome databases are the major ways to globally identify cis-NATs in various eukaryotic organisms. Genome-wide in silico analysis has identified a large number of cis-NATs that may generate endogenous short interfering RNAs (nat-siRNAs, which participate in important biogenesis mechanisms for transcriptional and post-transcriptional regulation in rice. However, the transcriptomes are yet to be deeply sequenced to comprehensively investigate cis-NATs. Results We applied high-throughput strand-specific complementary DNA sequencing technology (ssRNA-seq to deeply sequence mRNA for assessing sense and antisense transcripts that were derived under salt, drought and cold stresses, and normal conditions, in the model plant rice (Oryza sativa. Combined with RAP-DB genome annotation (the Rice Annotation Project Database build-5 data set, 76,013 transcripts corresponding to 45,844 unique gene loci were assembled, in which 4873 gene loci were newly identified. Of 3819 putative rice cis-NATs, 2292 were detected as expressed and giving rise to small RNAs from their overlapping regions through integrated analysis of ssRNA-seq data and small RNA data. Among them, 503 cis-NATs seemed to be associated with specific conditions. The deep sequence data from isolated epidermal cells of rice seedlings further showed that 54.0% of cis-NATs were expressed simultaneously in a population of homogenous cells. Nearly 9.7% of rice transcripts were involved in one-to-one or many-to-many cis-NATs formation. Furthermore, only 17.4-34.7% of 223 many-to-many cis-NAT groups were all expressed and generated nat-siRNAs, indicating that only some cis-NAT groups may be involved in complex regulatory networks. Conclusions
Directory of Open Access Journals (Sweden)
Kristina A Roberts
Full Text Available The vestibular apparatus of the vertebrate inner ear uses three fluid-filled semicircular canals to sense angular acceleration of the head. Malformation of these canals disrupts the sense of balance and frequently causes circling behavior in mice. The Epistatic circler (Ecl is a complex mutant derived from wildtype SWR/J and C57L/J mice. Ecl circling has been shown to result from the epistatic interaction of an SWR-derived locus on chromosome 14 and a C57L-derived locus on chromosome 4, but the causative genes have not been previously identified.We developed a mouse chromosome substitution strain (CSS-14 that carries an SWR/J chromosome 14 on a C57BL/10J genetic background and, like Ecl, exhibits circling behavior due to lateral semicircular canal malformation. We utilized CSS-14 to identify the chromosome 14 Ecl gene by positional cloning. Our candidate interval is located upstream of bone morphogenetic protein 4 (Bmp4 and contains an inner ear-specific, long non-coding RNA that we have designated Rubie (RNA upstream of Bmp4 expressed in inner ear. Rubie is spliced and polyadenylated, and is expressed in developing semicircular canals. However, we discovered that the SWR/J allele of Rubie is disrupted by an intronic endogenous retrovirus that causes aberrant splicing and premature polyadenylation of the transcript. Rubie lies in the conserved gene desert upstream of Bmp4, within a region previously shown to be important for inner ear expression of Bmp4. We found that the expression patterns of Bmp4 and Rubie are nearly identical in developing inner ears.Based on these results and previous studies showing that Bmp4 is essential for proper vestibular development, we propose that Rubie is the gene mutated in Ecl mice, that it is involved in regulating inner ear expression of Bmp4, and that aberrant Bmp4 expression contributes to the Ecl phenotype.
Munia, H.; Guillaume, J. H. A.; Mirumachi, N.; Porkka,M.; Wada, Yoshihide; Kummu, M.
2016-01-01
Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analyzed in many of these international river basins, this has not been systematically done at the global scale using coherent and comparable datasets. In this study, we aim to assess the change in downstream water stress due to upstream water use in the world's transboundary river basins. Water stress was first calculated considering only local water use of each sub-basin based on country-basin mesh, then compared with the situation when upstream water use was subtracted from downstream water availability. Wefound that water stress was generally already high when considering only local water use, affecting 0.95-1.44 billion people or 33%-51% of the population in transboundary river basins. After accounting for upstream water use, stress level increased by at least 1 percentage-point for 30-65 sub-basins, affecting 0.29-1.13 billion people. Altogether 288 out of 298 middle-stream and downstream sub-basin areas experienced some change in stress level. Further, we assessed whether there is a link between increased water stress due to upstream water use and the number of conflictive and cooperative events in the transboundary river basins, as captured by two prominent databases. No direct relationship was found. This supports the argument that conflicts and cooperation events originate from a combination of different drivers, among which upstream-induced water stress may play a role. Our findings contribute to better understanding of upstream-downstream dynamics in water stress to help address water allocation problems.
2010-01-01
Background The Mexican axolotl (Ambystoma mexicanum) is considered a hopeful monster because it exhibits an adaptive and derived mode of development - paedomorphosis - that has evolved rapidly and independently among tiger salamanders. Unlike related tiger salamanders that undergo metamorphosis, axolotls retain larval morphological traits into adulthood and thus present an adult body plan that differs dramatically from the ancestral (metamorphic) form. The basis of paedomorphic development was investigated by comparing temporal patterns of gene transcription between axolotl and tiger salamander larvae (Ambystoma tigrinum tigrinum) that typically undergo a metamorphosis. Results Transcript abundances from whole brain and pituitary were estimated via microarray analysis on four different days post hatching (42, 56, 70, 84 dph) and regression modeling was used to independently identify genes that were differentially expressed as a function of time in both species. Collectively, more differentially expressed genes (DEGs) were identified as unique to the axolotl (n = 76) and tiger salamander (n = 292) than were identified as shared (n = 108). All but two of the shared DEGs exhibited the same temporal pattern of expression and the unique genes tended to show greater changes later in the larval period when tiger salamander larvae were undergoing anatomical metamorphosis. A second, complementary analysis that directly compared the expression of 1320 genes between the species identified 409 genes that differed as a function of species or the interaction between time and species. Of these 409 DEGs, 84% exhibited higher abundances in tiger salamander larvae at all sampling times. Conclusions Many of the unique tiger salamander transcriptional responses are probably associated with metamorphic biological processes. However, the axolotl also showed unique patterns of transcription early in development. In particular, the axolotl showed a genome-wide reduction in mRNA abundance
Directory of Open Access Journals (Sweden)
Putta Srikrishna
2010-06-01
Full Text Available Abstract Background The Mexican axolotl (Ambystoma mexicanum is considered a hopeful monster because it exhibits an adaptive and derived mode of development - paedomorphosis - that has evolved rapidly and independently among tiger salamanders. Unlike related tiger salamanders that undergo metamorphosis, axolotls retain larval morphological traits into adulthood and thus present an adult body plan that differs dramatically from the ancestral (metamorphic form. The basis of paedomorphic development was investigated by comparing temporal patterns of gene transcription between axolotl and tiger salamander larvae (Ambystoma tigrinum tigrinum that typically undergo a metamorphosis. Results Transcript abundances from whole brain and pituitary were estimated via microarray analysis on four different days post hatching (42, 56, 70, 84 dph and regression modeling was used to independently identify genes that were differentially expressed as a function of time in both species. Collectively, more differentially expressed genes (DEGs were identified as unique to the axolotl (n = 76 and tiger salamander (n = 292 than were identified as shared (n = 108. All but two of the shared DEGs exhibited the same temporal pattern of expression and the unique genes tended to show greater changes later in the larval period when tiger salamander larvae were undergoing anatomical metamorphosis. A second, complementary analysis that directly compared the expression of 1320 genes between the species identified 409 genes that differed as a function of species or the interaction between time and species. Of these 409 DEGs, 84% exhibited higher abundances in tiger salamander larvae at all sampling times. Conclusions Many of the unique tiger salamander transcriptional responses are probably associated with metamorphic biological processes. However, the axolotl also showed unique patterns of transcription early in development. In particular, the axolotl showed a genome
Glyde, Robert; Ye, Fuzhou; Darbari, Vidya Chandran; Zhang, Nan; Buck, Martin; Zhang, Xiaodong
2017-07-06
Gene transcription is carried out by RNA polymerases (RNAPs). For transcription to occur, the closed promoter complex (RPc), where DNA is double stranded, must isomerize into an open promoter complex (RPo), where the DNA is melted out into a transcription bubble and the single-stranded template DNA is delivered to the RNAP active site. Using a bacterial RNAP containing the alternative σ 54 factor and cryoelectron microscopy, we determined structures of RPc and the activator-bound intermediate complex en route to RPo at 3.8 and 5.8 Å. Our structures show how RNAP-σ 54 interacts with promoter DNA to initiate the DNA distortions required for transcription bubble formation, and how the activator interacts with RPc, leading to significant conformational changes in RNAP and σ 54 that promote RPo formation. We propose that DNA melting is an active process initiated in RPc and that the RNAP conformations of intermediates are significantly different from that of RPc and RPo. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Sector report: Malaysia. Upstream oil and gas industry
International Nuclear Information System (INIS)
1997-01-01
This report is one of a series designed to introduce British exporters to the opportunities offered by the Malaysian market in oil and natural gas. The report includes Malaysia's oil and gas reserves, production, exploration, major profits upstream, production sharing contracts, pipeline construction, operators in production, service sector, and Petronas. (UK)
Dalla Rosa, Ilaria; Zhang, Hongliang; Khiati, Salim; Wu, Xiaolin; Pommier, Yves
2017-12-08
Mitochondrial DNA (mtDNA) is essential for cell viability because it encodes subunits of the respiratory chain complexes. Mitochondrial topoisomerase IB (TOP1MT) facilitates mtDNA replication by removing DNA topological tensions produced during mtDNA transcription, but it appears to be dispensable. To test whether cells lacking TOP1MT have aberrant mtDNA transcription, we performed mitochondrial transcriptome profiling. To that end, we designed and implemented a customized tiling array, which enabled genome-wide, strand-specific, and simultaneous detection of all mitochondrial transcripts. Our technique revealed that Top1mt KO mouse cells process the mitochondrial transcripts normally but that protein-coding mitochondrial transcripts are elevated. Moreover, we found discrete long noncoding RNAs produced by H-strand transcription and encompassing the noncoding regulatory region of mtDNA in human and murine cells and tissues. Of note, these noncoding RNAs were strongly up-regulated in the absence of TOP1MT. In contrast, 7S DNA, produced by mtDNA replication, was reduced in the Top1mt KO cells. We propose that the long noncoding RNA species in the D-loop region are generated by the extension of H-strand transcripts beyond their canonical stop site and that TOP1MT acts as a topological barrier and regulator for mtDNA transcription and D-loop formation.
Schluttenhofer, Craig; Pattanaik, Sitakanta; Patra, Barunava; Yuan, Ling
2014-06-20
To combat infection to biotic stress plants elicit the biosynthesis of numerous natural products, many of which are valuable pharmaceutical compounds. Jasmonate is a central regulator of defense response to pathogens and accumulation of specialized metabolites. Catharanthus roseus produces a large number of terpenoid indole alkaloids (TIAs) and is an excellent model for understanding the regulation of this class of valuable compounds. Recent work illustrates a possible role for the Catharanthus WRKY transcription factors (TFs) in regulating TIA biosynthesis. In Arabidopsis and other plants, the WRKY TF family is also shown to play important role in controlling tolerance to biotic and abiotic stresses, as well as secondary metabolism. Here, we describe the WRKY TF families in response to jasmonate in Arabidopsis and Catharanthus. Publically available Arabidopsis microarrays revealed at least 30% (22 of 72) of WRKY TFs respond to jasmonate treatments. Microarray analysis identified at least six jasmonate responsive Arabidopsis WRKY genes (AtWRKY7, AtWRKY20, AtWRKY26, AtWRKY45, AtWRKY48, and AtWRKY72) that have not been previously reported. The Catharanthus WRKY TF family is comprised of at least 48 members. Phylogenetic clustering reveals 11 group I, 32 group II, and 5 group III WRKY TFs. Furthermore, we found that at least 25% (12 of 48) were jasmonate responsive, and 75% (9 of 12) of the jasmonate responsive CrWRKYs are orthologs of AtWRKYs known to be regulated by jasmonate. Overall, the CrWRKY family, ascertained from transcriptome sequences, contains approximately 75% of the number of WRKYs found in other sequenced asterid species (pepper, tomato, potato, and bladderwort). Microarray and transcriptomic data indicate that expression of WRKY TFs in Arabidopsis and Catharanthus are under tight spatio-temporal and developmental control, and potentially have a significant role in jasmonate signaling. Profiling of CrWRKY expression in response to jasmonate treatment
Bloom, Chloe I; Graham, Christine M; Berry, Matthew P R; Rozakeas, Fotini; Redford, Paul S; Wang, Yuanyuan; Xu, Zhaohui; Wilkinson, Katalin A; Wilkinson, Robert J; Kendrick, Yvonne; Devouassoux, Gilles; Ferry, Tristan; Miyara, Makoto; Bouvry, Diane; Valeyre, Dominique; Dominique, Valeyre; Gorochov, Guy; Blankenship, Derek; Saadatian, Mitra; Vanhems, Phillip; Beynon, Huw; Vancheeswaran, Rama; Wickremasinghe, Melissa; Chaussabel, Damien; Banchereau, Jacques; Pascual, Virginia; Ho, Ling-Pei; Lipman, Marc; O'Garra, Anne
2013-01-01
New approaches to define factors underlying the immunopathogenesis of pulmonary diseases including sarcoidosis and tuberculosis are needed to develop new treatments and biomarkers. Comparing the blood transcriptional response of tuberculosis to other similar pulmonary diseases will advance knowledge of disease pathways and help distinguish diseases with similar clinical presentations. To determine the factors underlying the immunopathogenesis of the granulomatous diseases, sarcoidosis and tuberculosis, by comparing the blood transcriptional responses in these and other pulmonary diseases. We compared whole blood genome-wide transcriptional profiles in pulmonary sarcoidosis, pulmonary tuberculosis, to community acquired pneumonia and primary lung cancer and healthy controls, before and after treatment, and in purified leucocyte populations. An Interferon-inducible neutrophil-driven blood transcriptional signature was present in both sarcoidosis and tuberculosis, with a higher abundance and expression in tuberculosis. Heterogeneity of the sarcoidosis signature correlated significantly with disease activity. Transcriptional profiles in pneumonia and lung cancer revealed an over-abundance of inflammatory transcripts. After successful treatment the transcriptional activity in tuberculosis and pneumonia patients was significantly reduced. However the glucocorticoid-responsive sarcoidosis patients showed a significant increase in transcriptional activity. 144-blood transcripts were able to distinguish tuberculosis from other lung diseases and controls. Tuberculosis and sarcoidosis revealed similar blood transcriptional profiles, dominated by interferon-inducible transcripts, while pneumonia and lung cancer showed distinct signatures, dominated by inflammatory genes. There were also significant differences between tuberculosis and sarcoidosis in the degree of their transcriptional activity, the heterogeneity of their profiles and their transcriptional response to treatment.
Strategic human resources study of the upstream petroleum industry : the decade ahead
International Nuclear Information System (INIS)
2003-10-01
This report presents the results of a 10 month study of the human resources issues in Canada's upstream petroleum industry. The study identifies workforce demographics, skills, and supply and demand. It also discusses the impact of technology and other key challenges facing human resources issues. The upstream petroleum industry includes exploration and production, service industries, pipeline transmission, natural gas processing, and heavy oil and bitumen extracting and upgrading. The study defined four regions in Canada: Western Canada Sedimentary Basin, the oil sands, the north, and the east coast. The main influences on the management practices within the upstream petroleum industry are: globalization; cyclical economic conditions; operational excellence business models; government regulatory requirements; stakeholder expectations for involvement; technological advances; changing demographics, and workplace skills. The study also presented suggestions for changes in best practices to improve the efficiency and effectiveness of product and service delivery. refs., tabs., figs
International Nuclear Information System (INIS)
Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.
1987-01-01
The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site
Virlouvet, Laetitia; Ding, Yong; Fujii, Hiroaki; Avramova, Zoya; Fromm, Michael
2014-07-01
Plants subjected to a prior dehydration stress were seen to have altered transcriptional responses during a subsequent dehydration stress for up to 5 days after the initial stress. The abscisic acid (ABA) inducible RD29B gene of Arabidopsis thaliana was strongly induced after the first stress and displayed transcriptional memory with transcript levels nine-fold higher during the second dehydration stress. These increased transcript levels were due to an increased rate of transcription and are associated with an altered chromatin template during the recovery interval between the dehydration stresses. Here we use a combination of promoter deletion/substitutions, mutants in the trans-acting transcription factors and their upstream protein kinases, and treatments with exogenous ABA or dehydration stress to advance our understanding of the features required for transcriptional memory of RD29B. ABA Response Elements (ABREs) are sufficient to confer transcriptional memory on a minimal promoter, although there is a context effect from flanking sequences. Different mutations in Snf1 Related Protein Kinase 2 (SnRK2) genes positively and negatively affected the response, suggesting that this effect is important for transcriptional memory. Although exogenous ABA treatments could prime transcriptional memory, a second ABA treatment was not sufficient to activate transcriptional memory. Therefore, we concluded that transcriptional memory requires ABA and an ABA-independent factor that is induced or activated by a subsequent dehydration stress and directly or indirectly results in a more active RD29B chromatin template. These results advance our knowledge of the cis- and trans-acting factors that are required for transcriptional memory of RD29B. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Restructuring: new relationships between the oil companies and the upstream oil firms
International Nuclear Information System (INIS)
Barreau, S.
2001-11-01
Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)
The upstream escape of energized solar wind protons from the bow shock
International Nuclear Information System (INIS)
Greenstadt, E.W.
1975-01-01
Recently, there have been some systematic observations of backstreaming protons at the Earth's bow shock with parallel velocity components and total energies much too high to be associated with the usual long-period upstream waves or to be produced by Sonnerup's simple reflection process (Lin et al., 1974), and these protons (30-100keV) were attributed to some unknown acceleration mechanism in the upstream region. The observations of Lof et al. involved protons in high pitch angle, and, although their reasons for favoring an upstream acceleration were quite different, it may seem intuitive that high pitch angle particles would have difficulty escaping the shock, especially at large field-normal angles. Such an inference would superficially support the notion of energization outside the bow shock. It seems worthwhile therefore to examine the extent to which the geometry of individual particle motion alone might select among reflected particles those that can escape upstream and those that cannot. In this paper the geometry of escape is described and some simple numerical examples are worked out for a few special cases. It is found that protons with rather high energies and pitch angles can escape the shock at only marginally quasi-parallel field orientations (i.e., thetasub(nB) approximately 50 0 ), even if they have quite moderate speeds parallel to B. (Auth.)
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Upstream pressure variations associated with the bow shock and their effects on the magnetosphere
International Nuclear Information System (INIS)
Fairfield, D.H.; Baumjohann, W.; Paschmann, G.; Luehr, H.; Sibeck, D.G.
1990-01-01
Magnetic field enhancements and depressions on the time scales of minutes were frequently observed simultaneously by the AMPTE CCE, GOES 5, and GOES 6 spacecraft in the subsolar magnetosphere. The source of these perturbations has been detected in the high time resolution AMPTE IRM measurements of the kinetic pressure of the solar wind upstream of the bow shock. It is argued that these upstream pressure variations are not inherent in the solar wind but rather are associated with the bow shock. This conclusion follows from the facts that (1) the upstream field strength and the density associated with the perturbations are highly correlated with each other whereas these quantities tend to be anticorrelated in the undisturbed solar wind, and (2) the upstream perturbations occur within the foreshock or at its boundary. The results imply a mode of interaction between the solar wind and the magnetosphere whereby density changes produced in the foreshock subsequently convect through the bow shock and impinge on the magnetosphere. Also velocity decreases deep within the foreshock sometimes reach many tens of kilometers per second and may be associated with further pressure variations as a changing interplanetary field direction changes the foreshock geometry. Upstream pressure perturbations should create significant effects on the magnetopause and at the foot of nearby field lines that lead to the polar cusp ionosphere
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
Huin, Vincent; Buée, Luc; Behal, Hélène; Labreuche, Julien; Sablonnière, Bernard; Dhaenens, Claire-Marie
2017-10-03
Alternative promoter usage is an important mechanism for transcriptome diversity and the regulation of gene expression. Indeed, this alternative usage may influence tissue/subcellular specificity, protein translation and function of the proteins. The existence of an alternative promoter for MAPT gene was considered for a long time to explain differential tissue specificity and differential response to transcription and growth factors between mRNA transcripts. The alternative promoter usage could explain partly the different tau proteins expression patterns observed in tauopathies. Here, we report on our discovery of a functional alternative promoter for MAPT, located upstream of the gene's second exon (exon 1). By analyzing genome databases and brain tissue from control individuals and patients with Alzheimer's disease or progressive supranuclear palsy, we identified novel shorter transcripts derived from this alternative promoter. These transcripts are increased in patients' brain tissue as assessed by 5'RACE-PCR and qPCR. We suggest that these new MAPT isoforms can be translated into normal or amino-terminal-truncated tau proteins. We further suggest that activation of MAPT's alternative promoter under pathological conditions leads to the production of truncated proteins, changes in protein localization and function, and thus neurodegeneration.
Spatiotemporal behavior of nuclear cyclophilin B indicates a role in RNA transcription.
Dieriks, Birger; Van Oostveldt, Patrick
2012-06-01
Cyclophilin B (CypB) is an ubiquitously expressed protein, which performs several intra- and extracellular functions. Despite its abundant use as a household protein, little is known about its exact cellular localization and dynamics. In the present study we show that endogenous CypB localizes in one of two distinct compartments, either within the endoplasmic reticulum (ER) or inside the nucleus, accumulating in the fibrillar centers of the nucleoli. By means of a genetic deletion screen, we identified a minimal nucleolar localization signal for efficient relocation to the nucleoli. Within the fibrillar centers, CypB colocalized with RNA polymerase, upstream binding factor-1 (UBF), fibrillarin and dyskerin (DCK1). Even after chemical disruption of the nucleoli, a strong interaction with these proteins remained. Using live cell imaging, we showed a persistent colocalization of CypB with proteins involved in the ribosome biogenesis during the transcriptionally more active phases of the cell cycle. Supported by in silico data, our observations suggest that CypB interacts with these proteins and is involved in ribosome biogenesis and RNA transcription.
Directory of Open Access Journals (Sweden)
Tomotaka eShinya
2016-04-01
Full Text Available Eucalyptus species constitutes the most widely planted hardwood trees in temperate and subtropical regions. In this study, we compared the transcript levels of genes involved in lignocellulose formation such as cellulose, hemicellulose and lignin biosynthesis in two selected three-year old hybrid Eucalyptus (Eucalyptus urophylla x E. grandis genotypes (AM063 and AM380 that have different lignin content. AM063 and AM380 had 20.2 and 35.5% of Klason lignin content and 59.0% and 48.2%, -cellulose contents, respectively. We investigated the correlation between wood properties and transcript levels of wood formation-related genes using RNA-seq with total RNAs extracted from developing xylem tissues at a breast height. Transcript levels of cell wall construction genes such as cellulose synthase (CesA and sucrose synthase (SUSY were almost the same in both genotypes. However, AM063 exhibited higher transcript levels of UDP-glucose pyrophosphorylase (UGP and xyloglucan endotransglucoxylase (XTH than those in AM380. Most monolignol biosynthesis- related isozyme genes showed higher transcript levels in AM380. These results indicate monolignol biosynthesis-related genes may regulate wood composition in Eucalyptus. Flavonoids contents were also observed at much higher levels in AM380 as a result of the elevated transcript levels of common phenylpropanoid pathway genes, phenylalanine ammonium lyase (PAL, cinnamate-4-hydroxylase (C4H and 4-coumarate-CoA ligase (4CL. Secondary plant cell wall formation is regulated by many transcription factors. We analyzed genes encoding NAC, WRKY, AP2/ERF and KNOX transcription factors and found higher transcript levels of these genes in AM380. We also observed increased transcription of some MYB and LIM domain transcription factors in AM380 compared to AM063. All these results show that genes related to monolignol biosynthesis may regulate the wood composition and help maintain the ratio of cellulose and lignin contents
International Nuclear Information System (INIS)
Russell, C.T.; Smith, E.J.; Tsurutani, B.T.; Gosling, J.T.; Bame, S.J.
1982-01-01
All interplanetary shocks observed by ISEE-3 and either ISEE-1 or ISEE-2 or both in 1978 and 1979 are examined for evidence of upstream waves. In order to characterize the properties of these shocks it is necessary to determine accurate shock normals. We invert an overdetermined set of equations to obtain shock normals, velocities and error estimates for all these shocks. Tests of the method indicate it is quite reliable. Using these normals we then calculate the Mach number and angle between the interplanetary magnetic field and the shock normal for each shock. These parameters allow us to separate the upstream waves into two classes: whistler-mode precursors which occur at low Mach numbers and upstream turbulence whose amplitude at Mach numbers greater than 1.5 is controlled by the angle of the field to the shock normal. The former waves are right-hand circularly polarized and quite monochromatic. The latter waves are more linearly polarized and have a broadband featureless spectrum
Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects.
Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas
2017-06-01
This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L) of 192% over wild type (1.3 g/L). The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement.
Directory of Open Access Journals (Sweden)
Christina Rahayuningtyas
2014-01-01
Full Text Available The upstream Lesti watershed is one of the major watersheds of East Java in Indonesia, covering about 38093 hectares. Although there are enough water resources to meet current demands in the basin, many challenges including high spatial and temporal variability in precipitation from year to year exist. It is essential to understand how the climatic condition affects Lesti River stream flow in each sub basin. This study investigated the applicability of using the Soil and Water Assessment Tool (SWAT with the incorporation of groundwater recharge prediction in stream flow simulation in the upstream Lesti watershed. Four observation wells in the upstream Lesti watershed were used to evaluate the seasonal and annual variations in the water level and estimate the groundwater recharge in the deep aquifer. The results show that annual water level rise was within the 2800 - 5700 mm range in 2007, 3900 - 4700 mm in 2008, 3200 - 5100 mm in 2009, and 2800 - 4600 mm in 2010. Based on the specific yield and the measured water level rise, the area-weighted groundwater predictions at the watershed outlet are 736, 820.9, 786.7, 306.4 mm in 2007, 2008, 2009, and 2010, respectively. The consistency test reveals that the R-square statistical value is greater than 0.7, and the DV (% ranged from 32 - 55.3% in 2007 - 2010. Overall, the SWAT model performs better in the wet season flow simulation than the dry season. It is suggested that the SWAT model needs to be improved for stream flow simulation in tropical regions.
Torque fluctuations caused by upstream mean flow and turbulence
Farr, T. D.; Hancock, P. E.
2014-12-01
A series of studies are in progress investigating the effects of turbine-array-wake interactions for a range of atmospheric boundary layer states by means of the EnFlo meteorological wind tunnel. The small, three-blade model wind turbines drive 4-quadrant motor-generators. Only a single turbine in neutral flow is considered here. The motor-generator current can be measured with adequate sensitivity by means of a current sensor allowing the mean and fluctuating torque to be inferred. Spectra of torque fluctuations and streamwise velocity fluctuations ahead of the rotor, between 0.1 and 2 diameters, show that only the large-scale turbulent motions contribute significantly to the torque fluctuations. Time-lagged cross-correlation between upstream velocity and torque fluctuations are largest over the inner part of the blade. They also show the turbulence to be frozen in behaviour over the 2 diameters upstream of the turbine.
Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo
2014-04-01
The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells.
Zebrafish hoxd4a acts upstream of meis1.1 to direct vasculogenesis, angiogenesis and hematopoiesis.
Directory of Open Access Journals (Sweden)
Aseervatham Anusha Amali
Full Text Available Mice lacking the 4th-group paralog Hoxd4 display malformations of the anterior vertebral column, but are viable and fertile. Here, we report that zebrafish embryos having decreased function of the orthologous hoxd4a gene manifest striking perturbations in vasculogenesis, angiogenesis and primitive and definitive hematopoiesis. These defects are preceded by reduced expression of the hemangioblast markers scl1, lmo2 and fli1 within the posterior lateral plate mesoderm (PLM at 13 hours post fertilization (hpf. Epistasis analysis revealed that hoxd4a acts upstream of meis1.1 but downstream of cdx4 as early as the shield stage in ventral-most mesoderm fated to give rise to hemangioblasts, leading us to propose that loss of hoxd4a function disrupts hemangioblast specification. These findings place hoxd4a high in a genetic hierarchy directing hemangioblast formation downstream of cdx1/cdx4 and upstream of meis1.1. An additional consequence of impaired hoxd4a and meis1.1 expression is the deregulation of multiple Hox genes implicated in vasculogenesis and hematopoiesis which may further contribute to the defects described here. Our results add to evidence implicating key roles for Hox genes in their initial phase of expression early in gastrulation.
Fu, Shuang; Guo, Yan; Chen, Hong; Xu, Zhen-Ming; Qiu, Guang-Bin; Zhong, Ming; Sun, Kai-Lai; Fu, Wei-Neng
2011-01-01
Background MYCT1, a putative target of c-Myc, is a novel candidate tumor suppressor gene cloned from laryngeal squamous cell carcinoma (LSCC). Its transcriptional regulation and biological effects on LSCC have not been clarified. Methodology/Principal Findings Using RACE assay, we cloned a 1106 bp transcript named Myc target 1 transcript variant 1 (MYCT1-TV) and confirmed its transcriptional start site was located at 140 bp upstream of the ATG start codon of MYCT1-TV. Luciferase, electrophoretic mobility shift and chromatin immunoprecipitation assays confirmed c-Myc could regulate the promoter activity of MYCT1-TV by specifically binding to the E-box elements within −886 to −655 bp region. These results were further verified by site-directed mutagenesis and RNA interference (RNAi) assays. MYCT1-TV and MYCT1 expressed lower in LSCC than those in paired adjacent normal laryngeal tissues, and overexpression of MYCT1-TV and MYCT1 could inhibit cell proliferation and invasion and promote apoptosis in LSCC cells. Conclusions/Significance Our data indicate that MYCT1-TV, a novel MYCT1 transcript, is regulated by c-Myc and down-regulation of MYCT1-TV/MYCT1 could contribute to LSCC development and function. PMID:21998677
Khamis, Abdullah M.
2015-06-15
Honey bee colonies exhibit an age-related division of labor, with worker bees performing discrete sets of behaviors throughout their lifespan. These behavioral states are associated with distinct brain transcriptomic states, yet little is known about the regulatory mechanisms governing them. We used CAGEscan (a variant of the Cap Analysis of Gene Expression technique) for the first time to characterize the promoter regions of differentially expressed brain genes during two behavioral states (brood care (aka “nursing”) and foraging) and identified transcription factors (TFs) that may govern their expression. More than half of the differentially expressed TFs were associated with motifs enriched in the promoter regions of differentially expressed genes (DEGs), suggesting they are regulators of behavioral state. Strikingly, five TFs (nf-kb, egr, pax6, hairy, and clockwork orange) were predicted to co-regulate nearly half of the genes that were upregulated in foragers. Finally, differences in alternative TSS usage between nurses and foragers were detected upstream of 646 genes, whose functional analysis revealed enrichment for Gene Ontology terms associated with neural function and plasticity. This demonstrates for the first time that alternative TSSs are associated with stable differences in behavior, suggesting they may play a role in organizing behavioral state.
Directory of Open Access Journals (Sweden)
Guntur Fibriansah
Full Text Available PadR-like transcriptional regulators form a structurally-related family of proteins that control the expression of genes associated with detoxification, virulence and multi-drug resistance in bacteria. Only a few members of this family have been studied by genetic, biochemical and biophysical methods, and their structure/function relationships are still largely undefined. Here, we report the crystal structures of two PadR-like proteins from Bacillus cereus, which we named bcPadR1 and bcPadR2 (products of gene loci BC4206 and BCE3449 in strains ATCC 14579 and ATCC 10987, respectively. BC4206, together with its neighboring gene BC4207, was previously shown to become significantly upregulated in presence of the bacteriocin AS-48. DNA mobility shift assays reveal that bcPadR1 binds to a 250 bp intergenic region containing the putative BC4206-BC4207 promoter sequence, while in-situ expression of bcPadR1 decreases bacteriocin tolerance, together suggesting a role for bcPadR1 as repressor of BC4206-BC4207 transcription. The function of bcPadR2 (48% identical in sequence to bcPadR1 is unknown, but the location of its gene just upstream from genes encoding a putative antibiotic ABC efflux pump, suggests a role in regulating antibiotic resistance. The bcPadR proteins are structurally similar to LmrR, a PadR-like transcription regulator in Lactococcus lactis that controls expression of a multidrug ABC transporter via a mechanism of multidrug binding and induction. Together these proteins define a subfamily of conserved, relatively small PadR proteins characterized by a single C-terminal helix for dimerization. Unlike LmrR, bcPadR1 and bcPadR2 lack a central pore for ligand binding, making it unclear whether the transcriptional regulatory roles of bcPadR1 and bcPadR2 involve direct ligand recognition and induction.
Thomas, H.; Jaschkowitz, K.; Bulman, M.P.; Frayling, T.M.; Mitchell, S.M.; Roosen, S.; Lingott-Frieg, A.; Tack, C.J.J.; Ellard, S.; Ryffel, G.U.; Hattersley, A.T.
2001-01-01
Maturity-onset diabetes of the young (MODY) is a monogenic, autosomal dominant subtype of early-onset diabetes mellitus due to defective insulin secretion by the pancreatic beta-cell in humans. Five different genes have been identified including those encoding the tissue-specific transcription
Shaw, Dario Rangel
2017-11-23
Lysinibacillus sphaericus strain OT4b.31 is a bacterium widely applied in bioremediation processes of hydrocarbon and metal polluted environments. In this study, we identified the molecular mechanism underlying the Pb2+ and Cr6+ resistance. Metal uptake and temporal transcription patterns of metal resistance operons were evaluated using reverse-transcribed quantitative PCR amplification. The function of the resistance determinants was studied applying docking and in silico mutagenesis methods. The results revealed that the adaptation of Lysinibacillus sphaericus OT4b.31 to elevated levels of lead and chromium involves the pbr and chr operons which comprise a transcriptional regulatory component (pbrR and chrB) and efflux ATPases (pbrA and chrA) to expel ions from the cytoplasm. Expression of metal resistance genes was constitutive and specifically inducible to the exposure of Pb2+ and Cr6+. The simultaneous presence of cations didn\\'t affect the bioaccumulation of metals, evidencing the multimetal resistance of L. sphaericus. Docking analysis revealed the key metal-protein interactions and the conformational changes after metal or ATP binding. Results showed that residues with aromatic rings or imidazole in the catalytic domain are crucial for metal binding and achievement of the function. To our knowledge, this is the first report of a specific mechanism for lead and chromium resistance in Lysinibacillus genus. From the findings of this study, it is possible to suggest the bacterium as a suitable candidate for rapid toxic metals bioremediation processes.
DEFF Research Database (Denmark)
Pedersen, Jakob Madsen; Fredsøe, Jacob Christian; Rødgaard, Morten Terpager
2012-01-01
To investigate the role of DNA topoisomerases in transcription, we have studied global gene expression in Saccharomyces cerevisiae cells deficient for topoisomerases I and II and performed single-gene analyses to support our findings. The genome-wide studies show a general transcriptional down......-regulation upon lack of the enzymes, which correlates with gene activity but not gene length. Furthermore, our data reveal a distinct subclass of genes with a strong requirement for topoisomerases. These genes are characterized by high transcriptional plasticity, chromatin regulation, TATA box presence......-depth analysis of the inducible PHO5 gene reveals that topoisomerases are essential for binding of the Pho4p transcription factor to the PHO5 promoter, which is required for promoter nucleosome removal during activation. In contrast, topoisomerases are dispensable for constitutive transcription initiation...
Collisionless shocks and upstream waves and particles: Introductory remarks
International Nuclear Information System (INIS)
Kennel, C.F.
1981-01-01
We discuss more aspects of collisionless shock theory that might be pertinent to the problem of upstream waves and particles. It is hoped that our qualititive remarks may be a useful guide for the general reader as he goes through the detailed papers to come
Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G
2018-02-01
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
Yang, Yuping; Yan, Pengcheng; Yi, Che; Li, Wenzheng; Chai, Yuhui; Fei, Lingling; Gao, Ping; Zhao, Heping; Wang, Yingdian; Timko, Michael P; Wang, Bingwu; Han, Shengcheng
2017-08-01
Jasmonates (JAs) are well-known regulators of stress, defence, and secondary metabolism in plants, with JA perception triggering extensive transcriptional reprogramming, including both activation and/or repression of entire metabolic pathways. We performed RNA sequencing based transcriptomic profiling of tobacco BY-2 cells before and after treatment with methyl jasmonate (MeJA) to identify novel transcriptional regulators associated with alkaloid formation. A total of 107,140 unigenes were obtained through de novo assembly, and at least 33,213 transcripts (31%) encode proteins, in which 3419 transcription factors (TFs) were identified, representing 72 gene families, as well as 840 transcriptional regulators (TRs) distributed among 19 gene families. After MeJA treatment BY-2 cells, 7260 differentially expressed transcripts were characterised, which include 4443 MeJA-upregulated and 2817 MeJA-downregulated genes. Of these, 227 TFs/TRs in 36 families were specifically upregulated, and 102 TFs/TRs in 38 families were downregulated in MeJA-treated BY-2 cells. We further showed that the expression of 12 ethylene response factors and four basic helix-loop-helix factors increased at the transcriptional level after MeJA treatment in BY-2 cells and displayed specific expression patterns in nic mutants with or without MeJA treatments. Our data provide a catalogue of transcripts of tobacco BY-2 cells and benefit future study of JA-modulated regulation of secondary metabolism in tobacco. Copyright © 2017 Elsevier GmbH. All rights reserved.
Research on performance of upstream pumping mechanical seal with different deep spiral groove
International Nuclear Information System (INIS)
Wang, Q; Chen, H L; Liu, T; Liu, Y H; Liu, Z B; Liu, D H
2012-01-01
As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.
Research on performance of upstream pumping mechanical seal with different deep spiral groove
Wang, Q.; Chen, H. L.; Liu, T.; Liu, Y. H.; Liu, Z. B.; Liu, D. H.
2012-11-01
As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.
The relationship between transcription initiation RNAs and CCCTC-binding factor (CTCF localization
Directory of Open Access Journals (Sweden)
Taft Ryan J
2011-08-01
Full Text Available Abstract Background Transcription initiation RNAs (tiRNAs are nuclear localized 18 nucleotide RNAs derived from sequences immediately downstream of RNA polymerase II (RNAPII transcription start sites. Previous reports have shown that tiRNAs are intimately correlated with gene expression, RNA polymerase II binding and behaviors, and epigenetic marks associated with transcription initiation, but not elongation. Results In the present work, we show that tiRNAs are commonly found at genomic CCCTC-binding factor (CTCF binding sites in human and mouse, and that CTCF sites that colocalize with RNAPII are highly enriched for tiRNAs. To directly investigate the relationship between tiRNAs and CTCF we examined tiRNAs originating near the intronic CTCF binding site in the human tumor suppressor gene, p21 (cyclin-dependent kinase inhibitor 1A gene, also known as CDKN1A. Inhibition of CTCF-proximal tiRNAs resulted in increased CTCF localization and increased p21 expression, while overexpression of CTCF-proximal tiRNA mimics decreased CTCF localization and p21 expression. We also found that tiRNA-regulated CTCF binding influences the levels of trimethylated H3K27 at the alternate upstream p21 promoter, and affects the levels of alternate p21 (p21alt transcripts. Extending these studies to another randomly selected locus with conserved CTCF binding we found that depletion of tiRNA alters nucleosome density proximal to sites of tiRNA biogenesis. Conclusions Taken together, these data suggest that tiRNAs modulate local epigenetic structure, which in turn regulates CTCF localization.
Energy Technology Data Exchange (ETDEWEB)
Qin, Yuxiang, E-mail: yuxiangqin@126.com [Department of Biotechnology, University of Jinan, Jinan 250022 (China); Tian, Yanchen [The Key Laboratory of Plant Cell Engineering and Germplasm Innovation, Ministry of Education, School of Life Science, Shandong University, Jinan 250100 (China); Han, Lu; Yang, Xinchao [Department of Biotechnology, University of Jinan, Jinan 250022 (China)
2013-11-15
Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway.
International Nuclear Information System (INIS)
Qin, Yuxiang; Tian, Yanchen; Han, Lu; Yang, Xinchao
2013-01-01
Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway
Moreno, Heriberto; Linford, Alicia S; Gilchrist, Carol A; Petri, William A
2010-05-01
The Entamoeba histolytica upstream regulatory element 3-binding protein (URE3-BP) is a transcription factor that binds DNA in a Ca(2+)-inhibitable manner. The protein is located in both the nucleus and the cytoplasm but has also been found to be enriched in the plasma membrane of amebic trophozoites. We investigated the reason for the unusual localization of URE3-BP at the amebic plasma membrane. Here we identify and characterize a 22-kDa Ca(2+)-dependent binding partner of URE3-BP, EhC2A, a novel member of the C2-domain superfamily. Immunoprecipitations of URE3-BP and EhC2A showed that the proteins interact and that such interaction was enhanced in the presence of Ca(2+). Recombinant and native EhC2A bound phospholipid liposomes in a Ca(2+)-dependent manner, with half-maximal binding occurring at 3.4 muM free Ca(2+). A direct interaction between EhC2A and URE3-BP was demonstrated by the ability of recombinant EhC2A to recruit recombinant URE3-BP to phospholipid liposomes in a Ca(2+)-dependent manner. URE3-BP and EhC2A were observed to translocate to the amebic plasma membrane upon an increase in the intracellular Ca(2+) concentration of trophozoites, as revealed by subcellular fractionation and immunofluorescent staining. Short hairpin RNA-mediated knockdown of EhC2A protein expression significantly modulated the mRNA levels of URE3-BP-regulated transcripts. Based on these results, we propose a model for EhC2A-mediated regulation of the transcriptional activities of URE3-BP via Ca(2+)-dependent anchoring of the transcription factor to the amebic plasma membrane.
Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay A Amar; Zhu, Jian-Kang; Wohlschlegel, James A A.; Jacobsen, Steven E.
2010-01-01
DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.
Law, Julie A.
2010-05-01
DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Wincker Patrick
2009-12-01
Full Text Available Abstract Background Microsporidia are obligate intracellular eukaryotic parasites with genomes ranging in size from 2.3 Mbp to more than 20 Mbp. The extremely small (2.9 Mbp and highly compact (~1 gene/kb genome of the human parasite Encephalitozoon cuniculi has been fully sequenced. The aim of this study was to characterize noncoding motifs that could be involved in regulation of gene expression in E. cuniculi and to show whether these motifs are conserved among the phylum Microsporidia. Results To identify such signals, 5' and 3'RACE-PCR experiments were performed on different E. cuniculi mRNAs. This analysis confirmed that transcription overrun occurs in E. cuniculi and may result from stochastic recognition of the AAUAAA polyadenylation signal. Such experiments also showed highly reduced 5'UTR's (E. cuniculi genes presented a CCC-like motif immediately upstream from the coding start. To characterize other signals involved in differential transcriptional regulation, we then focused our attention on the gene family coding for ribosomal proteins. An AAATTT-like signal was identified upstream from the CCC-like motif. In rare cases the cytosine triplet was shown to be substituted by a GGG-like motif. Comparative genomic studies confirmed that these different signals are also located upstream from genes encoding ribosomal proteins in other microsporidian species including Antonospora locustae, Enterocytozoon bieneusi, Anncaliia algerae (syn. Brachiola algerae and Nosema ceranae. Based on these results a systematic analysis of the ~2000 E. cuniculi coding DNA sequences was then performed and brings to highlight that 364 translation initiation codons (18.29% of total CDSs had been badly predicted. Conclusion We identified various signals involved in the maturation of E. cuniculi mRNAs. Presence of such signals, in phylogenetically distant microsporidian species, suggests that a common regulatory mechanism exists among the microsporidia. Furthermore
Directory of Open Access Journals (Sweden)
Shibo Ying
Full Text Available UBC9 encodes a protein that conjugates small ubiquitin-related modifier (SUMO to target proteins thereby changing their functions. Recently, it was noted that UBC9 expression and activity play a role in breast tumorigenesis and response to anticancer drugs. However, the underlying mechanism is poorly understood. To investigate the transcriptional regulation of the UBC9 gene, we identified and characterized its promoter and cis-elements. Promoter activity was tested using luciferase reporter assays. The binding of transcription factors to the promoter was detected by chromatin immunoprecipitation (ChIP, and their functional role was confirmed by siRNA knockdown. UBC9 mRNA and protein levels were measured by quantitative reverse transcription PCR and Western blot analysis, respectively. An increased expression of UBC9 mRNA and protein was found in MCF-7 breast cancer cells treated with 17β-estradiol (E2. Analysis of various deletion mutants revealed a 137 bp fragment upstream of the transcription initiation site to be sufficient for reporter gene transcription. Mutations of putative estrogen receptor α (ER-α (one imperfect estrogen response element, ERE and/or nuclear factor Y (NF-Y binding sites (two CCAAT boxes markedly reduced promoter activity. Similar results were obtained in ER-negative MDA-MB-231 cells except that the ERE mutation did not affect promoter activity. Additionally, promoter activity was stimulated upon E2 treatment and overexpression of ER-α or NF-YA in MCF-7 cells. ChIP confirmed direct binding of both transcription factors to the UBC9 promoter in vivo. Furthermore, UBC9 expression was diminished by ER-α and NF-Y siRNAs on the mRNA and protein levels. In conclusion, we identified the proximal UBC9 promoter and provided evidence that ER-α and NF-Y regulate UBC9 expression on the transcriptional level in response to E2 in MCF-7 cells. These findings may contribute to a better understanding of the regulation of UBC9 in ER
Boldogköi, Zsolt
2012-01-01
The regulation of gene expression is essential for normal functioning of biological systems in every form of life. Gene expression is primarily controlled at the level of transcription, especially at the phase of initiation. Non-coding RNAs are one of the major players at every level of genetic regulation, including the control of chromatin organization, transcription, various post-transcriptional processes, and translation. In this study, the Transcriptional Interference Network (TIN) hypothesis was put forward in an attempt to explain the global expression of antisense RNAs and the overall occurrence of tandem gene clusters in the genomes of various biological systems ranging from viruses to mammalian cells. The TIN hypothesis suggests the existence of a novel layer of genetic regulation, based on the interactions between the transcriptional machineries of neighboring genes at their overlapping regions, which are assumed to play a fundamental role in coordinating gene expression within a cluster of functionally linked genes. It is claimed that the transcriptional overlaps between adjacent genes are much more widespread in genomes than is thought today. The Waterfall model of the TIN hypothesis postulates a unidirectional effect of upstream genes on the transcription of downstream genes within a cluster of tandemly arrayed genes, while the Seesaw model proposes a mutual interdependence of gene expression between the oppositely oriented genes. The TIN represents an auto-regulatory system with an exquisitely timed and highly synchronized cascade of gene expression in functionally linked genes located in close physical proximity to each other. In this study, we focused on herpesviruses. The reason for this lies in the compressed nature of viral genes, which allows a tight regulation and an easier investigation of the transcriptional interactions between genes. However, I believe that the same or similar principles can be applied to cellular organisms too.
Directory of Open Access Journals (Sweden)
Zsolt eBoldogkoi
2012-07-01
Full Text Available The regulation of gene expression is essential for normal functioning of biological systems in every form of life. Gene expression is primarily controlled at the level of transcription, especially at the phase of initiation. Non-coding RNAs are one of the major players at every level of genetic regulation, including the control of chromatin organisation, transcription, various post-transcriptional processes and translation. In this study, the Transcriptional Interference Network (TIN hypothesis was put forward in an attempt to explain the global expression of antisense RNAs and the overall occurrence of tandem gene clusters in the genomes of various biological systems ranging from viruses to mammalian cells. The TIN hypothesis suggests the existence of a novel layer of genetic regulation, based on the interactions between the transcriptional machineries of neighbouring genes at their overlapping regions, which are assumed to play a fundamental role in coordinating gene expression within a cluster of functionally-linked genes. It is claimed that the transcriptional overlaps between adjacent genes are much more widespread in genomes than is thought today. The Waterfall model of the TIN hypothesis postulates a unidirectional effect of upstream genes on the transcription of downstream genes within a cluster of tandemly-arrayed genes, while the Seesaw model proposes a mutual interdependence of gene expression between the oppositely-oriented genes. The TIN represents an auto-regulatory system with an exquisitely timed and highly synchronised cascade of gene expression in functionally-linked genes located in close physical proximity to each other. In this study, we focused on herpesviruses. The reason for this lies in the compressed nature of viral genes, which allows a tight regulation and an easier investigation of the transcriptional interactions between genes. However, I believe that the same or similar principles can be applied to cellular
Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects
Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas
2017-01-01
This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P...
Employee assistance programs in the upstream petroleum industry
International Nuclear Information System (INIS)
Crutcher, R.A.; Yip, R.Y.; Young, M.R.
1991-01-01
This paper is a descriptive overview of Employee Assistance Programs (EAPs) in the upstream Canadian petroleum industry. The authors review current EAP models within the occupational health setting and the Canadian health care context. This article also explores the challenging issues of EAP's emergent functions in workplace substance abuse programs, its changing role in organizational effectiveness and its professional identity
Battles and hijacks: Noncoding transcription in plants
Ariel, Federico
2015-06-01
Noncoding RNAs have emerged as major components of the eukaryotic transcriptome. Genome-wide analyses revealed the existence of thousands of long noncoding RNAs (lncRNAs) in several plant species. Plant lncRNAs are transcribed by the plant-specific RNA polymerases Pol IV and Pol V, leading to transcriptional gene silencing, as well as by Pol II. They are involved in a wide range of regulatory mechanisms impacting on gene expression, including chromatin remodeling, modulation of alternative splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates the current knowledge on the regulatory mechanisms acting through plant noncoding transcription. © 2015 Elsevier Ltd.
Kulakovskiy, Ivan V.
2011-08-18
Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding of the transcription regulatory code. Results: We constructed binding motifs for TFs forming a complex with HIF-1α at the erythropoietin 3\\'-enhancer. Corresponding TFBSs were predicted in the segments around transcription start sites (TSSs) of all human genes. Using the genome-wide set of regulatory regions, we observed several strongly preferred distances between hypoxia-responsive element (HRE) and binding sites of a particular cofactor protein. The set of preferred distances was called as a preferred pair distance template (PPDT). PPDT dramatically depended on the TF and orientation of its binding sites relative to HRE. PPDT evaluated from the genome-wide set of regulatory sequences was used to detect significant PPDT-consistent binding site pairs in regulatory regions of hypoxia-responsive genes. We believe PPDT can help to reveal the layout of eukaryotic regulatory segments. © The Author 2011. Published by Oxford University Press. All rights reserved.
Pyrosequencing data reveals tissue-specific expression of lineage-specific transcripts in chickpea
Garg, Rohini; Jain, Mukesh
2011-01-01
Chickpea is a very important crop legume plant, which provides a protein-rich supplement to cereal-based diets and has the ability to fix atmospheric nitrogen. Despite its economic importance, the functional genomic resources for chickpea are very limited. Recently, we reported the complete transcriptome of chickpea using next generation sequencing technologies. We analyzed the tissue-specific expression of chickpea transcripts based on RNA-seq data. In addition, we identified two sets of lin...
Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects
Directory of Open Access Journals (Sweden)
Ana Maria Salazar-Bryam
2017-06-01
Full Text Available This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1 was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L of 192% over wild type (1.3 g/L. The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement. Keywords: Biotechnology, Microbiology
DNA residence time is a regulatory factor of transcription repression
Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette
2017-01-01
Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492
2011-01-01
Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to
Increased risk of oesophageal adenocarcinoma among upstream petroleum workers
Kirkeleit, Jorunn; Riise, Trond; Bjørge, Tone; Moen, Bente E; Bråtveit, Magne; Christiani, David C
2013-01-01
Objectives To investigate cancer risk, particularly oesophageal cancer, among male upstream petroleum workers offshore potentially exposed to various carcinogenic agents. Methods Using the Norwegian Registry of Employers and Employees, 24 765 male offshore workers registered from 1981 to 2003 was compared with 283 002 male referents from the general working population matched by age and community of residence. The historical cohort was linked to the Cancer Registry of Norway and the Norwegian Cause of Death Registry. Results Male offshore workers had excess risk of oesophageal cancer (RR 2.6, 95% CI 1.4 to 4.8) compared with the reference population. Only the adenocarcinoma type had a significantly increased risk (RR 2.7, 95% CI 1.0 to 7.0), mainly because of an increased risk among upstream operators (RR 4.3, 95% CI 1.3 to 14.5). Upstream operators did not have significant excess of respiratory system or colon cancer or mortality from any other lifestyle-related diseases investigated. Conclusion We found a fourfold excess risk of oesophageal adenocarcinoma among male workers assumed to have had the most extensive contact with crude oil. Due to the small number of cases, and a lack of detailed data on occupational exposure and lifestyle factors associated with oesophageal adenocarcinoma, the results must be interpreted with caution. Nevertheless, given the low risk of lifestyle-related cancers and causes of death in this working group, the results add to the observations in other low-powered studies on oesophageal cancer, further suggesting that factors related to the petroleum stream or carcinogenic agents used in the production process might be associated with risk of oesophageal adenocarcinoma. PMID:19858535
Energy Technology Data Exchange (ETDEWEB)
Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)
2009-07-31
The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.
Bottacini, Francesca; Zomer, Aldert; Milani, Christian; Ferrario, Chiara; Lugli, Gabriele Andrea; Egan, Muireann; Ventura, Marco; van Sinderen, Douwe
2017-12-28
Bifidobacterium breve represents a common member of the infant gut microbiota and its presence in the gut has been associated with host well being. For this reason it is relevant to investigate and understand the molecular mechanisms underlying the establishment, persistence and activities of this gut commensal in the host environment. The assessment of vegetative promoters in the bifidobacterial prototype Bifidobacterium breve UCC2003 was performed employing a combination of RNA tiling array analysis and cDNA sequencing. Canonical -10 (TATAAT) and -35 (TTGACA) sequences were identified upstream of transcribed genes or operons, where deviations from this consensus correspond to transcription level variations. A Random Forest analysis assigned the -10 region of B. breve promoters as the element most impacting on the level of transcription, followed by the spacer length and the 5'-UTR length of transcripts. Furthermore, our transcriptome study also identified rho-independent termination as the most common and effective termination signal of highly and moderately transcribed operons in B. breve. The present study allowed us to identify genes and operons that are actively transcribed in this organism during logarithmic growth, and link promoter elements with levels of transcription of essential genes in this organism. As homologs of many of our identified genes are present across the whole genus Bifidobacterium, our dataset constitutes a transcriptomic reference to be used for future investigations of gene expression in members of this genus.
Weyman, Philip D; Beeri, Karen; Lefebvre, Stephane C; Rivera, Josefa; McCarthy, James K; Heuberger, Adam L; Peers, Graham; Allen, Andrew E; Dupont, Christopher L
2015-05-01
Diatoms are unicellular photosynthetic algae with promise for green production of fuels and other chemicals. Recent genome-editing techniques have greatly improved the potential of many eukaryotic genetic systems, including diatoms, to enable knowledge-based studies and bioengineering. Using a new technique, transcription activator-like effector nucleases (TALENs), the gene encoding the urease enzyme in the model diatom, Phaeodactylum tricornutum, was targeted for interruption. The knockout cassette was identified within the urease gene by PCR and Southern blot analyses of genomic DNA. The lack of urease protein was confirmed by Western blot analyses in mutant cell lines that were unable to grow on urea as the sole nitrogen source. Untargeted metabolomic analysis revealed a build-up of urea, arginine and ornithine in the urease knockout lines. All three intermediate metabolites are upstream of the urease reaction within the urea cycle, suggesting a disruption of the cycle despite urea production. Numerous high carbon metabolites were enriched in the mutant, implying a breakdown of cellular C and N repartitioning. The presented method improves the molecular toolkit for diatoms and clarifies the role of urease in the urea cycle. © 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Francisco, Joel Celio; Dai, Qian; Luo, Zhuojuan; Wang, Yan; Chong, Roxanne Hui-Heng; Tan, Yee Joo; Xie, Wei; Lee, Guan-Huei; Lin, Chengqi
2017-10-01
Chronic hepatitis B virus (HBV) infection can lead to liver cirrhosis and hepatocellular carcinoma. HBV reactivation during or after chemotherapy is a potentially fatal complication for cancer patients with chronic HBV infection. Transcription of HBV is a critical intermediate step of the HBV life cycle. However, factors controlling HBV transcription remain largely unknown. Here, we found that different P-TEFb complexes are involved in the transcription of the HBV viral genome. Both BRD4 and the super elongation complex (SEC) bind to the HBV genome. The treatment of bromodomain inhibitor JQ1 stimulates HBV transcription and increases the occupancy of BRD4 on the HBV genome, suggesting the bromodomain-independent recruitment of BRD4 to the HBV genome. JQ1 also leads to the increased binding of SEC to the HBV genome, and SEC is required for JQ1-induced HBV transcription. These findings reveal a novel mechanism by which the HBV genome hijacks the host P-TEFb-containing complexes to promote its own transcription. Our findings also point out an important clinical implication, that is, the potential risk of HBV reactivation during therapy with a BRD4 inhibitor, such as JQ1 or its analogues, which are a potential treatment for acute myeloid leukemia. Copyright © 2017 American Society for Microbiology.
Transcriptional landscape of Mycobacterium tuberculosis infection in macrophages
Roy, Sugata
2018-04-24
Mycobacterium tuberculosis (Mtb) infection reveals complex and dynamic host-pathogen interactions, leading to host protection or pathogenesis. Using a unique transcriptome technology (CAGE), we investigated the promoter-based transcriptional landscape of IFNγ (M1) or IL-4/IL-13 (M2) stimulated macrophages during Mtb infection in a time-kinetic manner. Mtb infection widely and drastically altered macrophage-specific gene expression, which is far larger than that of M1 or M2 activations. Gene Ontology enrichment analysis for Mtb-induced differentially expressed genes revealed various terms, related to host-protection and inflammation, enriched in up-regulated genes. On the other hand, terms related to dis-regulation of cellular functions were enriched in down-regulated genes. Differential expression analysis revealed known as well as novel transcription factor genes in Mtb infection, many of them significantly down-regulated. IFNγ or IL-4/IL-13 pre-stimulation induce additional differentially expressed genes in Mtb-infected macrophages. Cluster analysis uncovered significant numbers, prolonging their expressional changes. Furthermore, Mtb infection augmented cytokine-mediated M1 and M2 pre-activations. In addition, we identified unique transcriptional features of Mtb-mediated differentially expressed lncRNAs. In summary we provide a comprehensive in depth gene expression/regulation profile in Mtb-infected macrophages, an important step forward for a better understanding of host-pathogen interaction dynamics in Mtb infection.
Wind Predictions Upstream Wind Turbines from a LiDAR Database
Directory of Open Access Journals (Sweden)
Soledad Le Clainche
2018-03-01
Full Text Available This article presents a new method to predict the wind velocity upstream a horizontal axis wind turbine from a set of light detection and ranging (LiDAR measurements. The method uses higher order dynamic mode decomposition (HODMD to construct a reduced order model (ROM that can be extrapolated in space. LiDAR measurements have been carried out upstream a wind turbine at six different planes perpendicular to the wind turbine axis. This new HODMD-based ROM predicts with high accuracy the wind velocity during a timespan of 24 h in a plane of measurements that is more than 225 m far away from the wind turbine. Moreover, the technique introduced is general and obtained with an almost negligible computational cost. This fact makes it possible to extend its application to both vertical axis wind turbines and real-time operation.
Directory of Open Access Journals (Sweden)
Érica L. Fonseca
2015-11-01
Full Text Available The gene cassettes found in class 1 integrons are generally promoterless units composed by an open reading frame (ORF, a short 5’ untranslated region (UTR and a 3’ recombination site (attC. Fused gene cassettes are generated by partial or total loss of the attC from the first cassette in an array, creating, in some cases, a fusion with the ORF from the next cassette. These structures are rare and little is known about their mechanisms of mobilization and expression. The aim of this study was to evaluate the dynamic of mobilization and transcription of the gcu14-blaGES-1/aacA4 gene cassette array, which harbours a fused gene cassette represented by blaGES-1/aacA4. The cassette array was analyzed by Northern blot and real-time reverse transcription-polymerase chain reaction (RT-PCR in order to assess the transcription mechanism of blaGES-1/aacA4 fused cassette. Also, inverse polymerase chain reactions (PCR were performed to detect the free circular forms of gcu14, blaGES-1 and aacA4. The Northern blot and real time RT-PCR revealed a polycistronic transcription, in which the fused cassette blaGES-1/aacA4 is transcribed as a unique gene, while gcu14 (with a canonical attC recombination site has a monocistronic transcription. The gcu14 cassette, closer to the weak configuration of cassette promoter (PcW, had a higher transcription level than blaGES-1/aacA4, indicating that the cassette position affects the transcript amounts. The presence of ORF-11 at attI1, immediately preceding gcu14, and of a Shine-Dalgarno sequence upstream blaGES-1/aacA4 composes a scenario for the occurrence of array translation. Inverse PCR generated amplicons corresponding to gcu14, gcu14-aacA4 and gcu14-blaGES-1/aacA4 free circular forms, but not to blaGES-1 and aacA4 alone, indicating that the GES-1 truncated attC is not substrate of integrase activity and that these genes are mobilized together as a unique cassette. This study was original in showing the transcription
Directory of Open Access Journals (Sweden)
Su Zhen
2011-07-01
Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.
2011-01-01
Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548
Directory of Open Access Journals (Sweden)
Chapika Sangkapitux
2009-04-01
Full Text Available Providing compensation for agricultural conservation practices adopted by upstream farmers is still an alien concept in the Thai political context. The governance of common-pool natural resources, such as forest and water, has traditionally been under the control of powerful government line agencies, while the contribution of local communities to natural resource conservation have been hardly recognized by policy-makers. Drawing on a case study in Mae Sa watershed, Chiang Mai province, northern Thailand, this paper discusses the potential of developing compensation schemes in a socio-political context where upland farmers – mostly belonging to ethnic minority groups – tend to be considered a threat to the natural resource base rather than providers of environmental services. Based on data obtained from 371 households in the upstream communities and 151 households in the downstream communities of the watershed, upstream resource managers’ willingness to accept compensation for the conservation measures and downstream resource managers’ willingness to pay for water resource improvements were estimated through the use of choice experiments. Results from the study suggest that downstream resource managers would be willing to provide on average nearly 1% of their annual income for a substantial improvement of the quantity and quality of water resources, which could be achieved by compensating upstream farmers’ change of their agricultural systems towards more environment-friendly practices. Both willingness to pay of downstream respondents and willingness of upstream resource managers to accept compensation were positively correlated with age, education, participation in environmental conservation activities and previous experiences with droughts and/or erosion. The paper concludes that there is a clear potential for establishing compensation schemes for provision of environmental services in northern Thai watersheds. The important policy
Nosaka, Kazuto; Esaki, Hiroyoshi; Onozuka, Mari; Konno, Hiroyuki; Hattori, Yasunao; Akaji, Kenichi
2012-05-01
In Saccharomyces cerevisiae, genes involved in thiamin pyrophosphate (TPP) synthesis (THI genes) and the pyruvate decarboxylase structural gene PDC5 are transcriptionally induced in response to thiamin starvation. Three positive regulatory factors (Thi2p, Thi3p, and Pdc2p) are involved in the expression of THI genes, whereas only Pdc2p is required for the expression of PDC5. Thi2p and Pdc2p serve as transcriptional activators and each factor can interact with Thi3p. The target consensus DNA sequence of Thi2p has been deduced. When TPP is not bound to Thi3p, the interactions between the regulatory factors are increased and THI gene expression is upregulated. In this study, we demonstrated that Pdc2p interacts with the upstream region of THI genes and PDC5. The association of Pdc2p or Thi2p with THI gene promoters was enhanced by thiamin starvation, suggesting that Pdc2p and Thi2p assist each other in their recruitment to the THI promoters via interaction with Thi3p. It is highly likely that, under thiamin-deprived conditions, a ternary Thi2p/Thi3p/Pdc2p complex is formed and transactivates THI genes in yeast cells. On the other hand, the association of Pdc2p with PDC5 was unaffected by thiamin. We also identified a DNA element in the upstream region of PDC5, which can bind to Pdc2p and is required for the expression of PDC5. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Metagenomic screening for aromatic compound-responsive transcriptional regulators.
Directory of Open Access Journals (Sweden)
Taku Uchiyama
Full Text Available We applied a metagenomics approach to screen for transcriptional regulators that sense aromatic compounds. The library was constructed by cloning environmental DNA fragments into a promoter-less vector containing green fluorescence protein. Fluorescence-based screening was then performed in the presence of various aromatic compounds. A total of 12 clones were isolated that fluoresced in response to salicylate, 3-methyl catechol, 4-chlorocatechol and chlorohydroquinone. Sequence analysis revealed at least 1 putative transcriptional regulator, excluding 1 clone (CHLO8F. Deletion analysis identified compound-specific transcriptional regulators; namely, 8 LysR-types, 2 two-component-types and 1 AraC-type. Of these, 9 representative clones were selected and their reaction specificities to 18 aromatic compounds were investigated. Overall, our transcriptional regulators were functionally diverse in terms of both specificity and induction rates. LysR- and AraC- type regulators had relatively narrow specificities with high induction rates (5-50 fold, whereas two-component-types had wide specificities with low induction rates (3 fold. Numerous transcriptional regulators have been deposited in sequence databases, but their functions remain largely unknown. Thus, our results add valuable information regarding the sequence-function relationship of transcriptional regulators.
Shukunami, Chisa; Takimoto, Aki; Nishizaki, Yuriko; Yoshimoto, Yuki; Tanaka, Seima; Miura, Shigenori; Watanabe, Hitomi; Sakuma, Tetsushi; Yamamoto, Takashi; Kondoh, Gen; Hiraki, Yuji
2018-02-16
Tenomodulin (Tnmd) is a type II transmembrane glycoprotein predominantly expressed in tendons and ligaments. We found that scleraxis (Scx), a member of the Twist-family of basic helix-loop-helix transcription factors, is a transcriptional activator of Tnmd expression in tenocytes. During embryonic development, Scx expression preceded that of Tnmd. Tnmd expression was nearly absent in tendons and ligaments of Scx-deficient mice generated by transcription activator-like effector nucleases-mediated gene disruption. Tnmd mRNA levels were dramatically decreased during serial passages of rat tenocytes. Scx silencing by small interfering RNA significantly suppressed endogenous Tnmd mRNA levels in tenocytes. Mouse Tnmd contains five E-box sites in the ~1-kb 5'-flanking region. A 174-base pair genomic fragment containing a TATA box drives transcription in tenocytes. Enhancer activity was increased in the upstream region (-1030 to -295) of Tnmd in tenocytes, but not in NIH3T3 and C3H10T1/2 cells. Preferential binding of both Scx and Twist1 as a heterodimer with E12 or E47 to CAGATG or CATCTG and transactivation of the 5'-flanking region were confirmed by electrophoresis mobility shift and dual luciferase assays, respectively. Scx directly transactivates Tnmd via these E-boxes to positively regulate tenocyte differentiation and maturation.
Directory of Open Access Journals (Sweden)
Elizabeth A Rach
2011-01-01
Full Text Available The application of deep sequencing to map 5' capped transcripts has confirmed the existence of at least two distinct promoter classes in metazoans: "focused" promoters with transcription start sites (TSSs that occur in a narrowly defined genomic span and "dispersed" promoters with TSSs that are spread over a larger window. Previous studies have explored the presence of genomic features, such as CpG islands and sequence motifs, in these promoter classes, but virtually no studies have directly investigated the relationship with chromatin features. Here, we show that promoter classes are significantly differentiated by nucleosome organization and chromatin structure. Dispersed promoters display higher associations with well-positioned nucleosomes downstream of the TSS and a more clearly defined nucleosome free region upstream, while focused promoters have a less organized nucleosome structure, yet higher presence of RNA polymerase II. These differences extend to histone variants (H2A.Z and marks (H3K4 methylation, as well as insulator binding (such as CTCF, independent of the expression levels of affected genes. Notably, differences are conserved across mammals and flies, and they provide for a clearer separation of promoter architectures than the presence and absence of CpG islands or the occurrence of stalled RNA polymerase. Computational models support the stronger contribution of chromatin features to the definition of dispersed promoters compared to focused start sites. Our results show that promoter classes defined from 5' capped transcripts not only reflect differences in the initiation process at the core promoter but also are indicative of divergent transcriptional programs established within gene-proximal nucleosome organization.
Canada's upstream petroleum industry : 1997 perspective
International Nuclear Information System (INIS)
1997-06-01
A review of the trends and activities in the upstream petroleum industry during 1996 were presented, emphasizing the significance of the industry' contribution to Canada's economy. Among the areas included were highlights of Canada's hydrocarbon reserves, conventional production, frontier production, and non-conventional (oil sands) production. New market opportunities and activities in the pipeline transportation sector were also discussed. Environmental issues including health and safety received due attention. In this regard, the industry's efforts to work with government and other stakeholders to ensure that requirements for land use are balanced with the need to protect wilderness and wildlife habitat, received special mention. 16 figs
Munia, Hafsa Ahmed; Guillaume, Joseph H. A.; Mirumachi, Naho; Wada, Yoshihide; Kummu, Matti
2018-05-01
Countries sharing river basins are often dependent upon water originating outside their boundaries; meaning that without that upstream water, water scarcity may occur with flow-on implications for water use and management. We develop a formalisation of this concept drawing on ideas about the transition between regimes from resilience literature, using water stress and water shortage as indicators of water scarcity. In our analytical framework, dependency occurs if water from upstream is needed to avoid scarcity. This can be diagnosed by comparing different types of water availability on which a sub-basin relies, in particular local runoff and upstream inflows. At the same time, possible upstream water withdrawals reduce available water downstream, influencing the latter water availability. By developing a framework of scarcity and dependency, we contribute to the understanding of transitions between system regimes. We apply our analytical framework to global transboundary river basins at the scale of sub-basin areas (SBAs). Our results show that 1175 million people live under water stress (42 % of the total transboundary population). Surprisingly, the majority (1150 million) of these currently suffer from stress only due to their own excessive water use and possible water from upstream does not have impact on the stress status - i.e. they are not yet dependent on upstream water to avoid stress - but could still impact on the intensity of the stress. At the same time, 386 million people (14 %) live in SBAs that can avoid stress owing to available water from upstream and have thus upstream dependency. In the case of water shortage, 306 million people (11 %) live in SBAs dependent on upstream water to avoid possible shortage. The identification of transitions between system regimes sheds light on how SBAs may be affected in the future, potentially contributing to further refined analysis of inter- and intrabasin hydro-political power relations and strategic planning
Jiang, Guimei; Jiang, Xinqiang; Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing
2014-01-01
Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory seq...
Sakurai, Shunya; Shimizu, Toshiyuki; Ohto, Umeharu
2017-10-27
2,3,7,8-Tetrachlorodibenzo- p -dioxin and related compounds are extraordinarily potent environmental toxic pollutants. Most of the 2,3,7,8-tetrachlorodibenzo- p -dioxin toxicities are mediated by aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor belonging to the basic helix-loop-helix (bHLH) Per-ARNT-Sim (PAS) family. Upon ligand binding, AhR forms a heterodimer with AhR nuclear translocator (ARNT) and induces the expression of genes involved in various biological responses. One of the genes induced by AhR encodes AhR repressor (AhRR), which also forms a heterodimer with ARNT and represses the activation of AhR-dependent transcription. The control of AhR activation is critical for managing AhR-mediated diseases, but the mechanisms by which AhRR represses AhR activation remain poorly understood, because of the lack of structural information. Here, we determined the structure of the AhRR-ARNT heterodimer by X-ray crystallography, which revealed an asymmetric intertwined domain organization presenting structural features that are both conserved and distinct among bHLH-PAS family members. The structures of AhRR-ARNT and AhR-ARNT were similar in the bHLH-PAS-A region, whereas the PAS-B of ARNT in the AhRR-ARNT complex exhibited a different domain arrangement in this family reported so far. The structure clearly disclosed that AhRR competitively represses AhR binding to ARNT and target DNA and further suggested the existence of an AhRR-ARNT-specific repression mechanism. This study provides a structural basis for understanding the mechanism by which AhRR represses AhR-mediated gene transcription. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Brauburger, Kristina; Boehmann, Yannik; Tsuda, Yoshimi; Hoenen, Thomas; Olejnik, Judith; Schümann, Michael; Ebihara, Hideki; Mühlberger, Elke
2014-11-01
Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3' end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined
Environmental regulatory framework for the upstream petroleum industry
International Nuclear Information System (INIS)
1996-01-01
In order to provide its member companies with a useful reference document in environmental analysis and compliance, CAPP compiled a list of Canadian legislation, regulations and guidelines which relate to the upstream petroleum industry. Text of all federal, Alberta, British Columbia and Saskatchewan legislation, regulations, guidelines and related documents were provided. Pending legislation, regulations and government policy have been identified. Annual updates will be provided to all subscribers
Effects on the upstream flood inundation caused from the operation of Chao Phraya Dam
Directory of Open Access Journals (Sweden)
Sutham Visutimeteegorn
2007-11-01
Full Text Available During the flooding events, the operation of Chao Phraya Dam to control downstream water discharge is one of the causes of the inundation occuring over the upstream area. The purposes of this research are to study the effects of the operation of Chao Phraya Dam upon the upstream flood inundation and to find out the new measures of the flood mitigation in the upstream areas of Chao Phraya Dam by using a hydrodynamic model. The results show that Manning's n in the Chao Phraya River and its tributaries is 0.030-0.035 in the main channels and 0.050-0.070 in the flood plain areas. The backwater due to the operation of the Chao Praya dam affects as far as 110 kilometers upstream. New methods of water diversion can mitigate the flood inundation without the effect on the floating rice fields. The construction of reservoirs in the Upper Sakaekang River Basin and the Upper Yom River Basin will mitigate the flood not only in their own basins but also in the Lower Chao Phraya River Basin. The coordinated operation of the Chao Phraya Dam, the regulators and the upper basin reservoirs will efficiently mitigate the flood inundation.
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
MESSENGER Magnetic Field Observations of Upstream Ultra-Low Frequency Waves at Mercury
Le, G.; Chi, P. J.; Boardsen, S.; Blanco-Cano, X.; Anderosn, B. J.; Korth, H.
2012-01-01
The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth's is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury's bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury's foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury's foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the I-Hz waves in the Earth's foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth's foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at near 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at near 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.
EMMPRIN, an upstream regulator of MMPs, in CNS biology.
Kaushik, Deepak Kumar; Hahn, Jennifer Nancy; Yong, V Wee
2015-01-01
Matrix metalloproteinases (MMPs) are engaged in pathologies associated with infections, tumors, autoimmune disorders and neurological dysfunctions. With the identification of an upstream regulator of MMPs, EMMPRIN (Extracellular matrix metalloproteinase inducer, CD147), it is relevant to address if EMMPRIN plays a role in the pathology of central nervous system (CNS) diseases. This would enable the possibility of a more upstream and effective therapeutic target. Indeed, conditions including gliomas, Alzheimer's disease (AD), multiple sclerosis (MS), and other insults such as hypoxia/ischemia show elevated levels of EMMPRIN which correlate with MMP production. In contrast, given EMMPRIN's role in CNS homeostasis with respect to regulation of monocarboxylate transporters (MCTs) and interactions with adhesion molecules including integrins, we need to consider that EMMPRIN may also serve important regulatory or protective functions. This review summarizes the current understanding of EMMPRIN's involvement in CNS homeostasis, its possible roles in escalating or reducing neural injury, and the mechanisms of EMMPRIN including and apart from MMP induction. Copyright © 2015 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.
Upstream Tracking and the Decay $B^{0} \\to K^{+}\\pi^{-}\\mu^{+}\\mu^{-}$ at the LHCb Experiment
AUTHOR|(INSPIRE)INSPIRE-00388407; Serra, Nicola; Steinkamp, Olaf; Storaci, Barbara
The LHCb detector is a single-arm forward spectrometer covering the pseudorapidity range $2 < \\eta < 5$, designed to search for indirect evidence of New Physics in $C\\!P$ violation and rare decays of beauty and charm hadrons. The unique geometry takes advantage of the large $b$ and $c$ quark production in the forward region at the LHC. The detector includes a high granularity silicon-strip vertex detector, a silicon-strip detector upstream of the magnet and three stations of silicon-strip detectors and straw drift tubes downstream of the magnet. This thesis is divided into two main parts. The first part details the development of improved algorithms to perform track reconstruction using the sub-detectors upstream of the LHCb magnet. A novel idea to perform upstream tracking as an intermediate step of the track reconstruction sequence was investigated. The vast gains in tracking performance obtained when using upstream tracks led to the algorithm being adopted into the default reconstruction sequence for...
Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Íñigo; Novick, Richard P.; Christie, Gail E.; Penadés, José R.
2013-01-01
The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138
DEFF Research Database (Denmark)
Zhao, Jian; Yuan, Xuejun; Frödin, Morten
2003-01-01
-specific transcription initiation factor TIF-IA. Activation of TIF-IA and ribosomal gene transcription is sensitive to PD98059, indicating that TIF-IA is targeted by MAPK in vivo. Phosphopeptide mapping and mutational analysis reveals two serine residues (S633 and S649) that are phosphorylated by ERK and RSK kinases....... Replacement of S649 by alanine inactivates TIF-IA, inhibits pre-rRNA synthesis, and retards cell growth. The results provide a link between growth factor signaling, ribosome production, and cell growth, and may have a major impact on the mechanism of cell transformation....
Characterization of upstream sequences from the 8S globulin gene ...
African Journals Online (AJOL)
Administrator
2011-09-21
Sep 21, 2011 ... added recombinant proteins and enzymes for industries. The upstream region ... cost, eukaryotic expression and no endogenous patho- gen pollution, thus it ... developmental process (Santino et al., 1997) which may deplete nutrient ... ideal bioreactors for economic production and storage of value-added ...
Entrepreneurial Leadership in Upstream Oil and Gas Industry
Kalu, Mona Ukpai
2015-01-01
The study examined Entrepreneurial leadership in Upstream Oil and Gas industry and its ability to accelerate innovative energy technology development. The declining deliverability from existing reservoirs and ever increasing demand for energy to fuel growth in many parts of the world is driving oil and gas exploration into more difficult to access reservoirs like bituminous sands and shale gas. Accelerating new innovative technology development to access these new streams of profitable oil an...
Jaouannet, Maëlle; Morris, Jenny A.; Hedley, Peter E.; Bos, Jorunn I. B.
2015-01-01
Aphids are economically important pests that display exceptional variation in host range. The determinants of diverse aphid host ranges are not well understood, but it is likely that molecular interactions are involved. With significant progress being made towards understanding host responses upon aphid attack, the mechanisms underlying non-host resistance remain to be elucidated. Here, we investigated and compared Arabidopsis thaliana host and non-host responses to aphids at the transcriptional level using three different aphid species, Myzus persicae, Myzus cerasi and Rhopalosiphum pisum. Gene expression analyses revealed a high level of overlap in the overall gene expression changes during the host and non-host interactions with regards to the sets of genes differentially expressed and the direction of expression changes. Despite this overlap in transcriptional responses across interactions, there was a stronger repression of genes involved in metabolism and oxidative responses specifically during the host interaction with M. persicae. In addition, we identified a set of genes with opposite gene expression patterns during the host versus non-host interactions. Aphid performance assays on Arabidopsis mutants that were selected based on our transcriptome analyses identified novel genes contributing to host susceptibility, host defences during interactions with M. persicae as well to non-host resistance against R. padi. Understanding how plants respond to aphid species that differ in their ability to infest plant species, and identifying the genes and signaling pathways involved, is essential for the development of novel and durable aphid control in crop plants. PMID:25993686
Blood Transcriptional Signatures for Disease Progression in a Rat Model of Osteoarthritis
Directory of Open Access Journals (Sweden)
Michał Korostyński
2017-01-01
Full Text Available Biomarkers of osteoarthritis (OA that can accurately diagnose the disease at the earliest stage would significantly support efforts to develop treatments for prevention and early intervention. We have sought to determine the time course of alterations in peripheral blood gene expression profile associated with the development of OA. Blood samples were collected from a tail vein of individual rats with monosodium iodoacetate- (MIA- induced OA (2, 14, 21, and 28 days after the treatment. We used whole-genome microarrays to reveal OA-related transcriptional alterations of 72 transcripts. Three main groups of coexpressed genes revealed diverse time-dependent profiles of up- and downregulation. Functional links that connect expression of the gradually downregulated genes to the G13 signaling pathway were indicated. The mRNA abundance levels of the identified transcripts were further analyzed in publicly available gene expression dataset obtained from a GARP study cohort of OA patients. We revealed three-gene signature differentially expressed in both rat and human blood (TNK2, KCTD2, and WDR37. The alterations in expression of the selected transcripts in peripheral blood samples of the patients indicate heterogeneity of the OA profiles potentially related to disease progress and severity of clinical symptoms. Our study identifies several potential stage-specific biomarkers of OA progression.
Zhao, Xiu-Ju; Chen, Yu-Lian; Fu, Bing; Zhang, Wen; Liu, Zhiguo; Zhuo, Hexian
2017-03-01
Understanding the metabolic and transcription basis of pumpkin seed oil (PSO) intervention on metabolic disease (MD) is essential to daily nutrition and health. This study analyzed the liver metabolic variations of Wistar rats fed normal diet (CON), high-fat diet (HFD) and high-fat plus PSO diet (PSO) to establish the relationship between the liver metabolite composition/transcript profile and the effects of PSO on MD. By using proton nuclear magnetic resonance spectroscopy together with multivariate data analysis, it was found that, compared with CON rats, HFD rats showed clear dysfunctions of choline metabolism, glucose metabolism and nucleotide and amino acid metabolism. Using quantitative real-time polymerase chain reaction (qPCR), it was found that, compared with HFD rats, PSO rats showed alleviated endoplasmic reticulum stress accompanied by lowered unfolded protein response. These findings provide useful information to understand the metabolic alterations triggered by MD and to evaluate the effects of PSO intervention. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Kang, Dong-Min; Michon, Christophe; Morinaga, Tetsuro; Tanaka, Kosei; Takenaka, Shinji; Ishikawa, Shu; Yoshida, Ken-Ichi
2017-07-11
Bacillus subtilis is able to utilize at least three inositol stereoisomers as carbon sources, myo-, scyllo-, and D-chiro-inositol (MI, SI, and DCI, respectively). NAD + -dependent SI dehydrogenase responsible for SI catabolism is encoded by iolX. Even in the absence of functional iolX, the presence of SI or MI in the growth medium was found to induce the transcription of iolX through an unknown mechanism. Immediately upstream of iolX, there is an operon that encodes two genes, yisR and iolQ (formerly known as degA), each of which could encode a transcriptional regulator. Here we performed an inactivation analysis of yisR and iolQ and found that iolQ encodes a repressor of the iolX transcription. The coding sequence of iolQ was expressed in Escherichia coli and the gene product was purified as a His-tagged fusion protein, which bound to two sites within the iolX promoter region in vitro. IolQ is a transcriptional repressor of iolX. Genetic evidences allowed us to speculate that SI and MI might possibly be the intracellular inducers, however they failed to antagonize DNA binding of IolQ in in vitro experiments.
Directory of Open Access Journals (Sweden)
Ronne Hans
2008-11-01
Full Text Available Abstract Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context.
Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen
2018-05-05
Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.
Zhao, Fengli; Li, Gang; Hu, Panpan; Zhao, Xia; Li, Liangjie; Wei, Wei; Feng, Jiayue; Zhou, Houcheng
2018-01-01
As the second largest transcription factor family in plant, the basic helix-loop-helix (bHLH) transcription factor family, characterized by the conserved bHLH domain, plays a central regulatory role in many biological process. However, the bHLH transcription factor family of strawberry has not been systematically identified, especially for the anthocyanin biosynthesis. Here, we identified a total of 113 bHLH transcription factors and described their chromosomal distribution and bioinformatics...
Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra
2013-02-01
We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr(+) ). The epithelial invasion of Dr(+) E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by downregulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5'-untranslated region and mapped the NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5'-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3'-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to the AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. © 2012 The Authors Journal compilation © 2012 FEBS.
Tao, Lin; Zhu, Yue
2018-01-01
Several studies have indicated a relationship between melatonin and idiopathic scoliosis, including our previous work which demonstrated that melatonin can inhibit osteoblast proliferation; however, the mechanism remains unclear. Here, we utilized a MTT assay to show that melatonin significantly reduces osteoblast proliferation in a concentration-and time-dependent manner. Through a combination of techniques, including real-time PCR, MTT assays, immunofluorescence, and luciferase assays, we confirmed that melatonin-induced changes in phosphorylated cAMP response element-binding protein (CREB) reduced transcriptional activity in a melatonin receptor-dependent manner. Surprisingly, treatment of osteoblasts with the mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK) inhibitor PD98059 up-regulated other cascades upstream of CREB. We next treated cells with PKA and Src inhibitors and observed that melatonin can also activate the protein kinase A (PKA) and Src pathways. To examine whether Src is upstream from the cAMP-PKA pathway, we measured cAMP levels in response to melatonin with and without a Src inhibitor (PP2) and found that PP2 had no additional effect. Therefore, the transcription-dependent mechanisms involved in CREB phosphorylation, along with melatonin, activated Src via a parallel signaling pathway that was separate from that of PKA. Finally, we transfected osteoblasts with lentiviral CREB short hairpin (sh) RNAs and found a decrease in the expression of proliferating cell nuclear antigen (PCNA) and osteoblast proliferation. These results suggest that CREB and PCNA are downstream targets of melatonin signaling, and that the down-regulation of CREB, which is regulated via PKA and Src pathways, contributes to the melatonin-induced inhibition of osteoblast proliferation.
Uncovering transcriptional regulation of metabolism by using metabolic network topology
DEFF Research Database (Denmark)
Patil, Kiran Raosaheb; Nielsen, Jens
2005-01-01
in the metabolic network that follow a common transcriptional response. Thus, the algorithm enables identification of so-called reporter metabolites (metabolites around which the most significant transcriptional changes occur) and a set of connected genes with significant and coordinated response to genetic......Cellular response to genetic and environmental perturbations is often reflected and/or mediated through changes in the metabolism, because the latter plays a key role in providing Gibbs free energy and precursors for biosynthesis. Such metabolic changes are often exerted through transcriptional...... therefore developed an algorithm that is based on hypothesis-driven data analysis to uncover the transcriptional regulatory architecture of metabolic networks. By using information on the metabolic network topology from genome-scale metabolic reconstruction, we show that it is possible to reveal patterns...
International Nuclear Information System (INIS)
Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.
2003-01-01
The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation
LENUS (Irish Health Repository)
Moran, Gary P
2012-12-01
Hyphal growth is repressed in Candida albicans and Candida dubliniensis by the transcription factor Nrg1. Transcript profiling of a C. dubliniensis NRG1 mutant identified a common group of 28 NRG1-repressed genes in both species, including the hypha-specific genes HWP1, ECE1 and the regulator of cell elongation UME6. Unexpectedly, C. dubliniensis NRG1 was required for wild-type levels of expression of 10 genes required for iron uptake including seven ferric reductases, SIT1, FTR1 and RBT5. However, at alkaline pH and during filamentous growth in 10% serum, most of these genes were highly induced in C. dubliniensis. Conversely, RBT5, PGA10, FRE10 and FRP1 did not exhibit induction during hyphal growth when NRG1 is downregulated, indicating that in C. dubliniensis NRG1 is also required for optimal expression of these genes in alkaline environments. In iron-depleted medium at pH 4.5, reduced growth of the NRG1 mutant relative to wild type was observed; however, growth was restored to wild-type levels or greater at pH 6.5, indicating that alkaline induction of iron assimilation gene expression could rescue this phenotype. These data indicate that transcriptional control of iron assimilation and pseudohypha formation has been separated in C. albicans, perhaps promoting growth in a wider range of niches.
Dynamic usage of transcription start sites within core promoters
DEFF Research Database (Denmark)
Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro
2006-01-01
BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites...... is associated with CpG islands, broad and multimodal promoter structures, and imprinting. CONCLUSION: Our results reveal a new level of biologic complexity within promoters--fine-scale regulation of transcription starting events at the base pair level. These events are likely to be related to epigenetic...
Discriminative identification of transcriptional responses of promoters and enhancers after stimulus
Kleftogiannis, Dimitrios A.
2016-10-17
Promoters and enhancers regulate the initiation of gene expression and maintenance of expression levels in spatial and temporal manner. Recent findings stemming from the Cap Analysis of Gene Expression (CAGE) demonstrate that promoters and enhancers, based on their expression profiles after stimulus, belong to different transcription response subclasses. One of the most promising biological features that might explain the difference in transcriptional response between subclasses is the local chromatin environment. We introduce a novel computational framework, PEDAL, for distinguishing effectively transcriptional profiles of promoters and enhancers using solely histone modification marks, chromatin accessibility and binding sites of transcription factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers that discriminate with minimized classification error MCF-7 promoter and enhancer transcription response subclasses. Our work provides a general computational approach for identifying effectively cell-specific and stimulation-specific promoter and enhancer transcriptional profiles, and thus, contributes to improve our understanding of transcriptional activation in human.
Directory of Open Access Journals (Sweden)
Zahra Zinati
2017-05-01
Full Text Available Carotenoids, a diverse group of colorful pigments, contribute to the development, light harvesting and photoprotection in plants as well as human health. Due to the interesting properties of carotenoids, enhanced carotenoid biosynthesis has been of ongoing interest. Recent advances in computational biology and bioinformatics make it more feasible to understand the transcriptional regulatory network underlying carotenoid biosynthesis. Studies on carotenoid biosynthesis in corn ( Zea mays L. have indicated the pivotal role of the phytoene synthase gene PSY1 (accession: GRMZM2G300348 in endosperm color and carotenoid accumulation in corn kernels. Computational approaches such as Genomatix, PlantPAN, PlantCARE, PlantTFDB and IGDE6 have been used for promoter prediction, regulatory features and transcription factor identification, as well as pairwise promoter comparisons. Four transcripts have been identified for the PSY1 gene. Based on Genomatix and PlantPAN, the promoter predicted for GRMZM2G300348_T01 was different from that predicted for the other three transcripts (GRMZM2G300348_T02, GRMZM2G300348_T03 and GRMZM2G300348_T04. The results indiated that the promoter of GRMZM2G300348_T01 has more diverse motifs involved in hormonal/environmental stress responses. The most significant result obtained from this study is the discovery of two transcription factors belonging to the HB family that are co-expressed with all four transcripts of PSY1 under environmental stresses. It is, therefore, likely that these transcription factors may act as critical regulators of PSY1 gene expression in corn. Identification of the proteins acting upstream of PSY1 within corn will shed light on the fine tuning of PSY1 expression regulation. Such an understanding would also contribute to metabolic engineering aimed at enhanced carotenoid biosynthesis.
Perfluorooctanoic acid stimulated mitochondrial biogenesis and gene transcription in rats
International Nuclear Information System (INIS)
Walters, M.W.; Bjork, J.A.; Wallace, K.B.
2009-01-01
Perfluorooctanoic acid (PFOA), used in the production of non-stick surface compounds, exhibits a worldwide distribution in the serum of humans and wildlife. In rodents PFOA transactivates PPARα and PPARγ nuclear receptors and increases mitochondrial DNA (mtDNA) copy number, which may be critical to the altered metabolic state of affected animals. A key regulator of mitochondrial biogenesis and transcription of mitochondrial genes is the PPARγ coactivator-1α (Pgc-1α) protein. The purpose of this study was to determine if Pgc-1α is implicated in the stimulation of mitochondrial biogenesis that occurs following the treatment of rats with PFOA. Livers from adult male Sprague-Dawley rats that received a 30 mg/kg daily oral dose of PFOA for 28 days were used for all experiments. Analysis of mitochondrial replication and transcription was performed by real time PCR, and proteins were detected using western blotting. PFOA treatment caused a transcriptional activation of the mitochondrial biogenesis pathway leading to a doubling of mtDNA copy number. Further, transcription of OXPHOS genes encoded by mtDNA was 3-4 times greater than that of nuclear encoded genes, suggestive of a preferential induction of mtDNA transcription. Western blot analysis revealed an increase in Pgc-1α, unchanged Tfam and decreased Cox II and Cox IV subunit protein expression. We conclude that PFOA treatment in rats induces mitochondrial biogenesis at the transcriptional level with a preferential stimulation of mtDNA transcription and that this occurs by way of activation of the Pgc-1α pathway. Implication of the Pgc-1α pathway is consistent with PPARγ transactivation by PFOA and reveals new understanding and possibly new critical targets for assessing or averting the associated metabolic disease.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Production and processing of siRNA precursor transcripts from the highly repetitive maize genome.
Directory of Open Access Journals (Sweden)
Christopher J Hale
2009-08-01
Full Text Available Mutations affecting the maintenance of heritable epigenetic states in maize identify multiple RNA-directed DNA methylation (RdDM factors including RMR1, a novel member of a plant-specific clade of Snf2-related proteins. Here we show that RMR1 is necessary for the accumulation of a majority of 24 nt small RNAs, including those derived from Long-Terminal Repeat (LTR retrotransposons, the most common repetitive feature in the maize genome. A genetic analysis of DNA transposon repression indicates that RMR1 acts upstream of the RNA-dependent RNA polymerase, RDR2 (MOP1. Surprisingly, we show that non-polyadenylated transcripts from a sampling of LTR retrotransposons are lost in both rmr1 and rdr2 mutants. In contrast, plants deficient for RNA Polymerase IV (Pol IV function show an increase in polyadenylated LTR RNA transcripts. These findings support a model in which Pol IV functions independently of the small RNA accumulation facilitated by RMR1 and RDR2 and support that a loss of Pol IV leads to RNA Polymerase II-based transcription. Additionally, the lack of changes in general genome homeostasis in rmr1 mutants, despite the global loss of 24 nt small RNAs, challenges the perceived roles of siRNAs in maintaining functional heterochromatin in the genomes of outcrossing grass species.
Technological acceleration and organizational transformations in the upstream oil and gas industry
International Nuclear Information System (INIS)
Isabelle, M.
2000-12-01
The upstream oil and gas industry experienced a dramatic technological acceleration in the early 1970's. The relationships between the agents in this industry have themselves undergone deep changes since that date. This thesis shows that a tight link exists between the technological acceleration and the organizational transformations in the upstream oil and gas industry. In a first part, it focuses on the economic theory's developments concerning industrial organization. In a second part, it applies these developments to three types of relations: those between the owner-states of hydrocarbon resources and the international petroleum companies; those between the international petroleum companies and their subcontractors; and finally those between the international petroleum companies themselves. (author)
Directory of Open Access Journals (Sweden)
Sunil Kumar Thalor
Full Text Available Sucrose is known to repress the translation of Arabidopsis thaliana AtbZIP11 transcript which encodes a protein belonging to the group of S (S--stands for small basic region-leucine zipper (bZIP-type transcription factor. This repression is called sucrose-induced repression of translation (SIRT. It is mediated through the sucrose-controlled upstream open reading frame (SC-uORF found in the AtbZIP11 transcript. The SIRT is reported for 4 other genes belonging to the group of S bZIP in Arabidopsis. Tobacco tbz17 is phylogenetically closely related to AtbZIP11 and carries a putative SC-uORF in its 5'-leader region. Here we demonstrate that tbz17 exhibits SIRT mediated by its SC-uORF in a manner similar to genes belonging to the S bZIP group of the Arabidopsis genus. Furthermore, constitutive transgenic expression of tbz17 lacking its 5'-leader region containing the SC-uORF leads to production of tobacco plants with thicker leaves composed of enlarged cells with 3-4 times higher sucrose content compared to wild type plants. Our finding provides a novel strategy to generate plants with high sucrose content.
Thalor, Sunil Kumar; Berberich, Thomas; Lee, Sung Shin; Yang, Seung Hwan; Zhu, Xujun; Imai, Ryozo; Takahashi, Yoshihiro; Kusano, Tomonobu
2012-01-01
Sucrose is known to repress the translation of Arabidopsis thaliana AtbZIP11 transcript which encodes a protein belonging to the group of S (S--stands for small) basic region-leucine zipper (bZIP)-type transcription factor. This repression is called sucrose-induced repression of translation (SIRT). It is mediated through the sucrose-controlled upstream open reading frame (SC-uORF) found in the AtbZIP11 transcript. The SIRT is reported for 4 other genes belonging to the group of S bZIP in Arabidopsis. Tobacco tbz17 is phylogenetically closely related to AtbZIP11 and carries a putative SC-uORF in its 5'-leader region. Here we demonstrate that tbz17 exhibits SIRT mediated by its SC-uORF in a manner similar to genes belonging to the S bZIP group of the Arabidopsis genus. Furthermore, constitutive transgenic expression of tbz17 lacking its 5'-leader region containing the SC-uORF leads to production of tobacco plants with thicker leaves composed of enlarged cells with 3-4 times higher sucrose content compared to wild type plants. Our finding provides a novel strategy to generate plants with high sucrose content.
Directory of Open Access Journals (Sweden)
Ma Menggen
2010-06-01
Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance
Regulation of circadian clock transcriptional output by CLOCK:BMAL1
Trott, Alexandra J.
2018-01-01
The mammalian circadian clock relies on the transcription factor CLOCK:BMAL1 to coordinate the rhythmic expression of 15% of the transcriptome and control the daily regulation of biological functions. The recent characterization of CLOCK:BMAL1 cistrome revealed that although CLOCK:BMAL1 binds synchronously to all of its target genes, its transcriptional output is highly heterogeneous. By performing a meta-analysis of several independent genome-wide datasets, we found that the binding of other transcription factors at CLOCK:BMAL1 enhancers likely contribute to the heterogeneity of CLOCK:BMAL1 transcriptional output. While CLOCK:BMAL1 rhythmic DNA binding promotes rhythmic nucleosome removal, it is not sufficient to generate transcriptionally active enhancers as assessed by H3K27ac signal, RNA Polymerase II recruitment, and eRNA expression. Instead, the transcriptional activity of CLOCK:BMAL1 enhancers appears to rely on the activity of ubiquitously expressed transcription factors, and not tissue-specific transcription factors, recruited at nearby binding sites. The contribution of other transcription factors is exemplified by how fasting, which effects several transcription factors but not CLOCK:BMAL1, either decreases or increases the amplitude of many rhythmically expressed CLOCK:BMAL1 target genes. Together, our analysis suggests that CLOCK:BMAL1 promotes a transcriptionally permissive chromatin landscape that primes its target genes for transcription activation rather than directly activating transcription, and provides a new framework to explain how environmental or pathological conditions can reprogram the rhythmic expression of clock-controlled genes. PMID:29300726
The economic benefits of vegetation in the upstream area of Ciliwung watershed
Saridewi, T. R.; Nazaruddin
2018-04-01
Ciliwung watershed has strategic values since its entire downstream area is located in the Special Administrative Region of Jakarta (DKI Jakarta), the capital of Indonesia. This causes forest and farmland areas are converted into open areas or built-up areas. The existence of these areas provides enormous environmental and economic benefits. Economic benefit values are very important to be considered in developing a policy development plan, but they have not been calculated yet. This study aims to determine the economic benefits provided by trees and other vegetation anddevelops a development policy that takes into account simultaneously ecological and economic aspects. The study is conducted in the upstream Ciliwung watershed, by using land cover patterns in 1989, 2000, 2010 and 2014, and employs GIS and CITY green analysis. The results show that conversion of forest and farmland areas reduces the ability of Ciliwung upstream watershed to store water. Therefore, its ability to reduce the flow of surface has been decreased. This creates a decrease in the cost savings of annual stormwater, from US 15,175,721 in 1989 to US 13,317,469 in 2014. The Environmental Services Payment Policy (PES) for upstream community groups managing the watershed has been considered as a fairly effective policy.
Directory of Open Access Journals (Sweden)
Christine T Ferrara
2008-03-01
Full Text Available Although numerous quantitative trait loci (QTL influencing disease-related phenotypes have been detected through gene mapping and positional cloning, identification of the individual gene(s and molecular pathways leading to those phenotypes is often elusive. One way to improve understanding of genetic architecture is to classify phenotypes in greater depth by including transcriptional and metabolic profiling. In the current study, we have generated and analyzed mRNA expression and metabolic profiles in liver samples obtained in an F2 intercross between the diabetes-resistant C57BL/6 leptin(ob/ob and the diabetes-susceptible BTBR leptin(ob/ob mouse strains. This cross, which segregates for genotype and physiological traits, was previously used to identify several diabetes-related QTL. Our current investigation includes microarray analysis of over 40,000 probe sets, plus quantitative mass spectrometry-based measurements of sixty-seven intermediary metabolites in three different classes (amino acids, organic acids, and acyl-carnitines. We show that liver metabolites map to distinct genetic regions, thereby indicating that tissue metabolites are heritable. We also demonstrate that genomic analysis can be integrated with liver mRNA expression and metabolite profiling data to construct causal networks for control of specific metabolic processes in liver. As a proof of principle of the practical significance of this integrative approach, we illustrate the construction of a specific causal network that links gene expression and metabolic changes in the context of glutamate metabolism, and demonstrate its validity by showing that genes in the network respond to changes in glutamine and glutamate availability. Thus, the methods described here have the potential to reveal regulatory networks that contribute to chronic, complex, and highly prevalent diseases and conditions such as obesity and diabetes.
Transcriptional Network Analysis Reveals Drought Resistance Mechanisms of AP2/ERF Transgenic Rice
Directory of Open Access Journals (Sweden)
Hongryul Ahn
2017-06-01
Full Text Available This study was designed to investigate at the molecular level how a transgenic version of rice “Nipponbare” obtained a drought-resistant phenotype. Using multi-omics sequencing data, we compared wild-type rice (WT and a transgenic version (erf71 that had obtained a drought-resistant phenotype by overexpressing OsERF71, a member of the AP2/ERF transcription factor (TF family. A comprehensive bioinformatics analysis pipeline, including TF networks and a cascade tree, was developed for the analysis of multi-omics data. The results of the analysis showed that the presence of OsERF71 at the source of the network controlled global gene expression levels in a specific manner to make erf71 survive longer than WT. Our analysis of the time-series transcriptome data suggests that erf71 diverted more energy to survival-critical mechanisms related to translation, oxidative response, and DNA replication, while further suppressing energy-consuming mechanisms, such as photosynthesis. To support this hypothesis further, we measured the net photosynthesis level under physiological conditions, which confirmed the further suppression of photosynthesis in erf71. In summary, our work presents a comprehensive snapshot of transcriptional modification in transgenic rice and shows how this induced the plants to acquire a drought-resistant phenotype.
Energy Technology Data Exchange (ETDEWEB)
NONE
2006-07-15
In order to provide a detailed review of workplace health and safety, the Alberta Ministry of Human Resources and Employment prepares an annual report on the occupational injuries and diseases in the upstream oil and gas industries. The purpose of the report is to provide government, employers, workers, and health and safety professionals with information about key health and safety issues. This report presented estimations of the risk of injury or disease at the provincial, industry sector and subsector level as well as general descriptions about the incidents and injured workers. It also revealed the fatality rates for the major industry sectors as well as the occupational fatalities that the Workers Compensation Board (WCB) accepted for compensation. The number of employers that earned a certificate of recognition was also identified. The injury and disease analysis was discussed in terms of injured worker characteristics; nature of injury or disease; part of body injured; source of injury or disease; type of event or exposure; and duration of disability. The report also provided terms, definitions and formulas and upstream oil and gas WCB industry codes. It was found that in 2005, the WCB accepted 1,481 lost-time claims from upstream oil and gas workers, representing 4.2 per cent of all lost-time claims in the province. In addition, employers with 20 to 39 person-years had the highest lost-time claim rate of 2.4 per 100 person-years. tabs., figs., 2 appendices.
A Next-Generation Sequencing Approach Uncovers Viral Transcripts Incorporated in Poxvirus Virions
Directory of Open Access Journals (Sweden)
Marica Grossegesse
2017-10-01
Full Text Available Transcripts are known to be incorporated in particles of DNA viruses belonging to the families of Herpesviridae and Mimiviridae, but the presence of transcripts in other DNA viruses, such as poxviruses, has not been analyzed yet. Therefore, we first established a next-generation-sequencing (NGS-based protocol, enabling the unbiased identification of transcripts in virus particles. Subsequently, we applied our protocol to analyze RNA in an emerging zoonotic member of the Poxviridae family, namely Cowpox virus. Our results revealed the incorporation of 19 viral transcripts, while host identifications were restricted to ribosomal and mitochondrial RNA. Most viral transcripts had an unknown and immunomodulatory function, suggesting that transcript incorporation may be beneficial for poxvirus immune evasion. Notably, the most abundant transcript originated from the D5L/I1R gene that encodes a viral inhibitor of the host cytoplasmic DNA sensing machinery.
Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom
2017-07-01
Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin
Directory of Open Access Journals (Sweden)
Chelsea Herdman
2017-07-01
Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state
The logic of communication: roles for mobile transcription factors in plants.
Long, Yuchen; Scheres, Ben; Blilou, Ikram
2015-02-01
Mobile transcription factors play many roles in plant development. Here, we compare the use of mobile transcription factors as signals with some canonical signal transduction processes in prokaryotes and eukaryotes. After an initial survey, we focus on the SHORT-ROOT pathway in Arabidopsis roots to show that, despite the simplicity of the concept of mobile transcription factor signalling, many lines of evidence reveal a surprising complexity in control mechanisms linked to this process. We argue that these controls bestow precision, robustness, and versatility on mobile transcription factor signalling. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Co-expression networks reveal the tissue-specific regulation of transcription and splicing.
Saha, Ashis; Kim, Yungil; Gewirtz, Ariel D H; Jo, Brian; Gao, Chuan; McDowell, Ian C; Engelhardt, Barbara E; Battle, Alexis
2017-11-01
Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the regulation of splicing and transcription. We built TWNs for 16 tissues and found that hubs in these networks were strongly enriched for splicing and RNA binding genes, demonstrating their utility in unraveling regulation of splicing in the human transcriptome. Next, we used a Bayesian biclustering model that identifies network edges unique to a single tissue to reconstruct Tissue-Specific Networks (TSNs) for 26 distinct tissues and 10 groups of related tissues. Finally, we found genetic variants associated with pairs of adjacent nodes in our networks, supporting the estimated network structures and identifying 20 genetic variants with distant regulatory impact on transcription and splicing. Our networks provide an improved understanding of the complex relationships of the human transcriptome across tissues. © 2017 Saha et al.; Published by Cold Spring Harbor Laboratory Press.
Directory of Open Access Journals (Sweden)
Ze Wu
2018-03-01
Full Text Available Based on studies of monocot crops and eudicot model plants, the DREB2 class of AP2-type transcription factor has been shown to play crucial roles in various abiotic stresses, especially in the upstream of the heat stress response; however, research on DREB2s has not been reported in non-gramineous monocot plants. Here, we identified a novel DREB2 (LlDREB2B from lily (Lilium longiflorum, which was homologous to AtDREB2A of Arabidopsis, OsDREB2B of rice, and ZmDREB2A of maize. LlDREB2B was induced by heat, cold, salt, and mannitol stress, and its protein had transcriptional activity, was located in the nucleus, was able to bind to the dehydration-responsive element (DRE, and participated in the heat-responsive pathway of HsfA3. Overexpression of LlDREB2B in Arabidopsis activated expression of downstream genes and improved thermotolerance. LlDREB2B was not regulated by alternative splicing; functional transcripts accumulated under either normal or heat-stress conditions. A potential PEST sequence was predicted in LlDREB2B, but the stability of the LlDREB2B protein was not positively affected when the predicated PEST sequence was deleted. Further analysis revealed that the predicated PEST sequence lacked a SBC or SBC-like motif allowing interaction with BPMs and required for negative regulation. Nevertheless, LlDREB2B was still regulated at the post-translational level by interaction with AtDRIP1 and AtDRIP2 of Arabidopsis. In addition, LlDREB2B also interacted with AtRCD1 and LlRCD1 via a potential RIM motif located at amino acids 215–245. Taken together, our results show that LlDREB2B participated in the establishment of thermotolerance, and its regulation was different from that of the orthologs of gramineous and eudicot plants.
Wu, Ze; Liang, Jiahui; Zhang, Shuai; Zhang, Bing; Zhao, Qingcui; Li, Guoqing; Yang, Xi; Wang, Chengpeng; He, Junna; Yi, Mingfang
2018-01-01
Based on studies of monocot crops and eudicot model plants, the DREB2 class of AP2-type transcription factor has been shown to play crucial roles in various abiotic stresses, especially in the upstream of the heat stress response; however, research on DREB2s has not been reported in non-gramineous monocot plants. Here, we identified a novel DREB2 (LlDREB2B) from lily ( Lilium longiflorum ), which was homologous to AtDREB2A of Arabidopsis, OsDREB2B of rice, and ZmDREB2A of maize. LlDREB2B was induced by heat, cold, salt, and mannitol stress, and its protein had transcriptional activity, was located in the nucleus, was able to bind to the dehydration-responsive element (DRE), and participated in the heat-responsive pathway of HsfA3. Overexpression of LlDREB2B in Arabidopsis activated expression of downstream genes and improved thermotolerance. LlDREB2B was not regulated by alternative splicing; functional transcripts accumulated under either normal or heat-stress conditions. A potential PEST sequence was predicted in LlDREB2B, but the stability of the LlDREB2B protein was not positively affected when the predicated PEST sequence was deleted. Further analysis revealed that the predicated PEST sequence lacked a SBC or SBC-like motif allowing interaction with BPMs and required for negative regulation. Nevertheless, LlDREB2B was still regulated at the post-translational level by interaction with AtDRIP1 and AtDRIP2 of Arabidopsis. In addition, LlDREB2B also interacted with AtRCD1 and LlRCD1 via a potential RIM motif located at amino acids 215-245. Taken together, our results show that LlDREB2B participated in the establishment of thermotolerance, and its regulation was different from that of the orthologs of gramineous and eudicot plants.
NAC Transcription Factors in Stress Responses and Senescence
DEFF Research Database (Denmark)
O'Shea, Charlotte
Plant-specific NAM/ATAF/CUC (NAC) transcription factors have recently received considerable attention due to their significant roles in plant development and stress signalling. This interest has resulted in a number of physiological, genetic and cell biological studies of their functions. Some...... of these studies have also revealed emerging gene regulatory networks and protein-protein interaction networks. However, structural studies relating structure to function are lagging behind. Structure-function analysis of the NAC transcription factors has therefore been the main focus of this PhD thesis...... not involve significant folding-upon-binding but fuzziness or an extended ANAC046 region. The ANAC046 regulatory domain functions as an entropic chain with a bait for interactions with for example RCD1. RCD1 interacts with transcription factors from several different families, and the large stress...
2012-01-01
Background The MYB gene family comprises one of the richest groups of transcription factors in plants. Plant MYB proteins are characterized by a highly conserved MYB DNA-binding domain. MYB proteins are classified into four major groups namely, 1R-MYB, 2R-MYB, 3R-MYB and 4R-MYB based on the number and position of MYB repeats. MYB transcription factors are involved in plant development, secondary metabolism, hormone signal transduction, disease resistance and abiotic stress tolerance. A comparative analysis of MYB family genes in rice and Arabidopsis will help reveal the evolution and function of MYB genes in plants. Results A genome-wide analysis identified at least 155 and 197 MYB genes in rice and Arabidopsis, respectively. Gene structure analysis revealed that MYB family genes possess relatively more number of introns in the middle as compared with C- and N-terminal regions of the predicted genes. Intronless MYB-genes are highly conserved both in rice and Arabidopsis. MYB genes encoding R2R3 repeat MYB proteins retained conserved gene structure with three exons and two introns, whereas genes encoding R1R2R3 repeat containing proteins consist of six exons and five introns. The splicing pattern is similar among R1R2R3 MYB genes in Arabidopsis. In contrast, variation in splicing pattern was observed among R1R2R3 MYB members of rice. Consensus motif analysis of 1kb upstream region (5′ to translation initiation codon) of MYB gene ORFs led to the identification of conserved and over-represented cis-motifs in both rice and Arabidopsis. Real-time quantitative RT-PCR analysis showed that several members of MYBs are up-regulated by various abiotic stresses both in rice and Arabidopsis. Conclusion A comprehensive genome-wide analysis of chromosomal distribution, tandem repeats and phylogenetic relationship of MYB family genes in rice and Arabidopsis suggested their evolution via duplication. Genome-wide comparative analysis of MYB genes and their expression analysis
When defense becomes dangerous – transcription factor Nrf2 and cancer
Directory of Open Access Journals (Sweden)
Adam Krysztofiak
2015-01-01
Full Text Available The transcription factor Nrf2 controls the expression of genes encoding cytoprotective enzymes and proteins. Its activation is related to conformational changes in the inhibitory protein Keap1 and/or Nrf2 phosphorylation by upstream kinases. Activation of Nrf2 can lead to the induction of phase II enzymes responsible for the inactivation of potential carcinogens. This may constitute an important strategy of chemoprevention. Moreover, these enzymatic systems participating in the biotransformation of drugs can reduce their therapeutic effects, contributing to drug resistance. For this reason, a clear understanding of the role of Nrf2 is essential to assess the beneficial and adverse effects of its up-regulation, particularly in relation to the prevention and treatment of cancer. This article summarizes the current state of knowledge on the significance of Nrf2 in tumorigenesis.
Directory of Open Access Journals (Sweden)
Singsuksawat Ekapot
2010-06-01
Full Text Available Abstract Background Burkholderia pseudomallei is the causative agent of melioidosis where the highest reported incidence world wide is in the Northeast of Thailand, where saline soil and water are prevalent. Moreover, recent reports indicate a potential pathogenic role for B. pseudomallei in cystic fibrosis lung disease, where an increased sodium chloride (NaCl concentration in airway surface liquid has been proposed. These observations raise the possibility that high salinity may represent a favorable niche for B. pseudomallei. We therefore investigated the global transcriptional response of B. pseudomallei to increased salinity using microarray analysis. Results Transcriptome analysis of B. pseudomallei under salt stress revealed several genes significantly up-regulated in the presence of 320 mM NaCl including genes associated with the bsa-derived Type III secretion system (T3SS. Microarray data were verified by reverse transcriptase-polymerase chain reactions (RT-PCR. Western blot analysis confirmed the increased expression and secretion of the invasion-associated type III secreted proteins BipD and BopE in B. pseudomallei cultures at 170 and 320 mM NaCl relative to salt-free medium. Furthermore, salt-treated B. pseudomallei exhibited greater invasion efficiency into the lung epithelial cell line A549 in a manner partly dependent on a functional Bsa system. Conclusions B. pseudomallei responds to salt stress by modulating the transcription of a relatively small set of genes, among which is the bsa locus associated with invasion and virulence. Expression and secretion of Bsa-secreted proteins was elevated in the presence of exogenous salt and the invasion efficiency was enhanced. Our data indicate that salinity has the potential to influence the virulence of B. pseudomallei.
ISEE/IMP Observations of simultaneous upstream ion events
International Nuclear Information System (INIS)
Mitchel, D.G.; Roelof, E.C.; Sanderson, T.R.; Reinhard, R.; Wenzel, K.
1983-01-01
Propagation of upstream energetic (50--200 keV) ions is analyzed in sixteen events observed simulataneously by solid state detectors on ISEE 3 at approx.200 R/sub E/ and on IMP 8 at approx.35 R/sub E/ from the earth. Conclusions are based on comparisons of the pitch angle distributions observed at the two spacecraft and transformed into the solar wind frame. They are beamlike at ISEE 3 and are confined to the outward hemisphere. When IMP 8 is furtherest from the bow shock, they are also usually beamlike, or hemispheric. However, when IMP 8 is closer to the bow shock, pancakelike distributions are observed. This systematic variation in the IMP 8 pitch angle distributions delimits a scattering region l< or approx. =14 R/sub E/ upstream of the earth's bow shock (l measured along the interplanetary magnetic field) that dominates ion propagation, influences the global distribution of fluxes in the foreshock, and may play a role in acceleration of the ions. When IMP 8 is beyond lapprox.15 R/sub E/, the propagation appears to be essentially scatter-free between IMP 8 and ISEE 3; this is deduced from the absence of earthward fluxes at IMP 8 as well as the tendency for the spin-averaged fluxes to be comparable at the two spacecraft
Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra
2017-12-01
Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S
2000-01-01
A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln
Directory of Open Access Journals (Sweden)
L. Minieri
2010-04-01
Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.
Transcription termination in the plasmid/virus hybrid pSSVx from Sulfolobus islandicus
DEFF Research Database (Denmark)
Contursi, Patrizia; Cannio, Raffaele; She, Qunxin
2010-01-01
The pSSVx from Sulfolobus islandicus, strain REY15/4, is a hybrid between a plasmid and a fusellovirus. A systematic study previously performed revealed the presence of nine major transcripts, the expression of which was differentially and temporally regulated over the growth cycle of S. islandicus....... In this study, two new transcripts were identified. Then, 3' termini of all the RNAs were mapped using adaptor RT-PCR and RNase protection assays, and termination/arrest positions were identified for each transcript. The majority of the identified ending positions were located in the close vicinity of a T...... and counter-transcripts might be responsible for the transcription termination at these T-track-minus loci in the closely spaced pSSVx genes....
Directory of Open Access Journals (Sweden)
Leah A Owen
2008-04-01
Full Text Available EWS/FLI is a master regulator of Ewing's sarcoma formation. Gene expression studies in A673 Ewing's sarcoma cells have demonstrated that EWS/FLI downregulates more genes than it upregulates, suggesting that EWS/FLI, and/or its targets, function as transcriptional repressors. One critical EWS/FLI target, NKX2.2, is a transcription factor that contains both transcriptional activation and transcriptional repression domains, raising the possibility that it mediates portions of the EWS/FLI transcriptional signature. We now report that microarray analysis demonstrated that the transcriptional profile of NKX2.2 consists solely of downregulated genes, and overlaps with the EWS/FLI downregulated signature, suggesting that NKX2.2 mediates oncogenic transformation via transcriptional repression. Structure-function analysis revealed that the DNA binding and repressor domains in NKX2.2 are required for oncogenesis in Ewing's sarcoma cells, while the transcriptional activation domain is completely dispensable. Furthermore, blockade of TLE or HDAC function, two protein families thought to mediate the repressive function of NKX2.2, inhibited the transformed phenotype and reversed the NKX2.2 transcriptional profile in Ewing's sarcoma cells. Whole genome localization studies (ChIP-chip revealed that a significant portion of the NKX2.2-repressed gene expression signature was directly mediated by NKX2.2 binding. These data demonstrate that the transcriptional repressive function of NKX2.2 is necessary, and sufficient, for the oncogenic phenotype of Ewing's sarcoma, and suggest a therapeutic approach to this disease.
Ion acceleration at the earth's bow shock: A review of observations in the upstream region
International Nuclear Information System (INIS)
Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.
1979-01-01
Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different population of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compresive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e. those near 100 keV) are accelerated at the shock or in the broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles
Ion acceleration at the earth's bow shock: a review of observations in the upstream region
International Nuclear Information System (INIS)
Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.
1979-01-01
Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different populations of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compressive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e., those near 100 keV) are accelerated at the shock or in broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles
DEFF Research Database (Denmark)
Zhu, Xuefeng; Wirén, Marianna; Sinha, Indranil
2006-01-01
Mediator exists in a free form containing the Med12, Med13, CDK8, and CycC subunits (the Srb8-11 module) and a smaller form, which lacks these four subunits and associates with RNA polymerase II (Pol II), forming a holoenzyme. We use chromatin immunoprecipitation (ChIP) and DNA microarrays...... to investigate genome-wide localization of Mediator and the Srb8-11 module in fission yeast. Mediator and the Srb8-11 module display similar binding patterns, and interactions with promoters and upstream activating sequences correlate with increased transcription activity. Unexpectedly, Mediator also interacts...... with the downstream coding region of many genes. These interactions display a negative bias for positions closer to the 5' ends of open reading frames (ORFs) and appear functionally important, because downregulation of transcription in a temperature-sensitive med17 mutant strain correlates with increased Mediator...
Grimberg, Kristian Björk; Beskow, Anne; Lundin, Daniel; Davis, Monica M; Young, Patrick
2011-02-01
While the 26S proteasome is a key proteolytic complex, little is known about how proteasome levels are maintained in higher eukaryotic cells. Here we describe an RNA interference (RNAi) screen of Drosophila melanogaster that was used to identify transcription factors that may play a role in maintaining levels of the 26S proteasome. We used an RNAi library against 993 Drosophila transcription factor genes to identify genes whose suppression in Schneider 2 cells stabilized a ubiquitin-green fluorescent protein reporter protein. This screen identified Cnc (cap 'n' collar [CNC]; basic region leucine zipper) as a candidate transcriptional regulator of proteasome component expression. In fact, 20S proteasome activity was reduced in cells depleted of cnc. Immunoblot assays against proteasome components revealed a general decline in both 19S regulatory complex and 20S proteasome subunits after RNAi depletion of this transcription factor. Transcript-specific silencing revealed that the longest of the seven transcripts for the cnc gene, cnc-C, was needed for proteasome and p97 ATPase production. Quantitative reverse transcription-PCR confirmed the role of Cnc-C in activation of transcription of genes encoding proteasome components. Expression of a V5-His-tagged form of Cnc-C revealed that the transcription factor is itself a proteasome substrate that is stabilized when the proteasome is inhibited. We propose that this single cnc gene in Drosophila resembles the ancestral gene family of mammalian nuclear factor erythroid-derived 2-related transcription factors, which are essential in regulating oxidative stress and proteolysis.
Directory of Open Access Journals (Sweden)
Busche Tobias
2012-09-01
Full Text Available Abstract Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. Conclusions The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly
Busche, Tobias; Silar, Radoslav; Pičmanová, Martina; Pátek, Miroslav; Kalinowski, Jörn
2012-09-03
The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have
Cryptic Transcription and Early Termination in the Control of Gene Expression
Directory of Open Access Journals (Sweden)
Jessie Colin
2011-01-01
Full Text Available Recent studies on yeast transcriptome have revealed the presence of a large set of RNA polymerase II transcripts mapping to intergenic and antisense regions or overlapping canonical genes. Most of these ncRNAs (ncRNAs are subject to termination by the Nrd1-dependent pathway and rapid degradation by the nuclear exosome and have been dubbed cryptic unstable transcripts (CUTs. CUTs are often considered as by-products of transcriptional noise, but in an increasing number of cases they play a central role in the control of gene expression. Regulatory mechanisms involving expression of a CUT are diverse and include attenuation, transcriptional interference, and alternative transcription start site choice. This review focuses on the impact of cryptic transcription on gene expression, describes the role of the Nrd1-complex as the main actor in preventing nonfunctional and potentially harmful transcription, and details a few systems where expression of a CUT has an essential regulatory function. We also summarize the most recent studies concerning other types of ncRNAs and their possible role in regulation.
Transcriptional activity of Pax3 is co-activated by TAZ
International Nuclear Information System (INIS)
Murakami, Masao; Tominaga, Junji; Makita, Ryosuke; Uchijima, Yasunobu; Kurihara, Yukiko; Nakagawa, Osamu; Asano, Tomoichiro; Kurihara, Hiroki
2006-01-01
Pax3 is a transcription factor which functions in embryonic development and human diseases. In a yeast two-hybrid screen with full-length Pax3 as bait, we isolated a clone encoding transcriptional co-activator with PDZ-binding motif (TAZ) from an E10.5 mouse embryo cDNA library. Co-immunoprecipitation and nuclear co-localization of TAZ with Pax3 suggest that their association is functionally relevant. In situ hybridization revealed TAZ and Pax3 expression to partially overlap in the paraxial mesoderm, limb buds, and the neural tube. In C2C12 myoblast cells and NIH3T3 cells, TAZ enhanced the transcriptional activity of Pax3 on artificial and microphthalmia-associated transcription factor promoter-luciferase constructs, suggesting that TAZ can function as a co-activator of Pax3. Functional interaction between Pax3 and TAZ may provide a clue to clarifying the mechanism by which Pax3 serves as a transcriptional activator during embryogenesis
Directory of Open Access Journals (Sweden)
Anil K Singh
2010-03-01
Full Text Available Resistin is a cysteine rich protein, mainly expressed and secreted by circulating human mononuclear cells. While several factors responsible for transcription of mouse resistin gene have been identified, not much is known about the factors responsible for the differential expression of human resistin.We show that the minimal promoter of human resistin lies within approximately 80 bp sequence upstream of the transcriptional start site (-240 whereas binding sites for cRel, CCAAT enhancer binding protein alpha (C/EBP-alpha, activating transcription factor 2 (ATF-2 and activator protein 1 (AP-1 transcription factors, important for induced expression, are present within sequences up to -619. Specificity Protein 1(Sp1 binding site (-276 to -295 is also present and an interaction of Sp1 with peroxisome proliferator activating receptor gamma (PPARgamma is necessary for constitutive expression in U937 cells. Indeed co-immunoprecipitation assay demonstrated a direct physical interaction of Sp1 with PPARgamma in whole cell extracts of U937 cells. Phorbol myristate acetate (PMA upregulated the expression of resistin mRNA in U937 cells by increasing the recruitment of Sp1, ATF-2 and PPARgamma on the resistin gene promoter. Furthermore, PMA stimulation of U937 cells resulted in the disruption of Sp1 and PPARgamma interaction. Chromatin immunoprecipitation (ChIP assay confirmed the recruitment of transcription factors phospho ATF-2, Sp1, Sp3, PPARgamma, chromatin modifier histone deacetylase 1 (HDAC1 and the acetylated form of histone H3 but not cRel, C/EBP-alpha and phospho c-Jun during resistin gene transcription.Our findings suggest a complex interplay of Sp1 and PPARgamma along with other transcription factors that drives the expression of resistin in human monocytic U937 cells.
A scheme for regulating toxic substances to water quality of Chamsil upstream water system
Energy Technology Data Exchange (ETDEWEB)
Kim, Kang Suk; Kim, Jee Hoon [Korea Environment Institute, Seoul (Korea)
1998-12-01
This study asserts to reflect a concept of toxicity thoroughly in the present water quality concept. It presents an appropriate solution to control toxic substances flowing into the Chamsil upstream water system. Although a regulation of toxic substances into major rivers in Korea other than Han river is also required urgently, it will be studied in future. It is expected that this study on Chamsil upstream would be a cornerstone for establishing a national regulation policy of toxic substances into water system. 28 refs., 1 fig., 36 tabs.
Transcriptional network systems in cartilage development and disease.
Nishimura, Riko; Hata, Kenji; Nakamura, Eriko; Murakami, Tomohiko; Takahata, Yoshifumi
2018-04-01
Transcription factors play important roles in the regulation of cartilage development by controlling the expression of chondrogenic genes. Genetic studies have revealed that Sox9/Sox5/Sox6, Runx2/Runx3 and Osterix in particular are essential for the sequential steps of cartilage development. Importantly, these transcription factors form network systems that are also required for appropriate cartilage development. Molecular cloning approaches have largely contributed to the identification of several transcriptional partners for Sox9 and Runx2 during cartilage development. Although the importance of a negative-feedback loop between Indian hedgehog (Ihh) and parathyroid hormone-related protein (PTHrP) in chondrocyte hypertrophy has been well established, recent studies indicate that several transcription factors interact with the Ihh-PTHrP loop and demonstrated that Ihh has multiple functions in the regulation of cartilage development. The most common cartilage disorder, osteoarthritis, has been reported to result from the pathological action of several transcription factors, including Runx2, C/EBPβ and HIF-2α. On the other hand, NFAT family members appear to play roles in the protection of cartilage from osteoarthritis. It is also becoming important to understand the homeostasis and regulation of articular chondrocytes, because they have different cellular and molecular features from chondrocytes of the growth plate. This review summarizes the regulation and roles of transcriptional network systems in cartilage development and their pathological roles in osteoarthritis.
Moschen, Sebastián; Di Rienzo, Julio A; Higgins, Janet; Tohge, Takayuki; Watanabe, Mutsumi; González, Sergio; Rivarola, Máximo; García-García, Francisco; Dopazo, Joaquin; Hopp, H Esteban; Hoefgen, Rainer; Fernie, Alisdair R; Paniego, Norma; Fernández, Paula; Heinz, Ruth A
2017-07-01
By integration of transcriptional and metabolic profiles we identified pathways and hubs transcription factors regulated during drought conditions in sunflower, useful for applications in molecular and/or biotechnological breeding. Drought is one of the most important environmental stresses that effects crop productivity in many agricultural regions. Sunflower is tolerant to drought conditions but the mechanisms involved in this tolerance remain unclear at the molecular level. The aim of this study was to characterize and integrate transcriptional and metabolic pathways related to drought stress in sunflower plants, by using a system biology approach. Our results showed a delay in plant senescence with an increase in the expression level of photosynthesis related genes as well as higher levels of sugars, osmoprotectant amino acids and ionic nutrients under drought conditions. In addition, we identified transcription factors that were upregulated during drought conditions and that may act as hubs in the transcriptional network. Many of these transcription factors belong to families implicated in the drought response in model species. The integration of transcriptomic and metabolomic data in this study, together with physiological measurements, has improved our understanding of the biological responses during droughts and contributes to elucidate the molecular mechanisms involved under this environmental condition. These findings will provide useful biotechnological tools to improve stress tolerance while maintaining crop yield under restricted water availability.
VirF-Independent Regulation of Shigella virB Transcription is Mediated by the Small RNA RyhB
Broach, William H.; Egan, Nicholas; Wing, Helen J.; Payne, Shelley M.; Murphy, Erin R.
2012-01-01
Infection of the human host by Shigella species requires the coordinated production of specific Shigella virulence factors, a process mediated largely by the VirF/VirB regulatory cascade. VirF promotes the transcription of virB, a gene encoding the transcriptional activator of several virulence-associated genes. This study reveals that transcription of virB is also regulated by the small RNA RyhB, and importantly, that this regulation is not achieved indirectly via modulation of VirF activity. These data are the first to demonstrate that the regulation of virB transcription can be uncoupled from the master regulator VirF. It is also established that efficient RyhB-dependent regulation of transcription is facilitated by specific nucleic acid sequences within virB. This study not only reveals RyhB-dependent regulation of virB transcription as a novel point of control in the central regulatory circuit modulating Shigella virulence, but also highlights the versatility of RyhB in controlling bacterial gene expression. PMID:22701677
Gall, B J; Wilson, A; Schroer, A B; Gross, J D; Stoilov, P; Setola, V; Watkins, C M; Siderovski, D P
2016-03-01
G protein signaling modulator 3 (GPSM3) is a regulator of G protein-coupled receptor signaling, with expression restricted to leukocytes and lymphoid organs. Previous genome-wide association studies have highlighted single-nucleotide polymorphisms (SNPs; rs204989 and rs204991) in a region upstream of the GPSM3 transcription start site as being inversely correlated to the prevalence of rheumatoid arthritis (RA)-this association is supported by the protection afforded to Gpsm3-deficient mice in models of inflammatory arthritis. Here, we assessed the functional consequences of these polymorphisms. We collected biospecimens from 50 volunteers with RA diagnoses, 50 RA-free volunteers matched to the aforementioned group and 100 unmatched healthy young volunteers. We genotyped these individuals for GPSM3 (rs204989, rs204991), CCL21 (rs2812378) and HLA gene region (rs6457620) polymorphisms, and found no significant differences in minor allele frequencies between the RA and disease-free cohorts. However, we identified that individuals homozygous for SNPs rs204989 and rs204991 had decreased GPSM3 transcript abundance relative to individuals homozygous for the major allele. In vitro promoter activity studies suggest that SNP rs204989 is the primary cause of this decrease in transcript levels. Knockdown of GPSM3 in THP-1 cells, a human monocytic cell line, was found to disrupt ex vivo migration to the chemokine MCP-1.
Deciphering the Innate Lymphoid Cell Transcriptional Program
Directory of Open Access Journals (Sweden)
Cyril Seillet
2016-10-01
Full Text Available Innate lymphoid cells (ILCs are enriched at mucosal surfaces, where they provide immune surveillance. All ILC subsets develop from a common progenitor that gives rise to pre-committed progenitors for each of the ILC lineages. Currently, the temporal control of gene expression that guides the emergence of these progenitors is poorly understood. We used global transcriptional mapping to analyze gene expression in different ILC progenitors. We identified PD-1 to be specifically expressed in PLZF+ ILCp and revealed that the timing and order of expression of the transcription factors NFIL3, ID2, and TCF-1 was critical. Importantly, induction of ILC lineage commitment required only transient expression of NFIL3 prior to ID2 and TCF-1 expression. These findings highlight the importance of the temporal program that permits commitment of progenitors to the ILC lineage, and they expand our understanding of the core transcriptional program by identifying potential regulators of ILC development.
Directory of Open Access Journals (Sweden)
Elisa Dominguez
Full Text Available Branch retinal vein occlusion (BRVO leads to extensive vascular remodeling and is important cause of visual impairment. Although the vascular morphological changes following experimental vein occlusion have been described in a variety of models using angiography, the underlying cellular events are ill defined.We here show that laser-induced experimental BRVO in mice leads to a wave of TUNEL-positive endothelial cell (EC apoptosis in the upstream vascular network associated with a transient edema and hemorrhages. Subsequently, we observe an induction of EC proliferation within the dilated vein and capillaries, detected by EdU incorporation, and the edema resolves. However, the pericytes of the upstream capillaries are severely reduced, which was associated with continuing EC apoptosis and proliferation. The vascular remodeling was associated with increased expression of TGFβ, TSP-1, but also FGF2 expression. Exposure of the experimental animals to hypoxia, when pericyte (PC dropout had occurred, led to a dramatic increase in endothelial cell proliferation, confirming the vascular instability induced by the experimental BRVO.Experimental BRVO leads to acute endothelial cells apoptosis and increased permeability. Subsequently the upstream vascular network remains destabilized, characterized by pericyte dropout, un-physiologically high endothelial cells turnover and sensitivity to hypoxia. These early changes might pave the way for capillary loss and subsequent chronic ischemia and edema that characterize the late stage disease.
Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C
2018-03-29
The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.
Lovrics, Anna
2014-11-14
We have assembled a network of cell-fate determining transcription factors that play a key role in the specification of the ventral neuronal subtypes of the spinal cord on the basis of published transcriptional interactions. Asynchronous Boolean modelling of the network was used to compare simulation results with reported experimental observations. Such comparison highlighted the need to include additional regulatory connections in order to obtain the fixed point attractors of the model associated with the five known progenitor cell types located in the ventral spinal cord. The revised gene regulatory network reproduced previously observed cell state switches between progenitor cells observed in knock-out animal models or in experiments where the transcription factors were overexpressed. Furthermore the network predicted the inhibition of Irx3 by Nkx2.2 and this prediction was tested experimentally. Our results provide evidence for the existence of an as yet undescribed inhibitory connection which could potentially have significance beyond the ventral spinal cord. The work presented in this paper demonstrates the strength of Boolean modelling for identifying gene regulatory networks.
Transcription factor interplay in T helper cell differentiation
Evans, Catherine M.
2013-01-01
The differentiation of CD4 helper T cells into specialized effector lineages has provided a powerful model for understanding immune cell differentiation. Distinct lineages have been defined by differential expression of signature cytokines and the lineage-specifying transcription factors necessary and sufficient for their production. The traditional paradigm of differentiation towards Th1 and Th2 subtypes driven by T-bet and GATA3, respectively, has been extended to incorporate additional T cell lineages and transcriptional regulators. Technological advances have expanded our view of these lineage-specifying transcription factors to the whole genome and revealed unexpected interplay between them. From these data, it is becoming clear that lineage specification is more complex and plastic than previous models might have suggested. Here, we present an overview of the different forms of transcription factor interplay that have been identified and how T cell phenotypes arise as a product of this interplay within complex regulatory networks. We also suggest experimental strategies that will provide further insight into the mechanisms that underlie T cell lineage specification and plasticity. PMID:23878131
Transcription factor interplay in T helper cell differentiation.
Evans, Catherine M; Jenner, Richard G
2013-11-01
The differentiation of CD4 helper T cells into specialized effector lineages has provided a powerful model for understanding immune cell differentiation. Distinct lineages have been defined by differential expression of signature cytokines and the lineage-specifying transcription factors necessary and sufficient for their production. The traditional paradigm of differentiation towards Th1 and Th2 subtypes driven by T-bet and GATA3, respectively, has been extended to incorporate additional T cell lineages and transcriptional regulators. Technological advances have expanded our view of these lineage-specifying transcription factors to the whole genome and revealed unexpected interplay between them. From these data, it is becoming clear that lineage specification is more complex and plastic than previous models might have suggested. Here, we present an overview of the different forms of transcription factor interplay that have been identified and how T cell phenotypes arise as a product of this interplay within complex regulatory networks. We also suggest experimental strategies that will provide further insight into the mechanisms that underlie T cell lineage specification and plasticity.
DEFF Research Database (Denmark)
Simley, Eric; Angelou, Nikolas; Mikkelsen, Torben Krogh
2016-01-01
As a wind turbine generates power, induced velocities, lower than the freestream velocity, will be present upstream of the turbine due to perturbation of the flow by the rotor. In this study, the upstream induction zone of a 225kW horizontal axis Vestas V27 wind turbine located at the Danish...... Technical University’s Risø campus is investigated using a scanning Light Detection and Ranging (lidar) system. Three short-range continuous-wave “WindScanner” lidars are positioned in the field around the V27 turbine allowing detection of all three components of the wind velocity vectors within...... the induction zone. The time-averaged mean wind speeds at different locations in the upstream induction zone are measured by scanning a horizontal plane at hub height and a vertical plane centered at the middle of the rotor extending roughly 1.5 rotor diameters (D) upstream of the rotor. Turbulence statistics...
Directory of Open Access Journals (Sweden)
Andrew Woodard
2011-01-01
Full Text Available Termination of transcription is an important component of bacterial gene expression. However, little is known concerning this process in the obligate intracellular pathogen and model for reductive evolution, Rickettsia prowazekii. To assess transcriptional termination in this bacterium, transcripts of convergent gene pairs, some containing predicted intrinsic terminators, were analyzed. These analyses revealed that, rather than terminating at a specific site within the intervening region between the convergent genes, most of the transcripts demonstrated either a lack of termination within this region, which generated antisense RNA, or a putative non-site-specific termination that occurred throughout the intervening sequence. Transcripts terminating at predicted intrinsic terminators, as well as at a putative Rho-dependant terminator, were also examined and found to vary based on the rickettsial host environment. These results suggest that transcriptional termination, or lack thereof, plays a role in rickettsial gene regulation.
DEFF Research Database (Denmark)
Jørgensen, Mette
erent aspects of transcriptional regulation. In the rst study we develop a machine learning framework to predict mRNA production, stalling and elongation of RNA polymerase II using publicly available histone modi cation data. The study reveals new pieces of information about the histone code. Besides...... into proteins. All cells need di erent proteins in di erent amounts to function properly. The transcription and translation are therefore highly regulated and the regulation is not fully understood. It is important to learn as much as possible about both transcriptional and translational regulation to better...
Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G
2004-01-30
A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.
Msn2p/Msn4p act as a key transcriptional activator of yeast cytoplasmic thiol peroxidase II.
Hong, Seung-Keun; Cha, Mee-Kyung; Choi, Yong-Soo; Kim, Won-Cheol; Kim, Il-Han
2002-04-05
We observed that the transcription of Saccharomyces cerevisiae cytoplasmic thiol peroxidase type II (cTPx II) (YDR453C) is regulated in response to various stresses (e.g. oxidative stress, carbon starvation, and heat-shock). It has been suggested that both transcription-activating proteins, Yap1p and Skn7p, regulate the transcription of cTPx II upon exposure to oxidative stress. However, a dramatic loss of transcriptional response to various stresses in yeast mutant strains lacking both Msn2p and Msn4p suggests that the transcription factors act as a principal transcriptional activator. In addition to two Yap1p response elements (YREs), TTACTAA and TTAGTAA, the presence of two stress response elements (STREs) (CCCCT) in the upstream sequence of cTPx II also suggests that Msn2p/Msn4p could control stress-induced expression of cTPx II. Analysis of the transcriptional activity of site-directed mutagenesis of the putative STREs (STRE1 and STRE2) and YREs (TRE1 and YRE2) in terms of the activity of a lacZ reporter gene under control of the cTPx II promoter indicates that STRE2 acts as a principal binding element essential for transactivation of the cTPx II promoter. The transcriptional activity of the cTPx II promoter was exponentially increased after postdiauxic growth. The transcriptional activity of the cTPx II promoter is greatly increased by rapamycin. Deletion of Tor1, Tor2, Ras1, and Ras2 resulted in a considerable induction when compared with their parent strains, suggesting that the transcription of cTPx II is under negative control of the Ras/cAMP and target of rapamycin signaling pathways. Taken together, these results suggest that cTPx II is a target of Msn2p/Msn4p transcription factors under negative control of the Ras-protein kinase A and target of rapamycin signaling pathways. Furthermore, the accumulation of cTPx II upon exposure to oxidative stress and during the postdiauxic shift suggests an important antioxidant role in stationary phase yeast cells.
Reilman, Ewoud; Mars, Ruben A T; van Dijl, Jan Maarten; Denham, Emma L
2014-10-01
Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Essential roles of caspases and their upstream regulators in rotenone-induced apoptosis
International Nuclear Information System (INIS)
Lee Jihjong; Huang, M.-S.; Yang, I-C.; Lai, T.-C.; Wang, J.-L.; Pang, V.F.; Hsiao, M.; Kuo, M.Y.P.
2008-01-01
In the present study, we examined whether caspases and their upstream regulators are involved in rotenone-induced cytotoxicity. Rotenone significantly inhibited the proliferation of oral cancer cell lines in a dose-dependent manner compared to normal oral mucosal fibroblasts. Flow cytometric analysis of DNA content showed that rotenone treatment induced apoptosis following G2/M arrest. Western blotting showed activation of both the caspase-8 and caspase-9 pathways, which differed from previous studies conducted in other cell types. Furthermore, p53 protein and its downstream pro-apoptotic target, Bax, were induced in SAS cells after treatment with rotenone. Rotenone-induced apoptosis was inhibited by antioxidants (glutathione, N-acetylcysteine, and tiron). In conclusion, our results demonstrate significant involvement of caspases and their upstream regulators in rotenone-induced cytotoxicity
Directory of Open Access Journals (Sweden)
David Roquis
Full Text Available Chromatin structure can control gene expression and can define specific transcription states. For example, bivalent methylation of histone H3K4 and H3K27 is linked to poised transcription in vertebrate embryonic stem cells (ESC. It allows them to rapidly engage specific developmental pathways. We reasoned that non-vertebrate metazoans that encounter a similar developmental constraint (i.e. to quickly start development into a new phenotype might use a similar system. Schistosomes are parasitic platyhelminthes that are characterized by passage through two hosts: a mollusk as intermediate host and humans or rodents as definitive host. During its development, the parasite undergoes drastic changes, most notable immediately after infection of the definitive host, i.e. during the transition from the free-swimming cercariae into adult worms.We used Chromatin Immunoprecipitation followed by massive parallel sequencing (ChIP-Seq to analyze genome-wide chromatin structure of S. mansoni on the level of histone modifications (H3K4me3, H3K27me3, H3K9me3, and H3K9ac in cercariae, schistosomula and adults (available at http://genome.univ-perp.fr. We saw striking differences in chromatin structure between the developmental stages, but most importantly we found that cercariae possess a specific combination of marks at the transcription start sites (TSS that has similarities to a structure found in ESC. We demonstrate that in cercariae no transcription occurs, and we provide evidences that cercariae do not possess large numbers of canonical stem cells.We describe here a broad view on the epigenome of a metazoan parasite. Most notably, we find bivalent histone H3 methylation in cercariae. Methylation of H3K27 is removed during transformation into schistosomula (and stays absent in adults and transcription is activated. In addition, shifts of H3K9 methylation and acetylation occur towards upstream and downstream of the transcriptional start site (TSS. We conclude
Huang, Xiaosan; Li, Kongqing; Xu, Xiaoyong; Yao, Zhenghong; Jin, Cong; Zhang, Shaoling
2015-12-24
WRKY transcription factors (TFs) constitute one of the largest protein families in higher plants, and its members contain one or two conserved WRKY domains, about 60 amino acid residues with the WRKYGQK sequence followed by a C2H2 or C2HC zinc finger motif. WRKY proteins play significant roles in plant development, and in responses to biotic and abiotic stresses. Pear (Pyrus bretschneideri) is one of the most important fruit crops in the world and is frequently threatened by abiotic stress, such as drought, affecting growth, development and productivity. Although the pear genome sequence has been released, little is known about the WRKY TFs in pear, especially in respond to drought stress at the genome-wide level. We identified a total of 103 WRKY TFs in the pear genome. Based on the structural features of WRKY proteins and topology of the phylogenetic tree, the pear WRKY (PbWRKY) family was classified into seven groups (Groups 1, 2a-e, and 3). The microsyteny analysis indicated that 33 (32%) PbWRKY genes were tandemly duplicated and 57 genes (55.3%) were segmentally duplicated. RNA-seq experiment data and quantitative real-time reverse transcription PCR revealed that PbWRKY genes in different groups were induced by drought stress, and Group 2a and 3 were mainly involved in the biological pathways in response to drought stress. Furthermore, adaptive evolution analysis detected a significant positive selection for Pbr001425 in Group 3, and its expression pattern differed from that of other members in this group. The present study provides a solid foundation for further functional dissection and molecular evolution of WRKY TFs in pear, especially for improving the water-deficient resistance of pear through manipulation of the PbWRKYs.
Protein-protein interactions in the regulation of WRKY transcription factors.
Chi, Yingjun; Yang, Yan; Zhou, Yuan; Zhou, Jie; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang
2013-03-01
It has been almost 20 years since the first report of a WRKY transcription factor, SPF1, from sweet potato. Great progress has been made since then in establishing the diverse biological roles of WRKY transcription factors in plant growth, development, and responses to biotic and abiotic stress. Despite the functional diversity, almost all analyzed WRKY proteins recognize the TTGACC/T W-box sequences and, therefore, mechanisms other than mere recognition of the core W-box promoter elements are necessary to achieve the regulatory specificity of WRKY transcription factors. Research over the past several years has revealed that WRKY transcription factors physically interact with a wide range of proteins with roles in signaling, transcription, and chromatin remodeling. Studies of WRKY-interacting proteins have provided important insights into the regulation and mode of action of members of the important family of transcription factors. It has also emerged that the slightly varied WRKY domains and other protein motifs conserved within each of the seven WRKY subfamilies participate in protein-protein interactions and mediate complex functional interactions between WRKY proteins and between WRKY and other regulatory proteins in the modulation of important biological processes. In this review, we summarize studies of protein-protein interactions for WRKY transcription factors and discuss how the interacting partners contribute, at different levels, to the establishment of the complex regulatory and functional network of WRKY transcription factors.
A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response.
Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole
2009-03-01
IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP-chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response.
A ChIP–chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response
Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole
2009-01-01
IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP–chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response. PMID:19129219
Enge, Martin; Arda, H Efsun; Mignardi, Marco; Beausang, John; Bottino, Rita; Kim, Seung K; Quake, Stephen R
2017-10-05
As organisms age, cells accumulate genetic and epigenetic errors that eventually lead to impaired organ function or catastrophic transformation such as cancer. Because aging reflects a stochastic process of increasing disorder, cells in an organ will be individually affected in different ways, thus rendering bulk analyses of postmitotic adult cells difficult to interpret. Here, we directly measure the effects of aging in human tissue by performing single-cell transcriptome analysis of 2,544 human pancreas cells from eight donors spanning six decades of life. We find that islet endocrine cells from older donors display increased levels of transcriptional noise and potential fate drift. By determining the mutational history of individual cells, we uncover a novel mutational signature in healthy aging endocrine cells. Our results demonstrate the feasibility of using single-cell RNA sequencing (RNA-seq) data from primary cells to derive insights into genetic and transcriptional processes that operate on aging human tissue. Copyright © 2017 Elsevier Inc. All rights reserved.